Department Of Agriculture - Rajasthan

35136230 tender for supply of food testing laboratory hot air oven, drying oven, distilled water plant, water bath, autoclave, microbiological incbator, refrigerator, deep fridge, colony counter, micro pipette, uv lamp, muffle furnace, erlenmeyer flask, conical flask, flat bottom flask, etc....

Maharshi Dayanand Saraswati University - Rajasthan

35122270 bids are invited for scientific equipment visible spectrophotometer , ultrasonic probe sonicator , multimedia projector , vertical autoclave , centrifuge , trinocular microscope , biosafety cabinet , deep freezer , field camera for photography total quantity : 12...

Department Of Education - Rajasthan

34987937 bids are invited for science lab equipment visible spectrophotometer , vertical autoclave , ultra sonic probe sonicator , trinocular microscope , biosafety cabinet , deep freezer 30 total quantity : 6...

Department Of Technical Education - Rajasthan

34854117 tender for supply of health and sanitary trade items tds meter , sewage system and treatment plant , water purification plant , sanitary plant , waste disposal plant , autoclave , sterilizer , blood pressure monitor , stethoscope , hemoglobin meter , laboratory microscope , refrigerator 181 litre...

Directorate Of Technical Education - Rajasthan

34846737 bids are invited for boq 2 health and sanitary trade items tds meter , sewage system and treatment plant , water purification plant , sanitary plant , waste disposal plant , autoclave , sterilizer , blood pressure monitor , stethoscope , hemoglobin meter , laboratory microscope , refrigerator 181 litre total quantity : 17...

Medical Health And Family Welfare - Rajasthan

34846615 supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit ( 4th gen. ) , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit ( 4th gen. ) , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clotaing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , hb.tube , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 ?l ) , blue tips for micro pipette ( 1000 ?l ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 ?l , aerosol barrier tips 20 ?l , aerosol barrier tips 100 ?l , aerosol barrier tips 200 ?l , aerosol barrier tips 1000 ?l , water molecular grade 500 ml , self locking cable tie for bmw bags , micro pipette stand , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , cryo gloves all size , falcon tube 50 ml , falcon tube 15 ml , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) . , autoclave single channel micropipettes 100 1000ul , autoclave single channelmicropipettes 0 100ul , autoclave single channelmicropipettes 0 50ul , autoclave single channelmicropipettes 0 10ul , autoclave single channelmicropipettes 0 200ul...

Department Of Technical Education - Rajasthan

34823590 tender for supply of health and sanitary trade items tds meter , sewage system and treatment plan , water purification plant , sanitary plant , waste disposal plant , autoclave , sterilizer , blood pressure monitor , stethoscope , hemoglobin meter , laboratory microscope , refrigerator 190 litre...

Directorate Of Technical Education - Rajasthan

34821726 bids are invited for tds meter , sewage system and treatment plan , water purification plant , sanitary plant , waste disposal plant , autoclave , sterilizer , blood pressure monitor , stethoscope , hemoglobin meter , laboratory microscope , refrigerator 190 litre...

Indian Army - Rajasthan

34754576 procurement of medicines , drugs , polypropylene blue monofilament 1 / 2 circle rb 70cm, size 2 / 0 , abdominal drain kit size 20 fg , abdominal drain kit size 24 fg , abdominal drain kit size 28 fg , abdominal drain kit size 32 fg , hemostatic sponge gelatin 80 mm long, 50mm broad 10 mm thick , absorbable surgical suture violet 1 / 2 circle , rb 20mm, size 3 / 0 , adjustable arm pouch sling l / m / s , adult bain circuit , aluminium foil , ankle brace , ankle support , ansell non latex gloves s 7.5 ( brand specific ) , biological indicator for autoclave machine , bulb for laryngscope , chest drain system with trocar ( icd ) s 24 , chest drain system with trocar ( icd ) s 28 , chest drain system with trocar ( icd ) s 30 , chest drain system with trocar ( icd ) s 32 , closed wound suction system romovac 10 fg , closed wound suction system romovac 12 fg , closed wound suction system romovac 14 fg , closed wound suction system romovac 16 fg , closed wound suction system romovac 18 fg , combined spinal epidural set 18 / 27 g , cord clamp , crutches elbow adjustable , cvp manometer , disp bladeless trocar 10 mm , disp needle s 26 g , disp skin marker , duram tube , ecg electrodes ( disposable ) , endoclip lt 200 , epidural set 18g , feeding tube 10 fr , folleys catheter s 14 , g dressing s 15 , g dressing s 25 , g dressing s 5 , guedel airway size 01 , guedel airway size 02 , haemacel infusion, bott of 500ml , heel pad , hiv ppe kit for ot , keto diastix bottle of 50 strips , petri dish , erba machine printer roll , knee cap large , knee cap medium , knee cap small , knife bard parker, blade size 1 fitting ( commercial no. 11 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 12 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 15 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no.10 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no. 20 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 , lint absorbent, cotton , liquid formalin , malaria antigen test card ( mitra ) , methylene blue , microgen d 125 , microtips 1 1000 ul , microtips 1 50 ul , monocryl polyglecaprone 25 4 / 0cutting needle , monocryl polyglecaprone 70cm, 3 / 0 , ns bott of 100 ml , ot pack large gamma irradition sterlised consisting of: operating go , paedia drip , paraformaldehyde tab for sterilisation of catheters , pcm suppository , pressure monitoring line 100 cm / 200cm ( male / female ) , polyamidemonofilament size 1, 100 cm, 1 / 2 circle rb 40 mm , polyamidemonofilament size 2 / 0, 70 80 cm 3 / 8 circle reserve cutting 40 45 mm , polyamidemonofilament size 3 / 0, 70 80 cm, 3 / 8 circle reverse cutting 25 30 mm , polyamidemonofilament size 4 / 0, 40 50 cm, 3 / 8 circle cutting 15 20 mm , polyamidemonofilament size 5 / 0, 60 70 cm 3 / 8 circle cutting 15 20 mm , polydioxanone size 1, 1.5cms loop, 1 / 2 circlerb needle 50 55 mm , polyglicaprone size 3 / 0, 70 75 cm, 1 / 2 circle rb 20 25mm , polypropylene blue monofilament 70 75 cm size 3 / 0, 3 / 8 circle reverse cutting 12 mm , polypropylene mesh 15 x 15 cms, mesh prosthesis for hernia medium / polypropylene mesh, size 15cms*15 cms.composite light weight mesh of polypropylene and polygalactin910 / polygycolic acid size 15cms*15 cms , polypropylene mesh 6 cm x 11 cm ( box of 6 ) , naso gastric tube adult 100cm long 14g , naso gastric tube adult 100cm long 16g , silicon folleys catheter s 16 [ transparent ] , silicon folleys catheter s 18 [ transparent ] , silicon gel dressing , silk braided size 0 70 76 cm reverse cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 3 / 0, 70 76 cm cutting 3 / 8 circle needle 45mm , skin stapler with 35 / 55 stainless staples , suction catheter s 08 , suction catheter s 10 , surgicel , suspensory scrotal , swab stick , synthetic absorabable polygalactin rapid absorption 2 / 0, 80 90 cms, 1 / 2 circle cutting , 30 40 mm double arm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 2 / 0, 70 90 cms, 1 / 2 circle rb 30 40 mm , spinal needle s 25 g , steristrip , tegaderm s 10 cm , thumb spica splint , tracheostomy tube 6.5 mm , tracheostomy tube 7 mm , transparent anaesthesia face mask set of size 0, 1, 2, 3, 4, 5 , tube endo tracheal reinforced pvc size 2.5 with out cuff , tube endo tracheal reinforced pvc size 3.0 with out cuff , tube endo tracheal reinforced pvc size 3.5 with out cuff , tube endo tracheal reinforced pvc size 4.0 with out cuff , tube endo tracheal reinforced pvc size 4.5 withcuff , tube endo tracheal reinforced pvc size 7.5 withcuff , u drain size l & m , under water sealed drainage bag , vicryl 3 / 0, 20mm , vicryl 4 / 0, 20mm , vicryl no 1 ( rb ) 90 cm , silk no 1 cutting body , monocryl polyglecaprone 70cm, 3 / 0 cutting body , vicryl rapid no 1 round body , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 1 / 0, 70 90 cms, 1 / 2 circle rb 20 25 mm , polypropylene blue monofilament 70 75 cm size 1 3 / 8 circle cutting body 12 mm , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle , round body12 mm , glutaraldeyde 2% aqueous soln with activator , propofol 1% or 10mg / ml, 10 ml inj ( neon ) , tube plastic mount connection. , endotracheal tube cuffed 4.0 mm , apparatus anaesthitic face maskwith air cushion transparent size 0 infant , apparatus anaesthetic facemask with air cushiontransparent size 1paediatric , apparatus anaesthetic face mask ( anitistatic ) with aircushion ( transparent ) size 2 medium , apparatus anaesthetic face mask ( antistatic ) with, air cushion ( transparent ) size 3 adult with valve , apparatusanaesthetic face mask ( antistatic ) withair cushion ( transparent ) size 4 , multi coloured surgical skin marker, scrub resistant fd&c dyes colour: red, blue, green, black, gentian violet , sofratule / soframycin paraffin gauze ( box of 10 ) , linear stapler , linear cutter , dressing collagen wound management, size 8 x 14 , bacillocid , laryngoscope cells for battery aa , laryngoscope cell 1.5 vdia13 mm and length 51 mm for torch , disp bladeless trocar 7 mm , endo loop , gelofusion plasma substitute soln , inj etomidate 2 mg / ml , polypropylene blue monofilament 70 75 cm, size 2 / 0, 3 / 8 circle reverse cutting, 12 mm , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , endo bag , ipratropium bromide respirator soln 250 mcg / ml vial of 15ml , mesh prosthesis for hernia small polypropylene mesh size 6*11 cms. composite light wtmesh of polypropylene and polygalactin 910 / polygycolic acid, size 6 *11 cms , polypropylene blue monofilament 70 75 cm size 4 / 0, 1 / 2 circle rb25 mm double needle , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle reverse cutting, 12 mm , sofratulle , dressing, shell, compressed , hydrocolloid dressing , collagen dressing , lot iorep , polypropylene blue monofilament 70 75 cm, size 4 / 0, 3 / 8 circle reverse cutting, 12 mm , uro bag , urometer , usg printer paper roll , ventilator circuit for anaesthesia machine , i gel size 3 , i gel size 4 , jackson rees paediatric circuit , anaesthesia face mask inflatable size 0, 1, 2, 3 , colostomy set of bag / skin adhesive , inj tenectaplase 40 mg , inj alteplase 50 mg , kit albumin ( erba ) , kit alkaline phosphate ( erba ) , kit calcium ( erba ) , kit prothrombin time ( siemens ) , kit creatinine ( ( erba ) , kit for estimation of amylase ( 12 x 5 ml ) ( erba ) , kit for estimation of bilirubin ( erba ) , kit total protein ( erba ) , kits for estimation of cholesterol ( erba ) , kits for estimation of glucose ( erba ) , kits for estimation of sgot ( erba ) , kits for estimation of urea ( erba ) , kits for estimation of uric acid ( erba ) , pttk reagent ( siemens ) , urine container , urine strips ( protein + glucose ) , kit ckmb ( erba ) , kit for triglyceride estimation ( 100 ml ) ( erba ) , kit fsh detection elisa kit 96 tests ( calbiotech ) , kit lh detection elisa kit 96 tests ( calbiotech ) , kit lipase ( erba ) , kit prolactin detection elisa kit 96 tests ( calbiotech ) , kit sgpt ( erba ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , kit testosterone detection elisa kit 96 tests ( calbiotech ) , kit tsh detection elisa kit 96 tests ( calbiotech ) , slide microscope , soda lime , erba h lyse 360 ( erba ) , hcv rapid ( tridot ) , test hiv rapid ( tridot ) , sperm wash media , solution pack ( na, k & cl ) ( medica ) , erba diluent h 360 , erba h clean , kit hdl cholesterol ( erba ) , kit ldh ( erba ) , kit ggt ( erba ) , kit hbsag tridot , kit hcv tridot , kit vdrl , kit crp ( qualitative ) , kit ra factor , kit aso , kit widal , typhi dot igg igm , esr western green tube , kit microprotein , erba control h 360 , kit vit d , stool for ocult blood rapid card , antisera ab & d ( 3 x 10 ml ) meril , microscopic slide pkt of 50 ( blue star ) , distilled water , kit erba wash 5 x 20 ml , cover slip 22 x 50 ( blue star ) , ependorf tube , ethanol , methyl alcohol , acetone , macconkey broath double strength high media ( pack og 500 gm ) , cled agar pack of 500 gm ( hi media ) , mha agar pack of 500 gm ( hi media ) , blood agar base pack of 500 gm ( hi media ) , macconkey agar ( pack og 500 gm ) , antibiotics disc ampicillin pack of 250 disc ( hi media ) , antibiotics disc gentamycin pack of 500 disc ( hi media ) , antibiotics disc ciprofloxacin pack of 500 disc ( hi media ) , antibiotics disc norfloxacin pack of 500 disc ( hi media ) , antibiotics disc nitrofurantoin pack of 500 disc ( hi media ) , antibiotics disc imipenam pack of 500 disc ( hi media ) , antibiotics disc vancomycin pack of 500 disc ( hi media ) , antibiotics disc co trimazole pack of 500 disc ( hi media ) , antibiotics disc cefixime pack of 500 disc ( hi media ) , antibiotics disc ceftazidime pack of 500 disc ( hi media ) , antibiotics disc clindamycin pack of 500 disc ( hi media ) , antibiotics disc polymixin b pack of 500 disc ( hi media ) , blood culture bott ready to use , east lyte plus wash soln bott of 50 ml ( medica ) , east lyte plusclaening soln bott of 50 ml ( medica ) , watman filter paper size 1500 mm , sulphuric acid ( specific gravity 1.828 1.825 ) , acid amyl alcohol , glucosamine 250mg+ chondroitin sulphate 200 mg cap , mdi formoterol 6 mcg + budesonide 400mcg , r / c levosalbutamol + ipratropium bromide ( duolin ) , r / c salbutamol , respulesenterogermina , rifampicin 150mg cap , rotacap salmeterol 50mcg +fluticasone 250mcg , salbutamol 100 mcg + ipratropium 20 mcg inhaler , salbutamol sulphate respirator solution 5mg / ml, vial of 15 ml , serratiopeptidase 10 mg tab , streptokinase 15 lacs iu inj , syp ambroxol bott of 100 ml , syp b complex , syp disodium hydrogen ( alkasol ) , syp ofloxacin + ornidazole , syrup calcium phosphate , tab alpha keto analouge , tab bilastine 20mg , tab biotin , tab cabergoline 0.25mg , tab clinidipine 10mg , tab dapagliflozin 10 mg , tab dynapar , tab estradiol 2mg ( progynova ) , tab flunarazin 10mg , tab isosorbide dinitrate 10mg , mdi salmeterol 50mcg + fluticasone 250mcg , syp levosalbutamol 1mg / 5 ml , bottleof 100 ml , adenosine 3 mg / ml, 2 ml inj , ascorbic acid 500 mg tab , cap primosa evening oil , cap probiotic ( multibacillary 4 or more organisms ) , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , kit mifepristone 200 mg + misoprostol 800 mg , cream clobetasole + gentamycin , deflazacort 6mg tab , dextrose monohydrate for oral use , donepezil 5 mg tab , escitalopran 10 mg tab , formoterol 12 mcg & fluticasone 250 mcg dry powder , fusidic acid cream 2% w / w 10 g tube , l arginine sachet , lactic acid bacillus sachet , levosalbutamol + ipratropium bromide ( duolin ) respules , lidocaine spray , nifedipine retard 20 mg cap / tab , metoprolol 1 mg / ml, 5 ml inj , oint heparin , oint luliconazole , oxytocin 5 oxytocic units per 0.5ml, 0.5ml inj , tab levocarnitine 500mg , tab lithium carbonate 300 mg , tab micronised purified flavonoid fraction 500mg ( daflon ) , tab n acetyl cystene 600mg , tab nebivilol 5mg , tab pantaprazole 40 mg + domperidone 10 mg , tab paracetamol 650 mg , tab rifaximin 440 mg , tab sertaline 50 mg , tab sodium valporate 500 mg cr , tab teneligliptin 20mg , tab terbinafine 250 mg , tab thyroxin sodium 75 mcg , tab topiramate 50mg , tab torsemide 10mg , tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap , r / c tiotropium bromide 18 mcg dry powder , vitamin e 200 mg cap , diclofenac spray bott of 100 gm , walker tripod , warfarin 5 mg tab , wrist guard with thumb support , zolpidem 10 mg tab , cotton wool, absorbent pkt of 500 gm , syp grilintus , tramadol hcl 50 mg / ml inj , diethylcarbamazine 50mg tab , salbutamol 2.5mg + ipratropium 40mcg solution , tmppd , cotton wool, non absorbent pkt of 500g , magnesium sulphate 50% w / v inj , tab levodopa + carbidopa110 mg cr , endotracheal tube cuffed 7.5 mm , inj methotrexate 15 mg , 1 ml , inj rabies immunoglobilin 100iu / ml , pcm suppositories , resp asthalin ( cipla ) , dextrose 50%, 25 ml inj , dextrose inj 25%, 25 ml inj , povidone iodine gargle 2% , tab mesalamine 1.2gm , ethambutol 200mg tab , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses ) , human diploid cell rabies vaccine , calcium carbonate 500 gm tab , gauze surgical open wove 60 cm wide, pkt of 18 mtr , gauze surgical, open wove, unmedicated : 60 cm x 3 metres packet , heamatinic tab / cap containing ferrous fumarate vit b 12 folic acid and vit c, strength: 300mg, 1.5mg, 75mg min , human chorionic gonadotrophin 2000 iu inj ( hcg 2000iu ) , hydroxyprogesterone caproate 500 mg / 2 ml ( amp of 2 ml ) inj , infusion paracetamol 10mg / ml , bott of 100ml , inhaler salmetrol 50mcg + fluticasone 250mcg , human chorionic gonadotrophin 10000 iu inj ( hcg 1000iu ) , inj hmg 75iu , mdi budesunide 200mcg , mdi salbutamol , pregnancy card , rifampicin 450mg + isonex 300mg combination cap , sodium hypochlorite 5% , tab chlorzoxazone 500mg + diclofenac 50mg+ pcm 500mg ( cipzox ) , tab efavirenz 600mg , tab etoricoxib 90 mg , tab levetiracetam 500mg , tab neurobion forte , tab nitrofurontoin 100mg , tab trypsin+ chemotrypsin , vildagliptin 50 mg tab , cap multivitamin , tab ticagrelor 90 mg , glucostrip morepen , clotrimazole 1% w / v ip+ lignocaine 2% w / v ip ear drop bott of 10ml , nicorandil 10 mg tab , formoterol 6 mcg and budesonide 200 mcg cfc free mdi , oint hydroquinine + tretrition + mometasone , iron succinate / fractionate dextran 100 mg inj ( epo ) , arm sling pouch s large , corn cap , tab acelofenac 100 mg + paracetamol 325 mg , syp mifenamic acid + paracetamol , tab sodium bicarbonate 500 mg , tab ranalozine 500 mg , tab febuxostat 40mg , pioglitazone hydrochloride 15 mg tab , tab gliclazide 60mg xr , tab letrozole 5 mg , tab itopride 50mg , inh budesonide 400 mcg , tab rosuvastatin 10 mg , e / d moxifloxacin + dexamethasone , r / c duolin , tab azithromycin 500mg , tab pirfenidone 200 mg , tab racecodotril 100 mg , tab bisoprolol 5 mg , kitmifepristone + misoprostol , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape, 30 cm , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , adhesive plaster microfoam tape 3 inches box of 4 , adhesive plaster microfoam tape 4 inches box of 3 , bandage crepe: 10 cm , bandage, open woven compressed 2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , antacid gel each 5ml containing dried aluminium hyroxide gel ip 250mg, magn esium hydroxide nf 250mg and methyl polysiloxane 50mg ( as per nfi bott of 400 ml ) , bandage open woven for plaster of paris 10cmx5m , syp paracetamol 162.5 mg+ ibuprofen 100 mgbott of 60 ml , disposable gown , phytomenadione ( vit k ) 1 mg / 0.5ml inj , tramadol hc 50 mg / ml inj , mdi beclomethasone + salbutamol , mdi budecort 200mcg , mdi budecort 400mcg , r / c salbutamol , r / c tiotoproium bromide , r / c formeterol + budesonide 200 mcg , r / c formeterol + budesonide 400 mcg , r / c ipratorium bromide , tab acamprostate 333 mg , cough sedative syp each 5 ml containing chlorpheniramine maleate 2.5mg guiaphenesin 100mg noscapine 15mg sodium citrate 60mg in flavoured base bott of 100 ml , cremaffin white each 15 ml containing milk of magnesia 11.25 ml, liq paraffin 3.75ml bottle of 170 ml , alprazolam0.25 mg tab , tab zolpidem 10 mg , tab nimesulide 100 mg , inj thiamine 100mg / ml, 2ml amp , antispasmodic cap containing dicyclomine hcl 10mg, dextroprop oxyphen hcl 65mg acetaminophen ip 400mg , thiopentone inj of 0.5 g without water for injection , tab rabeprazole 20mg , oint miconazole , tab strepsils , band aid , tab thyroxin 25mcg , tab thyroxin 125mcg , tab rabeprazole 20 mg+ domperidone 10 mg , syptixylix , syp montelukast + levocetrizine , syp n cold , syp spasmonil , syp chorpheniramine maleate and phenylephrine , syp paracetamol + mefanemic acid , pencil cell aa , pencil cell aaa , ecg paper roll a4 size , bain circuit paed , bain circuit adult , syp megnakof ls , drop vit d3 60k nanoshot ( dee 3 ) , pkt of 4 bottle , calamine lotion , u drain male incontinence device made of soft, light weight latex sheath size large35 mm. , u drain male incontinence device made of soft, right weight latex sheath size medium 30 mm. , ketoconazole shampoo , syp neeri , tab dasatinib 50 mg , tab bosenten 62.5 mg , metronidazole inj for iv use. each ml containing metronidazole ip 500mg per bott of 100 ml , ranitidine hcl50 mg, 2 ml inj , ondansetron 8 mg tab , hydrogen peroxide solution , foleys balloon catheter 2 way, silicon16 g , foleys ballon catheter 2 way 14g , foleys ballon catheter 2 way 12g , prednisolone 5 mg tab , oint povidone iodine , tab pregablin 75mg + methylcobalamine 1500mcg , bandage triangular , inj n acetyl cystene , deriva bpo gel , syp power gel , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 120ml , pancreatin microspheres 150mg cap , isoxsuprine 10mg tab , mirtazapine 15 mg tab , venlafaxine 37.5mg tab , benzathine penicillin 6, 00, 00 unit inj , ls belt s medium , ls belt s large , ls belt s xl , dengue test , tab dihydrogesterone 10 mg , lot sun screen , lot liquid paraffin , protein powder , inj denosumab 120 mg , tab vildagliptin 50 mg + metformin 1 gm , tab vildagliptin 50 mg + metformin 500 mg , tab tadalafil 10 mg , tab duloxetine20 mg , tab fluoxetine 50 mg , tab sitagliptin 50 mg + metformin1 gm , tab eplerenome 25 mg , tab levosulpride 25 mg , knee brace s large , knee cap s medium , knee cap s large , tab baclofen 10 mg , hydroquinone 2% tube of 50 gm , inj depomedrol 80 mg / 2ml , inj neostigmine 5ml , inj triamcinalone ( kenacort ) 10mg , insulin disposable syringe 1ml , insulin highly purified human neutral40iu / ml, 10 ml inj , iron syp with vitamins each 5 ml containing ferrous fumarate 100mg folic acid ip 3mg & vit b12 10mcg , isapgol / ispaghula husk 3.5 gm , ketorolac 10 mg tab...

Medical Health And Family Welfare - Rajasthan

34711615 drugs and medicines procure for mg hospital sagwara , medicine and surgical equipment : , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , acetylcystine solution usp ( injection ) 200 mg / ml , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir cream 5% , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , alendronate sodium tablets usp / bp 35 mg , allopurinol tablets ip 100 mg , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , amiodarone hydrochloride inj 50 mg / ml , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amitriptyline tab ip 25mg film coated , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amphotericin b inj ip 50 mg , ampicillin cap ip 500mg , ampicillin injection ip 500 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , ascorbic acid tab ip 500 mg , aspirin delayed release tablet / aspirin gastroresistant tab ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , atorvastatin tablets ip 40 mg , atracurium inj 10 mg / ml , atropine eye ointment ip 1% , atropine sulphate injection 0.6mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tab ip 50 mg , azithromycin tab 100 mg dispersible tabs , azithromycin tab ip 500 mg , azithromycin tablets ip 250mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , beclomethasone inhalation ip 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone sod phos inj ip 4mg / ml , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromocriptine tablets ip 2.5 mg , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , calamine lotion ip 100ml , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium gluconate inj ip 10% ( iv use ) , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , carbamazepine oral suspension usp 100 mg / 5ml , carbamazepine tab ip 100 mg ( film coated ) , carbamazepine tab ip 200 mg ( film coated ) , carbimazole tabs ip 5 mg ( film coated ) , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carboxymethylcellulose eye drops 0.5% , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection 1 g , cefpodoxime dispersible tab 50 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cefuroxime axetil tab ip 250 mg , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetrimide cream ip 15 gm , chlorambucil tab ip 5 mg , chloramphenicol eye drops ip 0.5 0 / 0 , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% 250 ml , chlorhexidine mouthwash ip / bp 0.2 o / o , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , chlorpromazine inj. ip 25mg / ml , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops 0.3 o / o w / v , ciprofloxacin injection ip 200mg / 100ml f f s bottle , ciprofloxacin ophthalmic ointment usp 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol propionate cream 0.05 o / o , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clonazepam tablet 0.5 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , clotrimazole vaginal tab ip 500mg , cloxacillin sodium inj ip 500mg , coal tar 6% & salicylic acid 3% ointment , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , compound benzoin tincture ip , compound sodium lactate inj. ip f f s bottle , conc haemodialysis fluid b.p acetate concentrate 10 litre can , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , conjugated estrogen tabs usp 0.625 mg. , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablet ( trimethoprim 160mg+sulphamethoxazole 800mg ) , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , syp.ambroxal15 mg+terbufaline 1.5 mg+menthol 1.25mg+glucogon 50 mg , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cyclosporin capsule usp / ip 50 mg , cytarabine injection bp 500mg , dacarbazine injection 500 mg usp / bp , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dextromethorphan hbr syrup ip 13.5mg / 5ml , dextrose inj ip 10% f f s bottle 500 ml , dextrose inj ip 25% w / v f f s bottle 100 ml , dextrose inj ip 5% f f s bottle 500ml , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofence prolonged release tablet ip 100 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine hydrochloride oral solution ip 10mg / 5ml , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , diethylcarbamazine tab ip 100 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , diphtheria antitoxin 10000 iu , dobutamine inj ip / bp 50mg / ml / 250mg ( vial / ) dobutamine inj usp250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension ip 5mg / 5ml 30 ml , domperidone tab ip 10 mg , dopamine hydrochloride inj 40 mg / ml , doxorubicin inj ip 50 mg / 25 ml , doxycycline cap ip 100 mg , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , enalapril maleate tablets ip 10 mg , enoxaparin sodium inj ip 60 mg , escitalopram tab ip 10 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethinyloestradiol tabs ip 50 mcg , etoposide inj ip 100 mg , etoricoxib tab ip 120mg , etoricoxib tablet 90 mg , factor ix concentrate ( purified ) 600 i.u. ( human coagulation factor ix ) , fenofibrate capsules / tab ip 200 mg , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , filgrastim injection ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , finasteride tablets ip 5 mg , flavoxate tablets ip / bp 200 mg ( coated tablet ) , fluconazole eye drops 0.3% , fluconazole tablets ip 150mg , flunarizine tab 5 mg , fluorouracil inj ip 250 mg / 5ml , fluoxetine cap ip 20 mg , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , folic acid tab ip 5 mg , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack , framycetin sulphate cream 1 o / o 30gm pack , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , gadodiamide inj. 0.5mml / ml vial , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , gemcitabine for injection 1gm , gemcitabine for injection 200 mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , gentian violet topical solution usp 1o / o , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glipizide tab ip 5mg , glucagon for injection usp 1 mg / ml , gluteraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablets 2.6 mg controlled release tablets , glycopyrrolate inj usp 0.2 mg / ml , griseofulvin tab ip 125 mg , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , halothane bp , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , homatropine eye drops ip 2% , human albumin solution ip 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection 300mcg ( im use ) , human rabies immunoglobulin inj 150 iu / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrochlorthiazide tab ip 12.5 mg , hydrochlorthiazide tab ip 25mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , hydroxychloroquine sulphate tablets 200mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hydroxypropylmethyl cellulose solution 20 mg / ml , hydroxyzine tab ip 25 mg , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen and paracetamol tablets ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , ifosfamide injection usp / bp 1gm , imatinib tab 400mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , indomethacin cap ip 25 mg , insulin glargine 100iu / ml 3 ml vial , insulin glargine 100iu / ml 5ml vial , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium powder for inhalation ip 40 mcg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , ketamine inj ip 50 mg / ml , ketoconazole cream 2% , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , l asparaginase inj 10000 iu , leflunomide tablets ip / usp 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , levetiracetam injection 500mg / 5ml , levetiracetam oral suspension 100mg / ml , levetiracetam tablet 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tab 250 mg+ 25 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levofloxacin tablets ip 250 mg , lidocaine hcl topical solution usp 4% , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2% , lignocaine ointment 5 o / o , linezolid inj 200mg / 100ml , linezolid tablets ip 600 mg , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , lisinopril tab ip 2.5 mg , lisinopril tab ip 5 mg , lisinopril tablets ip 10 mg , lithium carbonate tab ip 300 mg , loperamide tab ip 2 mg , lorazepam inj 2 mg / ml , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. 50mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mecobalamin inj 500 mcg / ml , medroxyprogesterone acetate tablets ip 10 mg , mefenamic acid tablets bp 500 mg , mefloquine tablets ip 250 mg , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , metoclopramide hydrochloride syrup ip 5 mg / 5ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets ip / usp 50 mg , metoprolol tablets ip 25 mg , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole and norfloxacin suspension 100 mg + 100 mg per 5ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole inj ip 500 mg / f f s bottle 100 ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , miconazole nitrate cream ip 2% , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , misoprostol tab ip 200 mcg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , morphine sulphate inj ip 10mg / ml , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) f f s bottle 500 ml , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) f f s bottle 500 ml , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , naloxone inj ip 0.4mg / ml , naproxen tablet ip 250mg , naproxen tablet ip 500mg , neomycin bacitracin and sulphacetamide power ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , neostigmine tab ip 15 mg , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml f f s bottle , ofloxacin oral suspension ip 50mg / 5ml , ofloxacin tab ip 200 mg , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , olanzapine tab ip 5 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip 21.8 gram , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection usp 50 mg , oxytocin inj ip 5 iu / ml , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , pantoprazole 40mg and domperidone 30mg sr cap pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol inj. 150 mg / ml , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , peritonial dialysis solution ip , permethrin cream 5% , permethrin lotion 5% , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenobarbitone tab ip 30 mg , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , pilocarpine eye drops ip 2 o / o , pioglitazone tab ip 15 mg , piperacillin + tazobactum for injection usp 4gm+500mg , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml , povidone iodine solution ip 10 % 500 ml , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle , pralidoxime chloride injection ip 25 mg / ml / 500 mg , prazosin tablets ( extended release ) 2.5 mg , prednisolone tab 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , promethazine syrup ip 5 mg / 5ml 30 ml , promethazine tab ip 25 mg , propofol inj ip / bp / usp 10 mg / ml , propranolol tab ip 40 mg , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , ramipril tablets ip 2.5 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , rh erythropoetin inj 10000 iu , rh erythropoetin inj 2000iu , rh erythropoetin inj 4000 iu , risperidone tab 1 mg , risperidone tab 2mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup ip 2mg / 5ml 30ml , salbutamol tab ip 2 mg , salbutamol tablet ip 4 mg , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sertraline tab 50 mg , sevoflurane , silver sulphadiazine cream ip 1% 500 gm jar , silver sulphadiazine cream ip 1% 50gm tube , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o f f s bottle , sodium chloride inj ip 500 ml f f s bottle , sodium chloride injection ip 100 ml f f s bottle , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valproate gastro resistant tablets ip 200 mg , sodium valproate inj 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , streptokinase injection 15 lac units , succinylcholine inj. ip 50 mg / ml ( iv use ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical spirit ip / bp ( 100 ml ) , surgical spirit ip / bp ( 500 ml ) , tamoxifen tab ip 10 mg , tamsulosin hcl tablets / capsule 0.4 mg , telmisartan tablets ip 40 mg , tenaligliptin tablet 20mg , terazosin tab usp 1 mg , terazosin tablets usp 2 mg , terbutaline tablets ip 2.5 mg , tetanus immunoglobulin 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline ip 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , thiamine tablets ip 100 mg , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drops ip 0.5 o / o w / v , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , torsemide inj 10 mg / ml , torsemide tab 10 mg , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , tranexamic acid tablets ip / bp 500 mg , travoprost eye drops ip 0.004 o / o , tretenoin cream usp 0.025% , trifluperazine tab ip 5 mg coated , trihexyphenidyl hcl tab ip 2 mg , tropicamide eye drop ip 1o / o , urokinase injection 5 lac unit ( lyophilized ) , ursodeoxycholic acid tablets 300 mg , valethamate bromide inj 8mg / ml , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil tab ip 40 mg film coated , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin d3 oral solution 60000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , warfarin sodium. tab ip 5mg , water for inj ip , xylometazoline nasal drops ip 0.1% , zinc sulphate dispersible tablets ip elemental zinc 10 mg , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set blood transfusion set ( details in rc ) , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , mucus extractor sterile ( details in rc ) , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , corrugated drainage sheet all sizes ( details in rc ) , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , bone wax sterilised , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , skin graft knife blade ( sterile ) & handle ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , standard pama intra ocular lenses ( details in rc ) 11 to 17.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 , disposable sterile surgical rubber gloves size 8 inches, powdered , disposable sterile surgical rubber gloves size 8 inches, powder free , rubber examination gloves, non sterile, extra small ( details in rc ) , rubber examination gloves, size small ( details in rc ) , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , pressure monitoring line / high pressure extension line ( details in rc ) , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , absorbable oxidized regenerated cellulose 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , bone cement , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitary napkin beltless with wings ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 , k 90 catheter , vein o line 3 way with stock cork ( for infusion pump ) , cpap kit , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8cir rb taper point double needle 9.3mmlength 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , oxygen regulator with humidifier , surgical blade no 23 , vtm , ppe kit , liquid ecoshield , utility rubber gloves , liquid hand wash 500 ml , bleeching powder 25 kg , liquid hypocloride , formaldehyde tablets , makentosh rubber sheet 20 mtr , artery forcep criles 6 , artery forcep criles 8 , mosquito forcep 6 , scissor 6 , scissor 8 , mayo scissor 6 , mayo scissor 8 , tooth forcep criles 6 , tooth forcep criles 8 , needle holder 6 , needle holder 8 , s.s drum 12x15 , s.s drum 10x12 , electric sterilizer , s.s tray 12x15 , pluse oxymter & monitor , bp instrument desk model , bp instrument stand model , fumigation machine , kangaroo gown , labour room apron , handwash soap bar , safty dilivary kit , new born baby kit , rubber silar all size , n95 mask , sigma lock , mop with handle , portable pulse oxymeter , bp instrument mercury , bp instrument with stand , bp instrument bulb , bp instrument cuff , bp instrument cloth , hand scrub 500ml , lead aprom , hand sanitizer 500ml , electric element for sterlizer 100w / 200w , autoclave elemant 600 kw , digital thermometer , stethoscope , glass bottal 30 ml with aluminiumcap , plastic bottal 150 ml , brest pump set , deep freezer graph , record pen for graph , plastic box ( with lid ) , glass beker 2000ml above , glass beker 500ml , vim liquid ( dishwash ) , colin 500ml , harpic 500ml , savalon 500ml , soap ( cloth wash ) 125g , scrubber , manual breast pump , steel contaner , bottle brush , air router , air router burs set , dental reamer 8k file , b p handle , zink oxide ugienal cement , dental probe , mouth mirror with probe , dental explorer , tweezer , gic cement , crown remover , apec alocator , gutta purcha point , arch bar wire , calcium hydroxide paste , carbolic acid , zinc phosphate paste , eugenal oil , glass bead sterlizer , u v chmber , patient apron , air roater oil , rout crayers both side , dental suture material 3 0 , needle holder , aretery forcep , chetal forcep , kidney tray small , cotton 200 gm [ lp.13 ] [ u ] , cotton 400 gm [ lp.12 ] [ u ] , cotton roll ( 500 gm ) [ lp.39 ] [ m ] , cotton roll 300 gm lp21 [ lp.0 ] [ u ] , inj. gemcitabin 200 mg , inj.5 flurouracil 250 mg , inj. filgrastim 300 mg , inj. carboplatin 450 mg , inj. cyclophosphamide 200 mg , inj. pacilitaxel 260 mg , inj. cisplatin 50 mg , inj. oxaliplatin 50 mg , inj. gemcitabin 1 gm , inj. carboplatin 150 mg , inj. leucovorin 10 mg , inj. cisplatin 10 mg , inj. cyclophosphamide 500 mg , inj. ifosfamide 1 gm with mesna , inj. pacilitaxel 100 mg , inj. doxombicin 50 mg , inj. trastaumab 440 mg , inj. irinotecan 100 mg , inj. pemetrexed 500 mg , inj. pemetrexed 100 mg , inj. decetaxel 120 mg , tab. tamoxifen 10 mg , tab. methotrexate 2.5 mg , tab. methotrexate 10 mg , tab. capecitabin 500 mg , tab. clophosphamide 50 mg , cap. hysroxyurea 500 mg , inj. mephentermin 10 ml , inj. hepatities b imunoglobin , butorphanol tartrate injection usp 1mg / ml 1ml size , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tablet 10 mg , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , cefadroxil tablet 250 mg , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , clindamycin phosphate injection ip 300 mg , terbinafine hydrochloride tablet 250 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet usp 2.5 mg ( each film coated tablet contains letrozole usp 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bicalutamide tablet usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg / 100ml 100ml size , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , ethamsylate tablet bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , feracrylum 1% w / w sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , carvedilol tablet 3.125 mg , powder clotrimazole 1% w / w 30 gm , terbinafine ointment 1%w / w ( 10 gm tube ) , mupirocin cream usp 2% ( each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base ) 15 gm size , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , hepatitis b immunologlobin injection ip 100 i. , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg , human chorionic gonadotropin injection ip 5000 i.u. , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , acebrophylline tablet 100 mg , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , pyridostigmine tablet usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , vitamin e capsule 400 mg , inj. mephentermin 10 ml , alpha beta arteether injection [ lp.26 ] [ m ] , swine flu vaccine , triple layer mask for swine flu, covid 19 , inj hepatitis b imunoglobin...

Department Of Agriculture - Rajasthan

34648806 bids are invited for lab equipment digital egg hatcher machine, bottle top dispensers 60 ml capacity, bottle top dispensers 30 ml capacity, single beam atomic, microprocessor based manual ph meter, microcontroller based, automatic 0.01 digital, dot matrix printers, pa system, professional multifunction machine, dslr camera, electric hedge trimmer, laptop i7 8th generation, newspaper reading statnd 900 mm x 600 mm, 12 seater u0 shape meeting table, floor mounted hot and normal water dispenser, air conditioners 2.5 ton, air conditioners 1.5 ton, color ink tank multifunction printer, seed moisture meter, spring balance scale, sprayer knapsack motor operated, compound microscope with photo display arrangement, wet preservation jars autoclave, hot air oven, deep freeze, centrifuge machine ( 3000rpm ) , water bath, bod incubator, automatic macro block digestion system, scrubber system, automatic distillation system, fully automatic titration system, automatic pc compatible solvent / fat extraction, automatic pc compatible fiber estimation system, milk analyser , single cylinder engine actual cut section working models ( agricultural engineering ) , steering system actual working models ( agricultural engineering ) , gear box working models ( agricultural engineering ) , fuel supply system of automoile ( tractor ) ( agricultural engineering ) , different type brakes working model ( agricultural engineering ) , automobile parts actual cut section ( agricultural engineering ) , horizontal laminar air flow, microwave cum convection , lcm 120 lph plant...

University of Rajasthan - Rajasthan

34398437 supply of equipment at department of zoology, uor, jaipur supply of equipment at department of zoology, uor, jaipur , equipments description : , computerassisted semen analyzer ( casa ) , workstation server , stereozoom binocular with camera , spectrofluoremeter , rota evaporator , western blotting unit , uv chamber with 10 15 trays, capacity 5 10 l , potter tower , insect growth chamber , microplatespectrophotometer with plate / cuvette and other accessories wavelength range 200 1000 nm , incinerator , cooling orbital shaker incubator , microprocessor based autoclave , gradient thermal cycler with accessories...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

University of Rajasthan - Rajasthan

34378531 supply of scientific and laboratory equipment at department of zoology, uor, jaipur 1. computerassisted semen analyzer ( casa ) 2. workstation server 3. stereozoom binocular with camera 4. spectrofluoremeter 5. rota evaporator 6. westernibloti1ng unit 7. uv chamber with 10 15 frays, capacity 5 10 l 8. potter tower 9. insect growth chamber 10. microplatespectrophotometer with plate / cu vetfe and other accessories wavelength range 200 1000 nm 11. incinerator 12. cooling orbital shaker incubator 13. microprocessor based autoclave 14. gradient thermal cycler with accessories...

Dr. S.N.Medical College - Rajasthan

34336963 supply of autoclave(larger and medium) autoclave(larger and medium) , equipment and instrument , autoclave large horizontal , autoclave medium horizontal , ml6 contractor 230v ac (2no+2nc) or equilant...

Medical Education Department - Rajasthan

34145057 bids are invited for micropipettes single channel of variable volume , adjustable volume digital multiple channel nvhsp for microbiology micropipettes , hot air oven , water bath , bodincubator , vortex mixer , vertical autoclave , water purification system total quantity : 11...

Government University - Rajasthan

34110349 tender for purchase of equipments & instruments x ray machine 300 ma, portable x day machine, cr system emergency trolley, defibrillators, plaster cutter, iv stands, crush carts, dressing trolleys, of tables for ortho, gynet & obst., o1 lights, coutry, labour table, infusion pump, crush cort, bp instruments. fetal dopplers, incubator for baby, minor ot table & portable lights. ortho electrocomd pneumatic drilling machine. all instruments set for general surgery, gynec & obst & orthopedic surgery icu beds 10, anesthesia machine 2 & icu ventilators 1, cardiac monitors central station 108 10 for ot, emergency etc) defibrillator. cssd dressing drums 50, autoclaves 2, trays 10 ward jopd patient stretchers, wheel chairs, bedside lockers, examination couches xray view boxes, round steel stool etc▸ modular ot, icu & emergency curtain etc....

University Of Agriculture - Rajasthan

34007835 supply of field article for ars mandore 1. kraft seed container ( star paper ) 2. kraft seed container ( star paper ) 3. kraft seed container ( star paper ) 4. kraft seed container ( star paper ) 5. kraft seed container ( star paper ) 6. kraft seed container ( star paper ) 7. butter paper bag ( for test weight ) 8. crossing bag ( butter paper ) 9. crossing bag ( butter paper ) 10. luggage label no.4 ( one metal eyeleted ) 11. luggage label. no.4 ( one metal eyeleted ) 12. luggage label no.3 ( one metal eyeleted ) 13. plant tag with thread price label oval shaped 14. field note book 15. data sheet 16. markin cloth bag 17. markin cloth bag 18. markin cloth bag 19. markin cloth bag 20. markin cloth bag 21. markin cloth bag 22. printed markin cloth bag 23. printed markin cloth bag 24. printed markin cloth bag 25. printed markin cloth bag 26. printed jute canvass bag 27. plastic katta 28. polythene bag 29. .., polythene bag 30. polythene bag 31. polythene bag 32. polythene bag 33. polythene bag 34. polythene bag 35. polythene bag ( with zip lock ) 36. polythene bag ( with zip lock ) 37. plastic peg for plot identification 38. plastic peg for plot identification 39. luggage label no.4 with plastic cover 40. plastic water proof label with thread 41. plastic pots 42. laboratory apron terricoat 43. breeding clip ( 1000 / packet ) 44. crossing ! hag machine made ( butter paper ) 45. selfing bag machine made ( butter paper ) 46. selfing bag machine made ( butter paper ) 47. selfing bag ( butter paper ) 48. plastic container with lids 49. plastic crates 50. nylon net plastic bag 51. single side printed markin cloth bag 52. single side printed markin cloth bag, single colour 53. single side printed markin cloth bag single colour 54. single side printed markin cloth bag single colour 55. single side printed markin cloth bag single colour 56. single side printed markin cloth bag single colour 57. single side printed jute canvass bag single colour 58. printed jute canvass bag 59. nylon net seed bag 60. acrylic label with stand for field, acrylic 61. autoclave bag for mushroom 62. plastic ring for mushroom...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Govind Guru Tribal University - Rajasthan

33934146 supply of pharmacy lab equipments 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall, 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a ) stage micrometer b ) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a ) single channel b ) multi channel 53 uv cabinet 2 tube , 1 refractometer / abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double / triple necked a ) double neck b ) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath ( 12 holes ) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance ( 1mg sensitivity ) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc ( desirable ) , 36 atomic absorption and emission spectrophotometer ( desirable ) 37 biochemistry analyzer ( desirable ) 38 carbon, hydrogen, nitrogen analyzer 39 deep freezer ( desirable ) 40 ion exchanger 50 ltr. cap. 41 lyophilizer ( desirable ) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer ( trinocular microscope with camera attachment ) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly ( single unit ) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer ( activity cage ) 27 rotarod 2 compartment, 29 analgesiometer ( eddys hot plate and radiant heat methods ) a ) eddy hot plate digital b ) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a ) dissection tray 12x10 gi sheet b ) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a ) levers ( i ) simple lever with pointer ( ii ) starling heart lever with pointer ( iii ) frontal writing lever b ) cannula ( i ) symes cannula ( ii ) venous cannula ( iii ) arterial cannula 41 hypodermic syringes & needles size 15, 24, 26g pharmacognosy dept. 1 compound microscope ( student microscope ) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium, 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a ) single channel b ) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill ( bark and seed grinder ) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a ) autoclave 12x12 s.s. b ) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube, 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a ) blood pressure app. mercury b ) stethoscope 14 clinical thermometer mercury....

Dr. S.N.Medical College - Rajasthan

33900480 rate contract for purchase of electrical items rate contract for purchase of electrical items , electricalitems , element 6 kva , element 2 kva , electric 3 pin top isi / iso 6 amp , electric 3 pin top isi / iso 16 amp , electric wall plug 6 amp piano isi / iso , electric wall plug 16 amp piano isi / iso , electric switch piano 6 amp isi / iso , electric switch piano 16 amp isi / iso , switch & socket ( s.s.comand ) 16 amp , electric pandent holder plastic isi / iso , electric tube side pin holder isi / iso , electric bell isi / iso , electric bell switch isi / iso for table , electric mcb switch 25 amp isi / iso , electric mcb switch 6 amp isi / iso , electric mcb switch 16 amp isi / iso , electric mcb switch 32 amp isi / iso , isolator 2 poll32 amp , isolator 4 poll63 amp , isolator 4 poll100 amp , regulator for fan ( switch type ) , regulator for fan ( socket type ) , lid wire ( 3 core ) qty ( 1 coil ) , electric capacitor 4 mfd isi / iso , electric capacitor 2.5mfd isi / iso , electric pvc tape roll isi / iso , electric tube light starter isi / iso , electric wire flexibleisi / iso 23 / 76 gauze ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 4mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 2.5mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 1mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 1.5mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 0.75mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric welding rod ( welding electrodes ) 10 h qty ( 1pkt ) , electric bed switch , telephone wire isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric china connector pound isi / iso , electric mono block pump ½ h.p.isi / iso , electric bulb 25, 40, 60, 100, 200 watt isi / iso , electric chowk 36 watt isi / iso , electric room heater single rod isi / iso , electric room heater double rod isi / iso , electric tube rod 4’ isi / iso , electric tube rod 2’ isi / iso , 20 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 10 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 2 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 1 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 4mm wire cable qty ( 1 coil of 90 mtr ) , red bulb led 0.5w , electrical tester , electric drill machine hammer isi / iso , electric cutter machine isi / iso , battery terminal isi / iso , battery lug isi / iso , iron element 1500w isi / iso , gyser element isi / iso 1.5 kva ( 1500 watt ) , led bulb 5w , led bulb 7w , led bulb 9w , led bulb 11w , led bulb 12w , led bulb 15w , led bulb 17w , led bulb 20w , led bulb 23w , bulb holder ( bekellite ) , gyser thermostat , room heater / heat blower , switch board 4”x6” , switch board 8”x6” , switch board 8”x10” , switch board 10”x12” , electric bell for water tank , led tube light rod 4’ , led light 8”x8” ( for ceiling ) , led light 4”x4” ( for ceiling ) , led road light 100w , sterilizer element , desert cooler speed switch , desert cooler on / off switch , laryngoscope bulb , 5 port d link switch , 8 port d link switch , ups 600va , battery 12v 180ah ( on replacement basis ) , battery 12v 88ah ( on replacement basis ) , voltage stabilizer 2 kva for a.c. , voltage stabilizer 4 kva for a.c. , voltage stabilizer 5 kva for a.c. , stabilizer 2 kva , ups battery 42 ah ( on replacement basis ) , ups battery 42 ah ( without replacement basis ) , ups battery 26 ah ( on replacement basis ) , ups battery 26 ah ( without replacement basis ) , ups battery65 amp / 12volt ( on replacement basis ) , ups battery65 amp / 12volt ( without replacement basis ) , receiver cord for telephone , line cord for telephone , connection dp for telephone , 10 pair cable for epabx qty ( 1 mtr ) , contactor relay for autoclave machine 240v , bearing no. 6000 , bearing no. 6001 , bearing no. 6200 , bearing no. 6201 , bearing no. 6202 , bearing no. 6203 , desertcooler fan motor copper , desert cooler submersible pump 23w ( one season ) , desert cooler submersible pump 40w ( one season ) , desert cooler ball cock valve , desert cooler fan blade pvc , desert cooler fan leg , desert cooler fan leg nut , desert cooler distributor pvc , elbow for cooler ( p.v.c ) , electric pump namda isi / iso , endoscopy bulb 15v 150w , fan bush for cooler , fan ring bolt¾” for desert cooler qty ( 1kg ) , fan ring nut bolt 1 ½” for desert cooler qty ( 1kg ) , fan rivet for desert cooler qty ( 1kg ) , fan shaft for cooler , o.t.ceiling light bulb , screw ( for wood work ) various sizes steel 4”, 3”, 2½”, 1¾”, 1½”, ¾”, 1” qty ( 1kg ) , spanner fix , spanner ring , tata for desert cooler big size qty ( 1set ) , tata for desert cooler extra large size qty ( 1set ) , bit 6mm for hammer machine , bit 8mm for hammer machine , bit 10mm for hammer machine , ceiling fan clip , ceiling fan pipe 2 ft. , nut bolt with cottor pin ( no.10 ) for halfshed fan , nut bolt with cottor pin ( no.12 ) for halfshed fan , iron wire g.i. qty ( 1kg ) , electric plier , stone cutter 4” , wooden cutter 4” , stone cutter blade , iron cutter blade , wooden cutter blade , fan blade metal 18” , fan blade bolt , fan blade washer qty ( 1kg ) , rinch spanner 12” , rinch spanner 14” , multimeter , washer ironqty ( 1kg ) , telephone instrument , telephone instrument with id caller , 4 pin cfl 36 watt length 410mm , mcccb 160 amp. 4 pol adjustable o / l s / c , tp 63 amp. , mcccb 100 amp. 4 pol adjustable o / l s / c , bus bar chamber 63 amp. four strip copper , mcccb 100amp. 3pol adjustable o / l s / c , tpn switch side handle 63 amp. , copper wire coil 7 / 16 , copper lug , 811 item no. ( detailed description as per technical specification and compliance sheet ) , 812 item no. ( detailed description as per technical specification and compliance sheet ) , 813 item no. ( detailed description as per technical specification and compliance sheet ) , 814 item no. ( detailed description as per technical specification and compliance sheet ) , 815 item no. ( detailed description as per technical specification and compliance sheet ) , 816 item no. ( detailed description as per technical specification and compliance sheet ) , 817 item no. ( detailed description as per technical specification and compliance sheet ) , 818 item no. ( detailed description as per technical specification and compliance sheet ) , 819 item no. ( detailed description as per technical specification and compliance sheet ) , 820 item no. ( detailed description as per technical specification and compliance sheet ) , 821 item no. ( detailed description as per technical specification and compliance sheet ) , 822 item no. ( detailed description as per technical specification and compliance sheet ) , 823 item no. ( detailed description as per technical specification and compliance sheet ) , 824 item no. ( detailed description as per technical specification and compliance sheet ) , 825 item no. ( detailed description as per technical specification and compliance sheet ) , 826 item no. ( detailed description as per technical specification and compliance sheet ) , 827 item no. ( detailed description as per technical specification and compliance sheet ) , 828 item no. ( detailed description as per technical specification and compliance sheet ) , 829 item no. ( detailed description as per technical specification and compliance sheet ) , 830 item no. ( detailed description as per technical specification and compliance sheet ) , 831 item no. ( detailed description as per technical specification and compliance sheet ) , 832 item no. ( detailed description as per technical specification and compliance sheet ) , 833 item no. ( detailed description as per technical specification and compliance sheet ) , 834 item no. ( detailed description as per technical specification and compliance sheet ) , 835 item no. ( detailed description as per technical specification and compliance sheet ) , 836 item no. ( detailed description as per technical specification and compliance sheet ) , 837 item no. ( detailed description as per technical specification and compliance sheet ) , 838 item no. ( detailed description as per technical specification and compliance sheet ) , 839 item no. ( detailed description as per technical specification and compliance sheet ) , 840 item no. ( detailed description as per technical specification and compliance sheet ) , 841 item no. ( detailed description as per technical specification and compliance sheet ) , 842 item no. ( detailed description as per technical specification and compliance sheet ) , 843 item no. ( detailed description as per technical specification and compliance sheet ) , 844 item no. ( detailed description as per technical specification and compliance sheet ) , 845 item no. ( detailed description as per technical specification and compliance sheet ) , 846 item no. ( detailed description as per technical specification and compliance sheet ) , 847 item no. ( detailed description as per technical specification and compliance sheet ) , 848 item no. ( detailed description as per technical specification and compliance sheet ) , 849 item no. ( detailed description as per technical specification and compliance sheet ) , 850 item no. ( detailed description as per technical specification and compliance sheet ) , 851 item no. ( detailed description as per technical specification and compliance sheet ) , 852 item no. ( detailed description as per technical specification and compliance sheet ) , 853 item no. ( detailed description as per technical specification and compliance sheet ) , 854 item no. ( detailed description as per technical specification and compliance sheet ) , 855 item no. ( detailed description as per technical specification and compliance sheet ) , 856 item no. ( detailed description as per technical specification and compliance sheet ) , 857 item no. ( detailed description as per technical specification and compliance sheet ) , 858 item no. ( detailed description as per technical specification and compliance sheet ) , 859 item no. ( detailed description as per technical specification and compliance sheet ) , 860 item no. ( detailed description as per technical specification and compliance sheet ) , 861 item no. ( detailed description as per technical specification and compliance sheet ) , 862 item no. ( detailed description as per technical specification and compliance sheet ) , 863 item no. ( detailed description as per technical specification and compliance sheet ) , 864 item no. ( detailed description as per technical specification and compliance sheet ) , 865 item no. ( detailed description as per technical specification and compliance sheet ) , 866 item no. ( detailed description as per technical specification and compliance sheet ) , 867 item no. ( detailed description as per technical specification and compliance sheet ) , 868 item no. ( detailed description as per technical specification and compliance sheet ) , 869 item no. ( detailed description as per technical specification and compliance sheet ) , 870 item no. ( detailed description as per technical specification and compliance sheet ) , 871 item no. ( detailed description as per technical specification and compliance sheet ) , 872 item no. ( detailed description as per technical specification and compliance sheet ) , 873 item no. ( detailed description as per technical specification and compliance sheet ) , 874 item no. ( detailed description as per technical specification and compliance sheet ) , 875 item no. ( detailed description as per technical specification and compliance sheet ) , 876 item no. ( detailed description as per technical specification and compliance sheet ) , 877 item no. ( detailed description as per technical specification and compliance sheet ) , 878 item no. ( detailed description as per technical specification and compliance sheet ) , 879 item no. ( detailed description as per technical specification and compliance sheet ) , 880 item no. ( detailed description as per technical specification and compliance sheet ) , 881 item no. ( detailed description as per technical specification and compliance sheet ) , 882 item no. ( detailed description as per technical specification and compliance sheet ) , 883 item no. ( detailed description as per technical specification and compliance sheet ) , 884 item no. ( detailed description as per technical specification and compliance sheet ) , 885 item no. ( detailed description as per technical specification and compliance sheet ) , 886 item no. ( detailed description as per technical specification and compliance sheet ) , 887 item no. ( detailed description as per technical specification and compliance sheet ) , 888 item no. ( detailed description as per technical specification and compliance sheet ) , 889 item no. ( detailed description as per technical specification and compliance sheet ) , 890 item no. ( detailed description as per technical specification and compliance sheet ) , 891 item no. ( detailed description as per technical specification and compliance sheet ) , 892 item no. ( detailed description as per technical specification and compliance sheet ) , 893 item no. ( detailed description as per technical specification and compliance sheet ) , 894 item no. ( detailed description as per technical specification and compliance sheet ) , 895 item no. ( detailed description as per technical specification and compliance sheet ) , 896 item no. ( detailed description as per technical specification and compliance sheet ) , 897 item no. ( detailed description as per technical specification and compliance sheet ) , 898 item no. ( detailed description as per technical specification and compliance sheet ) , 899 item no. ( detailed description as per technical specification and compliance sheet ) , 900 item no. ( detailed description as per technical specification and compliance sheet ) , 901 item no. ( detailed description as per technical specification and compliance sheet ) , 902 item no. ( detailed description as per technical specification and compliance sheet ) , 903 item no. ( detailed description as per technical specification and compliance sheet ) , 904 item no. ( detailed description as per technical specification and compliance sheet ) , 905 item no. ( detailed description as per technical specification and compliance sheet ) , 906 item no. ( detailed description as per technical specification and compliance sheet ) , 907 item no. ( detailed description as per technical specification and compliance sheet ) , 908 item no. ( detailed description as per technical specification and compliance sheet ) , 909 item no. ( detailed description as per technical specification and compliance sheet ) , 910 item no. ( detailed description as per technical specification and compliance sheet ) , 911 item no. ( detailed description as per technical specification and compliance sheet ) , 912 item no. ( detailed description as per technical specification and compliance sheet ) , 913 item no. ( detailed description as per technical specification and compliance sheet ) , 914 item no. ( detailed description as per technical specification and compliance sheet ) , 915 item no. ( detailed description as per technical specification and compliance sheet ) , 916 item no. ( detailed description as per technical specification and compliance sheet ) , 917 item no. ( detailed description as per technical specification and compliance sheet ) , 918 item no. ( detailed description as per technical specification and compliance sheet ) , 919 item no. ( detailed description as per technical specification and compliance sheet ) , 920 item no. ( detailed description as per technical specification and compliance sheet ) , 921 item no. ( detailed description as per technical specification and compliance sheet ) , 922 item no. ( detailed description as per technical specification and compliance sheet ) , 923 item no. ( detailed description as per technical specification and compliance sheet ) , 924 item no. ( detailed description as per technical specification and compliance sheet ) , 925 item no. ( detailed description as per technical specification and compliance sheet ) , 926 item no. ( detailed description as per technical specification and compliance sheet ) , 927 item no. ( detailed description as per technical specification and compliance sheet ) , 928 item no. ( detailed description as per technical specification and compliance sheet ) , 929 item no. ( detailed description as per technical specification and compliance sheet ) , 930 item no. ( detailed description as per technical specification and compliance sheet ) , 931 item no. ( detailed description as per technical specification and compliance sheet ) , 932 item no. ( detailed description as per technical specification and compliance sheet ) , 933 item no. ( detailed description as per technical specification and compliance sheet ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33897350 rate contract for purchase of electrical items 1 element 6 kva 2 element 2 kva 3 electric 3 pin top isi / iso 6 amp 4 electric 3 pin top isi / iso 16 amp 5 electric wall plug 6 amp piano isi / iso 6 electric wall plug 16 amp piano isipso 7 electric switch piano 6 amp isi / iso 8 electric switch piano 16 amp isi / iso 9 switch & socket ( s.s.comand ) 16 amp 10 electric pandent holder plastic isi / iso 11 electric tube side pin holder isi / iso 12 electric bell isi / iso 13 electric bell switch i51 / iso for table 14 electric mcb switch 25 amp 151 / 150 15 electric mg switch 6 amp isi / i50 16 electric mcb switch 16 amp isi / iso 17 electric mcb switch 32 amp isi / iso 18 isolator 2 poll 32 amp 19 isolator 4 poll 63 amp 20 isolator 4 poll 100 amp 21 regulator for fan ( switch type ) 22 regulator for fan ( socket type ) 23 lid wire ( 3 core ) 24 electric capacitor 4 mfd isi / iso 25 electric capacitor 2.5mfd isi / iso 26 electric pvc tape roll 151 / 150 27 electric tube light starter isi / iso 28 electric wire flexible isi / iso 23 / 76 gauze ( coil of 90 mtr ) 29 electric wire 4mm isi / iso ( coil of 90 mtr ) 30 electric wire 2.5mm isipso ( coil of 90 mtr ) 31 electric wire 1mm isi / iso ( coil of 90 mtr ) 32 electric wire 1.smm 151 / iso ( coil of 90 mtr ) 33 electric wire 0.75mm 1s1 / iso ( coil of 90 mtr ) 34 electric welding rod ( welding electrodes ) 10 h 35 electric bed switch 36 telephone wire isi / iso ( coil of 90 mtr ) 37 electric chy ia connector pound 15i / iso, 38 electric mono block pump a h.p.isi / iso 39 electric bulb 25, 40, 60, 100, 200 watt isi / iso 40 electric chowk 36 wattisi / i50 41 electric room heater single r00151 / 150 42 electric room heater double rod isi / iso 43 electric tube rod 4 151 / 150 44 electric tube rod 2 151 / iso 45 20 pair jelly filled unarmored cable ( 0.5mm copper ) 46 10 pair jelly filled unarmored cable ( 0.5mm copper ) 47 2 pair jelly filled unarmored cable ( 0.5mm copper ) 48 1 pair jelly filled unarmored cable ( 0.5mm copper ) 49 4mm wire cable 50 red bulb led 0.5w 51 electrical tester 52 electric drill machine hammer isi / iso 53 electric cutter machine 151 / 150 54 battery terminal isi / iso 55 battery lug isi / 150 56 iron element 1500w151 / 150 57 gyser element 151 / 150 1.5 kva ( 1500 watt ) 58 led bulb 5w 59 led bulb 7w 60 led bulb 9w 61 led bulb 11w 62 led bulb 12w 63 led bulb 15w 64 led bulb 17w 65 led bulb 20w 66 led bulb 23w 67 bulb holder ( bekellite ) 68 gyser thermostat 69 room heater / heat blower 70 switch board 4x6 71 switch board 8xb 72 switch board 8x10 73 switch board 101 ( 12 74 electric bell for water tank 75 led tube light rod 4 76 led light 8x8 ( for ceiling ) / .. ‘ r 77 led light 4x4 ( for ceiling ) 78 led road light 100w 79 sterilizer element 80 desert cooler speed switch 81 desert cooler on / off switch 82 . laryngoscope bulb 83 5 port d link switch 84 8 port d link switch 85 ups 600va 86 battery 12v 180ah ( on replacement basis ) 87 battery 12v 88ah ( on replacement basis ) 88 voltage stabilizer 2 kva for a.c. 89 voltage stabilizer 4 kva for a.c. 90 voltage stabilizer 5 kva for a.c. 91 stabilizer 2 kva 92 ups battery 42 ah ( on replacement basis ) 93 ups battery 42 ah ( without replacement basis ) 94 ups battery 26 ah ( on replacement basis ) 95 ups battery 26 ah ( without replacement basis ) 96 ups battery65 amp / 12volt ( on replacement basis ) 97 ups battery65 amp / 12volt ( without replacement basis ) 98 receiver cord for telephone 99 line cord for telephone 100 connection dp for telephone 101 10 pair cable for epabx 102 contactor relay for autoclave machine 240v 103 bearing no. 6000 104 bearing no. 6001 105 bearing no. 6200 106 bearing no. 6201 107 bearing no. 6202 108 bearing no. 6203 109 desert cooler fan motor copper 110 desert cooler submersible pump 23w ( one season ) 111 desert cooler submersible pump 40w ( one season ) 112 desert cooler ball cock valve 113 desert cooler fan blade pvc 114 desert cooler fan leg 115 desert cooler fan leg nut 116 desert cooler distributor pvc, 7 , r 117 elbow for cooler ( p.v.c ) 118 electric pump namda isi / iso 11.9 endoscopy bulb 15v 150w 120 fan bush for cooler fan ring bolt % for desert cooler 121 122 fan ring nut bolt 1 m for desert cooler 123 fan rivet for desert cooler 124 fan shaft for cooler 125 o.t.ceiling light bulb 126 screw ( for wood work ) various sizes steel 4, 3, 2y2, 1%, 1y2, %, 1 127 spanner fix 128 spanner ring 129 tata for desert cooler big size 130 tata for desert cooler extra large size 131 bit 6mm for hammer machine 132 bit 8mm for hammer machine 133 bit 10mm for hammer machine 134 ceiling fan clip 135 ceiling fan pipe 2 ft. 136 nut bolt with cottor pin ( no.10 ) for halfshed fan 137 nut bolt with cottor pin ( no.12 ) for halfshed fan 138 iron wire g.i. 139 electric plier 140 stone cutter 4 141 wooden cutter 4 142 stone cutter blade 143 iron cutter blade 144 wooden cutter blade 145 fan blade metal 18 146 fan blade bolt 147 fan blade washer 148 rinch spanner 12 149 rinch spanner 14 150 multimeter 151 washer iron 152 telephone instrument 153 telephone instrument with id caller 154 4 pin cfl 36 watt length 410mm 155 mcccb 160 amp. 4 pol adjustable oil s / c 156 tp 63 amp. 7 j , 157 mcccb 100 amp. 4 pol adjustable oil s / c 158 bus bar chamber 63 amp. four strip copper 159 mcccb 100amp. 3 pol adjustable oil s / c 160 tpn switch side handle 63 amp. 161 copper wire coil 7 / 16 62 copper lug....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Govind Guru Tribal University - Rajasthan

33678311 supply of pharmacy lab equipments pharmaceutics dept. 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall 9 | p a g e ggtutender 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a) stage micrometer b) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a) single channel b) multi channel 53 uv cabinet 2 tube pharmaceutical chemistry dept. 1 refractometer/abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double/ triple necked a) double neck b) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath (12 holes) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance (1mg sensitivity) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc (desirable) 11 | p a g e ggtutender 36 atomic absorption and emission spectrophotometer (desirable) 37 biochemistry analyzer (desirable) 38 carbon,hydrogen,nitrogen analyzer 39 deep freezer (desirable) 40 ion exchanger 50 ltr. cap. 41 lyophilizer (desirable) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer (trinocular microscope with camera attachment) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly(single unit) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer(activity cage) 27 rotarod 2 compartment note. rotarod with 1 rpm accuracy rate on request 12 | p a g e ggtutender 28 pole climbing apparatus 29 analgesiometer (eddys hot plate and radiant heat methods) a) eddy hot plate digital b) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a) dissection tray 12x10 gi sheet b) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a) levers (i) simple lever with pointer (ii) starling heart lever with pointer (iii) frontal writing lever b) cannula (i) symes cannula (ii) venous cannula (iii) arterial cannula 41 hypodermic syringes & needles size 15,24,26g pharmacognosy dept. 1 compound microscope (student microscope) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium 13 | p a g e ggtutender 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a) single channel b) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill (bark and seed grinder) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a) autoclave 12x12 s.s. b) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube 14 | p a g e ggtutender 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a) blood pressure app. mercury b) stethoscope 14 clinical thermometer mercury ...

Sms Medical College - Rajasthan

33641597 rate contract for disposable and glassware and consumable and miscellaneous items ( nit 48 ) i. aluminium foil — 2. autoclavable borosil screw capped tubes 5ml 3. autoclavable borosil screw capped tubes1 omm 4. autoclavable petridish sample required 5. disposable gloves ( non sterile in pack of 25 to 50 pairs ) b a ) size 6.5 b ) size 7 c ) size 7.5 d ) size 8 6. centrifuge plastic test tubes with cap sterile 4, ’ 7. coplin jar with lid ( rectangular pvc ) 8. sterile disposable, polystyrene, optically clear, petridishes 9omm x15mm ( 4” ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment z aa £ 9. sterile disposable swab sticks individual ipacked size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expjry sample required to be supplied in installment_ 10. sterile disposable swab st1ck wth test tubes individually packed size ( 150 mmx 12mm ) , sterulized by gamma radlation with date of manufacture & exp1ry sample required 11. sample racks ( 96 slois / rack ) 12x75 mm tube 12. disposable stool sample coniainer with spatula 13. plastic discard container with lid and sieve 14. disposable autoclave bag a ) red 30l b ) yellow30l 15. transparentbag30l a ) red _15l b ) yellow.i5mlb 16. c ) transparent bag 15 l 17. disposable bag a. ) black 30l plastic basket ( jali ) autoclavable—small 18. a ) medium 7”x7”x7” b ) large 9”x9”x9” 19. 20. plastic pipe for water supply / 2 inch plastic trays i y2’ xi wx 6” 21. i plastic trays for reagent bottles 22. plastic dropper a ) b ) big 23. tissue paper rolls 100 meter 24. tie 8” long for lying plastic bags — 25. syringe needle sterile disposable . _... a ) 10ml b ) 2nml — c ) 5ml 26. disposable test tube with screw cap and label, individually packed, sterilized by gamma radiation with date of manufacture & expiry _.... sample require! ) a ) 1onmlr _ b ) 5ml — 27. steriledisposa [ 3le container wide mouth individually packed supplied in installment ( for sputum, urine ) without spoon 30 ml self standmng, sterilized by gamma radiation — 28. test tube stand 29. microtitre polystyrene plate of 96 round bottom wells with lid, individually packed sterilized by gamma radiation with date of manufacture & expiry sample required 30. nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plast1c shaft with breakable point about .._. i5cmnlong !—m 31. plain vial for blood collection 5ml — 32.. microcentrifuge tube ( 1.8 ml molecular biology grade ) 33. tooth pick...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33555781 supply of equipments and models for uch, kekri ajmer hot air oven ( 50 c ) for special standing . temperature ambient up to 250c with least count 10c. . latest technology & modern aesthetics. o capacity ( liters ) : 30 o chamber dimension ( mm ) ( wxdxh ) : 325x310x31 o double metal sheet body with air pocket keep the machine cool. o digital temperature control o perforated stainless steel removable two racks for keeping samples. o insulated glass door window to view the sample. o one main unit ( complete lnside made of ss 316 grade ) . two shelves ( made of ss 316 grade ) 0l 1.02 centrifuge machine electric rotofix o rpm: 500 8000 ( in increments of 100 ) . o max. capacity: 4 x 100m1 / 6 x 94m1. o dimensions ( w x d x h ) : 33 x 46 x27cm o timer: 0 99 minutes +constant. 02 1.03 water bath ( electric ) o lnner chamber & lid s. steel ( ss 304 grade ) . o outer chamber mild steel duly powder coated special grade mineral wool, control panel have on / offswitch, heating & main indicators. o power 22o v / 50 hz. holes o diameter 75 mm, o temperature range s to 10ooc. o temperature error correcting function, portable r simple block changing, convenient for cleaning. . lnstant temperature display, timing decreasing display. 1oo ncubator double walled construction outer s.5304 dull finish lnner s.s316 mirror polished puf insulation between two walled full acrylic door permit inspection of specimen, without disturbing the temp. temp controlled by pid controller with auto tuning facility with accuracy of 0.5c temp range 5 c to 60 c accuracy 0.5c lllumination light are provided for viewing cfc free hermetically sealed compressor provide temp for below ambient condition air circulation fan for marinating temp uniformity throughout the chamber the chamber is provided with modular removable shelves made of s.s. for complete flexibility in use temp range 5c to 50c with accuracy of + 1c double walled, inside anodized stainless steel and outside m.s. powder coated to work on 220 / 230 volts a.c 50hz lnner chamber size ( mm ) wxdxh455x410x610. capacity in cu. ft. 4 cu. ft capacitv 112 liters. 1.05 haemocytometer with rbc & wbc pipettes r cover slip and having wooden box o lmproved neubauer chamber r lmproved bc & wbc chamber, having better quality of cover slip. 2s 1.06 haemoglobinometer ( sahl i ) . lmproved quality chamber having better graduated square tube & properly visible comparator ( standard ) tube. 25 1.07 autoclave ( electric ) o made of heavy seamless aluminium sheet. o size 220mm x 230mm x 38mm o capacity 10ltr. o electric power source 220v.50h2 size: 350mm x 330mm + 90mm lid. ( 14 x 16 ) o suitable for two sterlizing / dressing drum and supplied with inner and outer stand 02 1.08 anaerobic apparatus o made of seamless ss body coupled with ss flange & ss lid 02 1.09 stopwatch ( % sec ) r digital o measuring capacity of 01 second, minute & hour 02 1.10 ph meter . ph range :0 14 ph r resolution : 0.01 ph r temperature range : 00 to 100c ( manual compensation ) r display: 3l / 2dieit led display o power suppiy: 230vac *lo%, 50 hz o catibration check facility & calibration error indication for 7.00 t400 ph 03 sign & seal of firms l.l l high speed centrifuge for serological / hematological work o microprocessor based square m s body duly powder coated double walled light weight abs lid o fitted with microprocessor based 2 lines 16 characters lcd panel for 0 59 minutes countdown timer. o digital rpm meter & programmable speed controller. 0l l.l2 esr ( westergren s / wintrobe ) . equipment for esr estimation / westergrens pipette for esr on standwestergrenss stand. o back aluminum scale having capacity of 6 to 8. westergren stand. 02 sets each l .13 colony counter o digital display o readout 0 999999. 7 segment led display o audible confirmation of each count. o uniform glare free illumination. o wolffhugel glass grid with focusing facility. o led based illumination. o dish size : 110mm o magnification : x1.7 o size:260x255x170mm o accessories: o marking pen 1 o magnifier lens 1 o lens holder 1 o height with integral support stand:3o0mm 01 1, l4 coplin jars . material ppcp ( polypropylene co polymer ) . air tight, no moisture absorption, unbreakable, self standing jar to protect glass slides. r holding capacity 5 slides of size 1n x 3n. 06 1.15 machine for estimation of blood sugar / serological test o glucometerdigitalusage / application r to monitor blood glucose level r measurement range20 600 mg / dl . display digital . sample volume 05 ul 01 l.l6 | semi autoanalyser analysis method: kinetics, end point, two point, etc. power supply:20w / !2y halogen light, life time:2000hr optical system: 340 800nm, 8 hard membrane filter: 340, 380, 405, 492, 5t0, 546, 57 8, 630nm ( wavelength ) accuracyt2nm abs range: 2.500 2.5abs resolution:0.001abs. flow cell: titanium quartz alloy, 33ul; optical path: 10mm. temperature: pelti e r elements, 25, 3037 0.1rei, e precision : er rct autoclave, re sterile, reusable, matte finish i i1.04 sponge holding forcep stainless steel ce oualitv.6inch.8inch, i 0inch, i 2, inch i each i 1.05 ovum forcep standard size , non rusted stainless steel i 1 1.06 uterine sound luni heavily serrated, fenestrated angled loops metal brass ( heavy duty, extended longevity ) stain chrome finish 32cm / l3 i i 1.07 cervical dilator ( hegars dilator ) c.rviat ciitator premium quality, set of 8 pieces lmm to l6mm, stainless steel, polish finish, autoclave, reusable i set i 1.08 vulsellum single tooth ( tinaculum ) size to inch, high grade stainless steel i i 1.09 vulsellum multipal tooth ( teals vulsellum ) size l0 inch, high grade stainless steel i i l.l0 uterine currators ooutg eaea, tligh grade stainless steel, set of4 dcs i set il il episiotomy scissor stai n i ess steel, s ize 5. 5 , 6, 7 .5, ce qual ity i each 11.12 towel clip sire +ir, .t, , s i*h, 5. 5 inch, high grade stainless steel, matt finish i each i 1.13 needle holder stainless steel, rust proof size 6inch, 8inch i each t t.t+tcyto urush i 1 l.l5 abdominal retractor shaped , l, ffi ( 5 ) nonrusted stainless steel, reusable, can be autoclave i each 1 1.16 chittle forcep size ginch, t0inch, l2inch, high quality stainless steel, non rusted, reusable, can be autoclaved i each i 1.17 stitch removal scissor stainless steel, standard size, i 1 l.l8 umbilical cord scissor ffirusted, reusable, can be autoclaved i each ll.19 simple dressing scissor blurt &sharp straight premium stainless steel o ualitv.5 inch, 6 inch, 8 inch i each 11.20 curved dressing scissor ntunt asnarp straight premium stainless steel quality, 5inch, 6inch, 8inch i each tt.2l allis tissue forcep size 5 inch, 6inch, 8inch handcrafted withy dremium surgical grade stainless steel i each 11.22 curved artery forcep stainless steel, silk matte satin finish size 5inch.6inch.8inch, i 0inch i each tr.23 bebcocks forcep staintess steel, non rusted, size 6inch, 8inch i each 11.24 foleys cathetor ffinised smooth surface, provided with ultra thin highly elastic balloon size 1 4.1 6.1 8 l0 each fi.25 melcots catheter rubber, siliconised smooth surface l0 11.26 urobag u.ie ac., rtrlati, tn bag with moulded handle.capacity of 2000m1 20 t2 surgery dept. equipments t2.01 kidney tray stainless steel, l0 & 12 inches i each 12.02 i.v. set pvc i box 12.03 b.t. set pvc i box 12.04 proctoscope stainless steel, with light and a lens, large size, app. 5 inches or molq 1 12.05 laryngoscope f. stainlest steel, glare free satin finish miller or macintosh style laryngoscope for adults, or 2. fiber optic light source laryngoscope for adults i seal of firms ttx 12.06 ent set led or optic fiber model with otoscope & oohthalmoscone i 2.07 clamp ( gastric & intestinal ) stainless steel doyens clamp l0 inches. 1 12.08 abdominal retractor stainless steel doyen stille abdominal retractor for adults i 12.09 spermatic cord retractor stainless steel fixation clamp 14.5 cm 5 inch 3 inch 4 inch or larse i 12.10 gland holding forcep stainless steel kochers forcep 6inch 8inch or larse i 2.tt allies tissue forcep stainless steel, 20 cm or large 6inch, 8 inch i 2.12 babcock forcep stainless steel, 8 inches i 2.13 scissor pointed stainless steel, 8 inches i 2.14 scissor curved stainless steel, 8 inches i 12.15 scissor mayo stainless steel, curved & straight, 6 & 8 inches 1 each 12.16 dissected forcep toothed stainless steel, 6 & 8 inches i each 12.t7 dissected forcep plain stainless steel, 7 & 8 inches i each 12.18 kochers artery forcep stainless steel, kochersstille artery forcep, 7 & 8 inches i each 12.19 cheatleforcep stainless steel, 8 & l0 inches i each 12.20 urethral dilator ( male ) stainless steel, set liom 4mm to 12mm i 12.2 urethral dilator ( female ) stainless steel, set fiom 4mm to 1omm i 12.22 catheter rubber rubber urinary catheter, male adult size i 12.23 catheter foleys latex2 or 3 way for adult male i t2.24 suturing needle with thread fersuson stainless steel half circle i set 12.25 needle holding forcep stainless steel, 6 & 8 inches i each 12.26 sponge holding forceps stainless steel, 6, 8, 1 0, 12 inches i each 2.27 straight artery forceps stainless steel.6 inch 8 inches i 12.28 curved artery forceps stainless steel, 6 inch , 8 inches i 12.29 mouth gauge doyens stainless steel for adults i 12.30 mosquito forcep stainless steel straight & curved, 5 or 6 inches i 12.31 sinus forcep stainless steel, straight & cupped, 6 or 8 inches i each 12.32 trocar & cannula laparoscopic i lmm cft, 8 12 inches in length i 12.33 probe stainless steel. 6 or 8 inches i 12.34 aneurism needle syme stainless steel, large 6.5 l65mm i 12.35 tetra towel clip moynihan stainless steel, 4 inch, 5 inch, 6& 8 inches i each 12.36 hydrometer glass and consists of a cylindrical stem and a bulb weighted with mercury or lead. i 12.37 infant mucus extractor pvc & of standard size i 12.38 silvermans biopsy needle stainless steel liver biopsy needle ofstandard size i 12.39 instrument tray stainless steel rectangular ofstandard size i 12.40 needle holder stainless steel, 6 & 8 inches i each l3 forensic medicine and toxicoloev dept. ( li$ dl 4adels ) i 3.01 asphyxial death non toxic pvc with wooden base of size l6*24 inches 0l 13.02 degree ofburns non toxic pvc with wooden base of size l6*24 inches 0l i 3.03 drowning non toxic pvc with wooden base of size l6*24 inches 0t 13.04 entrance & exit wound non toxic pvc with wooden base of size l6*24 inches 0l i 3.05 hanging ( suicidal and homicidal ) non toxic pvc with wooden base of size l6*24 inches 0l 10 i31 sign & seal of firms 13.06 bruises injury. non toxic pvc with wooden base of size 16x24 inches 01 13.07 abrasions injury. ffienbaseofsize l6*24 inches 0l i 3.08 lacerations injury. non toxic pvc with wooden base of size 16*24 inches 0l 13.09 contusions injury non toxic pvc with wooden base of size 16*24 inches 01 13.1 0 signs of death non to^ic pvc with wooden base of size l6*24 inches 01 t4 human skeleton 14.01 human skeleton articulated human skeleton ( female ) . 0l 14.02 human skeleton articulated human skeleton ( male ) 0l 14.03 human skeleton human pelvis articulated female 0l 14.04 human skeleton human pelvis articulated male 0l 14.05 human skeleton full articulated female skull 01 14.06 human skeleton fetal skull 01 l5 anatomv dent. ( list of mtldels ) 15.01 eyes non toxic wc models with wooden base of size l6*24 inches 0l 15.02 ear ffiwoodenbaseof size i 6*24 inches 0l i 5.03 nose nn t ic pvc models with wooden base of size l6*24 inches 01 i 5.04 stomach m; toxi pvc mdett with wooden base of size l6*24 inches 0l i 5.05 liver ffienbaseofsize l6*24 inches 0l 15.06 lungs non toxic pvc models with wooden base of size l6*24 inches 0l 15.07 skin ffienbaseofsize l6*24 inches 01 i 5.08 brain ffioodenbaseofsize i 6*24 inches 01 15.09 i pancreas norntoxic pvc models with wooden base of size l6*24 inches 0l 1 5.10 spleen ffiodenbaseofsize i 6*24 inches 01 15.1 i kidney & bladder norto i. pvc models with wooden base of size l6*24 inches 01 15.12 face ffinbaseofsize lol i 6*24 inches 1 5.13 heart no*toxic pvc models with wooden base of size i 6+24 inches 01 i 5.14 female reproductive organs no*toxic pvc models with wooden base of size i 6*24 inches 01 15.15 male reproductive organs non toxic pvc models with wooden base of size l6*24 inches 0l l6 patholosv & microbioloev dent. ( list of models ) 16.01 atherosclerosis thrombosis and embolism pathology model non toxic pvc models with wooden base of size l6*24 inches 0l 16.02 colon model with following common pathologies : adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon. ulcerative colitis non toxic pvc models with wooden base of size l6*24 inches 01 16.03 bladder pathology ffi fii. pvc *dat *ith wooden base of size i 6t24 inches 0l 16.04 pathological stomach model non toxrc pvc models with wooden base of size l6*24 inches 0l 16.05 pvc liver pathologies model nor toxi. pvc mdels, ith wooden base of size l6*24 inches 01 16.06 lung pathology mn toxic pvc , odels with wooden base of size t6*l / inches 01 1l_x;ii sign & seal of firms 16.07 life cycle of p. vivax non toxic pvc models with wooden base of size 16*24 inches 0l 15.08 osteomyelitis non toxic pvc models with wooden base of size l6*24 inches 0l 16.09 skin pathology non toxic pvc models with wooden base of size l6*24 inches 01 r 6.10 herpes simplex virus non toxic pvc models with wooden base of size l6*24 inches 01 r6.1i shape of aneurism non toxic pvc models with wooden base of size l6*24 inches 0l 16.12 influenza virus non toxic pvc models with wooden base of size l6*24 inches 01 16.13 mumps virus non toxic pvc models with wooden base of size l6+24 inches 0l 16.14 bacterialcell non toxic pvc models with wooden base of size 16*24 inches 0l t 6.15 fibroadenoma of breast nontoxic pvc models with wooden base of size l6*24 inches 01 t7 gynaec & obstetrics dept. ( list of models ) 17.01 a new born child pvc material 16x24 inches 0 17.02 fetus attached to placenta pvc material 16x24 inches 0 17.03 structure of human ovum pvc material 16x24 inches 0 17.04 ectopic pregnancy pop material 16x24 inches 0 17.05 uterus in section showing sperm & ovum in process of fertilization pvc material 16x24 inches 0l 17.06 showing the hemorrhages of presnancy & parturition pop material 16x24 inches 0l 17.07 first stage of labour pop materia 16x24 inches 0 17.08 second stage oflabour pop materia 16x24 inches 0 17.09 third stage of labour pop materia 16x24 inches 0 17.10 maternal surface of placenta pop materia 16x24 inches 0 l7.l i fetal surface of placenta pop materia 16x24 inches 0 17.12 bifth, l: beginning pop material 16x24 inches 0 17.r3 birth, 2: uterus, contracting pop material 16x24 inches 0 17.14 birth, 3: head deep in birth canal pop material 16x24 inches 0l 17.15 birth, 4: head emerging pop material 16x24 inches 01 17.16 birth, 5: head turns, upward pop material 16x24 inches 01 t7 .17 birth, 6: baby born pop material 16x24 inches 0l 17. l8 different clinical condition of uterus pop material 16x24 inches 0l 17.19 different clinical conditionsof fallopian tube pop material 16x24 inches 0l 17.20 different clinical condition of ovary pop material 16x24 inches 01 17.21 obstetrical manikin modelfetus provided is of a realistic newborn size with fontanels and cranial sutures ( for demonstration purpose ) skin color, pvc material, 16x24 inches 01 l8 sureerv dept. ( list of models 16x24 inches ) 18.01 types oftongue unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.02 gall stone unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0t 18.03 renal stone unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.04 types of hernia unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.05 pressure sore 8.06 spina bifida 18.07 deviated nasal septum 18.08 angioplasty 18.09 ano rectal disorders 18.10 mechanism of hearing l8.l i gerd etc...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33548736 supply of equipments and models for uch kekri ajmer supply of equipments and models for uch, kekri, ajmer , pathology & microbiology dept. equipments , hot air oven ( 50o c ) for special standing , centrifuge machine electric rotofix , water bath ( electric ) , incubator , haemocytometer with rbc & wbc pipettes , haemoglobinometer ( sahli ) , autoclave ( electric ) , anaerobic apparatus , stopwatch ( ½ sec ) , ph meter , high speed centrifuge for serological / hematological work , esr ( westergren’s / wintrobe ) , colony counter , coplin jars , machine for estimation of blood sugar / serological test , semi autoanalyser , cell counter ( cbc machine ) , forensic medicine and toxicology dept. equipments, weapons etc. , equipments , equipment for measuring heights , vernier caliper , weighing machine dial type human , weapons , blunt , i. animal chain , ii. cycle chain , iii. dog chain , iv. gullel , v. hammer , vi. hockey stick , vii. iron rod , viii. laathi ( wooden stick ) , ix. lock , x. meter scale , sharp , i. aari , ii. axe , iii. blade , iv. bread knife , v. chhuri , vi. gandasi , vii. hansiya , viii. iron cutter , ix. kataar , x. khurpi , pointed , i. ballam , ii. broken bottle , iii. garden scissor , iv. gokhru , v. ice cutter , firearms , i. air pistol , ii. air gun , teaching materials postmortem dvd and other dvd’s of f.m.t , gynecology & obstetrics instruments , sim’s speculum , cusco’s speculum , anterior vaginal wall retractor , sponge holding forcep , ovum forcep , uterine sound , cervical dilator ( hegar’s dilator ) , vulsellum single tooth ( tinaculum ) , vulsellum multipal tooth ( teal’s vulsellum ) , uterine currators , episiotomy scissor , towel clip , needle holder , cyto brush , abdominal retractor – ‘l’ shaped , chittle forcep , stitch removal scissor , umbilical cord – scissor , simple dressing scissor , curved dressing scissor , allis tissue forcep , curved artery forcep , bebcock’s forcep , foley’s cathetor , melcot’s catheter , urobag , surgery dept. equipments , kidney tray , i.v. set , b.t. set , proctoscope , laryngoscope , ent set , clamp ( gastric & intestinal ) , abdominal retractor , spermatic cord retractor , gland holding forcep , allie`s tissue forcep , babcock forcep , scissor pointed , scissor curved , scissor mayo , dissected forcep toothed , dissected forcep plain , kocher`s artery forcep , cheatleforcep , urethral dilator ( male ) , urethral dilator ( female ) , catheter rubber , catheter foley`s , suturing needle with thread , needle holding forcep , sponge holding forceps , straight artery forceps , curved artery forceps , mouth gauge , mosquito forcep , sinus forcep , trocar & cannula , probe , aneurism needle syme , tetra towel clip , hydrometer , infant mucus extractor , silverman`s biopsy needle , instrument tray , needle holder , forensic medicine and toxicology dept. ( list of models ) , asphyxial death , degree of burns , drowning , entrance & exit wound , hanging ( suicidal and homicidal ) , bruises injury. , abrasions injury. , lacerations injury. , contusions injury , signs of death , human skeleton , articulated human skeleton ( female ) . , articulated human skeleton ( male ) , human pelvis articulated female , human pelvis articulated male , full articulated female skull , fetal skull , anatomy dept. ( list of models ) , eyes , ear , nose , stomach , liver , lungs , skin , brain , pancreas , spleen , kidney & bladder , face , heart , female reproductive organs , male reproductive organs , pathology & microbiology dept. ( list of models ) , atherosclerosis thrombosis and embolism pathology model , colon model with following common pathologies: adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon, ulcerative colitis , bladder pathology , pathological stomach model , pvc liver pathologies model , lung pathology , life cycle of p. vivax , osteomyelitis , skin pathology , herpes simplex virus , shape of aneurism , influenza virus , mumps virus , bacterial cell , fibroadenoma of breast , gynaec & obstetrics dept. ( list of models ) , a new born child , fetus attached to placenta , structure of human ovum , ectopic pregnancy , uterus in section showing sperm & ovum in process of fertilization , showing the hemorrhages of pregnancy & parturition , first stage of labour , second stage of labour , third stage of labour , maternal surface of placenta , fetal surface of placenta , birth, 1: beginning , birth, 2: uterus, contracting , birth, 3: head deep in birth canal , birth, 4: head emerging , birth, 5: head turns, upward , birth, 6: baby born , different clinical condition of uterus , different clinical conditionsof fallopian tube , different clinical condition of ovary , obstetrical manikin modelfetus provided is of a realistic newborn size with fontanels and cranial sutures ( for demonstration purpose ) , surgery dept. ( list of models 16x24 inches ) , types of tongue , gall stone , renal stone , types of hernia , pressure sore , spina bifida , deviated nasal septum , angioplasty , ano rectal disorders , mechanism of hearing , gerd...

Sms Medical College - Rajasthan

33454893 regarding supply of surgical items and metp items at hospital 1 lens 1ol. all size 2 abdominal drain kit no. 24 2000 ml 3 absorbale gelatin kit sponge 8o x 50 x 10 mm 4 absorhant surgical cotton roll ( 500 gms. ) 5 allies forceps 6 ambu bag adult 7 ambu bag paed. 8 artery forcep 10” curved 9 artery forcep 10” mosquito 1o artery forcep 10” straight 11 artery forcep 6” curved? 12 artery forcep 6 mosquito 13 artery forcep 6” straight 14 artery forcep 8” cursed 15 artery forcep 8” mosquito 16 artery forcep 8” straight 17 asepto syringe with transparent bulb sterile ( 60rnl ) 18 autoclave label 19 b.b. splint l. cull’ 1nail’ 20 bp cuff 21 b.pcuffcomplete set 22 b.p. cuff for cardiac monitor 23 b.p. cuff for digital b.p. instrument 20 b.p cuff mnaual 24 b.p. cuff for monitor 25 b.p. instrument digital 26 b.p. instrument mercury type 27 b.t set ( blood administration set ) 28 baincircuit adult 29 baincircuit paed. 30 bandage 10cm x 4 mtrs. ( pkt of 12 spool ) 31 bandage 15 cm x4.mtrs. ( pktof 12 spool ) 32 bandage 5cm x 4 mtrs. ( pkt of 12 spool ) 33 bandage 7.5cm x 4 mtrs. ( pkt or 12 spool ) 34 barbour thread no. 20, 40. 60. 80 — 35 bed side screen with green cloth ( good quality ) 36 bohlers stirrups 37 bulk conversion unit 38 carmen wire large 39 carmen wire small 40 catheter for urinary drainage ( folys balloon catheter ) . chittal forceps 2 way. size 16 ( s9.c ) slze 18 ( s9.d ) 41 42 catheter for urinary drainage ( folys balloon catheter ) , 2 way, size 16 ( s9.c ) .size 18 ( s9.d ) chittal forceps 42 chittal forceps 43 cresent blade 44 cureter small 45 curved artery forceps 46 cylinder key ( ox>gen, nitrous ) 47 dialator set 48 digital finger pulse oximeter 49 digital thermometer 50 disposable endotracheal tube cuffed 2.5 to 5.0 51 disposable endotracheal tube cuffed 5.5 to 9.0 52 disposable footware 53 disposable plastic g loves ( paper ) 54 disposable razor 55 disposable steriie surgical gloves ( isi mark ) size 6.0. 6.5. 7.0, 7.5. 8.0 56 dispovan needle 26fv2 57 double foot step 58 dressing drum loxi i 1st 59 dressing drum 1 1x15 1st 60 dressing drum 9x1m1 1si 61 dressing trolley as per standard size 62 dynaplast 4” dynaplast 6” 63 64 endotracheal tube with cuff red rubber size: 2.5 .3 .3 .5 a .5 .5 .5 .6 .5 .7 .7 .5 .8.8.5.9 65 ent otoscope 66 esmarch bandage 2” 67 esmarch bandage 4” 68 esmarch bandage 6” 69 eusol 500ml. 70 examination couche ( as per standard size ) 71 face mask ( disposable ) 72 face shield 73 fine scissor 74 finger pulie oximeter — 75 gauge unnedicated size: 120cm x 9mtrs. 76 gauge unmedicated size: 60cm x 9mtrs. 77 hsg cannula all sizes 78 hypodernmic needle 79 i v. cannula three way80 l.v. cannula two way 81 l.v. stand good quality 82 lnsulin syringe with 3g needle ( dispo. ) icc 83 jerry pot 84 kelleys pad 85 kerotorne blade 2.8 ( sharp edge ) 86 kidney tray 87 kirschner wire ( k wire ) 1.0mm. 88 kirschner wire ( k wire ) 1.5mm. 89 knife handle no. 3 & 4 90 laryngoscope with 3 blades adult 91 laryngoscope whh 3 blades paed. 92 lead apron 3mm.thick 93 leucoplast 6 94 low suction machine catheter 95 mackintosh rubber sheet ( good quality ) 96 mattress for bed: size 6’x3’ 97 mattress for examination couche size 6’x2’ 98 medicated baby oil 99 medicated soap 100 mosquito artery forceps straight 1oo mosquito artery forceps straight 101 mucus sucker 102 mva cannula all size 103 mva syringe with cannula 104 n 95 mask ( forcovid 19 ) 105 nasal oxygen cannula 106 nasal oxygen set. twin bore all sizes adult 107 nebuliser machine 108 needle cutter with syringe destroyer electric‘ ss 109 needle holder 10 110 needle holder 6 111 needle holder 8 112 needleno. l1, 14.20.25.26? 113 neubilizer mask with tubing complete set ( disposable ) adult 114 neubilizer mask with tubing complete set [ disposable ) paed. 115 non tooth forceps 6” 116 ovem forceps 117 oxygen cylinder a type 1st with explosive certificate 118 oxygen cylinder b type 1st with explosive certificate 119 oxygen cylinder c type 1st with explosive certificate 120 oxygen cylinde d type 1st with explosive ccrii ficate 121 oxygen regulator with humidifier bottle 122 oxygen tail pipe copper 123 paper adhesive plaster 1” 9 mtrs. 124 paper adhesive plaster 2 9 mtrs. 125 paper adhesive plaster 3” 126 parafin dressing 197s 127 plastic gloves for examination 128 ppe kit ( complete ) 129 pulley traction weight 130 rexine cloth ( good quality ) 131 rubber appron 132 ryles tube / nasogastric tube ( p.v.c. ) slze 6, 8. 16.18 133 s.s. tray with cover 300mm. x 250mm. 134 s.s. tray with cover 350mm. x 240mm. 135 safe delivery kit 136 sanitary napkin 137 sanitary pads 138 sanitizer bottle 500ml. not less than 70% aichohol 139 san itory pads belt type [ s99.b ] 140 scissor for stitch remover 141 skin traction kit large 142 skin traction kit medium 143 skin traction kit small 144 sonography couche with dmawer ( iron ) size: 6x2’ 145 — sponge holder 146 stand for a type oxygen cylinder 147 stand for t3 type oxygen cylinder 148 stand for c type oxygen cylinder 149 — stand for d type oxygen cylinder 150 standard pama intra occular lenses 151 steinman pin 3.0 152 steinman pin 3.5 153 i steinman pin 4.5 154 sterile disposable lv. carmula no. 24 ( three way ) 1s5 sterile disposable i.v. cannula size 1 8. 20 & 22 _ three way 1s6 sterile disposable infusion set with microdrip 157 sterile disposable perfusion set ( i.v. set ) 158 sterile disposable spinal needle 25g 159 sterile disposable syringe 1ome 160 sterile disposable syringe 2ml 161 sterile disposable syringe 5ml 162 steriliser element 1.5kw with holder 163 steriliser element 3.0kw with holder 164 sterlizer element 2 kw. with holder 165 stilet . big 166 stilet small 167 stitch cutting scisor 168 stockinet 169 straight scissor with tip 17o stretcher trolley as per hospital standard ( good oualty ) pi suction cannula no. 4. 6. 8. 10 suction catheter no. 18.16 ( s 9 ) 172 173 suction catheter no. 6 & 8 174 surgical blade 10. 1 1. 15, 20. 22 ( s 30 ) isi mark ( lo0pcs. ) 175 surgical foldable cap. disposable ( 1 x50strip!caps ) 176 surgical scissor curved 10” metazbown 177 surgical scissor curved 8” heavy mayo 178 surgical scissor curved 8” metazbown 179 suture forcep non tooth 6:8.10o 180 suture forcep tooth 6.8.10? 181 suture needle curved size: 6.8. 10.12.14, 16 182 suture needle straight size: 6.8. 10, 12.14. 16 183 thomas splint large 184 thomas splint medium 185 thomas splint small 186 tooth forceps 6” 187 tooth rorceps 6 188 torniquet phenomenon small dinklage cuff 189 trolley for cautery machine 2” x4” 190 umbilical catheter 191 uretheral plain catheter ( k 90 ) 192 urine collection bag cap. 2000 ml 193 vaginal speculum sims 194 vaginal speculum wall retractor 195 vaginal wall retractor 195 — vaginal wall retractor 196 valsuleen 197 viral transmision medium vial ( vtm ) 198 weighing scale adult 199 weighing scale child 200 weight machine electric 201 wheel chair good quality made with as per standard 202 x ray view box two films 203 lris scissor curved ( for eye patient ) 204 hub needle cutter 205 lnfant feeding tube size 8 etc...

Medical Education Department - Rajasthan

33422880 bids are invited for micropipettes single channel of variable volume , adjustable volume digital multiple channel micropipettes , hot air oven , water bath , bodincubator , vortex mixer , vertical autoclave , water purification system total quantity : 11...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33294149 supply of anaesthesia equipment kit for ot anaesthesia equipment kit for ot , opd , operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268475 supply and installation of resuscitation kit for o.t’s and wards operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....