Government Medical College - Rajasthan

37860249 rate contract for chemicals, test kits, reagents, media and glassware , (a)chemicals preferred make: merck, cdh, qualigens, srl, himedia, thermofisher , absolute alcohol /ethanol absolute ar , acetic acid glacial ar , acetone ar , acid fuchsin m.s/ certified , agar agar powder , albumin egg flakes , alcian blue m.s/ certified , amido black stain , aluminum sulphate ar , aluminum chloride , alkaline haematin d regentwith haemoglobin standard 9.0 g/dl , alkaline haematin d regentwith haemoglobin standard &15.0 g/dl , ammonia solution30% , ammonium oxalate ar , ammonium potassium sulphate (alum) , ammonium sulphate ar , aniline blue m.s/ certified , anti microbial hand rub , anti sera a, anit sera b and anti sera d one set of blood group antiseras containing each of 10ml. all antisera must be monoclonal must be able to deduct weakerblood groups , avidity nust be less than 5 second , barium chloride ar , basic fuchsin m.s/ certified , agar agar bacteriological , bees wax, yellow , benedict’s reagents qualitative lr , benzidine powder , benzidine powder dihydrochloride , biebrich scarlet m.s certified , bouin’s fluid fixing solution , brilliant cresyl blue m.s/ certified , bromophenol blue , boric acid ar , borate buffer ph 9.0 , borax powder ep , buffer tablets6.2 ph , buffer tablets7.0 ph , buffer tablets9.2 ph , calcium chloride ar , congo red m.s/ certified , carbol fuchsin dilute , carbol fuchsin strong , carmine m.s./certified , cedar wood oil , charcoal activated ar , citric acid ar , crystal violet m.s/ certified , csf diluting fluid , dextrose ndhydrous /d glucose , d.p.x. mountant , darbkin’s solution , deionised water , distilled water , di sodium hydrogen ortho phosphate , diastage , emry powder no 2 , emry powder no 3 , eosin water soluble , eosinophil counting fluid , esbach’s reagent , ehrlich’s reagents solution , ethylene diamine tetra acitic acid (edta) , fast green ms , ferric ammonium sulphate , fetal hb kits , formal dehyde (37 41%) w/var , fouchet’s reagents , field staina sol’n , field stainb sol’n , gram’s iodine ms , g6pd reagent kit (qualitative) , giemsa stain powder m.s/certified , giemsa stain solution , glycerol ar , gold chloride m.s , hematoxylin powder ms/certified , hematoxylin may’s soln ms , haemoglobin standard , hemocue hb microcuvettes , hydrochloric acid (concentrated) , hydrogen peroxide (6%) , iodine powder , iso propyl alcohol ar , kaolin light ep , labogent/labklin(glass cleaning solution ) , leishman’s stain solution m.s , leishman’s stain powderm.s/ certified , light green m.s/ certified , liquid paraffin oil heavy , liquid paraffin oil light , lithium carbonate ar , lugol’s iodine , mercuric oxide red purified , metanil yellow m.s/ certified , methanol ep (acetone free) , methyl violet m.s/ certified , methyline blue m.s/ certified , myeloperoxidase stain , neutral red m.s/ certified , n/10 hcl , nitric acid ar , normal saline 0.9% , paraffin wax with ceresin, in block form (600 620) , paraffin wax with ceresin, in block form (580 600) , peanut oil , periodic acid m.s/ certified , phenol crystal , phosphomolibidic acid , phosphotungestic acid ar , picric acid (saturated) , platelet count fluid , phloxin –b m.s/ certified , phenyle , potassium dichromate , potassium ferrocynide , potassium hydroxide pellets , potassium iodine ar , sodium acetate ep(anhydrous) , sodium chloride ep , sodium citrate 3.8% , sodium carbonate , sodium dihydrogen ortho phosphate , sodium hypo chlorite solution 4% , sodium hydrogen phosphate ar , sodium di hydrogen phosphate ar , sodium nitrate ar , sodium nitropruside , sodium sulphate ar , sodium thiosulphate , sudan black , spirit , sulphosalicylic acid , potassium metabisulphite ar , potassium permangnatepurified , ponceau’s stain , rapid pap’s kit , rbc counting fluid , reticulocyte count fluid , semen diluting fluid , silver nitrate ep , xylene sulphur free , sulpher powder , sulphuricacid pure , thymol crystal , toludine blue m/s certified , tris buffer phosphate , tris sodium citrate , wbc counting flude , hexamine , chromium trioxide , sodium powder , b antibody forimmuno histochemistry (ihc test) (a) products should be mouse/rabbit monoclonal type. (b) price will be calculated on per ml basis. (c) it should have shelf life of minimum 12 months from supply. (d) due to low consumption & short expiry, small packing (1x2/6ml)preferred (e) all antibodies should be usfda/bis approved (not registered only). the certificate should be provided. , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp dab substrate buffer & dab chromogen for 100 tests or 10ml along with histozyme enzyme , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp, dab substrate buffer & dab chromogen for 250 tests or 25ml along with histozyme enzyme , hematoxyleane , adhesive for ihc/ tissue bond , alk 1 (monoclonal mouse anti human cd246, clone) , alk 1 (monoclonal mouse anti human cd246, clone) , alpha feto protein (afp) (polyclonal rabbit anti human ) , alpha feto protein (afp) (polyclonal rabbit anti human ) , amacr (monoclonal mouse anti human clone 13h4) , amacr (monoclonal mouse anti human clone 13h4) , androgen receptor (ar) , androgen receptor (ar) , antibody diluent (vidas rub igm) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 2 , bcl 2 , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , bob 1 , bob 1 , brachyury , brachyury , calcitonin (polyclonal rabbit anti human calcitonin) , calcitonin (polyclonal rabbit anti human calcitonin) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret1) , cam 5.2 , cam 5.2 , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 2 (monoclonal mouse anti –human) , cd 2 (monoclonal mouse anti –human) , cd 20 (monoclonal mouse anti –human cd20,clone ber h2) , cd 20 (monoclonal mouse anti – human cd20,clone ber h2) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 22 , cd 22 , cd 24(monoclonal mouse anti – human cd24, classii clone qbend 10) , cd 24 (monoclonal mouse anti –human cd24, classii clone qbend 10) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 56 (monoclonal mouse anti – human cd56,clone 122c2) , cd 56 (monoclonal mouse anti –human cd56,clone 122c2) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 61 , cd 61 , cd 68 (monoclonal mouse anti –human cd68,clone pgm1) , cd 68(monoclonal mouse anti – human cd68,clone pgm1) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 99 (monoclonal mouse anti – human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd11c , cd11c , cd14 , cd14 , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , chromogranin , chromogranin , citrate retrieval buffer ( ph. 6.0) , tris edta retrieval buffer (ph. 9.0) , immuno wash buffer , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 7 (monoclonal mouse anti – human cytokeratin 7,clone ov tl12/20) , ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/20) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , dab chromogen , dab substrate buffer (100ml) , delimiting pen /novo pen/pap pen , desmin (monoclonal mouse anti –human desmin,clone d22) , desmin (monoclonal mouse anti –human desmin,clone d22) , dog 1 , dog 1 , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , egfr , egfr , ema (monoclonal mouse anti – human epithelial membrane antigen,clonee29) , ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , fl i 1 , fl i 1 , galectin 3 , galectin 3 , gfap (polyclonal rabbit gfap) , gfap (polyclonal rabbit gfap) , glypican 1 , glypican 1 , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg beta , hcg beta , her 2 neu (polyclonal rabbit anti human cerb 2) , her 2 neu (polyclonal rabbit anti human cerb 2) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hmwck(monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hpv , hpv , ihc coated slides , immuno wash buffer , inhibin , inhibin , inhibin alpha , inhibin alpha , ini 1 , ini 1 , kappa light chain (polyclonal rabbit anti human kappa light chains) , kappa light chain (polyclonal rabbit anti human kappa light chains) , ki 67 (ki 67 antigen clone mib 1) , ki 67 (ki 67 antigen clone mib 1) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , melan a (monoclonal mouse anti human melan a clone a102) , melan a (monoclonal mouse anti human melan a clone a102) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , muc 2 , muc 2 , muc 5 ac , muc 5 ac , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , myo d1 , myo d1 , myogenin (monoclonal mouse anti myogenin clone f5d) , myogenin (monoclonal mouse anti myogenin clone f5d) , napsin a , napsin a , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , oct 2/4 , oct 2/4 , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 63 , p 63 , pax 8 , pax 8 , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , s 100 (polyclonal rabbit antis100) , s 100 (polyclonal rabbit antis100) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sox 11 , sox 11 , synaptophysin (monoclonal mouse antisynaptophysin sy28) , synaptophysin (monoclonal mouse antisynaptophysin sy28) , tdt , tdt , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , tle 1 , tle 1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , vimentin (monoclonal mouse antivimentin v9) , vimentin (monoclonal mouse antivimentin v9) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , c antibody for immunofluorescence microscopy , albumin, polyclonal fitc ready to use for immunofluorescence rabbit anti albumin conjugated to fluorescein isothiocyanate. , c1q complement, polyclonal fitc ready to use for immunofluorescence rabbit anti c1q complement conjugated to fluorescein isothiocyanate , c2c complement, polyclonal fitc ready to use for immunofluorescence sheep anti c2c complement conjugated to fluorescein isothiocyanate , fibrinogen, polyclonal fitc ready to use for immunofluorescence rabbit anti fibrinogen conjugated to fluorescein isothiocyanate , immunoglobulin a (iga), polyclonal fitc ready to use for immunofluorescence sheep anti iga conjugated to fluorescein isothiocyanate , immunoglobulin g (igg), polyclonal fitc ready to use for immunofluorescence sheep anti igg conjugated to fluorescein isothiocyanate , immunoglobulin m (igm), polyclonal fitc ready to use for immunofluorescence rabbit anti igm conjugated to fluorescein isothiocyanate , kappa, polyclonal fitc ready to use for immunofluorescence rabbit anti kappa conjugated to fluorescein isothiocyanate , lambda, polyclonal fitc ready to use for immunofluorescence rabbit anti lamda conjugated to fluorescein isothiocyanate , mount staining reagent , blocking reagent , c antibody for immunofluorescence microscopy , (1)cal.thromboplastin/neoplastine with solvent (sta neoptimal 5) , (2)pt neoplastin (sta neoptimal 10) , (3)aptt activated partial thromoplastin (c.k.prest 2) , (4) fib.2 fibrinogen (sta fibrinogen 5) , (5) calcium cloride (sta cacl2 0.025 m , other items for coagulometer (6)cuvette (sta cuvettes) , (7)fintips for start 4 1.25 ml , (8) steel bals (sta steel bals , (9)thermal paper size 50 mm , c antibody for immunofluorescence microscopy , (1) actime , (2) erba protime ls , (3) erba actime , (4) reaction tubes su 40 , (5) reaction tubes su 40 , (6) erba factor vii deficient plasma , (7) erba factor x deficient plasma , (8) erba factor ix deficient plasma , (9) erba factor viii deficient plasma , (10)erba factor xi deficient plasma , (11)erba factor xii deficient plasma , (12)erba thrombin reagent , (13)erba thrombin time , (14) thermal printer paper (printer paper roll kit) , (15)erba calcium chloride , (16) erba control p , (17) erba control n , (18) erba control n plus , (19) erba control p plus , (20) control plasma n , (21) erba d dimer calibrator , (22)erba d dimer control n + p , (23)erba d dimer r , (3) properiatory items/reagents/consumable for fully automated esr analyzer model: vasmatic cube 80 make:transasia , (1)vasmatic esr controls normal , (2)abnormal , (3) transponder , (4)esr vaccutainer , (4) properiatory items/reagents/consumables for electronic blood cell counter sysmex xs 800i proprietary items for make : sysmex , (1) cell pack pk dcl , (2) stromatolyser 4dl ffd 200a , (3) sulpholyser sls 220 a , (4) stromatolyser 4ds ffs 800a , (5) cell clean , (6) control xs 800i tri level , (7)pm kit & air pump assembly , (8)solenoid valve lvm11 6a2(av199859) , (9)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (10) tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (11)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (12)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (13)calibrator for 5 part hematology analyzer , (5) proprietary item for machine: reagents for fully automated diferential haematology analyzer,model: xn 10 / xn 1000 / xn 550 / xn 350 make: sysmex , (1)cell pack dcl , (2) cell pack dfl , (3)sulfolyser , (4)flurocell wdf , (5)flurocell wnr , (6)lysercell wnr , (7)lysercell wdf , (8)fluorcell ret , (9)fluorcell plt , (10)cell clean , (11)xn check (tri level) control , (12)xn check bf (l1 3.0ml: l2 3.0 ml) , (13)xn cal(calibrator) , (14)pm kit & air pump assembly for xn series , (15)solenoid valve lvm11 6a2(av199859) , (16)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (17)tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (18)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (19)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (6) rajasthan medical service corporation ltd approved items for electronic blood cell counter 3 part, model: abx micros es 60,make: horiba , (1) minidil lmg , (2) abx lyse bio , (2)abx cleaner , (4) minoclair , (5) minitrol 16(2l) , (6) minitrol 16(2n) , (7) minotrol 16(2h) , (8)minotrolcalibrator , (9) printer roll , (7)proprietary items / consumables for urine analyzersmodel: aution eleven ae 4020, make: arkray , (1) aution screen , (2) urine sticks tlt 10 a , (3) aution sticks 10 pa , (8) proprietary items strips for urine analyzers , 1 urine analyzer strips 10 parameters , 2 mas ua dip tube control bi level , 3 uro dipcheck 200 calibration strip , (9)proprietary items /consumables for histopathology slide cover slipper model: clear vuemake thermo , 1 superfrost, microscopic slides ground edge 90 deg, 76x26 mm. , 2 clear vue mountant , 3 cover slip hoppers 24 mmx50mm #1.5 , 4 gemini basket with white slide retainer , 5 gemini basket with black slide retainer , (10)proprietary kits /consumables for hplc machinelaboratories, model d 10,make: bio rad , 1 diabetic control. bi , 2 hemoglobin a2 control , 3 eqas haemoglobin prog , 4 d 10 dual reorder pack , 5 d 10 microvials 0.1x 1.5 ml , 6 d 10 printer paper,1 , 7 d 10 dual a2/f/a1c ca , 8 d 10 dual analytical , (11)proprietary items / consumables for automated cryostat (frozen microtome)model: hm525 cryostat & automated roroty microtome model 355 s, make: thermo , 1 cryomatrix , 2 cryostat oil , 3 mx 25 primer low profile disposableblades , (12) proprietary items / consumables for histopathologytssue embedding station, model: eci 350 make: myr,spain , 1 plastic embedding rings , 2 plastic tissue embedding cassettes with lid , 3 metallic base moulds , 4 histowax , (13) proprietary items / consumables kits for lbc machine model: thin prep 2000 make hologic usa marketed by m/s hemogenomics , (1)complete pack of gyn kits for lbc , (2)complete pack of non gyn kits for lbc , (3)eosin solution0.2% 5 lit , (4)hematoxilin modified( harris, gill ii pap1: 5 lit , (5)papanicolaou 2b orange ii; 5 lit , (6)papanicolaou 2b ea50; 5 lit , (14)proprietaryitemformachine:itemsreagents&consumablesforserum,urineelectrophoresis model:pretty ,make :srl , 1 serum protein kit , 2 alkaline hemoglobins kit , 3 destain solution conc: product code sre 201m , (15)proprietary items /reagents/kits for cytocentryfuge machine model: cytospin 4 make: thermo , 1 tpx reusable chamber with caps , 2 ez mega funnels with filter cards for large vol. samples , 3 double cyto funnels with filter cards , 4 single cyto funnels with brown filter cards , 5 single cyto funnels with white filter cards product code 5991040 , 6 white filter cards , 7 polysine slides for cytology , (16)proprietary reagents &consumables for urine analyzer ,m/s roche diagnostic india pvt ltd , 1 urine analyzer strip compur 10 (roshe) (propriety items for urine analyser) , 2 tharmal paper roll 110 mm , 3 control test mcalibration strip , (17) proprietary reagents / consumablesfor fully automated esr analyzer model: test 1,make : alifax ,marketed by suyog diagnostics , 1 universal card for 10000 tests , 2 universal card for 4000 tests , 3 universal card for 20000 tests , 4 latex control kit 06 test (quality control kit) , 5 latex control kit 30 test (quality control kit) , 6 latex caliber kit 6 tests , 7 pump tube for esr analyzer , 8 capillary tubes , 9 sample aspiration needle , (18) proprietary reagents /consumablesforgel electrophoresismodel: sas 1 & sas2 make : helenabio sciences marketed by suyog diagnostics , 1 rep prep , 2 disposablesample cup , 3 sas – 1 applicators , 4 sas – sp 24 kit , 5 sas – 1ife 4 kit , 6 sas – 1 urine anal sis kit , 7 sas – 1 high res 12 kit , 8 sas – 1 alk phos kit , 9 sas – 1 alk hb kit , 10 sas – 1 acid hb kit , 11 sas – 1 lipo kit , 12 sas – 1 ld vis kit , 13 sas – 1 carbon electrode , 14 sas – 1 metal electrode , 14 sas – 1 sample tray , 15 sas – 1 ife antisera template , 16 sas – 1 gel block remover , 17 electrophoresis staining tray , 18 serum fixative , 19 sas supplementarydestain , 20 sas supplementarywash additive , 21 sas barcode set , 22 lipotrol control , 23 afsa2hemo control , 24 afsc hemo control , 25 kemtrol serum control normal kit , 26 kemtrol serum control abnormal kit , 27 immunofixation control , 28 alk phos control , 29 igg ief control , 30 igd antiserum , 31 ige antiserum , 32 urinetotal antiserum , 33 urine micro antiserum , 34 urine macro antiserum , 35 gam antiserum , 36 free ka a antiserum , 37 free lambda antiserum , 38 kappa antiserum , 39 lambda antiserum , 40 staining dish , 41 incubation chamber , 42 development weight , 43 hbs solubility screening kit , (19) proprietary reagents/ consumables for electronic blood cell counter 5part differential haematology analyzermake: horiba, model: yumizen h2500 , (1) abx basolyse , (2) abx cleaner , (3) abx diluent , (4) abx fluocyte , (5) abx lysebio , (6) abx monoclair , (7) abx minocal (calibrator) , (8)abx nucedif , (9) difftrol (control) normal , (10) difftrol (control)low , (11) difftrol (control) high , (12)minotrol retic(retic control) (2n) , (13) minotrol retic (retic control) (1l1h) , (20) proprietary reagents/ consumables for automated haematology slide stainer model: aerospray haematology pro, make elitech ,marketed by suyog diagnostics , (1) hematology buffer ph 6.8/7.2 , (2) hematology thiazin stain , (3) hematology eosin stain , (4) hematology aerofix additive for methanol , (21) proprietary reagents/ consumables forfully automated haematology analyzer model:elite 580, make: transasia , (1) elite h 580 diluent , (2) elite h 580 lyse 1 , (3) elite h 580 lyse 2 , (4) elite h 580 lyse 3 , (5)h clean , (6)calibrator , (7)control l , (8)control n , (9)control h , (10) pm kit for elite 580 , (22) proprietary reagents/ consumablesfor fully automated coagulation analyser, model acl elite pro, make –instrumentation laboratory, marketed by suyog diagnostics , (1)recombiplastin 2g 8ml (pttest) , (2)synthasil (aptt test ) with cacl2 , (3)fib c (2 ml ) fibrinogen , (4)thrombin time , (5)factor deficiennt viii , (6)factor deficient ix , (7)d dimer , (8)proclot (protein c) , (9)protein s activity , (10)liquid antithrombin acl elite family , (11)factor v leiden (apcr) , (12)drvvt screen , (12)drvvt confurm , (14)vwf antigen , (15)calibration plasma , (16)special level control 1 , (17)special level control2 , (18)normal control , (19)low abnormal control , (20)high abnormal control , (21)la positive control , (22)la negative control , (22)factor diluent , (24)clean a , (25)clean b , (26)wash r (elite) , (27)rotors (elite) , (28)sample cups , (29) d dimer control , (23) proprietary reagents/ consumables for urine chemistry / sediment microscopic analyser model labureader plus 2 & urised minimodel: 77 electronica hungary, marketed by suyog diagnostics , (1)urised cuvette , (2)labustrip u11 urine strips , (3)urinalysis controls 2 levels , (4)dip tube urinalysis + micro 2 levels , (5)urinalysis + micro normal , (6)urinalysis + micro abnormal , (24) proprietary reagents/ consumables for fully automated coagulation analyzer , model: sta compact max make stago , (1)sta neoptimal 5 , (2)sta neoptimal 10 , (3)sta neoptimal 20 , (4)sta c.k.prest 5 , (5) c.k.prest 2 , (6)c.k.prest 5 , (7)fibri prest automate 2 , (8)sta liquid fib , (9)sta fibrinogen 5 , (10)fibri prest automate 5 , (11)sta thrombin 2 , (12)sta reptilase , (13)sta thrombin 10 , (14)d di test , (15)sta liatest d di , (16)sta liatest d di plus , (17)coag control n+p , (18)sta d di control , (19)sta owren koller , (20)sta cacl2 0.025m , (21)sta cleaner solution , (22)sta desorb u , (23)sta cuvettes , (24)fintipps for st art 4 1.25ml , (25)sta steel balls , (26)sta cuvettes , (27)white stirrer magnet for pt(s 0091098) , (28)red stirrer magnet for aptt (s 0091124) , (29)connected pipette , (30)liquid cooling glycol , (31)lamp halogen , (32)maintainance kit compact , (33)yearly additional maintainance kit compact , (34)yearly maintainance kit compact , (35)red stirred magnet for (s 0091124) , (36)ball dispenser , (37)connected pipette , (38)needle arm n 3 with nut b , (39)syringe and o ring , (40)photometry box fan filter , (25) proprietary reagents/ consumables abg analyzer, model nova stat profile phox plus l,make nova biomedical,usa marketed by surgitech , soaking (polishing)solution , reference line: external beze 1 each phox s , sample probe : phox & phox b , po2 sensor, 1 each: phox s , ph sensor,1 each: phox s , pco2 sensor, 1each: phox s , po2 membrance cap kit, 6/bx:phox s , waste tubing harness: external bezel , phox s , so2% calibration ampules: (ampoules) , ph(na+) conditioning solution , po2 membrance cap kit, 3/bx:phox s , reagent pack; phox coox , reagent pack harness:phox coox , glucose sensor (1 each): phox s , na sensor, 1 each: phox+/c/l , potassium sensor phox+/c/l , chloride sensor phox+/c/l , ionized calcium sensor (1 each):phox s , pump harness assembly:phox coox , sample line assy: phox coox , reference sensor,1 each phox s , w/r pump complete tubing assy phox+/c/l/m (inconnector tbgs) , lactate membrane kit (3/pkg): phox s , lactate sensor (1 each); phox s , glucose membrane kit (3/pkg):phox+s , calibrator pack b: phox plus l , calibrtaor pack c; phox plus l , phox+econo, on board qc(tri level) , tri level external qc ampoules (phox plus) , probe: phox & phox plus , lactate membrane kit , pco2 membrane caps , po2 membrane caps , w/r pump complete tubing assy (basic; no connector tubings) lea , air detector , printer paper , (26)proprietary item for machine: ihc antigen, model : montage opus , make: diagnostic biosystem , tris edta retrieval buffer ph 9 (10x) , citrate buffer ph 6(10x) , immuno wash buffer (10x) , hematoxylin kit , dp 3 1 step (10x)de paraffinization solution , proprietary item for machine : karyotyping & fish cytogenetic workstation make: metasystem, model:ikaros , cll panel , xl cll probe kit , xl 6q21/6q23/6cen , xl mdm2 , myelomapanel , xl cdkn2c/cks1b , xl dleu/lamp/12cen , xl igh ba , xl 5p15/9q22/15q22 , xl atm/tp53 , nmyc , tissue pretreatment kit , dapi + antifade , bladder cancer , xce 3/7/17 , xl cdkn2a , sarcoma panel , xl mdm2 , xl etv6 , xl ewsr1 ba , xl mycn amp , xl ddit3 ba , xl ss18 ba , xl foxo1 ba , xl fus ba , glioma , xl 1p36/1q25 del , xl 19p/19q del , xl mycn amp , aml panel , xl t(15;17) df , xl t(8;21) plus , xl mecom 3q26 , or , xl t(3;3) gata2/mecom df , xl tp53/nf1 , xl rara ba , cml panel , xl iso(17q) , or , xl tp53/nf1 , or , xl tp53/17cen , xl tet2 , mm relex fish panel , xl t(4;14) fgfr3/igh df , xl t(6;14) ccnd3/igh df , xl t(11;14) myeov/igh df , xl t(14;16) igh/maf df , xl t(14;20) igh/mafb df , mpn panel , xl fgfr1 , xl 4q12 , xl 5q32 pdgfrb ba , xl bcr/abl1 plus , xl jak2 , prenatal , xa aneuscore ii (xa 13/18/21 + xa x/y) , xa aneuscore (xa 13/21 + xa x/y/18) , all panel , xl bcr/abl1 plus , xl t(12;21) etv6/runx1 df , xl mll plus , xl abl2 ba , mds panel , xl 5q31/5q33/5p15 , xl del(7)(q22q31) , xl del(20q) plus , or , xl 20q12/20qter/8cen plus , cen 8 (if xl del(20q) is used) , lung cancer , xl alk ba , xl ros1 gopc ba , xl egfr amp , e blood collection tubes & vacutainer , clot activator for serum vaccum tube with gel 3.5 ml, 13 x 75mm with yellow cap , clot activator for serum with gel 5 ml, 13 x 100 mm with yellow cap , evacuated blood collection tube with spray dried k2edta with lavender cap , sodium citrate evacuated tube with tube in tube technology sealed from the top to avoid citrate leakage for coagulation test with vacuum (with na citrate 0.109 mi 3.2%) , evacuated tube for silica clot activator/silicon coated made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol.4.0 ml. , blood collection needle 21 or 22 gauge with cap for evacuated tube. , blood collection needle 21 or 22 gauge with cap and safety lock for evacuated tube. , evacuated tube for spray coated with sodium fluoride (3mg.), na2edta (6mg.) made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 2.0 ml. , evacuated tube needle holder , blood lancet for high blood flow. , complete blood collection kit , paediatric collection products , clot activator paediatric blood collection tubes with cap for serum , paediatric blood collection tubes with spray dried k2 edta. , safety lok blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle for paediatric and microbiology. 21g x 0.75 inch needle x 12 inch tubing. , urine sampling products , kit for routine urinalysis , urine kit for culture & amp , other items / miscellaneous items/plasticwares make accumax(p’fact), axiva,starlab,eppendrof , adhesive tape/ micropore , aluminum test tube rack (12 hole) , anti human globulin (coomb’s test) , auto pipette tips 1 ml fix , auto pipette tips 10 ?l , auto pipette tips 100 ?l , auto pipette tips 100 1000 ?l , auto pipette tips 2 ml fix , auto pipette tips 5 ml fix , auto pipette tips 10 ml fix , auto pipette tips 200 1000 ?l variable , auto pipette tips 20 200 ?lvariable , auto pipette tips 50 ?l , bone marrow aspiration needle (jamshidi) , bone marrow aspiration needle(salah’s)ss , bone marrow aspiration needle (disposable) , lumber puncture needle (disposable) , bovine albumin 4% higher titer will be preferred , diamond pencil export quality , disposable needle 22 g , disposable needle 24 g , disposable latex rubber gloves 6.5” , disposable surgical blade/ scalpel blade (22 no) , disposable surgical gloves latex rubber 6.5” , disposable surgical gloves latex rubber 7.0” , disposable surgical gloves latex rubber 7.5” , disposable syringes2 ml , disposable syringes5 ml , disposable syringes 10 ml , disposable syringes 20 ml , disposable needle 22 g , disposable needle 24 g , esr kits. 10 tubes with cups and stand , filter papers (whatman) no 1 , glass marking pencil red , glass marking pencil white , l.p.needle 22g x 2.5 inch , l.p.needle 22g x 2.5 inch , spirit lamp (ss) , litmus paper (indicator paper red ) , litmus paper (indicator paper blue) , micro pipette 1000 ?l , micro pipette40 200 ?l variable , micropipette 20?l fix , micropipette 50?lfix , micropipette 10?l fix , micropipette 100?lfix , micropipette 5ml fix , micropipette 1ml fix , micropipette 2ml fix , improved neubauer chamber , plastic bucket 50 lit with lid , reagent rack plastic , polythene bagsyellow, blue, black for bmw , pregnancy test (hcg card test) , stethoscopes , sticker for cytology size (2 x 1.5 cm) , stop watch , syringe cutter / needle destroyer isi mark , tournicates , tissue paper roll , lens cleaning tissue paper ( kimwipes) , urine container (plastic) non sterile 50 ml , urine strip for albumin & sugar , urine strip for pregnancy test , urine strip for ketone bodies & sugar , urine strip for micro albinuria (micral strips) , urine strip for multiple test (7 parameter) , urine strip for occult blood , vacutainertubes 5 ml (blood collection vial edta) , wooden spatula pap smear (ayre) , cyto brush for pap smear , thermal paper roll 75 mm , thermal paper roll 110 mm , bone marrow patient entry register , urine reporting form , cytology reporting form(fnac) , cytology entry register (fnac) , cytology fluid entry register , cytology entry register (pap’s) , cytology reporting form(pap’s) , urine test entry register , fnac sticker , hematology entry register , hematology cbc reporting form , reporting form csf , hematology reporting form stool , reporting form bone marrow , histopathology entry register , histopathology reporting form , histopathology requisition form , histopathology slide sticker , outdoor patient entry register , hand wash soap , washing powder , ream/zerox paper , duster clothe , nitrile gloves powder free length 9.5 inch, s, m, l , nitrile gloves powder free length 12.0 inch, s, m, l , (g.) list of glassware , micro glass slides, polished edges, lint free (transparent) size 75x25x1.25mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 75x25x1.0 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.25 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.0 mm 50 slides in each pkts , cover slip english glass/imported lint free smooth edges (transparent) size 22x50 no. 1 , cover slip english glass/ imported lint free smooth edges (transparent) size 22x50 no. 0 , cover slip english glass/imported lint free (transparent) size 22x22 no. 1 , cover slip english glass/imported lint free (transparent) size 22x22 no. 0 , cover slip english glass/imported lint free (transparent) size 18x18 no. 1 , cover slip english glass/imported lint free (transparent) size 18x18 no. 0 , high profile microtome disposable blade (50 blade each pkt.) , low profile microtome disposable blade (50 blade each pkt.) , rubber teat for dropper , dropper big size (glass) , dropper medium size (glass) , capillary tubes (micro) , test tube brush , beaker with spout 1000 ml , beaker with spout 500 ml , beaker with spout 50 ml , conical flask flat bottom500 ml , measuring cylinder graduated 1000 ml , measuring cylinder graduated 500 ml , measuring cylinder graduated 100 ml , funnel (big) , funnel (medium) , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x10x20cm , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x12x20cm , reagent bottle 2000 ml , reagent bottle 60 ml , reagent bottle 120 ml , reagent bottle 250 ml , reagent bottle 500 ml , reagent bottle 1000 ml , canada blossom bottle 20 ml , couplin jar , wash bottle plastic 500 ml , urino meter , esbach’s albunometer , hb tube round top/gdr,isi mark (sahli,s) , hb pipette 20? top isi mark with rubber teat (sahli) , pertidish 110 mm(glass) , rbc pipette top/gdr isi mark , wbc pipette top/gdr isi mark , stirrer for h.b.meter (sahli) , test tubes 12x75 mm(glass) , test tubes 12x100 mm (glass) , test tubes 18x150 x1.2mm with rim (glass) , bulb for microscopes halogen (6v 12 w) make; philips, labomed , h. other items with specifications , hemocytometer improved, , haemoglobbino meter ( sahali method) , slide box (plastic) 50 slides capacity . , slide box (plastic) 100 slides capacity. , slide tray (aluminium)....

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33896694 supply of various laboratory items of m.m.n.n.j.y it paraffin wax 60 62% with ceresin absolute akohol ( ethanol 3 distilled water 4 xylene 5 sidit 6 cotton roll ( item related to schedule 1 as per rtpp rules 2013. priority will be given to msme sector hence enclose msme certificate i 7 micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass } b chloral hydrate 9 among solution 10 formaldehyde solution 40% 11 white adhesive tape u mfaotorne disposable blade high profile. 13 filter pape round 100x1 pkt 14 cassettes 3 crn.x1.5cm. ( plastic ) —yellow 15 cassettes 3 cm.3c2.5cnt. ( plastic ) —white 16 lain gloves sterilized 6.5p.0 / 75 no. 17 latex gloves unsterilized 6.5 / 7.0 / 7.5 no. i 18 dextrose 19 albumin powder 20 leishman stain 21 sulphur powder 22 sodium acetate 23 potassium ) acetate 24 potassium nitrate 25 benedlcts solution 26 acetone 27 dpx solution 28 cover slip libc18 0.1 man english glass 29 cover slip 22x22 0.1 mm english glass 30 cover slip 22360 0.1 mm english glass 31 glycerine 32 di— ionized water 33 schlffs reagent 34 bees wax 35 cea ( primary antibodies ) 36 gfap ( primary antibodies ) 37 hmb 4s ( primary antibodies ) 38 death ( primary antibodies ) 39 ema ( primary antibodies ) 40 bc12 temary setitakein4 41 hmwck ( primary antibodies ) 42 ck7 ( primary antibodies ) 43 er ( pnrnary antibodies ) 44 cd30 ( primary antibodies ) 45 cds ( primary antibodies ) 46 co23 ( primary antibodies ) 47 ck20 ( pdmary antibodies ) 48 1367 ( primary antibodies ) 49 cd10 ( primary antibodies ) 50 synaptoplvysin ( primary antibodies ) si pr ( primary antibodies ) 52 mpo ( primary antibodies ) 53 pax•5 ( primary antibodies ) 54 cd3 ( primary antibodies ) 55 vit1 ( primary antibodies ) 56 swo ( primary antibodies ) 57 aeuae3 ( muld ck ) ( primary antibodies ) 58 sma ( primary antibodies ) s9 inhibit ( primary antibodies ) 60 hpv ( primary antibodies ) 61 pi4 peran rams* 62 eber ( primary antbodes ) 63 oript avvin rebtedhes ) 64 cod ( primary antibodies ) 65 arnyioid ( primary antibodies ) 66 her 2— neu ( primary antibodies ) 67 vimentin ( primary antibodies ) 68 chromcieamin ( primary antibodies ) 60 antigens retrial buffer diva deciosket mr ( for manual ihc staining ) 70 background snapper ( for manual inc staining ) 71 wash buffer tbs autowash buffer 40x ( for manual ihc staining ) 72 imp polymer detection kit ( for manual ihc staining ) 73 pohtlysine coated slides ( for manual inc staining ) 74 peroxidaxed block 1 ( for manual ihc stain:mg ) 75 beuzold dab chtornogen ( for manual ihc staining ) 76 betazold dab substrate buffer ( for manual ihc staining ) 77 cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) sway! disinfectandfor cryostate ) i churls for cryostat microtome by thermofisher ( for cryostate ) microtorne blades ( high definition ) l cell pack dcl rd / sulfolyser 1....

Medical College - Rajasthan

27304647 supply of equipments clinical pharmacy. 20 deep freezer, automated blood culture system, bio safety cabinet, microbiology charts, lab freezer, elisa reader and washer, bod incubator, laminar flow, hot air oven and incubator, environment decontamination system, non referigerated misc. equipment, binocular microscope, fully automatic cryostat, pathology instrument, grossing station, pentahead microscope, tissue processor, waste water treatment unit, autopsy saw, downdraft elevating pedstal autopsy table, l shaped autopsy table, forensic instrument, ultraviolet spectroscope, pharmacology charts, pharmacology computer assisted module, equipment clinical pharmacy, equipments manniquin...

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Dr. S.N.Medical College - Rajasthan

26654824 supply of reagents and chemicals for pathology 1 disposable syringes 5 ml x 2 disposable syringes 10 ml x 3 disposable syringes 20 ml x 4 disposable syringes 2 ml x 5 disposable vacutainer needles 24 gauge 6 disposable needles 22 gauge 7 urine container plastic with lid 30 ml 8 rubber tourniquate 9 urine strip 10 urine strip 4 parameter 11 multi parameter urine strips 12 stool occult blood kit 13 giemsa stain powder 14 methanol ch3 oh = 32.04 purity 15 distilled water 16 micro capillary tube (90mm length) 17 cover slip 1. 22 mm 18 cover slip 2. 22 x50 mm 19 cover slip 3. 22 x 22 mm 20 glass test tube 12 x 100 mm 21 pregnancy card 22 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 23 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 24 reticulocite fluid – brilliant cresyle blue 25 diamond pencill 26 micropipettes (50 mm) 27 micropipettes (100mm) 28 sodium hypochlorite 29 esr pipette disposable 30 dpx meuntant 31 spirit 32 rapid pap kit 33 iron stand for staining 34 slide tray (horizontal) 35 slide tray (vertical) 36 coplin jars 37 graduated cylinder small 200 ml 38 graduated cylinder large 500 ml 39 sample transport racks ( big plastic ) 40 sterile lancets for blood grouping 41 sharps containers with lid and lock 42 plastic funnel 10 cm diameter 43 hematoxylin stain powder 44 eosin powder 45 modified neubaur’s chamber 46 zn stain kit 47 bulbs halogen for microscope 6v 20 watts 48 filter paper full size nohi 49 formalin tablets 50 disposable bone marrow aspiration needle 18 gauge 51 disposable bone marrow aspiration needle 20 gauge 52 disposable spinal needle 22 gauge 53 betadin 54 eye towel 55 xylene 56 slide box plastic 57 slide box wooden 58 absolute alcohol 59 methyl alcohol 60 dustbin 61 coplin jar (glass) 62 3 amino propyl triethoxysilane 63 acetone 64 albumin egg flaskes 65 alcian blue 66 ammonium sulphate 67 bees wax 68 benedict solution ( reagent ) 69 brilliant cresyl blue stain powder 70 cassettes s.s.3cmx2.5cm 71 cd 45 kit (6ml) 72 chloroform 73 ck cocktail kit (6ml) 74 combistix 75 copper sulphate powder 76 dextrose anhydrous 77 diamino benzidine (dab) 78 disodium hydrogen phosphate (na2hpo4) 79 disposable plastic test tube 75x12 ml 80 disposable vial – 5ml 81 drabkin solution with hemoglobin standard 82 dropper plastic – 3ml 83 eosinophil diluting fluid 84 er diagnostic kit (6ml) 85 ferric ammonium sulphate 86 field stain a & b 87 fluoride vial for blood sugar 88 formaldehyde 37 40% 89 formic acid 90 french chalk powder 91 giemsa stain solution 92 glacial acetic acid 93 glass cover slip 18x18mm 94 glass pipette 20cm long 95 halogen bulb for mp qbc machine 96 hb a/c kit 97 glycerin a.r. 98 hemocytometer 99 her 2/niu kit (6ml) ( 6 ml x 4) 100 hydrochloric acid hct n/10 101 hydrogen peroxide (liquid 30%) 102 ketostix 103 knife sharpner powder 2000 micro abrasive powder 104 knife sharpner powder 3000 micro abrasive powder 105 lead oxide powder 106 leishmain stain powder 107 leishmain stain (liquid) solution 108 liquid ammonia 109 liquid paraffin 110 mal mal cloth 111 measuring cylinder 100 ml glass 112 measuring cylinder 250 ml 113 mercuric oxide 114 methyline blue solution 115 micropipette, auto pipette (a) 10 fix volume 116 micropipette, auto pipette (a) 100 fireed 10% 117 micropipette, auto pipette (a) 1000 fireed 10% 118 micropipette, auto pipette (a) 50 fireed volume 119 micropipette, auto pipette (multichannel) variable 50 300 micro ltr channel 8 or 12 120 micro slides 75x25x1.25 to 1.5 mm (glass) 121 microtome knife 120 mm 122 microtome knife 150 mm 123 micro ambrary 3000 micro gm 124 mp qbc oil 125 multistix 126 museum specimen glass jar with glass lid (7x3.5x5) 127 museum specimen glass jar with glass lid (6x3x10”) 128 museum specimen glass jar with glass lid (4x2x8”) 129 museum specimen glass jar with glass lid (6x4x10.5”) 130 museum specimen glass jar with glass lid (7.5x3.5x12”) 131 oil 3 : 1 132 paraffin wax 60 62’ with ceresin 133 pasteur pipette 134 picric acid 135 phenyl solution 136 pipettes for hemoglobin 20 micro ltr. 137 plain vial 5ml 138 plain vial screw cap 3 ml with sticker 139 plastic beaker 100 ml 140 plastic casettes 141 plastic beaker 200 ml 142 plastic cuvettes with stirrer for coagulation analyzer model coastat 1 fibran 20 143 plastic cuvettes with stirrer for coagulation analyzer model fibran 20 144 plastic test tube screw cap with sticker 145 platelet diluting fluid 146 poly – l – lysine 147 polymer hrp kit 148 potassium alum 149 potassium ferrocyanide 150 pr diagnostic kit (6ml) 151 prussian blue stain 152 rbc diluting fluid 153 rbc pipettes 154 schiff’s reagent 155 semen diluting fluid 156 silver nitrate 157 sodium nitrate 158 sodium chloride 159 sodium citrate powder 160 sodium citrate 3.8% 161 blood collection vacutech with 1.8 ml marking for coagulation analyser 162 sodium nitroprusside 163 sodium thiosulphate 164 spirit lamp aluminium 165 staining jar (glass) 13x11x7 cm 166 staining jars 100ml & 500 ml 167 sulphur powder / sulphur precipitate 168 sulphuric acid 169 test tube brushes for cleaning tubes small 170 test tube brushes for cleaning tubes large 171 test tube graduated conical 15 ml 172 thermal printer paper 173 thermometer 174 thymol 175 tips blue (1000) for micropipette 176 urea 177 wbc diluting fluid 178 wbc pipette 179 cell clean/ equivalent 50 ml for sysmex xs 800i 180 antiseptic solution 181 coated slides 182 filter paper round 183 formaline 184 glass test tubes 4” 185 hematoxylene powder 186 metallic slide holders 187 micropipette 10 200ml 188 micropipette 100 1000ml 189 micropipette variable 50 micro ltr to 200 190 tincture iodine 191 vacutte holder with vacutte needles size/ g4920 192 pas staining kit 193 muci carmine staining kit 194 msn staining kit 195 perls staining kit 196 mts staining kits 197 three one oil 198 boxes for block 16 ½ x 10 ½ x 2 ½ 199 white cloth 200 antiseptic solution 201 ammonia solution 202 wbc diluting fluid for tlc 203 trbc fluid 204 test tube holder 205 test tube 10ml 206 match box 207 adhesive tape 208 spirit rectified 209 peroxide acid 210 cea 211 gfap 212 hmb45 213 desmin 214 ema 215 bcl2 216 hmwck 217 ck7 218 er 219 cd 13 220 cd 5 221 cd 23 222 ck 20 223 ki 67 224 cd 10 225 synaptophysin 226 pr 227 mpo 228 pax 5 229 cd 3 230 wt 1 231 s 100 232 ae 1/ae3 233 sma 234 inhibin 235 hpv 236 p16 237 eber 238 lmp 1 239 c4d 240 amyloid 241 her2 neu 242 vimentin 243 chromogranin for manual ihc staining 244 antigen retrieval buffer diva decloaker 20x 245 background snipper 246 wash buffer tbs autowash buffer 40x 247 mach2 hrp polymer detection kit 248 polylysine coated slides 249 peroxidated block 1 250 betazoid dab chromogen 251 betazoid dab substrate buffer for cytocentrifuge 252 filter card for cytology (funnel reusable) 253 cell slides single circle coated 254 cell slides single circle uncoated 255 double cytology funnel (reusable) 256 ck 20 257 ttf 1 258 pax 8 259 cd 31 260 cd 34 261 cd 99 262 cd 57 263 fli 1 264 cd 15 265 cd 22 266 cd 30 267 cd 57 268 cd 5 269 cd 7 270 cd 79 a 271 cd 163 272 cd 68 273 cd 56 274 nsf 275 ca 125 276 ck 7 277 cdx 2 278 kappa 279 lambda 280 cell clip for cell clipotor 281 single cytology funnel (for cryostat) 282 cryomatrix (optimal cooling tool gel coolant) 283 sarasil disinfectant 284 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 285 lyser cell(wnr) 286 fluorocell (ret) 287 fluorcell plt (plt) 288 basic fucshin 289 sodium metabisulfite 290 acetic acid solution 3 % 291 nuclear fast red 292 carmine 293 ferric chloride 294 metanil yellow 295 acid fucshine 296 phospho molybdic acid 297 methyl blue 298 iodine 299 potassium permanganate 300 potassium metabisulfite 301 iron alum 302 gold chloride 303 oxalic acid 304 aquous phenol 305 toluedene blue 306 silver nitrate 307 safferenine o 308 potassium alum 309 cryomatrix gel 310 tissue freezing chacks 311 mix preniere microtome blades 312 letheium corborate 313 sodium acetate ...

Medical College - Rajasthan

25798234 supply of chemical test kits, raegent, media, glass ware items for pathology absolute alcohol /ethanol absolute ar, acetic acid glacial ar, acetone ar, acid fuchsin m.s/ certified, agar agar powder, albumin egg flakes, alcian blue m.s/ certified, amido black stain, aluminum sulphate ar, aluminum chloride, alkaline haematin d regent with haemoglobin standard 9.0 g/dl, alkaline haematin d regent with haemoglobin standard &15.0 g/dl, ammonia solution 30%, ammonium oxalate ar, ammonium potassium sulphate (alum), ammonium sulphate ar, aniline blue m.s/ certified, anti microbial hand rub, anti sera a, anit sera b and anti sera d one set of blood group antiseras containing each of 10ml. all antisera must be monoclonal must be able to deduct weakerblood groups , avidity nust be less than 5 second, barium chloride ar, basic fuchsin m.s/ certified, agar agar bacto, bees wax, white, benedict’s reagents qualitative lr, benzidine powder, benzidine powder dihydrochloride, biebrich scarlet m.s certified, bouin’s fluid fixing solution, brilliant cresyl blue m.s/ certified, bromophenol blue, boric acid ar, borate buffer ph 9.0, borax powder ep, buffer tablets 6.2 ph, buffer tablets 7.0 ph, buffer tablets 9.2 ph, calcium chloride ar, congo red m.s/ certified, carbol fuchsin dilute, carbol fuchsin strong, carmine m.s./certified, cedar wood oil, charcoal activated ar, citric acid ar, crystal violet m.s/ certified, csf diluting fluid, dextrose ndhydrous /d glucose, d.p.x. mountant, darbkin’s solution, deionised water, distilled water, di sodium hydrogen ortho phosphate, diastage, emry powder no 2, emry powder no 3, eosin water soluble, eosinophil counting fluid, esbach’s reagent, ehrlich’s reagents solution, ethylene diamine tetra acitic acid (edta), fast green ms, ferric ammonium sulphate, fetal hb kits, formal dehyde (37 41%) w/var, fouchet’s reagents, field stain a sol’n, field stain b sol’n, gram’s iodine ms, g6pd reagent kit (qualitative), giemsa stain powder m.s/certified, glycerol ar, gold chloride m.s, hematoxylin powder ms/certified, hematoxylin may’s soln ms, haemoglobin standard, hydrochloric acid (concentrated), hydrogen peroxide (6%), iodine powder, iso propyl alcohol ar, kaolin light ep, labogent/labklin (glass cleaning solution ), leishman’s stain solution m.s, leishman’s stain powder m.s/ certified, light green m.s/ certified, liquid paraffin oil heavy, liquid paraffin oil light, lithium carbonate ar, lugol’s iodine, mercuric oxide red purified, metanil yellow m.s/ certified, methanol ep (acetone free), methyl violet m.s/ certified, methyline blue m.s/ certified, neutral red m.s/ certified, n/10 hcl, nitric acid ar, normal saline 0.9%, paraffin wax with ceresin, in block form (600 620), paraffin wax with ceresin, in block form (580 600), peanut oil, periodic acid m.s/ certified, phenol crystal, phosphomolibidic acid, phosphotungestic acid ar, picric acid (saturated), platelet count fluid, phloxin –b m.s/ certified, phenyle, potassium dichromate, potassium ferrocynide, potassium hydroxide pellets, potassium iodine ar, potassium metabisulphite ar, potassium permangnate purified, ponceau’s stain, rapid pap’s kit, rbc counting fluid, reticulocyte count fluid, semen diluting fluid, silver nitrate ep, sodium acetate ep(anhydrous), sodium chloride ep, sodium citrate 3.8%, sodium carbonate, sodium dihydrogen ortho phosphate, sodium hypo chlorite solution 4%, sodium hydrogen phosphate ar, sodium di hydrogen phosphate ar, sodium nitrate ar, sodium nitropruside, sodium sulphate ar, sodium thiosulphate, sudan black, spirit, sulphosalicylic acid, sulphur powder, sulphuric acid pure, thymol crystal, toludine blue m.s/ certified, tris buffer phosphate, tri sodium citrate, wbc counting fluid, xylene ar, alk 1(monoclonal mouse anti human cd246, clone), alk 1(monoclonal mouse anti human cd246, clone), alk 1(monoclonal mouse anti human cd246, clone), alpha feto protein (afp) (polyclonal rabbit anti human ), alpha feto protein (afp) (polyclonal rabbit anti human ), alpha feto protein (afp) (polyclonal rabbit anti human ), amacr (monoclonal mouse anti human clone 13h4), amacr (monoclonal mouse anti human clone 13h4), amacr (monoclonal mouse anti human clone 13h4), amyloid a (monoclonal mouse anti human amyloid clone mc1), amyloid a (monoclonal mouse anti human amyloid clone mc1), amyloid a (monoclonal mouse anti human amyloid clone mc1), b 72 . 3, b 72 . 3, b 72 . 3, bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p), bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p), bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p), bcl 2, bcl 2, bcl 2, ber ep4 (monoclonal mouse anti human epithelial antigen, clone), ber ep4 (monoclonal mouse anti human epithelial antigen, clone), ber ep4 (monoclonal mouse anti human epithelial antigen, clone), beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1), beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1), beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1), bob 1, bob 1, bob 1, brachyury, brachyury, brachyury, calcitonin (polyclonal rabbit anti human calcitonin), calcitonin (polyclonal rabbit anti human calcitonin), calcitonin (polyclonal rabbit anti human calcitonin), caldesmon (monoclonal mouse anti –human caldesmon clone h cd), caldesmon (monoclonal mouse anti –human caldesmon clone h cd), caldesmon (monoclonal mouse anti –human caldesmon clone h cd), calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1), calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1), calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1), cam 5.2, cam 5.2, cam 5.2, cd 1a (monoclonal mouse anti –humancd1a,clone 010), cd 1a (monoclonal mouse anti –humancd1a,clone 010), cd 1a (monoclonal mouse anti –humancd1a,clone 010), cd 2 (monoclonal mouse anti –human cd2,clone ab75), cd 2 (monoclonal mouse anti –human cd2,clone ab75), cd 2 (monoclonal mouse anti –human cd2,clone ab75), cd 3 (monoclonal mouse anti –human), cd 3 (monoclonal mouse anti –human), cd 3 (monoclonal mouse anti –human), cd 5 (monoclonal mouse anti –humancd4,clone 4b12), cd 5 (monoclonal mouse anti –humancd4,clone 4b12), cd 5 (monoclonal mouse anti –humancd4,clone 4b12), cd 7 (monoclonal mouse anti –human cd5,clone 4c7), cd 7 (monoclonal mouse anti –human cd5,clone 4c7), cd 7 (monoclonal mouse anti –human cd5,clone 4c7), cd 8 (monoclonal mouse anti –human cd8,clone c8/144b), cd 8 (monoclonal mouse anti –human cd8,clone c8/144b), cd 8 (monoclonal mouse anti –human cd8,clone c8/144b), cd 10 (monoclonal mouse anti –human cd10,clone 56c6), cd 10 (monoclonal mouse anti –human cd10,clone 56c6), cd 10 (monoclonal mouse anti –human cd10,clone 56c6), cd11c, cd11c, cd11c, cd14, cd14, cd14, cd15 (monoclonal mouse anti –human cd15,clone carb 3), cd15 (monoclonal mouse anti –human cd15,clone carb 3), cd15 (monoclonal mouse anti –human cd15,clone carb 3), cd 20 (monoclonal mouse anti –human cd21,clone l26), cd 20 (monoclonal mouse anti –human cd21,clone l26), cd 20 (monoclonal mouse anti –human cd21,clone l26), cd 21 (monoclonal mouse anti –human cd15,clone 1f8), cd 21 (monoclonal mouse anti –human cd15,clone 1f8), cd 21 (monoclonal mouse anti –human cd15,clone 1f8), cd 23 (monoclonal mouse anti –human cd23,clone dak cd23), cd 23 (monoclonal mouse anti –human cd23,clone dak cd23), cd 23 (monoclonal mouse anti –human cd23,clone dak cd23), cd 30 (monoclonal mouse anti –human cd30,clone ber h2), cd 30 (monoclonal mouse anti –human cd30,clone ber h2), cd 30 (monoclonal mouse anti –human cd30,clone ber h2), cd 31 (monoclonal mouse anti –human cd31,endothelial cell jc70a), cd 31 (monoclonal mouse anti –human cd31,endothelial cell jc70a), cd 31 (monoclonal mouse anti –human cd31,endothelial cell jc70a), cd 33, cd 33, cd 33, cd 34 (monoclonal mouse anti –human cd34, classii clone qbend 10), cd 34 (monoclonal mouse anti –human cd34, classii clone qbend 10), cd 34 (monoclonal mouse anti –human cd34, classii clone qbend 10), cd 35 (monoclonal mouse anti –human cd35, ), cd 35 (monoclonal mouse anti –human cd35, ), cd 35 (monoclonal mouse anti –human cd35, ), cd 41, cd 41, cd 41, cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26), cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26), cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26), cd 56 (monoclonal mouse anti –human cd56,clone 123c3), cd 56 (monoclonal mouse anti –human cd56,clone 123c3), cd 56 (monoclonal mouse anti –human cd56,clone 123c3), cd 57 (monoclonal mouse anti –human cd57,clone tb01), cd 57 (monoclonal mouse anti –human cd57,clone tb01), cd 57 (monoclonal mouse anti –human cd57,clone tb01), cd 61, cd 61, cd 61, cd 68 (monoclonal mouse anti –human cd68,clone pgm1), cd 68 (monoclonal mouse anti –human cd68,clone pgm1), cd 68 (monoclonal mouse anti –human cd68,clone pgm1), cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117), cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117), cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117), cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7), cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7), cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7), cd 103, cd 103, cd 103, cd 117 (c kit) (polyclonal rabbit cd117), cd 117 (c kit) (polyclonal rabbit cd117), cd 117 (c kit) (polyclonal rabbit cd117), cd 138 (monoclonal mouse anti –human cd138 clone mi15), cd 138 (monoclonal mouse anti –human cd138 clone mi15), cd 138 (monoclonal mouse anti –human cd138 clone mi15), cdx 2 (monoclonal mouse anti –human cdx 2, clone dak cdx 2), cdx 2 (monoclonal mouse anti –human cdx 2, clone dak cdx 2), cdx 2 (monoclonal mouse anti –human cdx 2, clone dak cdx 2), cea (monoclonal mouse anti –human carcinoembryonic antigen,clone ii 7), cea (monoclonal mouse anti –human carcinoembryonic antigen,clone ii 7), cea (monoclonal mouse anti –human carcinoembryonic antigen,clone ii 7), chromogranin, chromogranin, chromogranin, ck 5/6 (monoclonal mouse anti –human cytokeratin 5/6,clone d 5/16 b4), ck 5/6 (monoclonal mouse anti –human cytokeratin 5/6,clone d 5/16 b4), ck 5/6 (monoclonal mouse anti –human cytokeratin 5/6,clone d 5/16 b4), ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/30), ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/30), ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/30), ck 19 (monoclonal mouse anti –human cytokeratin 19,rck 108), ck 19 (monoclonal mouse anti –human cytokeratin 19,rck 108), ck 19 (monoclonal mouse anti –human cytokeratin 19,rck 108), ck 20 (monoclonal mouse anti –human cytokeratin 20,clone ks20.8), ck 20 (monoclonal mouse anti –human cytokeratin 20,clone ks20.8), ck 20 (monoclonal mouse anti –human cytokeratin 20,clone ks20.8), ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3), ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3), ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3), cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12), cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12), cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12), desmin (monoclonal mouse anti –human desmin,clone d33), desmin (monoclonal mouse anti –human desmin,clone d33), desmin (monoclonal mouse anti –human desmin,clone d33), dog 1, dog 1, dog 1, e cadherin (monoclonal mouse anti –human e cadherin,clone nch 3), e cadherin (monoclonal mouse anti –human e cadherin,clone nch 3), e cadherin (monoclonal mouse anti –human e cadherin,clone nch 3), egfr, egfr, egfr, ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29), ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29), ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29), estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor ,clone ep1), estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor ,clone ep1), estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor ,clone ep1), factor viii (vwf), factor viii (vwf), factor viii (vwf), fl i – 1, fl i – 1, fl i – 1, galectin 3, galectin 3, galectin 3, gfap (polyclonal rabbit gfap), gfap (polyclonal rabbit gfap), gfap (polyclonal rabbit gfap), hcg (polyclonal rabbit anti human chorinc gonadotropin), hcg (polyclonal rabbit anti human chorinc gonadotropin), hcg (polyclonal rabbit anti human chorinc gonadotropin), hcg beta, hcg beta, hcg beta, hepatitis b surface antigen, hepatitis b surface antigen, hepatitis b surface antigen, hepatocyte growth factor receptor, hepatocyte growth factor receptor, hepatocyte growth factor receptor, her 2 neu (polyclonal rabbit anti human cerb 2), her 2 neu (polyclonal rabbit anti human cerb 2), her 2 neu (polyclonal rabbit anti human cerb 2), hmb 45 (monoclonal mouse anti human melanosome clone hmb45), hmb 45 (monoclonal mouse anti human melanosome clone hmb45), hmb 45 (monoclonal mouse anti human melanosome clone hmb45), hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12), hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12), hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12), inhibin, inhibin, inhibin, inhibin – alpha, inhibin – alpha, inhibin – alpha, ini 1, ini 1, ini 1, kappa light chain (polyclonal rabbit anti human kappa light chains), kappa light chain (polyclonal rabbit anti human kappa light chains), kappa light chain (polyclonal rabbit anti human kappa light chains), ki 67 (ki 67 antigen clone mib 1), ki 67 (ki 67 antigen clone mib 1), ki 67 (ki 67 antigen clone mib 1), lambda light chain (polyclonal rabbit anti human lambda light chains.), lambda light chain (polyclonal rabbit anti human lambda light chains.), lambda light chain (polyclonal rabbit anti human lambda light chains.), mammaglobin (monoclonal mouse anti human mammaglobin clone304 1a5), mammaglobin (monoclonal mouse anti human mammaglobin clone304 1a5), mammaglobin (monoclonal mouse anti human mammaglobin clone304 1a5), mart 1, mart 1, mart 1, mast cell tryptase (monoclonal mouse anti human mast cell trytase clone aa1), mast cell tryptase (monoclonal mouse anti human mast cell trytase clone aa1), mast cell tryptase (monoclonal mouse anti human mast cell trytase clone aa1), melan a (monoclonal mouse anti human melan a clone a103), melan a (monoclonal mouse anti human melan a clone a103), melan a (monoclonal mouse anti human melan a clone a103), moc 31, moc 31, moc 31, mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase), mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase), mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase), muc 2, muc 2, muc 2, muc 5 ac, muc 5 ac, muc 5 ac, mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p, mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p, mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p, myo d1, myo d1, myo d1, myogenin (monoclonal mouse anti myogenin clone f5d), myogenin (monoclonal mouse anti myogenin clone f5d), myogenin (monoclonal mouse anti myogenin clone f5d), napsin –a, napsin –a, napsin –a, nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14), nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14), nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14), oct 3/4, oct 3/4, oct 3/4, p 53 (monoclonal mouse anti human p53 protein clone do 7), p 53 (monoclonal mouse anti human p53 protein clone do 7), p 53 (monoclonal mouse anti human p53 protein clone do 7), p 63, p 63, p 63, pap (prostatic acid phosphatase), pap (prostatic acid phosphatase), pap (prostatic acid phosphatase), parafibromin, parafibromin, parafibromin, pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5), pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5), pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5), p cadherin, p cadherin, p cadherin, plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9), plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9), plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9), progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 636), progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 636), progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 636), psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen), psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen), psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen), s 100 (polyclonal rabbit antis100), s 100 (polyclonal rabbit antis100), s 100 (polyclonal rabbit antis100), sma (mono clonal mouse anti human smooth muscle actin1a4), sma (mono clonal mouse anti human smooth muscle actin1a4), sma (mono clonal mouse anti human smooth muscle actin1a4), synaptophysin (monoclonal mouse antisynaptophysin sy38), synaptophysin (monoclonal mouse antisynaptophysin sy38), synaptophysin (monoclonal mouse antisynaptophysin sy38), tdt, tdt, tdt, thrombomodulin, thrombomodulin, thrombomodulin, thyroglobulin (polyclonal rabbit anti human thyroglobulin), thyroglobulin (polyclonal rabbit anti human thyroglobulin), thyroglobulin (polyclonal rabbit anti human thyroglobulin), tle 1, tle 1, tle 1, ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g3/1, ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g3/1, ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g3/1, uroplakin iii, uroplakin iii, uroplakin iii, vimentin (monoclonal mouse antivimentin v9)+b1115:b1128, vimentin (monoclonal mouse antivimentin v9)+b1115:b1128, vimentin (monoclonal mouse antivimentin v9)+b1115:b1128, wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2), wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2), wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2), polymer based detection kit (should contain peroxide block, protien block, post primary block, secondary antibody tagged wirt hrp, hemotoxicylin, dab substrate buffer & dab chromogen for 100 tests, adhesive for ihc/ poly l lysine (sigma), delimiting pen /novo pen/pap pen, dab chromogen, dab substrate buffer (100ml), antibody diluent (vidas rub igm), ihc coated slides, epitope retrieval buffer ( ph. 6.0), epitope retrieval buffer (ph. 9.0), c antibody for immunofluorescence microscopy, albumin, polyclonal fitc ready to use for immunofluorescence rabbit anti albumin conjugated to fluorescein isothiocyanate., c1q complement, polyclonal fitc ready to use for immunofluorescence rabbit anti c1q complement conjugated to fluorescein isothiocyanate, c3c complement, polyclonal fitc ready to use for immunofluorescence sheep anti c3c complement conjugated to fluorescein isothiocyanate, fibrinogen, polyclonal fitc ready to use for immunofluorescence rabbit anti fibrinogen conjugated to fluorescein isothiocyanate, immunoglobulin a (iga), polyclonal fitc ready to use for immunofluorescence sheep anti iga conjugated to fluorescein isothiocyanate, immunoglobulin g (igg), polyclonal fitc ready to use for immunofluorescence sheep anti igg conjugated to fluorescein isothiocyanate, immunoglobulin m (igm), polyclonal fitc ready to use for immunofluorescence rabbit anti igm conjugated to fluorescein isothiocyanate, kappa, polyclonal fitc ready to use for immunofluorescence rabbit anti kappa conjugated to fluorescein isothiocyanate, lambda, polyclonal fitc ready to use for immunofluorescence rabbit anti lamda conjugated to fluorescein isothiocyanate, moun/t staining reagent, blocking reagent, d reagents and other items reagents for coagulation tests note: bidder should be submit authorization, proprietarycertificate and manufacturer rate list., coagulation analyser diagnostica stago ( st art 4), (1)cal.thromboplastin/neoplastine with solvent (sta neoptimal 5), (2)pt neoplastin (sta neoptimal 10), (3)aptt activated partial thromoplastin (c.k.prest 2), (4) fib.2 fibrinogen (sta fibrinogen 5), (5) calcium cloride (sta cacl2 0.025 m, other items for coagulometer (1)cuvette (sta cuvettes), (2)fintips for start 4 1.25 ml, (3) steel bals (sta steel bals, (4)thermal paper size 50 mm, items reagents & consumables for coagulation tests sysmex model: ca 50, (1) actim, (2) erba protime ls, (3) erba actime, (4) reaction tubes su 40, (5) erba factor vii deficient plasma, (6) erba factor x deficient plasma, (7) erba factor ix deficient plasma, (8) erba factor viii deficient plasma, (9) thermal printer paper (printer paper roll kit), (10)erba calcium chloride, (11) erba control p, (12) erba control n, (13) erba control n plus, (14) erba control p plus, (15) control plasma n, reagents & consumables for fully automated esr analyzer model: vasmatic cube 80, (1) vasmatic esr controls normal, (2) abnormal, (3)transponder, (4)esr vaccutainer, for electronic blood cell counter sysmex xs 800i, items reagents electronic blood cell counter sysmex xs 800i, (1) cell pack pk dcl, (2) stromatolyser 4dl ffd 200a, (3) sulpholyser sls 220 a, (4) stromatolyser 4ds, (5) cell clean, (6) control xs 800i normal, (7) control xs 800i tri level, reagents for 6 part blood cell counter sysmex xn 10, (1) cell pack dcl, (2) cell pack dfl, (3) sulfolyser, (4) flurocell wdf, (5) flurocell wnr, (6) lysercell wnr, (7) lysercell wdf, (8) fluorcell ret, (9) cell clean, (10) xn check low (l1)control, (11) xn check normal (l2)control, (12) xn check high (l3)control, (13) xn check (tri level) control, (14) edta vacutec tubes, items electronic blood cell counter3 part abx sas model: horibo abx micros es 60, (1) minidil lmg, (2) abx lyse bio, (3)abx cleaner, (4) minoclair, (5) minitrol 16(2l), (6) minitrol 16(2n), (7) minotrol 16(2h), (8)minotrolcalibrator, (9) printer roll, strips for urine analyzers model: aution eleven ae 4020, (1) aution screen, (2) urine sticks tlt 10 a, (3) aution sticks 10 pa, strips for urine analyzers model: uro dipcheck 300, 1 urine analyzer strips 10 parameters, 2 mas ua dip tube control bi level, 3 uro dipcheck 300 calibration strip, consumables for histopathology slide cover slipper model: clear vue, 1 superfrost, microscopic slides ground edge 90 deg, 76x26 mm., 2 clear vue mountant, 3 cover slip hoppers 24 mmx50mm #1.5, kits & consumables for hplc machine model d 10, 1 diabetic control. bi, 2 hemoglobin a2 control, 3 eqas haemoglobin prog, 4 d 10 dual reorder pack, 5 d 10 microvials 0.1x1.5 ml, 6 d 10 printer paper,1, consumables for automated cryostat (frozen microtome) model: hm525 cryostat & automated roroty microtome model 355 s, 1 cryomatrix, 2 cryostat oil, 3 mx 35 primer low profile disposable blades, consumables for histopathology tissue embedding station model: ecl350, 1 plastic embedding rings(item code ec 351 102), 2 plastic tissue embedding cassettes with lid (item code ec 351 103), 3 metallic base moulds(item code ec 351 112), 4 histowax (item code ec 351 1118), consumables kits for lbc machine model: thin prep 2000, (1)complete pack of gyn kits for lbc part code no70096 004, (2)complete pack of non gyn kits for lbcpart code no234000, (3)eosin solution0.2% 5 lit part code no8703, (4)hematoxilin modified( harris, gill ii pap1: 5 lit part code no8708, (5)papanicolaou 2b orange ii; 5 lit part code no 8720, (6)papanicolaou 3b ea50; 5 lit part code no 8723, items reagents &consumables for serum, urine electrophoresis machine model: pretty, 1 serum protein kit, 2 alkaline hemoglobins kit, 3 destain solution conc: product code sre 201m, consumables for cytocentryfuge machine model: cytospin 4 thermo, 1 tpx reusable chamber with caps product code a 78710018, 2 ez mega funnels with filter cards for large vol. samples product code a 78710001, 3 double cyto funnels with filter cards product code 5991039, 4 single cyto funnels with brown filter cards product code 5991043, 5 single cyto funnels with white filter cards product code 5991040, 6 white filter cards product code 5991022, 7 polysine slides for cytology product code 6776215, items reagents & consumables for roche diagnostic model urysis 1100, 1 urine analyzer strip compur 10 (roshe) (propriety items for urine analyser), 2 tharmal paper roll 110 mm, 3 control test m calibration strip, items reagents & consumables for fully automated esr analyzer model: model no. alifax suyog diagno, 1 universal card for 10000 tests, 2 universal card for 4000 tests, 3 universal card for 20000 tests, 4 latex control kit 06 test (quality control kit), 5 latex control kit 30 test (quality control kit), 6 latex caliber kit 6 tests, for electronic blood cell counter fully automated 5 part differential heamatology analyzer model: yumizen h 2500, (1) abx basolyse, (2) abx cleaner, (3) abx diluent, (4) abx fluocyte, (5) abx lysebio, (6) abx monoclair, (7) abx minocal (calibrator), (8)abx nucedif, (9) difftrol (control) normal, (10) difftrol (control)low, (11) difftrol (control) high, (12)minotrol retic(retic control) (2n), (13) minotrol retic (retic control) (1l1h), items for automated haematology slide stainer model: aerospray haematology, (1)hematology buffer ph 6.8/7.2, (2)hematology thiazinstain, (3)hematology eosin stain, (4)hematology aerofixadditive for methanol, items for urine chemistry / sediment microscopic analyser model labureader plus & urised mini model: 77 electronica hungry, (1)urised cuvette, (2)labustrip u11 urine strips, e blood collection tubes & vacutainer, 1) clot activator for serum with gel 3.5 ml, 13 x 75mm with yellow cap, clot activator for serum with gel 5 ml, 13 x 100 mm with yellow cap, evacuated blood collection tube with spray dried k2edta with lavender cap, sodium citrate evacuated tube with tube in tube technology sealed from the top to avoid citrate leakagefor coagulation test with vacuum (with na citrate 0.109 mi,3.2%), evacuated tube for silica clot activator/silicon coated made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml., blood collection needle 21 or 22 gauge with cap for evacuated tube., blood collection needle 21 or 22 gauge with cap and safety lock for evacuated tube., evacuated tube for spray coated with lithium heparinmade of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml., evacuated tube for spray coated with sodium heparin made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml., evacuated tube for spray coated with sodium fluoride (3mg.), na2edta (6mg.) made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 2.0 ml., evacuated tube for buffered citrate (0.129m, 0.6ml.) for esr made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 1.6 ml., evacuated tube needle holder , blood lancet for high blood flow., contact activated blood lancet for high blood flow., luerlock access devise for blood collection from cannula for ipd sample, leak & puncture resistant sharp collector with brackets facilitating one handed disposable, satisfying niosh guideline on sharps disposal container, made of non toxic colorants and compliance with coneg heavy metal limits. it should be virgin plastic and chlorinated free. capacity – 5.4 litre., safety portable box for disposal of hypodermic needles. it should be single, one time use to prevent risk of needle stick injuries to healthcare worker handling sharps, should be made up of virgin plastic no electricity required. able to cut the needle from the hub of the syringe, container with yellow casing and cap of volume .3lts where, exterior can be cleaned with 70% alcohol. puncture resistant hard and can be locked after the needles are encapsulated., tourniquets should be stretch latex free width heavy duty coloured elastic delaine colourful, paediatric collection products, clot activator paediatric blood collection tubes with cap for serum, paediatric blood collection tubes with spray dried k2 edta., 23g x 0.75 inch needle x 7 inch tubing safety lok blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle for paediatric and microbiology., urine sampling products, kit for routine urinalysis comprising of: sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device (allows for the transfer of urine to one or more tubes without exposure to specimen) and 8.0 ml, 16 x 100 mm evacuated plastic conical tube (red& yellow closure cap) with mercury free preservative (ethyl paraben + sodium propionate + chlorhexidine) providing sample integrity for 72 hours at room temperature, for urinalysis testing. use of an evacuated tube system ensures proper urine to preservative ratio.it should be us fda certified., kit for routine urinalysis comprising of : sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device (allows for the transfer of urine to one or more tubes without exposure to specimen ) and 10.0 ml, 16 x 100 mm evacuated plastic round bottom tube(yellow closure cap) for urinalysis testing” batch wise sterility/pyrogenicity/toxicity certificate should be given. adequate combustion data to prove that it is safe for the environment upon incineration. firm should provide training to technicians/nurses regularly. clinical services should be documented by the company., kit for routine urinalysis comprising of: sterile straw as integrated transfer device (allows for the transfer of urine to one or more tubes without exposure to specimen) and8.0 ml, 16 x 100 mm evacuated plastic conical tube (red& yellow closure cap) with mercury free preservative (ethyl paraben + sodium propionate + chlorhexidine) providing sample integrity for 72 hours at room temperature, for urinalysis testing. use of an evacuated tube system ensures proper urine to preservative ratio.it should be us fda certified.batch wise sterility, pyrogenicity and toxicity certificate should be given. adequate combustion data to prove that it is safe for the environment upon incineration. firm should provide training to technicians/nurses regularly. clinical services should be documented by the company; pack size 1 x 100, urine kit for culture &sensetivity testing:sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device (allows for the transfer of urine to one or more tubes without exposure to specimen)and 4.0 ml, 13 x 75 mm evacuated plastic c&s preservative tube (grey closure cap) with preservation additive of boric acid + sodium formate + sodium borate , providing sample integrity for 48 hours at room temperature , for urine microbiology testing.it should be us fda certified. use of an evacuated tube system ensures proper urine to preservative ratiobatch wise sterility, pyrogenicity and toxicity certificate, other items / miscellaneous items, adhesive tape/ micropore, aluminum test tube rack (12 hole), anti human globulin (coomb’s test), auto pipette tips 1 ml fix, auto pipette tips 10 μl, auto pipette tips 100 μl, auto pipette tips 100 1000 μl, auto pipette tips 2 ml fix, auto pipette tips 5 ml fix, auto pipette tips 10 ml fix, auto pipette tips 200 1000 μl variable, auto pipette tips 20 200 μl variable, auto pipette tips 50 μl, bone marrow aspiration needle (jamshidi), bone marrow aspiration needle(salah’s)ss, bone marrow aspiration needle (disposable), lumber puncture needle (disposable), bovine albumin 4% higher titer will be preferred, diamond pencil export quality, disposable needle 22 g, disposable needle 24 g, disposable plastic gloves 6.5”, disposable surgical blade/ scalpel blade (22 no), disposable surgical gloves latex rubber 6.5”, disposable surgical gloves latex rubber 7.0”, disposable surgical gloves latex rubber 7.5”, disposable syringes 2 ml, disposable syringes 5 ml, disposable syringes 10 ml, disposable syringes 20 ml, disposable needle 22 g, disposable needle 24 g, esr kits. 10 tubes with cups and stand, filter papers (whatman) no 1, glass marking pencil red, glass marking pencil white, l.p.needle 22g, l.p.needle 23g, spirit lamp (ss), litmus paper (indicator paper red ), litmus paper (indicator paper blue), micro pipette 1000 μl, micro pipette 40 200 μl variable, micropipette 20μl fix, micropipette 50μl fix, micropipette 10μl fix, micropipette 100μl fix, micropipette 5ml fix, micropipette 1ml fix, micropipette 2ml fix, plastic bucket 50 lit with lid, poly vials 5 ml (plain), poly vials edta 5 ml, reagent rack plastic, k3 edta vials double cap, sodium citrate vials (3.2%) 5 ml for pt, polythene bagsyellow, blue, black for bmw, pregnancy test (hcg card test), stethoscopes, sticker for cytology size (2x1.5 cm), stop watch, syringe cutter / needle destroyer isi mark, tournicates, tissue paper, urine container (plastic) non sterile 50 ml, urine strip for albumin & sugar, urine strip for ketone bodies& sugar, urine strip for micro albinuria (micral strips), urine strip for multiple test (7 parameter), urine strip for occult blood, vacutainertubes 5 ml (blood collection vial edta), wooden spatula pap smear (ayre), cyto brush for pap smear, thermal paper roll 75 mm, thermal paper roll 110 mm, g. list of glassware note: sample may be asked before approval item no 1 to10, micro glass slides, polished edges, lint free (transparent) size 75x25x1.35mm 50 slides in each pkts, micro glass slides, polished edges, lint free (transparent) size 75x25x1.0 mm 50 slides in each pkts, micro glass slides, polished edges, lint free (transparent) size 76x26x1.35 mm 50 slides in each pkts, micro glass slides, polished edges, lint free (transparent) size 76x26x1.0 mm 50 slides in each pkts, cover slip english glass/imported lint free smooth edges (transparent) size 22x50 no. 1, cover slip english glass/imported lint free smooth edges (transparent) size 22x50 no. 1, cover slip english glass/ imported lint free smooth edges (transparent) size 22x50 no. 0, cover slip english glass/imported lint free (transparent) size 22x22 no. 1, cover slip english glass/imported lint free (transparent) size 22x22 no. 1, cover slip english glass/imported lint free (transparent) size 22x22 no. 0, cover slip english glass/imported lint free (transparent) size 18x18 no. 1, cover slip english glass/imported lint free (transparent) size 18x18 no. 1, cover slip english glass/imported lint free (transparent) size 18x18 no. 0, high profile microtome disposable blade (50 blade each pkt.), low profile microtome disposable blade (50 blade each pkt.), rubber teat for dropper, dropper big size (glass), dropper medium size (glass), capillary tubes, test tube brush, beaker with spout 1000 ml, beaker with spout 500 ml, beaker with spout 50 ml, conical flask flat bottom 500 ml, measuring cylinder graduated 1000 ml, measuring cylinder graduated 500 ml, measuring cylinder graduated 100 ml, funnel (big), funnel (medium), museum jars ( acrelic, clear transpernt with inner plate & molded lid ) size 15x10x30, museum jars ( acrelic, clear transpernt with inner plate & molded lid ) size 15x12x30, reagent bottle 2000 ml, reagent bottle 60 ml, reagent bottle 120 ml, reagent bottle 250 ml, reagent bottle 500 ml, reagent bottle 1000 ml, canada blossom bottle 20 ml, coupling jar, wash bottle plastic 500 ml, urino meter, esbach’s albino meter, hb tube round top/gdr,isi mark (sahli,s), hb pipette 20μ top isi mark with rubber teat (sahli), pertidish 110 mm (glass), rbc pipette top/gdr isi mark, wbc pipette top/gdr isi mark, stirrer for h.b.meter (sahli), test tubes 12x75 mm (glass), test tubes 12x100 mm (glass), test tubes 18x150 mm with rim (glass), bulb for microscopes halogen (6v 12 w) make; philips, labomed, other items, hemocytometer improved,, haemoglobbino meter ( sahli method), slide box (plastic) 50 slides capacity ., slide box (plastic) 100 slides capacity product size slide capacity100 color white height (english)1.25 in.height (metric)3.8cmlength (english)8.25 in.length (metric)21cmmaterialabs plasticwidth (english)6.375 in.width (metric)16cmitem description100 slide box; dimensions (l x w x h)8.25 x 6.375 x 1.25 in. (21 x 16 x 3.8cm), slide tray (aluminium) .the aluminium slide trays have elevated ridges to separate 76 x 26mm slides and finger holes for easy removal. ideal for drying fresh mounts. capacity: 20 slides dimensions: length 330mm x width 190m, for 5 part blood cell counter sysmex xn l 350(reagent for 5 part blood cell counter make sysmex model xnl 350), (1) cell pack dcl20l, (2) cell pack dfl 1.5x02 lit, (3) sulfolyser 3x500 ml, (4) lysercell wdf, (5) fluorcell wdf 2x42 ml, (6) fluorcell ret 1x24 ml, (7) cell clean, (8) xn l check low, (9) xn l check normal, (10) xn l check high...

Government Medical College - Rajasthan

25696534 supply of chemical test kits , raegents , media and glass ware items for pathology. 1 absolute alcohol / ethanol absolute ar item1 1 nos 3 2 acetic acid glacial ar item2 1 nos 4 3 acetone ar item3 1 nos 5 4 acid fuchsin m.s / certified item4 1 nos 6 5 agar agar powder item5 1 nos 7 6 albumin egg flakes item6 1 nos 8 7 alcian blue m.s / certified item7 1 nos 9 8 amido black stain item8 1 nos 10 9 aluminum sulphate ar item9 1 nos 11 10 aluminum chloride item10 1 nos 12 11 alkaline haematin d regent with haemoglobin standard 9.0 g / dl item11 1 nos 13 12 alkaline haematin d regent with haemoglobin standard &15.0 g / dl item12 1 nos 14 13 ammonia solution 30% item13 1 nos 15 14 ammonium oxalate ar item14 1 nos 16 15 ammonium potassium sulphate ( alum ) item15 1 nos 17 16 ammonium sulphate ar item16 1 nos 18 17 aniline blue m.s / certified item17 1 nos 19 18 anti microbial hand rub item18 1 nos 20 19 anti sera a, anit sera b and anti sera d one set of blood group antiseras containing each of 10ml. all antisera must be monoclonal must be able to deduct weakerblood groups , avidity nust be less than 5 second item19 1 nos 21 20 barium chloride ar item22 1 nos 22 21 basic fuchsin m.s / certified item23 1 nos 23 22 agar agar bacto item24 1 nos 24 23 bees wax, white item25 1 nos 25 24 benedict’s reagents qualitative lr item26 1 nos 26 25 benzidine powder item27 1 nos 27 26 benzidine powder dihydrochloride item28 1 nos 28 27 biebrich scarlet m.s certified item29 1 nos 29 28 bouin’s fluid fixing solution item30 1 nos 30 29 brilliant cresyl blue m.s / certified item31 1 nos 31 30 bromophenol blue item32 1 nos 32 31 boric acid ar item33 1 nos 33 32 borate buffer ph 9.0 item34 1 nos 34 33 borax powder ep item35 1 nos 35 34 buffer tablets 6.2 ph item36 1 nos 36 35 buffer tablets 7.0 ph item37 1 nos 37 36 buffer tablets 9.2 ph item38 1 nos 38 37 calcium chloride ar item39 1 nos 39 38 congo red m.s / certified item40 1 nos 40 39 carbol fuchsin dilute item41 1 nos 41 40 carbol fuchsin strong item42 1 nos 42 41 carmine m.s. / certified item43 1 nos 43 42 cedar wood oil item44 1 nos 44 43 charcoal activated ar item45 1 nos 45 44 citric acid ar item46 1 nos 46 45 crystal violet m.s / certified item47 1 nos 47 46 csf diluting fluid item48 1 nos 48 47 dextrose ndhydrous / d glucose item49 1 nos 49 48 d.p.x. mountant item50 1 nos 50 49 darbkin’s solution item51 1 nos 51 50 deionised water item52 1 nos 52 51 distilled water item53 1 nos 53 52 di sodium hydrogen ortho phosphate item54 1 nos 54 53 diastage item55 1 nos 55 54 emry powder no 2 item56 1 nos 56 55 emry powder no 3 item57 1 nos 57 56 eosin water soluble item58 1 nos 58 57 eosinophil counting fluid item59 1 nos 59 58 esbach’s reagent item60 1 nos 60 59 ehrlich’s reagents solution item61 1 nos 61 60 ethylene diamine tetra acitic acid ( edta ) item62 1 nos 62 61 fast green ms item63 1 nos 63 62 ferric ammonium sulphate item64 1 nos 64 63 fetal hb kits item65 1 nos 65 64 formal dehyde ( 37 41% ) w / var item66 1 nos 66 65 fouchet’s reagents item67 1 nos 67 66 field stain a sol’n item68 1 nos 68 67 field stain b sol’n item69 1 nos 69 68 gram’s iodine ms item70 1 nos 70 69 g6pd reagent kit ( qualitative ) item71 1 nos 71 70 giemsa stain powder m.s / certified item72 1 nos 72 71 glycerol ar item73 1 nos 73 72 gold chloride m.s item74 1 nos 74 73 hematoxylin powder ms / certified item75 1 nos 75 74 hematoxylin may’s soln ms item76 1 nos 76 75 haemoglobin standard item77 1 nos 77 76 hydrochloric acid ( concentrated ) item78 1 nos 78 77 hydrogen peroxide ( 6% ) item79 1 nos 79 78 iodine powder item80 1 nos 80 79 iso propyl alcohol ar item81 1 nos 81 80 kaolin light ep item82 1 nos 82 81 labogent / labklin ( glass cleaning solution ) item83 1 nos 83 82 leishman’s stain solution m.s item84 1 nos 84 83 leishman’s stain powder m.s / certified item85 1 nos 85 84 light green m.s / certified item86 1 nos 86 85 liquid paraffin oil heavy item87 1 nos 87 86 liquid paraffin oil light item88 1 nos 88 87 lithium carbonate ar item89 1 nos 89 88 lugol’s iodine item90 1 nos 90 89 mercuric oxide red purified item91 1 nos 91 90 metanil yellow m.s / certified item92 1 nos 92 91 methanol ep ( acetone free ) item93 1 nos 93 92 methyl violet m.s / certified item94 1 nos 94 93 methyline blue m.s / certified item95 1 nos 95 94 neutral red m.s / certified item96 1 nos 96 95 n / 10 hcl item97 1 nos 97 96 nitric acid ar item98 1 nos 98 97 normal saline 0.9% item99 1 nos 99 98 paraffin wax with ceresin, in block form ( 600 620 ) item100 1 nos 100 99 paraffin wax with ceresin, in block form ( 580 600 ) item101 1 nos 101 100 peanut oil item102 1 nos 102 101 periodic acid m.s / certified item103 1 nos 103 102 phenol crystal item104 1 nos 104 103 phosphomolibidic acid item105 1 nos 105 104 phosphotungestic acid ar item106 1 nos 106 105 picric acid ( saturated ) item107 1 nos 107 106 platelet count fluid item108 1 nos 108 107 phloxin –b m.s / certified item109 1 nos 109 108 phenyle item110 1 nos 110 109 potassium dichromate item111 1 nos 111 110 potassium ferrocynide item112 1 nos 112 111 potassium hydroxide pellets item113 1 nos 113 112 potassium iodine ar item114 1 nos 114 113 potassium metabisulphite ar item115 1 nos 115 114 potassium permangnate purified item116 1 nos 116 115 ponceau’s stain item117 1 nos 117 116 rapid pap’s kit item118 1 nos 118 117 rbc counting fluid item119 1 nos 119 118 reticulocyte count fluid item120 1 nos 120 119 semen diluting fluid item121 1 nos 121 120 silver nitrate ep item122 1 nos 122 121 sodium acetate ep ( anhydrous ) item123 1 nos 123 122 sodium chloride ep item124 1 nos 124 123 sodium citrate 3.8% item125 1 nos 125 124 sodium carbonate item126 1 nos 126 125 sodium dihydrogen ortho phosphate item127 1 nos 127 126 sodium hypo chlorite solution 4% item128 1 nos 128 127 sodium hydrogen phosphate ar item129 1 nos 129 128 sodium di hydrogen phosphate ar item130 1 nos 130 129 sodium nitrate ar item131 1 nos 131 130 sodium nitropruside item132 1 nos 132 131 sodium sulphate ar item133 1 nos 133 132 sodium thiosulphate item134 1 nos 134 133 sudan black item135 1 nos 135 134 spirit item136 1 nos 136 135 sulphosalicylic acid item137 1 nos 137 136 sulphur powder item138 1 nos 138 137 sulphuric acid pure item139 1 nos 139 138 thymol crystal item140 1 nos 140 139 toludine blue m.s / certified item141 1 nos 141 140 tris buffer phosphate item142 1 nos 142 141 tri sodium citrate item143 1 nos 143 142 wbc counting fluid item144 1 nos 144 143 xylene ar item145 1 nos 145 143.01 b antibody for immune histochemistry ( ihc test ) note – ( a ) product should be ivd approved n ( b ) price will be calculated on per ml basis n ( b ) it should have helf life of minimum 12 months from supply ( c ) due to low consumption & short expiry marker no. 1 110 small packing ( 1x3ml ) preferred 146 144 alk 1 ( monoclonal mouse anti human cd246, clone ) item146 1 nos 147 145 alk 1 ( monoclonal mouse anti human cd246, clone ) item147 1 nos 148 146 alk 1 ( monoclonal mouse anti human cd246, clone ) item148 1 nos 149 147 alpha feto protein ( afp ) ( polyclonal rabbit anti human ) item149 1 nos 150 148 alpha feto protein ( afp ) ( polyclonal rabbit anti human ) item150 1 nos 151 149 alpha feto protein ( afp ) ( polyclonal rabbit anti human ) item151 1 nos 152 150 amacr ( monoclonal mouse anti human clone 13h4 ) item152 1 nos 153 151 amacr ( monoclonal mouse anti human clone 13h4 ) item153 1 nos 154 152 amacr ( monoclonal mouse anti human clone 13h4 ) item154 1 nos 155 153 amyloid a ( monoclonal mouse anti human amyloid clone mc1 ) item155 1 nos 156 154 amyloid a ( monoclonal mouse anti human amyloid clone mc1 ) item156 1 nos 157 155 amyloid a ( monoclonal mouse anti human amyloid clone mc1 ) item157 1 nos 158 156 b 72 . 3 item158 1 nos 159 157 b 72 . 3 item159 1 nos 160 158 b 72 . 3 item160 1 nos 161 159 bcl 6 ( monoclonal mouse anti human bcl6, clonepg b6p ) item161 1 nos 162 160 bcl 6 ( monoclonal mouse anti human bcl6, clonepg b6p ) item162 1 nos 163 161 bcl 6 ( monoclonal mouse anti human bcl6, clonepg b6p ) item163 1 nos 164 162 bcl 2 item164 1 nos 165 163 bcl 2 item165 1 nos 166 164 bcl 2 item166 1 nos 167 165 ber ep4 ( monoclonal mouse anti human epithelial antigen, clone ) item167 1 nos 168 166 ber ep4 ( monoclonal mouse anti human epithelial antigen, clone ) item168 1 nos 169 167 ber ep4 ( monoclonal mouse anti human epithelial antigen, clone ) item169 1 nos 170 168 beta catenin ( monoclonal mouse anti –human beta catenin, clone ß catenin 1 ) item170 1 nos 171 169 beta catenin ( monoclonal mouse anti –human beta catenin, clone ß catenin 1 ) item171 1 nos 172 170 beta catenin ( monoclonal mouse anti –human beta catenin, clone ß catenin 1 ) item172 1 nos 173 171 bob 1 item173 1 nos 174 172 bob 1 item174 1 nos 175 173 bob 1 item175 1 nos 176 174 brachyury item176 1 nos 177 175 brachyury item177 1 nos 178 176 brachyury item178 1 nos 179 177 calcitonin ( polyclonal rabbit anti human calcitonin ) item179 1 nos 180 178 calcitonin ( polyclonal rabbit anti human calcitonin ) item180 1 nos 181 179 calcitonin ( polyclonal rabbit anti human calcitonin ) item181 1 nos 182 180 caldesmon ( monoclonal mouse anti –human caldesmon clone h cd ) item182 1 nos 183 181 caldesmon ( monoclonal mouse anti –human caldesmon clone h cd ) item183 1 nos 184 182 caldesmon ( monoclonal mouse anti –human caldesmon clone h cd ) item184 1 nos 185 183 calretinin ( monoclonal mouse anti –human calretinin, cloneclone dak calret 1 ) item185 1 nos 186 184 calretinin ( monoclonal mouse anti –human calretinin, cloneclone dak calret 1 ) item186 1 nos 187 185 calretinin ( monoclonal mouse anti –human calretinin, cloneclone dak calret 1 ) item187 1 nos 188 186 cam 5.2 item188 1 nos 189 187 cam 5.2 item189 1 nos 190 188 cam 5.2 item190 1 nos 191 189 cd 1a ( monoclonal mouse anti –humancd1a, clone 010 ) item191 1 nos 192 190 cd 1a ( monoclonal mouse anti –humancd1a, clone 010 ) item192 1 nos 193 191 cd 1a ( monoclonal mouse anti –humancd1a, clone 010 ) item193 1 nos 194 192 cd 2 ( monoclonal mouse anti –human cd2, clone ab75 ) item194 1 nos 195 193 cd 2 ( monoclonal mouse anti –human cd2, clone ab75 ) item195 1 nos 196 194 cd 2 ( monoclonal mouse anti –human cd2, clone ab75 ) item196 1 nos 197 195 cd 3 ( monoclonal mouse anti –human ) item197 1 nos 198 196 cd 3 ( monoclonal mouse anti –human ) item198 1 nos 199 197 cd 3 ( monoclonal mouse anti –human ) item199 1 nos 200 198 cd 5 ( monoclonal mouse anti –humancd4, clone 4b12 ) item200 1 nos 201 199 cd 5 ( monoclonal mouse anti –humancd4, clone 4b12 ) item201 1 nos 202 200 cd 5 ( monoclonal mouse anti –humancd4, clone 4b12 ) item202 1 nos 203 201 cd 7 ( monoclonal mouse anti –human cd5, clone 4c7 ) item203 1 nos 204 202 cd 7 ( monoclonal mouse anti –human cd5, clone 4c7 ) item204 1 nos 205 203 cd 7 ( monoclonal mouse anti –human cd5, clone 4c7 ) item205 1 nos 206 204 cd 8 ( monoclonal mouse anti –human cd8, clone c8 / 144b ) item206 1 nos 207 205 cd 8 ( monoclonal mouse anti –human cd8, clone c8 / 144b ) item207 1 nos 208 206 cd 8 ( monoclonal mouse anti –human cd8, clone c8 / 144b ) item208 1 nos 209 207 cd 10 ( monoclonal mouse anti –human cd10, clone 56c6 ) item209 1 nos 210 208 cd 10 ( monoclonal mouse anti –human cd10, clone 56c6 ) item210 1 nos 211 209 cd 10 ( monoclonal mouse anti –human cd10, clone 56c6 ) item211 1 nos 212 210 cd11c item212 1 nos 213 211 cd11c item213 1 nos 214 212 cd11c item214 1 nos 215 213 cd14 item215 1 nos 216 214 cd14 item216 1 nos 217 215 cd14 item217 1 nos 218 216 cd15 ( monoclonal mouse anti –human cd15, clone carb 3 ) item218 1 nos 219 217 cd15 ( monoclonal mouse anti –human cd15, clone carb 3 ) item219 1 nos 220 218 cd15 ( monoclonal mouse anti –human cd15, clone carb 3 ) item220 1 nos 221 219 cd 20 ( monoclonal mouse anti –human cd21, clone l26 ) item221 1 nos 222 220 cd 20 ( monoclonal mouse anti –human cd21, clone l26 ) item222 1 nos 223 221 cd 20 ( monoclonal mouse anti –human cd21, clone l26 ) item223 1 nos 224 222 cd 21 ( monoclonal mouse anti –human cd15, clone 1f8 ) item224 1 nos 225 223 cd 21 ( monoclonal mouse anti –human cd15, clone 1f8 ) item225 1 nos 226 224 cd 21 ( monoclonal mouse anti –human cd15, clone 1f8 ) item226 1 nos 227 225 cd 23 ( monoclonal mouse anti –human cd23, clone dak cd23 ) item227 1 nos 228 226 cd 23 ( monoclonal mouse anti –human cd23, clone dak cd23 ) item228 1 nos 229 227 cd 23 ( monoclonal mouse anti –human cd23, clone dak cd23 ) item229 1 nos 230 228 cd 30 ( monoclonal mouse anti –human cd30, clone ber h2 ) item230 1 nos 231 229 cd 30 ( monoclonal mouse anti –human cd30, clone ber h2 ) item231 1 nos 232 230 cd 30 ( monoclonal mouse anti –human cd30, clone ber h2 ) item232 1 nos 233 231 cd 31 ( monoclonal mouse anti –human cd31, endothelial cell jc70a ) item233 1 nos 234 232 cd 31 ( monoclonal mouse anti –human cd31, endothelial cell jc70a ) item234 1 nos 235 233 cd 31 ( monoclonal mouse anti –human cd31, endothelial cell jc70a ) item235 1 nos 236 234 cd 33 item236 1 nos 237 235 cd 33 item237 1 nos 238 236 cd 33 item238 1 nos 239 237 cd 34 ( monoclonal mouse anti –human cd34, classii clone qbend 10 ) item239 1 nos 240 238 cd 34 ( monoclonal mouse anti –human cd34, classii clone qbend 10 ) item240 1 nos 241 239 cd 34 ( monoclonal mouse anti –human cd34, classii clone qbend 10 ) item241 1 nos 242 240 cd 35 ( monoclonal mouse anti –human cd35, ) item242 1 nos 243 241 cd 35 ( monoclonal mouse anti –human cd35, ) item243 1 nos 244 242 cd 35 ( monoclonal mouse anti –human cd35, ) item244 1 nos 245 243 cd 41 item245 1 nos 246 244 cd 41 item246 1 nos 247 245 cd 41 item247 1 nos 248 246 cd 45 ( cd45, leucocyte common antigen, clone 2b11+pd7 / 26 ) item248 1 nos 249 247 cd 45 ( cd45, leucocyte common antigen, clone 2b11+pd7 / 26 ) item249 1 nos 250 248 cd 45 ( cd45, leucocyte common antigen, clone 2b11+pd7 / 26 ) item250 1 nos 251 249 cd 56 ( monoclonal mouse anti –human cd56, clone 123c3 ) item251 1 nos 252 250 cd 56 ( monoclonal mouse anti –human cd56, clone 123c3 ) item252 1 nos 253 251 cd 56 ( monoclonal mouse anti –human cd56, clone 123c3 ) item253 1 nos 254 252 cd 57 ( monoclonal mouse anti –human cd57, clone tb01 ) item254 1 nos 255 253 cd 57 ( monoclonal mouse anti –human cd57, clone tb01 ) item255 1 nos 256 254 cd 57 ( monoclonal mouse anti –human cd57, clone tb01 ) item256 1 nos 257 255 cd 61 item257 1 nos 258 256 cd 61 item258 1 nos 259 257 cd 61 item259 1 nos 260 258 cd 68 ( monoclonal mouse anti –human cd68, clone pgm1 ) item260 1 nos 261 259 cd 68 ( monoclonal mouse anti –human cd68, clone pgm1 ) item261 1 nos 262 260 cd 68 ( monoclonal mouse anti –human cd68, clone pgm1 ) item262 1 nos 263 261 cd 79 a ( monoclonal mouse anti –human cd79a, clone jcb117 ) item263 1 nos 264 262 cd 79 a ( monoclonal mouse anti –human cd79a, clone jcb117 ) item264 1 nos 265 263 cd 79 a ( monoclonal mouse anti –human cd79a, clone jcb117 ) item265 1 nos 266 264 cd 99 ( monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker, clone 12e7 ) item266 1 nos 267 265 cd 99 ( monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker, clone 12e7 ) item267 1 nos 268 266 cd 99 ( monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker, clone 12e7 ) item268 1 nos 269 267 cd 103 item269 1 nos 270 268 cd 103 item270 1 nos 271 269 cd 103 item271 1 nos 272 270 cd 117 ( c kit ) ( polyclonal rabbit cd117 ) item272 1 nos 273 271 cd 117 ( c kit ) ( polyclonal rabbit cd117 ) item273 1 nos 274 272 cd 117 ( c kit ) ( polyclonal rabbit cd117 ) item274 1 nos 275 273 cd 138 ( monoclonal mouse anti –human cd138 clone mi15 ) item275 1 nos 276 274 cd 138 ( monoclonal mouse anti –human cd138 clone mi15 ) item276 1 nos 277 275 cd 138 ( monoclonal mouse anti –human cd138 clone mi15 ) item277 1 nos 278 276 cdx 2 ( monoclonal mouse anti –human cdx 2, clone dak cdx 2 ) item278 1 nos 279 277 cdx 2 ( monoclonal mouse anti –human cdx 2, clone dak cdx 2 ) item279 1 nos 280 278 cdx 2 ( monoclonal mouse anti –human cdx 2, clone dak cdx 2 ) item280 1 nos 281 279 cea ( monoclonal mouse anti –human carcinoembryonic antigen, clone ii 7 ) item281 1 nos 282 280 cea ( monoclonal mouse anti –human carcinoembryonic antigen, clone ii 7 ) item282 1 nos 283 281 cea ( monoclonal mouse anti –human carcinoembryonic antigen, clone ii 7 ) item283 1 nos 284 282 chromogranin item284 1 nos 285 283 chromogranin item285 1 nos 286 284 chromogranin item286 1 nos 287 285 ck 5 / 6 ( monoclonal mouse anti –human cytokeratin 5 / 6, clone d 5 / 16 b4 ) item287 1 nos 288 286 ck 5 / 6 ( monoclonal mouse anti –human cytokeratin 5 / 6, clone d 5 / 16 b4 ) item288 1 nos 289 287 ck 5 / 6 ( monoclonal mouse anti –human cytokeratin 5 / 6, clone d 5 / 16 b4 ) item289 1 nos 290 288 ck 7 ( monoclonal mouse anti –human cytokeratin 7, clone ov tl12 / 30 ) item290 1 nos 291 289 ck 7 ( monoclonal mouse anti –human cytokeratin 7, clone ov tl12 / 30 ) item291 1 nos 292 290 ck 7 ( monoclonal mouse anti –human cytokeratin 7, clone ov tl12 / 30 ) item292 1 nos 293 291 ck 19 ( monoclonal mouse anti –human cytokeratin 19, rck 108 ) item293 1 nos 294 292 ck 19 ( monoclonal mouse anti –human cytokeratin 19, rck 108 ) item294 1 nos 295 293 ck 19 ( monoclonal mouse anti –human cytokeratin 19, rck 108 ) item295 1 nos 296 294 ck 20 ( monoclonal mouse anti –human cytokeratin 20, clone ks20.8 ) item296 1 nos 297 295 ck 20 ( monoclonal mouse anti –human cytokeratin 20, clone ks20.8 ) item297 1 nos 298 296 ck 20 ( monoclonal mouse anti –human cytokeratin 20, clone ks20.8 ) item298 1 nos 299 297 ck ae 1 / ae3 ( monoclonal mouse anti –human cytokeratin, clone ae1 / ae3 ) item299 1 nos 300 298 ck ae 1 / ae3 ( monoclonal mouse anti –human cytokeratin, clone ae1 / ae3 ) item300 1 nos 301 299 ck ae 1 / ae3 ( monoclonal mouse anti –human cytokeratin, clone ae1 / ae3 ) item301 1 nos 302 300 cyclin d1 ( monoclonal mouse anti –human cyclind1, clone ep12 ) item302 1 nos 303 301 cyclin d1 ( monoclonal mouse anti –human cyclind1, clone ep12 ) item303 1 nos 304 302 cyclin d1 ( monoclonal mouse anti –human cyclind1, clone ep12 ) item304 1 nos 305 303 desmin ( monoclonal mouse anti –human desmin, clone d33 ) item305 1 nos 306 304 desmin ( monoclonal mouse anti –human desmin, clone d33 ) item306 1 nos 307 305 desmin ( monoclonal mouse anti –human desmin, clone d33 ) item307 1 nos 308 306 dog 1 item308 1 nos 309 307 dog 1 item309 1 nos 310 308 dog 1 item310 1 nos 311 309 e cadherin ( monoclonal mouse anti –human e cadherin, clone nch 3 ) item311 1 nos 312 310 e cadherin ( monoclonal mouse anti –human e cadherin, clone nch 3 ) item312 1 nos 313 311 e cadherin ( monoclonal mouse anti –human e cadherin, clone nch 3 ) item313 1 nos 314 312 egfr item314 1 nos 315 313 egfr item315 1 nos 316 314 egfr item316 1 nos 317 315 ema ( monoclonal mouse anti –human epithelial membrane antigen, clonee29 ) item317 1 nos 318 316 ema ( monoclonal mouse anti –human epithelial membrane antigen, clonee29 ) item318 1 nos 319 317 ema ( monoclonal mouse anti –human epithelial membrane antigen, clonee29 ) item319 1 nos 320 318 estrogen receptor ( er ) ( monoclonal rabbit anti –human estrogen receptor , clone ep1 ) item320 1 nos 321 319 estrogen receptor ( er ) ( monoclonal rabbit anti –human estrogen receptor , clone ep1 ) item321 1 nos 322 320 estrogen receptor ( er ) ( monoclonal rabbit anti –human estrogen receptor , clone ep1 ) item322 1 nos 323 321 factor viii ( vwf ) item323 1 nos 324 322 factor viii ( vwf ) item324 1 nos 325 323 factor viii ( vwf ) item325 1 nos 326 324 fl i – 1 item326 1 nos 327 325 fl i – 1 item327 1 nos 328 326 fl i – 1 item328 1 nos 329 327 galectin 3 item329 1 nos 330 328 galectin 3 item330 1 nos 331 329 galectin 3 item331 1 nos 332 330 gfap ( polyclonal rabbit gfap ) item332 1 nos 333 331 gfap ( polyclonal rabbit gfap ) item333 1 nos 334 332 gfap ( polyclonal rabbit gfap ) item334 1 nos 335 333 hcg ( polyclonal rabbit anti human chorinc gonadotropin ) item335 1 nos 336 334 hcg ( polyclonal rabbit anti human chorinc gonadotropin ) item336 1 nos 337 335 hcg ( polyclonal rabbit anti human chorinc gonadotropin ) item337 1 nos 338 336 hcg beta item338 1 nos 339 337 hcg beta item339 1 nos 340 338 hcg beta item340 1 nos 341 339 hepatitis b surface antigen item341 1 nos 342 340 hepatitis b surface antigen item342 1 nos 343 341 hepatitis b surface antigen item343 1 nos 344 342 hepatocyte growth factor receptor item344 1 nos 345 343 hepatocyte growth factor receptor item345 1 nos 346 344 hepatocyte growth factor receptor item346 1 nos 347 345 her 2 neu ( polyclonal rabbit anti human cerb 2 ) item347 1 nos 348 346 her 2 neu ( polyclonal rabbit anti human cerb 2 ) item348 1 nos 349 347 her 2 neu ( polyclonal rabbit anti human cerb 2 ) item349 1 nos 350 348 hmb 45 ( monoclonal mouse anti human melanosome clone hmb45 ) item350 1 nos 351 349 hmb 45 ( monoclonal mouse anti human melanosome clone hmb45 ) item351 1 nos 352 350 hmb 45 ( monoclonal mouse anti human melanosome clone hmb45 ) item352 1 nos 353 351 hmwck ( monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12 ) item353 1 nos 354 352 hmwck ( monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12 ) item354 1 nos 355 353 hmwck ( monoclonal mouse anti human cytokeratin, high molecular weight clone 34be12 ) item355 1 nos 356 354 inhibin item356 1 nos 357 355 inhibin item357 1 nos 358 356 inhibin item358 1 nos 359 357 inhibin – alpha item359 1 nos 360 358 inhibin – alpha item360 1 nos 361 359 inhibin – alpha item361 1 nos 362 360 ini 1 item362 1 nos 363 361 ini 1 item363 1 nos 364 362 ini 1 item364 1 nos 365 363 kappa light chain ( polyclonal rabbit anti human kappa light chains ) item365 1 nos 366 364 kappa light chain ( polyclonal rabbit anti human kappa light chains ) item366 1 nos 367 365 kappa light chain ( polyclonal rabbit anti human kappa light chains ) item367 1 nos 368 366 ki 67 ( ki 67 antigen clone mib 1 ) item368 1 nos 369 367 ki 67 ( ki 67 antigen clone mib 1 ) item369 1 nos 370 368 ki 67 ( ki 67 antigen clone mib 1 ) item370 1 nos 371 369 lambda light chain ( polyclonal rabbit anti human lambda light chains. ) item371 1 nos 372 370 lambda light chain ( polyclonal rabbit anti human lambda light chains. ) item372 1 nos 373 371 lambda light chain ( polyclonal rabbit anti human lambda light chains. ) item373 1 nos 374 372 mammaglobin ( monoclonal mouse anti human mammaglobin clone304 1a5 ) item374 1 nos 375 373 mammaglobin ( monoclonal mouse anti human mammaglobin clone304 1a5 ) item375 1 nos 376 374 mammaglobin ( monoclonal mouse anti human mammaglobin clone304 1a5 ) item376 1 nos 377 375 mart 1 item377 1 nos 378 376 mart 1 item378 1 nos 379 377 mart 1 item379 1 nos 380 378 mast cell tryptase ( monoclonal mouse anti human mast cell trytase clone aa1 ) item380 1 nos 381 379 mast cell tryptase ( monoclonal mouse anti human mast cell trytase clone aa1 ) item381 1 nos 382 380 mast cell tryptase ( monoclonal mouse anti human mast cell trytase clone aa1 ) item382 1 nos 383 381 melan a ( monoclonal mouse anti human melan a clone a103 ) item383 1 nos 384 382 melan a ( monoclonal mouse anti human melan a clone a103 ) item384 1 nos 385 383 melan a ( monoclonal mouse anti human melan a clone a103 ) item385 1 nos 386 384 moc 31 item386 1 nos 387 385 moc 31 item387 1 nos 388 386 moc 31 item388 1 nos 389 387 mpo ( myeloperoxidase ) ( polyclonal rabbit anti human myeloperoxidase ) item389 1 nos 390 388 mpo ( myeloperoxidase ) ( polyclonal rabbit anti human myeloperoxidase ) item390 1 nos 391 389 mpo ( myeloperoxidase ) ( polyclonal rabbit anti human myeloperoxidase ) item391 1 nos 392 390 muc 2 item392 1 nos 393 391 muc 2 item393 1 nos 394 392 muc 2 item394 1 nos 395 393 muc 5 ac item395 1 nos 396 394 muc 5 ac item396 1 nos 397 395 muc 5 ac item397 1 nos 398 396 mumi – protein ( monoclonal mouse anti human mum1 protein clonemum1p item398 1 nos 399 397 mumi – protein ( monoclonal mouse anti human mum1 protein clonemum1p item399 1 nos 400 398 mumi – protein ( monoclonal mouse anti human mum1 protein clonemum1p item400 1 nos 401 399 myo d1 item401 1 nos 402 400 myo d1 item402 1 nos 403 401 myo d1 item403 1 nos 404 402 myogenin ( monoclonal mouse anti myogenin clone f5d ) item404 1 nos 405 403 myogenin ( monoclonal mouse anti myogenin clone f5d ) item405 1 nos 406 404 myogenin ( monoclonal mouse anti myogenin clone f5d ) item406 1 nos 407 405 napsin –a item407 1 nos 408 406 napsin –a item408 1 nos 409 407 napsin –a item409 1 nos 410 408 nse ( monoclonal mouse anti human neuron specific enolase bbs / nc / vi h14 ) item410 1 nos 411 409 nse ( monoclonal mouse anti human neuron specific enolase bbs / nc / vi h14 ) item411 1 nos 412 410 nse ( monoclonal mouse anti human neuron specific enolase bbs / nc / vi h14 ) item412 1 nos 413 411 oct 3 / 4 item413 1 nos 414 412 oct 3 / 4 item414 1 nos 415 413 oct 3 / 4 item415 1 nos 416 414 p 53 ( monoclonal mouse anti human p53 protein clone do 7 ) item416 1 nos 417 415 p 53 ( monoclonal mouse anti human p53 protein clone do 7 ) item417 1 nos 418 416 p 53 ( monoclonal mouse anti human p53 protein clone do 7 ) item418 1 nos 419 417 p 63 item419 1 nos 420 418 p 63 item420 1 nos 421 419 p 63 item421 1 nos 422 420 pap ( prostatic acid phosphatase ) item422 1 nos 423 421 pap ( prostatic acid phosphatase ) item423 1 nos 424 422 pap ( prostatic acid phosphatase ) item424 1 nos 425 423 parafibromin item425 1 nos 426 424 parafibromin item426 1 nos 427 425 parafibromin item427 1 nos 428 426 pax 5 ( monoclonal mouse anti human b cell specific activator protein dak pax5 ) item428 1 nos 429 427 pax 5 ( monoclonal mouse anti human b cell specific activator protein dak pax5 ) item429 1 nos 430 428 pax 5 ( monoclonal mouse anti human b cell specific activator protein dak pax5 ) item430 1 nos 431 429 p cadherin item431 1 nos 432 430 p cadherin item432 1 nos 433 431 p cadherin item433 1 nos 434 432 plap ( placental alkaline phosphatase ) ( monoclonal mouse anti human placental alkaline phosphate clone 8a9 ) item434 1 nos 435 433 plap ( placental alkaline phosphatase ) ( monoclonal mouse anti human placental alkaline phosphate clone 8a9 ) item435 1 nos 436 434 plap ( placental alkaline phosphatase ) ( monoclonal mouse anti human placental alkaline phosphate clone 8a9 ) item436 1 nos 437 435 progesterone receptor ( pr ) ( monoclonal mouse anti human progesterone receptor clone pgr 636 ) item437 1 nos 438 436 progesterone receptor ( pr ) ( monoclonal mouse anti human progesterone receptor clone pgr 636 ) item438 1 nos 439 437 progesterone receptor ( pr ) ( monoclonal mouse anti human progesterone receptor clone pgr 636 ) item439 1 nos 440 438 psa ( prostate specific antigen ) ( polyclonal rabbit anti human prostate specific antigen ) item440 1 nos 441 439 psa ( prostate specific antigen ) ( polyclonal rabbit anti human prostate specific antigen ) item441 1 nos 442 440 psa ( prostate specific antigen ) ( polyclonal rabbit anti human prostate specific antigen ) item442 1 nos 443 441 s 100 ( polyclonal rabbit antis100 ) item443 1 nos 444 442 s 100 ( polyclonal rabbit antis100 ) item444 1 nos 445 443 s 100 ( polyclonal rabbit antis100 ) item445 1 nos 446 444 sma ( mono clonal mouse anti human smooth muscle actin1a4 ) item446 1 nos 447 445 sma ( mono clonal mouse anti human smooth muscle actin1a4 ) item447 1 nos 448 446 sma ( mono clonal mouse anti human smooth muscle actin1a4 ) item448 1 nos 449 447 synaptophysin ( monoclonal mouse antisynaptophysin sy38 ) item449 1 nos 450 448 synaptophysin ( monoclonal mouse antisynaptophysin sy38 ) item450 1 nos 451 449 synaptophysin ( monoclonal mouse antisynaptophysin sy38 ) item451 1 nos 452 450 tdt item452 1 nos 453 451 tdt item453 1 nos 454 452 tdt item454 1 nos 455 453 thrombomodulin item455 1 nos 456 454 thrombomodulin item456 1 nos 457 455 thrombomodulin item457 1 nos 458 456 thyroglobulin ( polyclonal rabbit anti human thyroglobulin ) item458 1 nos 459 457 thyroglobulin ( polyclonal rabbit anti human thyroglobulin ) item459 1 nos 460 458 thyroglobulin ( polyclonal rabbit anti human thyroglobulin ) item460 1 nos 461 459 tle 1 item461 1 nos 462 460 tle 1 item462 1 nos 463 461 tle 1 item463 1 nos 464 462 ttf 1 ( monoclonal mouse antithyroid transcription factor ( ttf 1 ) clone 8g7g3 / 1 item464 1 nos 465 463 ttf 1 ( monoclonal mouse antithyroid transcription factor ( ttf 1 ) clone 8g7g3 / 1 item465 1 nos 466 464 ttf 1 ( monoclonal mouse antithyroid transcription factor ( ttf 1 ) clone 8g7g3 / 1 item466 1 nos 467 465 uroplakin iii item467 1 nos 468 466 uroplakin iii item468 1 nos 469 467 uroplakin iii item469 1 nos 470 468 vimentin ( monoclonal mouse antivimentin v9 ) +b1115:b1128 item470 1 nos 471 469 vimentin ( monoclonal mouse antivimentin v9 ) +b1115:b1128 item471 1 nos 472 470 vimentin ( monoclonal mouse antivimentin v9 ) +b1115:b1128 item472 1 nos 473 471 wt 1 ( monoclonal mouse anti human wilms’tumar 1 ( wt1 ) protein clone 6f h2 ) item473 1 nos 474 472 wt 1 ( monoclonal mouse anti human wilms’tumar 1 ( wt1 ) protein clone 6f h2 ) item474 1 nos 475 473 wt 1 ( monoclonal mouse anti human wilms’tumar 1 ( wt1 ) protein clone 6f h2 ) item475 1 nos 476 474 polymer based detection kit ( should contain peroxide block, protien block, post primary block, secondary antibody tagged wirt hrp, hemotoxicylin, dab substrate buffer & dab chromogen for 100 tests item476 1 nos 477 475 adhesive for ihc / poly l lysine ( sigma ) item477 1 nos 478 476 delimiting pen / novo pen / pap pen item478 1 nos 479 477 dab chromogen item479 1 nos 480 478 dab substrate buffer ( 100ml ) item480 1 nos 481 479 antibody diluent ( vidas rub igm ) item481 1 nos 482 480 ihc coated slides item482 1 nos 483 481 epitope retrieval buffer ( ph. 6.0 ) item483 1 nos 484 482 epitope retrieval buffer ( ph. 9.0 ) item484 1 nos 485 482.01 c antibody for immunofluorescence microscopy 486 483 albumin, polyclonal fitc ready to use for immunofluorescence rabbit anti albumin conjugated to fluorescein isothiocyanate. item485 1 nos 487 484 c1q complement, polyclonal fitc ready to use for immunofluorescence rabbit anti c1q complement conjugated to fluorescein isothiocyanate item486 1 nos 488 485 c3c complement, polyclonal fitc ready to use for immunofluorescence sheep anti c3c complement conjugated to fluorescein isothiocyanate item487 1 nos 489 486 fibrinogen, polyclonal fitc ready to use for immunofluorescence rabbit anti fibrinogen conjugated to fluorescein isothiocyanate item488 1 nos 490 487 immunoglobulin a ( iga ) , polyclonal fitc ready to use for immunofluorescence sheep anti iga conjugated to fluorescein isothiocyanate item489 1 nos 491 488 immunoglobulin g ( igg ) , polyclonal fitc ready to use for immunofluorescence sheep anti igg conjugated to fluorescein isothiocyanate item490 1 nos 492 489 immunoglobulin m ( igm ) , polyclonal fitc ready to use for immunofluorescence rabbit anti igm conjugated to fluorescein isothiocyanate item491 1 nos 493 490 kappa, polyclonal fitc ready to use for immunofluorescence rabbit anti kappa conjugated to fluorescein isothiocyanate item492 1 nos 494 491 lambda, polyclonal fitc ready to use for immunofluorescence rabbit anti lamda conjugated to fluorescein isothiocyanate item493 1 nos 495 492 moun / t staining reagent item494 1 nos 496 493 blocking reagent item495 1 nos 497 493.01 d reagents and other items reagents for coagulation tests note: bidder should be submit authorization, proprietarycertificate and manufacturer rate list. 498 493.02 coagulation analyser diagnostica stago ( st art 4 ) 499 494 ( 1 ) cal.thromboplastin / neoplastine with solvent ( sta neoptimal 5 ) item496 1 nos 500 495 ( 2 ) pt neoplastin ( sta neoptimal 10 ) item497 1 nos 501 496 ( 3 ) aptt activated partial thromoplastin ( c.k.prest 2 ) item498 1 nos 502 497 ( 4 ) fib.2 fibrinogen ( sta fibrinogen 5 ) item499 1 nos 503 498 ( 5 ) calcium cloride ( sta cacl2 0.025 m item500 1 nos 504 499 other items for coagulometer ( 1 ) cuvette ( sta cuvettes ) item501 1 nos 505 500 ( 2 ) fintips for start 4 1.25 ml item502 1 nos 506 501 ( 3 ) steel bals ( sta steel bals item503 1 nos 507 502 ( 4 ) thermal paper size 50 mm item5044 1 nos 508 502.01 items reagents & consumables for coagulation tests sysmex model: ca 50 509 503 ( 1 ) actim item504 1 nos 510 504 ( 2 ) erba protime ls item505 1 nos 511 505 ( 3 ) erba actime item506 1 nos 512 506 ( 4 ) reaction tubes su 40 item507 1 nos 513 507 ( 5 ) erba factor vii deficient plasma item508 1 nos 514 508 ( 6 ) erba factor x deficient plasma item509 1 nos 515 509 ( 7 ) erba factor ix deficient plasma item510 1 nos 516 510 ( 8 ) erba factor viii deficient plasma item511 1 nos 517 511 ( 9 ) thermal printer paper ( printer paper roll kit ) item512 1 nos 518 512 ( 10 ) erba calcium chloride item513 1 nos 519 513 ( 11 ) erba control p item514 1 nos 520 514 ( 12 ) erba control n item515 1 nos 521 515 ( 13 ) erba control n plus item516 1 nos 522 516 ( 14 ) erba control p plus item517 1 nos 523 517 ( 15 ) control plasma n item518 1 nos 524 517.01 reagents & consumables for fully automated esr analyzer model: vasmatic cube 80 525 518 ( 1 ) vasmatic esr controls normal item519 1 nos 526 519 ( 2 ) abnormal item520 1 nos 527 520 ( 3 ) transponder item521 1 nos 528 521 ( 4 ) esr vaccutainer item522 1 nos 529 521.01 for electronic blood cell counter sysmex xs 800i 530 521.02 items reagents electronic blood cell counter sysmex xs 800i 531 522 ( 1 ) cell pack pk dcl item523 1 nos 532 523 ( 2 ) stromatolyser 4dl ffd 200a item524 1 nos 533 524 ( 3 ) sulpholyser sls 220 a item525 1 nos 534 525 ( 4 ) stromatolyser 4ds item526 1 nos 535 526 ( 5 ) cell clean item527 1 nos 536 527 ( 6 ) control xs 800i normal item528 1 nos 537 528 ( 7 ) control xs 800i tri level item529 1 nos 538 528.01 reagents for 6 part blood cell counter sysmex xn 10 539 529 ( 1 ) cell pack dcl item530 1 nos 540 530 ( 2 ) cell pack dfl item531 1 nos 541 531 ( 3 ) sulfolyser item532 1 nos 542 532 ( 4 ) flurocell wdf item533 1 nos 543 533 ( 5 ) flurocell wnr item534 1 nos 544 534 ( 6 ) lysercell wnr item535 1 nos 545 535 ( 7 ) lysercell wdf item536 1 nos 546 536 ( 8 ) fluorcell ret item537 1 nos 547 537 ( 9 ) cell clean item538 1 nos 548 538 ( 10 ) xn check low ( l1 ) control item539 1 nos 549 539 ( 11 ) xn check normal ( l2 ) control item540 1 nos 550 540 ( 12 ) xn check high ( l3 ) control item541 1 nos 551 541 ( 13 ) xn check ( tri level ) control item542 1 nos 552 542 ( 14 ) edta vacutec tubes item543 1 nos 553 542.01 items electronic blood cell counter3 part abx sas model: horibo abx micros es 60 554 543 ( 1 ) minidil lmg item544 1 nos 555 544 ( 2 ) abx lyse bio item545 1 nos 556 545 ( 3 ) abx cleaner item546 1 nos 557 546 ( 4 ) minoclair item547 1 nos 558 547 ( 5 ) minitrol 16 ( 2l ) item548 1 nos 559 548 ( 6 ) minitrol 16 ( 2n ) item549 1 nos 560 549 ( 7 ) minotrol 16 ( 2h ) item550 1 nos 561 550 ( 8 ) minotrolcalibrator item551 1 nos 562 551 ( 9 ) printer roll item552 1 nos 563 551.01 strips for urine analyzers model: aution eleven ae 4020 564 552 ( 1 ) aution screen item553 1 nos 565 553 ( 2 ) urine sticks tlt 10 a item554 1 nos 566 554 ( 3 ) aution sticks 10 pa item555 1 nos 567 554.01 strips for urine analyzers model: uro dipcheck 300 568 555 1 urine analyzer strips 10 parameters item556 1 nos 569 556 2 mas ua dip tube control bi level item557 1 nos 570 557 3 uro dipcheck 300 calibration strip item558 1 nos 571 557.01 consumables for histopathology slide cover slipper model: clear vue 572 558 1 superfrost, microscopic slides ground edge 90 deg, 76x26 mm. item559 1 nos 573 559 2 clear vue mountant item560 1 nos 574 560 3 cover slip hoppers 24 mmx50mm #1.5 item561 1 nos 575 560.01 kits & consumables for hplc machine model d 10 576 561 1 diabetic control. bi item562 1 nos 577 562 2 hemoglobin a2 control item563 1 nos 578 563 3 eqas haemoglobin prog item564 1 nos 579 564 4 d 10 dual reorder pack item565 1 nos 580 565 5 d 10 microvials 0.1x1.5 ml item566 1 nos 581 566 6 d 10 printer paper, 1 item567 1 nos 582 566.01 consumables for automated cryostat ( frozen microtome ) model: hm525 cryostat & automated roroty microtome model 355 s 583 567 1 cryomatrix item568 1 nos 584 568 2 cryostat oil item569 1 nos 585 569 3 mx 35 primer low profile disposable blades item570 1 nos 586 569.01 consumables for histopathology tissue embedding station model: ecl350 587 570 1 plastic embedding rings ( item code ec 351 102 ) item571 1 nos 588 571 2 plastic tissue embedding cassettes with lid ( item code ec 351 103 ) item572 1 nos 589 572 3 metallic base moulds ( item code ec 351 112 ) item573 1 nos 590 573 4 histowax ( item code ec 351 1118 ) item574 1 nos 591 573.01 consumables kits for lbc machine model: thin prep 2000 592 574 ( 1 ) complete pack of gyn kits for lbc part code no70096 004 item575 1 nos 593 575 ( 2 ) complete pack of non gyn kits for lbcpart code no234000 item576 1 nos 594 576 ( 3 ) eosin solution0.2% 5 lit part code no8703 item577 1 nos 595 577 ( 4 ) hematoxilin modified ( harris, gill ii pap1: 5 lit part code no8708 item578 1 nos 596 578 ( 5 ) papanicolaou 2b orange ii; 5 lit part code no 8720 item579 1 nos 597 579 ( 6 ) papanicolaou 3b ea50; 5 lit part code no 8723 item580 1 nos 598 579.01 items reagents &consumables for serum, urine electrophoresis machine model: pretty 599 580 1 serum protein kit item581 1 nos 600 581 2 alkaline hemoglobins kit item582 1 nos 601 582 3 destain solution conc: product code sre 201m item583 1 nos 602 582.01 consumables for cytocentryfuge machine model: cytospin 4 thermo 603 583 1 tpx reusable chamber with caps product code a 78710018 item585 1 nos 604 584 2 ez mega funnels with filter cards for large vol. samples product code a 78710001 item586 1 nos 605 585 3 double cyto funnels with filter cards product code 5991039 item587 1 nos 606 586 4 single cyto funnels with brown filter cards product code 5991043 item588 1 nos 607 587 5 single cyto funnels with white filter cards product code 5991040 item589 1 nos 608 588 6 white filter cards product code 5991022 item590 1 nos 609 589 7 polysine slides for cytology product code 6776215 item591 1 nos 610 589.01 items reagents & consumables for roche diagnostic model urysis 1100 611 590 1 urine analyzer strip compur 10 ( roshe ) ( propriety items for urine analyser ) item592 1 nos 612 591 2 tharmal paper roll 110 mm item593 1 nos 613 592 3 control test m calibration strip item594 1 nos 614 592.01 items reagents & consumables for fully automated esr analyzer model: model no. alifax suyog diagno 615 593 1 universal card for 10000 tests item595 1 nos 616 594 2 universal card for 4000 tests item596 1 nos 617 595 3 universal card for 20000 tests item597 1 nos 618 596 4 latex control kit 06 test ( quality control kit ) item598 1 nos 619 597 5 latex control kit 30 test ( quality control kit ) item599 1 nos 620 598 6 latex caliber kit 6 tests item600 1 nos 621 598.01 for electronic blood cell counter fully automated 5 part differential heamatology analyzer model: yumizen h 2500 622 599 ( 1 ) abx basolyse item601 1 nos 623 600 ( 2 ) abx cleaner item602 1 nos 624 601 ( 3 ) abx diluent item603 1 nos 625 602 ( 4 ) abx fluocyte item604 1 nos 626 603 ( 5 ) abx lysebio item605 1 nos 627 604 ( 6 ) abx monoclair item606 1 nos 628 605 ( 7 ) abx minocal ( calibrator ) item607 1 nos 629 606 ( 8 ) abx nucedif item608 1 nos 630 607 ( 9 ) difftrol ( control ) normal item609 1 nos 631 608 ( 10 ) difftrol ( control ) low item610 1 nos 632 609 ( 11 ) difftrol ( control ) high item611 1 nos 633 610 ( 12 ) minotrol retic ( retic control ) ( 2n ) item612 1 nos 634 611 ( 13 ) minotrol retic ( retic control ) ( 1l1h ) item613 1 nos 635 611.01 items for automated haematology slide stainer model: aerospray haematology 636 612 ( 1 ) hematology buffer ph 6.8 / 7.2 item614 1 nos 637 613 ( 2 ) hematology thiazinstain item615 1 nos 638 614 ( 3 ) hematology eosin stain item616 1 nos 639 615 ( 4 ) hematology aerofixadditive for methanol item617 1 nos 640 615.01 items for urine chemistry / sediment microscopic analyser model labureader plus & urised mini model: 77 electronica hungry 641 616 ( 1 ) urised cuvette item618 1 nos 642 617 ( 2 ) labustrip u11 urine strips item619 1 nos 643 617.01 e blood collection tubes & vacutainer 644 618 1 ) clot activator for serum with gel 3.5 ml, 13 x 75mm with yellow cap item620 1 nos 645 619 clot activator for serum with gel 5 ml, 13 x 100 mm with yellow cap item621 1 nos 646 620 evacuated blood collection tube with spray dried k2edta with lavender cap item622 1 nos 647 621 sodium citrate evacuated tube with tube in tube technology sealed from the top to avoid citrate leakagefor coagulation test with vacuum ( with na citrate 0.109 mi, 3.2% ) item623 1 nos 648 622 evacuated tube for silica clot activator / silicon coated made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml. item624 1 nos 649 623 blood collection needle 21 or 22 gauge with cap for evacuated tube. item625 1 nos 650 624 blood collection needle 21 or 22 gauge with cap and safety lock for evacuated tube. item626 1 nos 651 625 evacuated tube for spray coated with lithium heparinmade of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml. item627 1 nos 652 626 evacuated tube for spray coated with sodium heparin made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 4.0 ml. item628 1 nos 653 627 evacuated tube for spray coated with sodium fluoride ( 3mg. ) , na2edta ( 6mg. ) made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 2.0 ml. item629 1 nos 654 628 evacuated tube for buffered citrate ( 0.129m, 0.6ml. ) for esr made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 1.6 ml. item630 1 nos 655 629 evacuated tube needle holder item631 1 nos 656 630 blood lancet for high blood flow. item632 1 nos 657 631 contact activated blood lancet for high blood flow. item633 1 nos 658 632 luerlock access devise for blood collection from cannula for ipd sample item634 1 nos 659 633 leak & puncture resistant sharp collector with brackets facilitating one handed disposable, satisfying niosh guideline on sharps disposal container, made of non toxic colorants and compliance with coneg heavy metal limits. it should be virgin plastic and chlorinated free. capacity – 5.4 litre. item635 1 nos 660 634 safety portable box for disposal of hypodermic needles. it should be single, one time use to prevent risk of needle stick injuries to healthcare worker handling sharps, should be made up of virgin plastic no electricity required. able to cut the needle from the hub of the syringe, container with yellow casing and cap of volume .3lts where, exterior can be cleaned with 70% alcohol. puncture resistant hard and can be locked after the needles are encapsulated. item636 1 nos 661 635 tourniquets should be stretch latex free width heavy duty coloured elastic delaine colourful item637 1 nos 662 635.01 paediatric collection products 663 636 clot activator paediatric blood collection tubes with cap for serum item638 1 nos 664 637 paediatric blood collection tubes with spray dried k2 edta. item639 1 nos 665 638 23g x 0.75 inch needle x 7 inch tubing safety lok blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle for paediatric and microbiology. item640 1 nos 666 638.01 urine sampling products 667 639 kit for routine urinalysis comprising of: sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device ( allows for the transfer of urine to one or more tubes without exposure to specimen ) and 8.0 ml, 16 x 100 mm evacuated plastic conical tube ( red& yellow closure cap ) with mercury free preservative ( ethyl paraben + sodium propionate + chlorhexidine ) providing sample integrity for 72 hours at room temperature, for urinalysis testing. use of an evacuated tube system ensures proper urine to preservative ratio.it should be us fda certified. item641 1 nos 668 640 kit for routine urinalysis comprising of : sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device ( allows for the transfer of urine to one or more tubes without exposure to specimen ) and 10.0 ml, 16 x 100 mm evacuated plastic round bottom tube ( yellow closure cap ) for urinalysis testing” batch wise sterility / pyrogenicity / toxicity certificate should be given. adequate combustion data to prove that it is safe for the environment upon incineration. firm should provide training to technicians / nurses regularly. clinical services should be documented by the company. item642 1 nos 669 641 kit for routine urinalysis comprising of: sterile straw as integrated transfer device ( allows for the transfer of urine to one or more tubes without exposure to specimen ) and8.0 ml, 16 x 100 mm evacuated plastic conical tube ( red& yellow closure cap ) with mercury free preservative ( ethyl paraben + sodium propionate + chlorhexidine ) providing sample integrity for 72 hours at room temperature, for urinalysis testing. use of an evacuated tube system ensures proper urine to preservative ratio.it should be us fda certified.batch wise sterility, pyrogenicity and toxicity certificate should be given. adequate combustion data to prove that it is safe for the environment upon incineration. firm should provide training to technicians / nurses regularly. clinical services should be documented by the company; pack size 1 x 100 item643 1 nos 670 642 urine kit for culture &sensetivity testing:sterile screw cap collection cup capacity of 120 ml sample volume with integrated transfer device ( allows for the transfer of urine to one or more tubes without exposure to specimen ) and 4.0 ml, 13 x 75 mm evacuated plastic c&s preservative tube ( grey closure cap ) with preservation additive of boric acid + sodium formate + sodium borate , providing sample integrity for 48 hours at room temperature , for urine microbiology testing.it should be us fda certified. use of an evacuated tube system ensures proper urine to preservative ratiobatch wise sterility, pyrogenicity and toxicity certificate item644 1 nos 671 642.01 other items / miscellaneous items 672 643 adhesive tape / micropore item645 1 nos 673 644 aluminum test tube rack ( 12 hole ) item646 1 nos 674 645 anti human globulin ( coomb’s test ) item647 1 nos 675 646 auto pipette tips 1 ml fix item648 1 nos 676 647 auto pipette tips 10 μl item649 1 nos 677 648 auto pipette tips 100 μl item650 1 nos 678 649 auto pipette tips 100 1000 μl item651 1 nos 679 650 auto pipette tips 2 ml fix item652 1 nos 680 651 auto pipette tips 5 ml fix item653 1 nos 681 652 auto pipette tips 10 ml fix item654 1 nos 682 653 auto pipette tips 200 1000 μl variable item655 1 nos 683 654 auto pipette tips 20 200 μl variable item656 1 nos 684 655 auto pipette tips 50 μl item657 1 nos 685 656 bone marrow aspiration needle ( jamshidi ) item658 1 nos 686 657 bone marrow aspiration needle ( salah’s ) ss item659 1 nos 687 658 bone marrow aspiration needle ( disposable ) item660 1 nos 688 659 lumber puncture needle ( disposable ) item661 1 nos 689 660 bovine albumin 4% higher titer will be preferred item662 1 nos 690 661 diamond pencil export quality item663 1 nos 691 662 disposable needle 22 g item664 1 nos 692 663 disposable needle 24 g item665 1 nos 693 664 disposable plastic gloves 6.5” item666 1 nos 694 665 disposable surgical blade / scalpel blade ( 22 no ) item667 1 nos 695 666 disposable surgical gloves latex rubber 6.5” item668 1 nos 696 667 disposable surgical gloves latex rubber 7.0” item669 1 nos 697 668 disposable surgical gloves latex rubber 7.5” item670 1 nos 698 669 disposable syringes 2 ml item671 1 nos 699 670 disposable syringes 5 ml item672 1 nos 700 671 disposable syringes 10 ml item673 1 nos 701 672 disposable syringes 20 ml item674 1 nos 702 673 disposable needle 22 g item675 1 nos 703 674 disposable needle 24 g item676 1 nos 704 675 esr kits. 10 tubes with cups and stand item677 1 nos 705 676 filter papers ( whatman ) no 1 item678 1 nos 706 677 glass marking pencil red item679 1 nos 707 678 glass marking pencil white item680 1 nos 708 679 l.p.needle 22g item681 1 nos 709 680 l.p.needle 23g item682 1 nos 710 681 spirit lamp ( ss ) item683 1 nos 711 682 litmus paper ( indicator paper red ) item684 1 nos 712 683 litmus paper ( indicator paper blue ) item685 1 nos 713 684 micro pipette 1000 μl item686 1 nos 714 685 micro pipette 40 200 μl variable item687 1 nos 715 686 micropipette 20μl fix item688 1 nos 716 687 micropipette 50μl fix item689 1 nos 717 688 micropipette 10μl fix item690 1 nos 718 689 micropipette 100μl fix item691 1 nos 719 690 micropipette 5ml fix item692 1 nos 720 691 micropipette 1ml fix item693 1 nos 721 692 micropipette 2ml fix item694 1 nos 722 693 plastic bucket 50 lit with lid item695 1 nos 723 694 poly vials 5 ml ( plain ) item696 1 nos 724 695 poly vials edta 5 ml item697 1 nos 725 696 reagent rack plastic item698 1 nos 726 697 k3 edta vials double cap item699 1 nos 727 698 sodium citrate vials ( 3.2% ) 5 ml for pt item700 1 nos 728 699 polythene bagsyellow, blue, black for bmw item701 1 nos 729 700 pregnancy test ( hcg card test ) item702 1 nos 730 701 stethoscopes item703 1 nos 731 702 sticker for cytology size ( 2x1.5 cm ) item704 1 nos 732 703 stop watch item705 1 nos 733 704 syringe cutter / needle destroyer isi mark item706 1 nos 734 705 tournicates item707 1 nos 735 706 tissue paper item708 1 nos 736 707 urine container ( plastic ) non sterile 50 ml item709 1 nos 737 708 urine strip for albumin & sugar item710 1 nos 738 709 urine strip for ketone bodies& sugar item711 1 nos 739 710 urine strip for micro albinuria ( micral strips ) item712 1 nos 740 711 urine strip for multiple test ( 7 parameter ) item713 1 nos 741 712 urine strip for occult blood item714 1 nos 742 713 vacutainertubes 5 ml ( blood collection vial edta ) item715 1 nos 743 714 wooden spatula pap smear ( ayre ) item716 1 nos 744 715 cyto brush for pap smear item717 1 nos 745 716 thermal paper roll 75 mm item718 1 nos 746 717 thermal paper roll 110 mm item719 1 nos 747 717.01 g. list of glassware nnote: sample may be asked before approval item no 1 to10 748 718 micro glass slides, polished edges, lint free ( transparent ) size 75x25x1.35mm 50 slides in each pkts item720 1 nos 749 719 micro glass slides, polished edges, lint free ( transparent ) size 75x25x1.0 mm 50 slides in each pkts item721 1 nos 750 720 micro glass slides, polished edges, lint free ( transparent ) size 76x26x1.35 mm 50 slides in each pkts item722 1 nos 751 721 micro glass slides, polished edges, lint free ( transparent ) size 76x26x1.0 mm 50 slides in each pkts item723 1 nos 752 722 cover slip english glass / imported lint free smooth edges ( transparent ) size 22x50 no. 1 item724 1 nos 753 723 cover slip english glass / imported lint free smooth edges ( transparent ) size 22x50 no. 1 item725 1 nos 754 724 cover slip english glass / imported lint free smooth edges ( transparent ) size 22x50 no. 0 item726 1 nos 755 725 cover slip english glass / imported lint free ( transparent ) size 22x22 no. 1 item727 1 nos 756 726 cover slip english glass / imported lint free ( transparent ) size 22x22 no. 1 item728 1 nos 757 727 cover slip english glass / imported lint free ( transparent ) size 22x22 no. 0 item729 1 nos 758 728 cover slip english glass / imported lint free ( transparent ) size 18x18 no. 1 item730 1 nos 759 729 cover slip english glass / imported lint free ( transparent ) size 18x18 no. 1 item731 1 nos 760 730 cover slip english glass / imported lint free ( transparent ) size 18x18 no. 0 item732 1 nos 761 731 high profile microtome disposable blade ( 50 blade each pkt. ) item733 1 nos 762 732 low profile microtome disposable blade ( 50 blade each pkt. ) item734 1 nos 763 733 rubber teat for dropper item735 1 nos 764 734 dropper big size ( glass ) item736 1 nos 765 735 dropper medium size ( glass ) item737 1 nos 766 736 capillary tubes item738 1 nos 767 737 test tube brush item739 1 nos 768 738 beaker with spout 1000 ml item740 1 nos 769 739 beaker with spout 500 ml item741 1 nos 770 740 beaker with spout 50 ml item742 1 nos 771 741 conical flask flat bottom 500 ml item743 1 nos 772 742 measuring cylinder graduated 1000 ml item744 1 nos 773 743 measuring cylinder graduated 500 ml item745 1 nos 774 744 measuring cylinder graduated 100 ml item746 1 nos 775 745 funnel ( big ) item747 1 nos 776 746 funnel ( medium ) item748 1 nos 777 747 museum jars ( acrelic, clear transpernt with inner plate & molded lid ) size 15x10x30 item749 1 nos 778 748 museum jars ( acrelic, clear transpernt with inner plate & molded lid ) size 15x12x30 item750 1 nos 779 749 reagent bottle 2000 ml item751 1 nos 780 750 reagent bottle 60 ml item752 1 nos 781 751 reagent bottle 120 ml item753 1 nos 782 752 reagent bottle 250 ml item754 1 nos 783 753 reagent bottle 500 ml item755 1 nos 784 754 reagent bottle 1000 ml item756 1 nos 785 755 canada blossom bottle 20 ml item757 1 nos 786 756 coupling jar item758 1 nos 787 757 wash bottle plastic 500 ml item759 1 nos 788 758 urino meter item760 1 nos 789 759 esbach’s albino meter item761 1 nos 790 760 hb tube round top / gdr, isi mark ( sahli, s ) item762 1 nos 791 761 hb pipette 20μ top isi mark with rubber teat ( sahli ) item763 1 nos 792 762 pertidish 110 mm ( glass ) item764 1 nos 793 763 rbc pipette top / gdr isi mark item765 1 nos 794 764 wbc pipette top / gdr isi mark item766 1 nos 795 765 stirrer for h.b.meter ( sahli ) item767 1 nos 796 766 test tubes 12x75 mm ( glass ) item768 1 nos 797 767 test tubes 12x100 mm ( glass ) item769 1 nos 798 768 test tubes 18x150 mm with rim ( glass ) item770 1 nos 799 769 bulb for microscopes halogen ( 6v 12 w ) make; philips, labomed item771 1 nos 800 769.01 other items 801 770 hemocytometer improved, item772 1 nos 802 771 haemoglobbino meter ( sahli method ) item773 1 nos 803 772 slide box ( plastic ) 50 slides capacity . item774 1 nos 804 773 slide box ( plastic ) 100 slides capacity product size slide capacity100 color white height ( english ) 1.25 in.height ( metric ) 3.8cmlength ( english ) 8.25 in.length ( metric ) 21cmmaterialabs plasticwidth ( english ) 6.375 in.width ( metric ) 16cmitem description100 slide box; dimensions ( l x w x h ) 8.25 x 6.375 x 1.25 in. ( 21 x 16 x 3.8cm ) item775 1 nos 805 774 slide tray ( aluminium ) .the aluminium slide trays have elevated ridges to separate 76 x 26mm slides and finger holes for easy removal. ideal for drying fresh mounts. capacity: 20 slides dimensions: length 330mm x width 190m item776 1 nos 806 774.01 for 5 part blood cell counter sysmex xn l 350 n ( reagent for 5 part blood cell counter make sysmex model xnl 350 ) 807 775 ( 1 ) cell pack dcl20l item777 1 nos 808 776 ( 2 ) cell pack dfl 1.5x02 lit item778 1 nos 809 777 ( 3 ) sulfolyser 3x500 ml item779 1 nos 810 778 ( 4 ) lysercell wdf item780 1 nos 811 779 ( 5 ) fluorcell wdf 2x42 ml item781 1 nos 812 780 ( 6 ) fluorcell ret 1x24 ml item782 1 nos 813 781 ( 7 ) cell clean item783 1 nos 814 782 ( 8 ) xn l check low item784 1 nos 815 783 ( 9 ) xn l check normal item785 1 nos 816 784 ( 10 ) xn l check high item786 1 nos...

Medical College - Rajasthan

24948880 supply of consumable reagents and chemical for pathology item no 03 1. disposable syringes 5 ml x 2. disposable syringes 10 ml x 3. disposable syringes 20 ml x 4. disposable syringes 2 ml x 5. disposable vacutainer needles 24 gauge 6. disposable needles 22 gauge 7. urine container plastic with lid 30 ml 8. rubber tourniquate 9. urine strip 10.. urine strip 4 parameter 11. multi parameter urine strips 12. stool occult blood kit 13. giemsa stain powder 14. methanol ch3 oh = 32.04 purity 15. distilled water 16. micro capillary tube (90mm length 17. cover slip 1. 22 mm 18. cover slip 2. 22 x50 mm 19. cover slip 3. 22 x 22 mm 20. glass test tube 12 x 100 mm 21. pregnancy card 22. paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 23. paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 24. reticulocite fluid brilliant cresyle blue 25. diamond pencill 26. micropipettes (50 mm) 27. micropipettes (100mm) 28. sodium hypochlorite 29. esr pipette disposable 30. dpx meuntant 31. spirit 32. rapid pap kit 33. iron stand for staining 34. slide tray (horizontal) 35. slide tray (vertical) 36. coplin jars 37. graduated cylinder small 200 ml 38. graduated cylinder large 500 ml 39. sample transport racks ( big plastic ) 40. sterile lancets for blood grouping 41. sharps containers with lid and lock 42. plastic funnel 10 cm diameter 43. hematoxylin stain powder 44. eosin powder 45. modified neubaurs chamber 46. zn stain kit 47. bulbs halogen for microscope 6v 20 watts 48. filter paper full size nohl 49. formalin tablets 50. disposable bone marrow aspiration needle 18 gauge 51. disposable bone marrow aspiration needle 20 gauge 52. disposable spinal needle 22 gauge 53. betadin 54. eye towel 55. xylene 56. slide box plastic 57. slide box wooden 58. absolute alcohol 59. methyl alcohol 60. dustbin 61. coplin jar (glass) 62. 3 amino propyl triethoxysilane 63. acetone 64. albumin egg flaskes 65. alcian blue 66. ammonium sulphate 67. bees wax 68. benedict solution ( reagent ) 69. brilliant cresyl blue stain powder 70. cassettes s.s.3cmx2.scm 71. cd 45 kit (6ml) 72. chloroform 73. ck cocktail kit (6m1) 74. combistix 75. copper sulphate powder 76. dextrose anhydrous 77. diamino benzidine (dab) 78. disodium hydrogen phosphate (na2hpo4) 79. disposable plastic test tube 75x12 ml 80. disposable vial 5m1 81. drabkin solution with hemoglobin standard 82. dropper plastic 3m1 83. eosinophil diluting fluid 84. er diagnostic kit (6m1) 85. ferric ammonium sulphate 86. field stain a & b 87. fluoride vial for blood sugar 88. formaldehyde 37 40% 89. formic acid 90. french chalk powder 91. giemsa stain solution 92. glacial acetic acid 93. glass cover slip 18x18mm 94. glass pipette 20cm long 95. halogen bulb for mp qbc machine 96. hb a/c kit 97. glycerin a.r. 98. hemocytometer 99. her 2/niu kit (6m1) ( 6 ml x 4) 100. hydrochloric acid hct n/10 101. hydrogen peroxide (liquid 30%) 102. ketostix 103. knife sharpner powder 2000 micro abrasive powder 104. knife sharpner powder 3000 micro abrasive powder 105. lead oxide powder 106. leishmain stain powder 107. leishmain stain (liquid) solution 108. liquid ammonia 109. liquid paraffin 110. mal mal cloth 111. measuring cylinder 100 ml glass 112. measuring cylinder 250 ml 113. mercuric oxide 114. methyline blue solution 115. micropipette, auto pipette (a) 10 fix volume 116. micropipette, auto pipette (a) 100 fireed 10% 117. micropipette, auto pipette (a) 1000 fireed 10% 118. micropipette, auto pipette (a) 50 fireed volume 119. micropipette, auto pipette (multichannel) variable 50 300 micro ltr channel 8 or 12 120. micro slides 75x25x1.25 to 1.5 mm (glass) 121. microtome knife 120 mm 122. microtome knife 150 mm 123. micro ambrary 3000 micro gm 124. mp qbc oil 125. multistix 126. museum specimen glass jar with glass lid (7x3.5x5) 127. museum specimen glass jar with glass lid (6x3x10) 128. museum specimen glass jar with glass lid (4x2x8) 129. museum specimen glass jar with glass lid (6x4x10.5) 130. museum specimen glass jar with glass lid (7.5x3.5x12) 131. oil 3 : 1 132. paraffin wax 60 62 with ceresin 133. pasteur pipette 134. picric acid 135. phenyl solution 136. pipettes for hemoglobin 20 micro ltr. 137. plain vial 5m1 138. plain vial screw cap 3 ml with sticker 139. plastic beaker 100 ml 140. plastic casettes 141. plastic beaker 200 ml 142. plastic cuvettes with stirrer for coagu!ation analyzer model coastat 1 fibran 20 143. plastic cuvettes with stirrer for coagulation analyzer model fibran 20 144. plastic test tube screw cap with sticker 145. platelet diluting fluid 146. poly l lysine 147. polymer hrp kit 148. potassium alum 149. potassium ferrocyanide 150. pr diagnostic kit (6m1) 151. prussian blue stain 152. rbc diluting fluid 153. rbc pipettes 154. schiffs reagent 155. semen diluting fluid 156. silver nitrate 157. sodium nitrate 158. sodium chloride 159. sodium citrate powder 160. sodium citrate 3.8% 161. blood collection vacutech with 1.8 ml marking for coagulation analyser 162. sodium nitroprusside 163. sodium thiosulphate 164. spirit lamp aluminium 165. staining jar (glass) 13x11x7 cm 166. staining jars 100m1 & 500 ml 167. sulphur powder / sulphur precipitate 168. sulphuric acid 169. test tube brushes for cleaning tubes small 170. test tube brushes for cleaning tubes large 171. test tube graduated conical 15 ml 172. thermal printer paper 173. thermometer 174. thymol 175. tips blue (1000) for micropipette 176. urea 177. wbc diluting fluid 178. wbc pipette blood cell counter reagents suit 179. cell clean/ equivalent 50 ml for sysmex xs 800i 180. antiseptic solution 181. coated slides 182. filter paper round 183. formaline 184. glass test tubes 4 185. hematoxylene powder 186. metallic slide holders 187. micropipette 10 200m1 188. micropipette 100 1000m1 189. micropipette variable 50 micro kr to 200 190. tincture iodine 191. vacutte holder with vacutte needles size/ g4920 192. pas staining kit 193. muci carmine staining kit 194. msn staining kit 195. perls staining kit 196. mts staining kits 197. three one oil 198. boxes for block 161/2x 10y2 x 2 1/2 199. white cloth 200. antiseptic solution 201. ammonia solution 202. wbc diluting fluid for tlc 203. trbc fluid 204. test tube holder 205. test tube 10m1 206. match box 207. adhesive tape 208. spirit rectified 209. peroxide acid 210. bond tm wash solution 10x 211. bond tm epitope retrival 2 212. bond tm epitope retrival 1 213. bond dewax solution 214. bond aspirating probe cleaning kit 215. bond polymer refine detection 216. bond open container 7m1 217. leica universal label 3000/pk 218. bond mixing stations 219. bond universal cover tiles 220. microsystem plus slide for inc 1.0mm) ( 25.5 x 75.5 x 221. slide label & printer ribbon 222. cea 223. gfap 224. hmb45 225. desmin 226. ema 227. bcl2 228. hmwck 229. ck7 230. er 231. cd 13 232. cd 5 233. cd 23 234. ck 20 235. ki 67 236. cd 10 237. synaptophysin 238. pr 239. mpo 240. pax 5 241. cd 3 242. wt 1 243. s 100 244. ae 1/ae3 245. sma 246. inhibin 247. hpv 248. p16 249. eber 250. lmp 1 251. c4d 252. amyloid 253. her2 neu 254. vimentin 255. chromogranin for manual ihc staining 256. antigen retrieval buffer diva decloaker 20x 257. background snipper 258. wash buffer tbs autowash buffer 40x 259. mach2 hrp polymer detection kit 260. polylysine coated slides 261. peroxidated block 1 262. betazoid dab chromogen 263. betazoid dab substrate buffer for cytocentrifuge 264. filter card for cytology (funnel reusable) 265. cell slides single circle coated 266. cell slides single circle uncoated 267. double cytology funnel (reusable) 268. cell clip for cell clipotor 269. single cytology funnel (for cryostat) 270. cryomatrix (optimal cooling tool gel coolant) 271. sarasil disinfectant 272. microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 273. lyser cell(wnr) 274. fluorocell (ret) 275. fluorcell plt (plt) 276. basic fucshin 277. sodium metabisulfite 278. acetic acid solution 3 % 279. nuclear fast red 280. carmine 281. ferric chloride 282. metanil yellow 283. acid fucshine 284. phospho molybdic acid 285. methyl blue 286. iodine 287. potassium permanganate 288. potassium metabisulfite 289. iron alum 290. gold chloride 291. oxalic acid 292. aquous phenol 293. toluedene blue 294. silver nitrate 295. safferenine 0 ...

Rajasthan University - Rajasthan

20179813 tender for ln2 cryostat, temperature controller, vacuum pump and lcr meter, ln2 cryostat, temperature controller, vacuum pump and lcr meter...

Amity University - Rajasthan

20176882 supply of scientific equipments: ln2 cryostat, temperature controller, vacuum pump and lcr meter=> open tender...

Hindustan Steel Works Construction Limited - Rajasthan

19848051 supply, installation, testing, commissioning and handover of medical equipments for 1st renewal of medical college, churu rajasthan: 31 dept. of pathology department of pathology fully motorized microtome 32 dept. of pathology dept of pathology tissue processor 33 dept. of pathology department of pathology fully automatic cryostat 34 dept. of pathology fully automatic immuno histochemistry setup 35 dept. of pathology dept of pathology grossing station 36 dept. of pathology hot plate and cold plate 37 dept. of pathology fully automatic coagulation analyzer 38 dept. of pathology dept of pathology electrophoresis set up 39 dept. of pathology automatic high speed slide scanner 40 dept. of pathology fully automated high throughput multi strainer workstation 41 dept. of pathology fully automated cover slipping workstation 42 dept. of pathology fully automated embedding system 43 dept. of pathology pentahead microscope 44 dept. of pathology dept of pathology models 45 dept. of pathology pathology instruments 46 dept. of pathology microscope for diagnostic and research work 47 dept. of pathology deca head microscope 48 dept. of pathology 3 part hematology analyzer 49 dept. of pathology 5 part hematology analyzer dept. of pathology total 50 common department dept of pathology and forensic manual rotary microtome 51 common department pathology and microbiology water purification system 52 common department waste water treatment unit for pathology, microbiology labs 53 common department dept of pathology , micro, forensic binocular microscope 54 common department dept of pathology, microbiology and forensic binocular microscope for faculty => open tender...

Hindustan Steel Works Construction Limited - Rajasthan

19779882 supply, installation, testing, commissioning and handover of medical equipments: 31 dept. of pathology department of pathology fully motorized microtome 32 dept. of pathology dept of pathology tissue processor 33 dept. of pathology department of pathology fully automatic cryostat 34 dept. of pathology fully automatic immuno histochemistry setup 35 dept. of pathology dept of pathology grossing station 36 dept. of pathology hot plate and cold plate 37 dept. of pathology fully automatic coagulation analyzer 38 dept. of pathology dept of pathology electrophoresis set up 39 dept. of pathology automatic high speed slide scanner 40 dept. of pathology fully automated high throughput multi strainer workstation 41 dept. of pathology fully automated cover slipping workstation 42 dept. of pathology fully automated embedding system 43 dept. of pathology pentahead microscope 44 dept. of pathology dept of pathology models 45 dept. of pathology pathology instruments 46 dept. of pathology microscope for diagnostic and research work 47 dept. of pathology deca head microscope 48 dept. of pathology 3 part hematology analyzer 49 dept. of pathology 5 part hematology analyzer 50 common department dept of pathology and forensic manual rotary microtome 51 common department pathology and microbiology water purification system 52 common department waste water treatment unit for pathology, microbiology labs 53 common department dept of pathology , micro, forensic binocular microscope 54 common department dept of pathology, microbiology and forensic binocular microscope for faculty => open tender...

Hindustan Steel Works Construction Limited - Rajasthan

19584385 supply, installation, testing, commissioning and handover of medical equipments for 1st renewal of medical college, churu rajasthan: 31 dept. of pathology department of pathology fully motorized microtome 32 dept. of pathology dept of pathology tissue processor 33 dept. of pathology department of pathology fully automatic cryostat 34 dept. of pathology fully automatic immuno histochemistry setup 35 dept. of pathology dept of pathology grossing station 36 dept. of pathology hot plate and cold plate 37 dept. of pathology fully automatic coagulation analyzer 38 dept. of pathology dept of pathology electrophoresis set up 39 dept. of pathology automatic high speed slide scanner 40 dept. of pathology fully automated high throughput multi strainer workstation 41 dept. of pathology fully automated cover slipping workstation 42 dept. of pathology fully automated embedding system 43 dept. of pathology pentahead microscope 44 dept. of pathology dept of pathology models 45 dept. of pathology pathology instruments 46 dept. of pathology microscope for diagnostic and research work 47 dept. of pathology deca head microscope 48 dept. of pathology 3 part hematology analyzer 49 dept. of pathology 5 part hematology analyzer dept. of pathology total 50 common department dept of pathology and forensic manual rotary microtome 51 common department pathology and microbiology water purification system 52 common department waste water treatment unit for pathology, microbiology labs 53 common department dept of pathology , micro, forensic binocular microscope 54 common department dept of pathology, microbiology and forensic binocular microscope for faculty => open tender...

Hscc India Ltd - Rajasthan

19424559 supply, installation, testing, commissioning and handing over of various medical equipment for medical college at pali, rajasthan fully automatic cryostat...

Sms Medical College - Rajasthan

19397487 purchase of kit reagents disposables and glassware ( cat no 3 ) : 1. measuring cylinder 2. click lock microtube stand 3. tris buffer 4. tris edta buffer 5. cryomatrix embedding resin 6. micro tips 7.. click look microcentrifuge tube 8. brush for cryostat 9. staining hanger 10. micro pipettes 11. incubator 12. moisture chamber 13..pap pen 14. forcep small 15. igg ab fitc 16. c3cab fitc 17. kappa ab 18. lambda 19. fibrinogen ab 20. c4d ihc antibody 6ml...

National Buildings Construction Corporation Limited - Rajasthan

19309814 tender for supply installation testing commissioning and handing over of medical equipment: 1 ) environment decontamination system 2 ) department of forensic walk in cold room 3 ) department of forensic ultraviolet spectroscope 4 ) department of forensic mortuary chamber 5 ) department of forensic infra red spectroscope 6 ) department of forensic gas chromatography and mass spectrphometer 7 ) other equipments for forensic department 8 ) department of forensic dissection 9 ) department of forensic charts & models 10 ) department of forensic autopsy saw 11 ) department of forensic downdraft flouting pedestal autopsy table 12 ) department of forensic autopsy work station 13 ) 20 deep freezer microbiology department 14 ) microbiology charts 15 ) pathology, micro, forensic binocular microscope 16 ) automated blood culture system 17 ) biosafety cabinet department of microbiology 18 ) microbiology lab freezer 19 ) microbiology elisa reader and washer 20 ) dept of microbiology bod incubator 21 ) dept of microbiology laminar flow 22 ) c02 incubator 23 ) microbiology hot air oven & incubator 24 ) non refrigerated centrifuge 25 ) microbiology dept: refrigerated centrifuge 26 ) single channel and multi channel pipette 27 ) microbiology equipments misc 28 ) waste water treatment unit for pathology, microbiology labs 29 ) pathology and microbiology water purification system 30 ) dept of pathology lab. 3 part hematology analyzer 31 ) department of pathology fully automatic cryostat 32 ) dept of pathology fully motorised microtome 33 ) dept of pathology lab. 5 part hematology analyzer 34 ) dept of pathology fully automated high throughput multi stainer workstation 35 ) dept of pathology fully automatic cover slipping workstation 36 ) dept of pathology fully automatic immuno histochemistry setup 37 ) dept of pathology hot plate & cold plate...

Medical College - Rajasthan

18847031 supply of reagents and chemicals for microbiology 437 bond aspirating probe cleaning kit 438 bond polymer refine detection 439 bond open container 7m1 440 leica universal label 3000 / pk 441 bond mixing stations 442 bond universal cover tiles 443 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm ) it a 444 slide label 445 printer ribbon 446 eber 447 antigen retrieval buffer diva decloaker 20x 448 background snipper 449 polylysine coated slides 450 peroxidated block 1 451 betazoid dab chromogen 452 betazoid dab substrate buffer for cytocentrifuge 453 filter card for cytology ( funnel reusable ) 454 cell slides single circle coated 455 cell slides single circle uncoated 456 double cytology funnel ( reusable ) 457 cell clip for cell clipotor 458 single cytology funnel ( for cryostat ) 459 cryomatrix ( optimal cooling tool gel coolant ) 460 sarasil disinfectant 461 microtome blades ( high definition ) ( for 6 part hematology analyser sysmex xn1000 ) s 462 lyser cell ( wnr ) 463 fluorocell ( ret ) 464 fluorcell plt ( plt ) 465 e.c.g jelly...

Dr. S.N.Medical College - Rajasthan

18834080 supply of reagents and chemicals for microbiology 437 bond aspirating probe cleaning kit 438 bond polymer refine detection 439 bond open container 7m1 440 leica universal label 3000 / pk 441 bond mixing stations 442 bond universal cover tiles 443 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm ) it a 444 slide label 445 printer ribbon 446 eber 447 antigen retrieval buffer diva decloaker 20x 448 background snipper 449 polylysine coated slides 450 peroxidated block 1 451 betazoid dab chromogen 452 betazoid dab substrate buffer for cytocentrifuge 453 filter card for cytology ( funnel reusable ) 454 cell slides single circle coated 455 cell slides single circle uncoated 456 double cytology funnel ( reusable ) 457 cell clip for cell clipotor 458 single cytology funnel ( for cryostat ) 459 cryomatrix ( optimal cooling tool gel coolant ) 460 sarasil disinfectant 461 microtome blades ( high definition ) ( for 6 part hematology analyser sysmex xn1000 ) s 462 lyser cell ( wnr ) 463 fluorocell ( ret ) 464 fluorcell plt ( plt ) 465 e.c.g jelly...

Medical College - Rajasthan

18516133 rate contract for glassware and disposable for pathology department7 i micro cober slip, glass slides, surgical blad, disposable gloveshaematoeytometer cover saip 8 faiter paper no. ‘0’ 17”x27” sheets iens cleaning paper io. staining tiough capaciiy — 25 30 slides, dimension 13x10x7 cm wiih __________ lid made of glass 11 wash iottie made of idpe plaiiic waih delivery tube. it shculd be made of chemically resistant low density polyethylene, flexible with screw cap _________ ( 500 ml ) 12.? tissue paper roll 13. urinometer for specific graviiw ________e_ 14. disposabie microtome blade low piofile, ce ceiiiiied li i approved suitable for leica microtome sample for approval is must. ____._____ 15. disposabie piasiic casseiie wiih lids, yailow ralour for iissu processing, sample required for approval.nit 133 ) 16. disposabie piaitic casieiie wiih lids, white? off white colour for tissue — processing, sample required for approval. 17. disposabie plastic cassette with lids, bium colour for tiisui processing, _......___ sample required for approval. ______ 18. diamond pencil for marking glass slides 19. disposabie gowm for autopsy and histopathology, sample approval. o. reetangnlar museum jar with rover made of borosilicate gla s _.____ ( 2oox125x 12s mm ) ______ _______________ 21. rectangnlar museum iar with cover made of borosiiicate gin’.s _..__.._ ( 36oxl5oxloomn ) 22. rectangular museum jar with cover made of borosilicate gla s _.....__.__ ( 220x195x8o mm ) ____ 23. index card 24. fiiier paper disposable for cytotek 2s. measuring cyliider 25 ml, . 26. measuring cylinder 500 ml 27. measuring cylinder 1000 ml ) click lock microtube stand27. measuring cylinder 1o0o ml ) 28. click iock microtube stand? — 29. cryomatrix embedding resin 30. micro tips 0.5 10 ul 31. micro tips 10 l0oul 32. micro tips 10oo ul 33 click lock microcentifuge tube ( ipendoff ) 34 brush for cryostat...

Medical College - Rajasthan

18502541 rate contract of glassware and disposable for pathology department : 11 wash bottle made of ldpe plastic with delivery tube . it should be made of chemically resistant low density polyethylene, flexible with screw cap ( 500 ml ) 12 tissue paper roll 13 urinometer for specific gravity 14 disposable microtome blade low profile, ce certified ivd approved suitable for leica microtome, sample for approval is must. 15 disposable plastic cassette with lids, yellow colour for tissue processing, sample required for approval. 16 disposable plastic cassette with lids, white / off white colour for tissue processing, sample required for approval. 17 disposable plastic cassette with lids, blue colour for tissue processing, sample required for approval. 18 diamond pencil for marking glass slides 19 disposable gown for autopsy and histopathology , sample approval. 20 rectangular museum jar with cover made of borosilicate glass ( 200x125x125 mm ) 21 rectangular museum jar with cover made of borosilicate glass ( 360x150x100 mm ) 22 rectangular museum jar with cover made of borosilicate glass ( 220x195x80 mm ) 23 index card 24 filter paper disposable for cytotek 25 measuring cylinder 25 ml, 26 measuring cylinder 500 ml 27 measuring cylinder 1000 ml ) 28 click lock microtube stand 29 cryomatrix embedding resin 30 micro tips 0.5 10 ul 31 micro tips 10 100ul 32 micro tips 1000 ul 33 click lock microcentifuge tube ( ipendoff ) 34 brush for cryostat...