34915078 supply of lab items in svgms sarada junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....


34915073 supply of lab items in svgms jhadol junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....


34914978 supply of lab items in svgms mavli junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....


34914962 supply of lab items in svgms salumber junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....


34914949 supply of lab items in svgms kotda junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....

Department Of Education - Rajasthan

34898280 bids are invited for verniar caliper , screw gauge 25mm , sphe ro meter , dcc wire , resistance wire ureka , resistance wire contan , resistance wire manghine , copper caprimeter pot , drowing bord woden , simple pendulam dob sel , stop clock , stop watch , thermameter 110c , therma meter , therma meter room temp , minimum maximum therma meter , drowing bord pin , sonometer , meter sccle wooden 1 mtr , meter bridge , potentiometer , resohance app , tunning fork set , rubber pad , stand. with claimp iron , plug kcc one way , plug kcc two way , resistance box 100000 , resistance box 100 , resistance box , rhehosted , zinc rod heavy , lacklanchi cell , denial cell , poras pot field , poras pot empty , cell box 2 cell plastic , ameter , volt meter dc 12 holt , galvenometer , induction cail , barmagnet , miliameter 500 ma , optical bench. 1 mtr. ss p , pn juction diode add p , pnp transistor , zener diode ap p , lens holder plastic , transistor loose , compass both side glass , solated weight , inclain plan p , hooks law app p , digital multimeter , parrol gram app p , battery eliminitor , reagent batlle nm 250 ml , reagent batlle nm 500 ml , reagent batlle wm 250 ml , reagent batlle wm 500 ml , dropping bottle 125 ml dolyks , glass tube , igawion tube , certifuge machire hand drive , certifuge machire remi electric , filter paper rim 500 nos , filter paper 125 , water bath copper , corck borar sel , pestal motor , weight machine , china disc , bunsen burner , pippel vlumatric 25ml , burrel 50 ml borocil a , test tube 25x150 borocil a , test tube 15x125 borocil a , test tube 12x100 borocil a , funnel 2 pvc. , funnel 100mm pvc. , test tube holder brass , test tube stand pvc. , spettula , sprit lamp ss , wash bottle 500 ml pvc. , reogent. bottle nm125ml borocil , beoker 100 ml borocil , beaker 250ml borocil , beaker 500ml borocil , conical. flask 250ml borocil , conical. flask 500ml borocil , flate. bottle flask. , conical. flask 500ml borocil , flate. bottle flask. 500ml borocil , dropper g , glass rod. , plaitinum wire , wire gauge. with fram , tonas , univer scal. ckeimp. , boss head , try pot stand , junior medical compound microscope , disseting microscope , forcep. big. , forcep. small , scisser small , scisser big , test. tube holder , test. tube stand , test. tube brush , stop. watch , niddle with plastic handal , dissecting brush , auxano meter , staing rock wooden , try. pot. stand , wire gauge , water bath electric rectangale , s phygnometer , stethoscope , dissecting tray. , electronic balance 300gm cap , test tube 15x125 borocilcole , watch glass , petric disc , plain slide , cavity slide , cover. slipe. , becker , becker 250ml borocilicete , measuring cylender 500ml pvc. , measuring cylender 100ml pvc , conicel flask. 250ml borocilicate , funnel 75mm pvc , gangoes potometer borociliate , gangoes respairometer borociliate , bell jar. soda glass , specimen jar. empty plastic , dropping bottle 60ml sodaglass , wash bottle 500ml pvc , dropper plastic , dessicator polykab. 300ml , thermameter clinic , funnel pvc , sprit. lamp aluminium , all permanan slide at the list , meosis. slide , mitosis slide , model amba , model frog , model eye , model ear , model brain , human skelition without box , all raxine charts at the list , all specimen at the list , specimen , material cutting dicot rot, stem leaf , material cutting monoct rot, stem leaf , filter paper 100 nos. , p.h. paper glaxo , saffarawine glaxo , eiosine glaxo , glycerol glaxo , methylene blue glaxo , fast green lanco , xylene rankem , formeldenyde glaxo , chloroform glaxo , acetocarmine lancer , bendicy solu. glaxo , steel almihra , teacher chair...

Shri Karan Narendra Agriculture University - Rajasthan

34879221 rate contract of laboratory glassware for fy 2022 23 and 23 24 1 low form beaker with_spout_ ( 50_ml ) 2 low form beaker with spout ( looml ) 3 low form beaker with spout ( 15o ml ) 4 low form beaker with spout ( 250 ml ) 5 low form beaker with spout ( 500 ml ) 6 low form beaker with spout ( 1000 ml ) 7 erlenmeyer ( conical ) flask narrow mouth, with rim ( i00 ml ) 8 erlenmeyer ( conical ) flask narrow mouth, with rim ( 150 mll, ‘c erlenmeyer ( conical ) flask narrow mouth, wilh rim ( 250 ml ) 10 erlenmeyer ( conical ) flask narrow mouth, with rim ( 500 ml ) 11 erlenmeyer ( conical ) flask narrow mouth, with rim ( 1000 ml ) 12 volumetric flask class a, narrow mouth, clear, with individual calibration certificate ( 5 ml ) , 21 cylinder class b, hexagonal base, pour out ( 5 ml ) 22 cylinder class b, hexagonal base, pour out ( 10 ml ) 23 cylinder class b, hexagonal base, pour out ( 25 ml ) 24 cylinder cla.ss b., 32 volumetric pipette class_b_ ( 10_ml ) 33 volumetric pipette class_b_ ( 20_ml ) 34 volumetric pipette class b ( 25 ml ) 35 volumetric pipette class b ( 50 ml ) 36 burette with boroflo stopcock, class b 10 ml 37 burette with boroflo stopcock, class b ( 25 ml ) 38 bure fib with boroflo stopcock, class b ( 50 ml ) 39 reagent bottle narrow mouth with screw cap ( 50 ml ) 40 reagent bottle narrow mouth with screw cap ( 100 ml ) , etc....

Rajasthan State Pollution Control Board - Rajasthan

34840487 supply of consumables, reagent and controls for lab sodium hydroxide sodium arsenite sulphanilamide neda hydrogen peroxide 30% phosphoric acid 85 % sodium nitrite mercuric chloride sodium chloride edta disodium salt suplhamic acid 0.6% formaldeyde 0.2% pa rarosa nil i ne hydrochloric acid iodine potassium iodide starch soluble potassium lodate, sodium carbonate sodmum metabisuiphite, i flasks volumetric. with interchangeable glass stopper. class a 2 flasks volumetric, vith lnterchangeable glass stopper, class a 3 nessler tube with graduation ( borosil ) 4 nessler tube with graduation ( i3orosil ) 5 flasks volumetric. with interchangeable glass stopper. class a 6 flasks volumetric. with lnierchangeable glass stopper. class a 7 flasks volumetrie, with lnterchangeable glass stopper, class a 8 pipettes. graduated . schelibach. ( seriological type ) , class as graduation division 0.01 ml with calibration certificate 9 pipettes. graduated . scbelibach. ( seriological type ) . class as graduation division 0.01 ml with calibration certiticate 10 pipettes. graduuted . schelihach. ( scriological typw ) , class as graduation division 0.01 tnl with calibration certiticate 11 pipettes. graduated . schellhach. ( seriological type ) . class as graduation division 00l ml with calibration certificate 12 reagent bottles, plain clear glass graduated with screw cap 13 reagent bottles. plain clear glass graduated with screw cap, 14 bottles. amber glass graduated with screw cap 15 bottles. amber glass graduated with screw cap 16 lmnpinger 17 spectrophotometer quart, cuvettes 0.5 ml, 3 forcep 200 mm 4 s_patula ( sandlsizc ) 5? — wash bottels ( 500 nnl ) 6 coolling box ( small ) 7 nesaler tube stand hnving capaciiy 50 and 100 ml tubes 8? — silical gel ( in gel type ) 9 pette stand vertical ( 28 pipettes ) narrow mouth bottle ( medical gaade [ mdpe ( ‘oatirming to us1 class vi ) 0ml ) amber narro’ mouth bottle ( medical grade hdpe confirming tm usp class vi ) ( 60 nl ) narrnw month bottie ( medical grade ldpe confirming to usp class vi ) 500 mnl ) s amber narrow mouth bottle ( medical grade hdpe confirming to usp class vi ) ( 500 ml ) lnjection ( 10 nl ) extension cord ith power plug i pette aid sucker 10 ml 2 bottle top dispenser 1 10 ml 10, liqumd glassware cieaner hand 1owebe 4ormal filter ipaixrr register data sheet file filter paper envelr filter pajper etwel scre kit gloves ( l size, alluimiiniunll foil test tube cleaner brush first aid kit labelling t markers issue roll....

Ministry Of Education Training And Employment - Rajasthan

34838766 bids are invited for labortory item crucible tongs 8 inch long stainless steel , china dish 3 inch dia , burette clamp fischer type , volumetric flask capacity 200 ml , wide neck flat bottom , beaker 250 ml , beaker 150 ml , beaker 100 ml , rubber latex teats for glass dropper , pocket ph meter pen type for lab , litmus granules blue 25 gm , buffer tablets ph 4 each pack 20 tablets , buffer tablets ph 7 each pack 20 tablets , buffer tablets ph 10 each pack 20 tablets , nesselars reagent 100 ml each , molish reagent 100 ml each , lead acetate 250 gm each , litmus paper blue 100 strips each , ph paper ph 1 to 14 100 strips each , ethyl alcohol 500ml each , ferric phosphate 100 gm each , magnesium carbonate 100 gm each , calcium nitrite 500 gm each , magnesium phosphate 250 gm each , lead sulphide 250 gm each total quantity : 274...

Department of School Education - Rajasthan

34823087 bids are invited for laboratory item aluminium chloride , aluminium nitrate , ammonium carbonate , ammonium chloride , ammonium nickel sulphate , ammonium nitrate , ammonia liquor , calcium chloride , copper sulphate , e.d.t.a di sodium salt , fehling solution a , fehling solution b , ferrous sulphide iron sulphide , ferric chloride anhydrous , hydrogen peroxide , lead chloride , magnesium acetate , magnesium metal ribbon , manganese chloride , potassium iodide , silver nitrate , sodium bi carbonate , sodium hydroxide , acetaldehyde , acetanilide , acetone , acetic acid glacial , aniline , benzaldehyde , benzamide , benzophenone , carbon tetra chloride , carbon disulphide , 1, 4 di chlorobenzene , ether di ethyl ether , ethyl acetate , m di nitrobenzene , 1 naphthol alpha , nitrobenzene , oxalic acid , salicylic acid , schiffs reagent , silica gel crystal , thalic acid , thiourea , urea , magnesium sulphate ar , hydrochloric acid , sulphuric acid , nitric acid , beaker 250 ml , beaker 500ml , burette graduated with ptfestopcock, 50ml 0.10 ml graduation , burette stand , capillary tube , charcoal block , cork 2mm, 3mm, 7mm, 8mm, 10mm , filter paper ordinary , glass dropper 3 inch 6 inch , ignition tube , ostwald viscometer , pipette one mark 10ml , reagent bottle 5 litre , rd bottle 10 ml , round bottom flask 100 ml , round bottom flask clamp with boss head , short stem funnel , stalagmometer , test tube brush , test tube holder , test tube 15x125m , test tube stand aluminium 12 holes 15 mm , thermometer long stem for thiels tube 2500c , thermometer long stem for thiels tube 3600c , thiels tube , tiles 6 inch x 6inch , watch glass 4 inch , whatman filter paper 41 , wire gauge with frame 6 inch x6 inch , stop watch , distilled water plant , heating elements of distilled water plant total quantity : 2486...

Rajasthan State Pollution Control Board - Rajasthan

34797233 rate contract for chemicals, glass wares and other lab items under namp sodium hydroxide sodium arsenite sulphanilamide ( melting point 16s 167° c ) neda hydrogen peroxide 30% phosphoric acid 85% sodium nitrite ( 97 % or greater ) mercuric chloride sodium chloride edta disodiurn salt suplhamicacid formaldeyde pararosaniline chloride hydrochloric acid iodine potassium iodine, flasks volumetricwith interchangeable glass stopper, class a fiasks volumetric with interchangeable glass stopper, class a nessler tube with graduation ( borosil ) mmr nessler tube with graduation ( borosil ) flasks volumetric with lnterchangeable glass stopper, class a flasks volumetric with interchangeable glass stopper, class a flasks volumetric with interchangeable glass stopper, class a pipettes ( volumetric ) , graduated, schellbach, ( seriological type ) class as graduation division 0.01 ml with calibration certificate pipettes ( volumetric ) , graduated, schelibach, ( seriological type ) class as graduation division 0.01 ml with calibration certificate reagent bottles, plain clear glass graduated with screw cap reagent bottles, plain clear glass graduated with screw cap bottles, amber glass graduated with screw caps cap pipettes, graduated, schellbach, graduation division 0.01 ml with pipettes, graduated, schellbach, graduation division 0.01 ml with ( seriological type ) class as calibration certificate ( seriological type ) class as calibration certificate bottles, amber glass graduated with screw caps cap, pipette aid sucker 10 ml bottle top dispenser 1 10 ml forcep 200 mm spatula ( s& lsize ) wash bottles ( 500m l ) coolling box ( small ) nessler tube stand having capacity 50 ml &s10o ml tubes silica l.gel_ ( in_gel.type ) pipette stand vertical ( 28 pipettes ) narrow mount bottle ( medical grade ldpe confirming to usp class vi ) ( 60 ml ) amber narrow mount bottle ( medical grade hope confirming to usp class vi ) ( 60 ml ) narrow mount bottle ( medical grade ldpe confirming to usp class vi ) ( 500 ml ) amber narrow mount bottle ( medical grade hdpe confirming to usp class vi ) ( 500 ml ) injection ( 10 ) extension cord with power plug cloth for cleaning machine rds cover apron, test tube cleaner brush first aid kit labelling tape ( cryo tags ) markers tissue roll liquid glassware cleaner hand towels normal filter paper register data sheet file filter paper envelop ( for pm 2.5 ) filter paper envelop ( for mp 10 ) screw.kit gloves ( l size ) aluminum foil, etc....

Ground Water Department - Rajasthan

34593100 supply of various materials required for nabl accreditation of water quality labs , buffer ph 4.0(500 ml) , buffer ph 7.0(500 ml) , buffer ph 9.0(500 ml) , buffer ph 10.0(500 ml) , potassium chloride kcl (80gm) , sodium chloride (80gm) , calcium standard (80gm) , magnesium standard(100 ml) , sodium chloride (80gm) , sulphate standard (100 ml) , sodium carbonate (80gm) , nitrate standard (500 ml) , fluoride standard (f – 1000pm) (500 ml) , calcium standard (80gm) , potassium dichromate(80gm) , hot plate (electric) , digital lab oven , colorimeter , weight box , digital thermometer , magnetic stirrer , digital thermo hygrometer , ion meter – for fluoride , desiccator with lid and porcelain plate 250 mm , turbidity meter (naphelometer) , heating element of borosil distill water plant , fix volume pipette (5 ml) , fix volume pipette (10 ml) , variable volume pipette (10 ml) , volumetric flask 10 ml , volumetric flask 25 ml , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 200 ml , volumetric flask 250 ml , volumetric flask 500 ml , volumetric flask 1000 ml , beaker 50 ml , beaker 100 ml , beaker 250 ml , beaker 500ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , pipette graduated 1 ml , pipette graduated 2 ml , pipette graduated 5 ml , pipette graduated 10 ml , pipette bulb type 1 ml , pipette bulb type 2 ml , pipette bulb type 5 ml , pipette bulb type 10 ml , pipette bulb type 25 ml , burette 25 ml , burette 50 ml , conical flask 250 ml , first aid box , cotton lab coatxxl (apron) , cotton lab coatxl (apron) , plastic lab coat , safety goggles , safety face shield , fire extinguisher ( dry powder) 5 kg , fire extinguisher ( dry co2)5 kg , acid dispenser , sample handling trolley ( steel) , hand gloves ( acid alkali) , hand gloves ( polyurethane) , oven gloves , hand free shower , safety shoes , bottle cleaning brush ( medium) , dustbin with lid_20 l , bucket_10 l , safety instruction display board , display board:address board , display board: working areadisplay , display board: testingareadisplay , display board:sop display , display board: layout display , display board: policy display , display board: periodic table , absolute alcohol/ ethanol (ar) (500 ml) , silver nitrate(ar) (25 gm) , copper sulphate penta hydrate (ar) (cuso4.5h2o)(500 gm) , toulene(ar) (500 ml) , n hexane (ar) (500 ml) , potassium dichromate(500 ml) , index file large , spring cobra file large , register hard core bind wide size 200 page , register hard core bind wide size 100 page , punching machine , stapler small & big , red /blue/green ink stamp pad , rubber stamp , paper rima4 size , paper rim legal size...

Indian Army - Rajasthan

34568142 bids are invited for domestic vacuum flasks as per is 7708 (q4) total quantity : 2373...

Department Of Technical Education - Rajasthan

34533958 bids are invited for civil boq part 2 enamel metal tray size 12inches x 18inches 1 , weight balance , sieves i.s. 1 , sieves i.s. 2 , thickness gauge 1 , length gauge 1 , lechatelier flask , electronic balance complete metal body 1 , rebound hammer apparatus , equipment for specific gravity of fine aggregate pycnometer , equipment for specific gravity of coarse aggregate , set of sieves for sieve analysis of coarse aggregate , set of sieves for sieve analysis of fine aggregate , enamel metal tray size 12inches x 18inches 2 , electronic weight balance complete metal body 1 , electronic weight balance complete metal body 2 , thickness gauge 2 , length gauge 2 , metallurgical microscope , digital electronic balance , cod analysis system , plastic limit set is 2720 part 7 , liquidlimit device is 2720 part 5 , core cutter is 2720 part 29 , standard compaction test is 2720 part 7 , pycnometer , sieves , enamel metal tray , electronic balance completemetal body 2 , prismatic compass , full aluminum bodyleveling staff , full wood body leveling staff , plane tableset , mild steel ranging rod , survey chain mertic chain , surveyor measuring tape fibre glass leatherette measuringtape numbers for easier reading. , arrow made of gi size400 mm, , automatic level with accessories , digitalplanimeter , vernier tranist theodolite , total station , gps , electronic distance measurement edm , drawing board asper is1444 and timber material as per is 399 total quantity : 531...

Department Of Technical Education - Rajasthan

34525125 supply of enamel metal tray size 12inches x 18inches 1 , weight balance , sieves i.s. 1 , sieves i.s. 2 , thickness gauge 1 , length gauge 1 , lechatelier flask , electronic balance complete metal body 1 , rebound hammer apparatus , equipment for specific gravity of fine aggregate pycnometer , equipment for specific gravity of coarse aggregate , set of sieves for sieve analysis of coarse aggregate , set of sieves for sieve analysis of fine aggregate , enamel metal tray size 12inches x 18inches 2 , electronic weight balance complete metal body 1 , electronic weight balance complete metal body 2 , thickness gauge 2 , length gauge 2 , metallurgical microscope , digital electronic balance , cod analysis system , plastic limit set is 2720 part 7 , liquid limit device is 2720 part 5 , core cutter is 2720 part 29 , standard compaction test is 2720 part 7 , pycnometer , sieves , enamel metal tray , electronic balance complete metal body 2 , prismatic compass , full aluminum body leveling staff , full wood body leveling staff , plane table set , mild steel ranging rod , survey chain mertic chain , surveyor measuring tape fibre glass leatherette measuring tape numbers for easier reading. , arrow made of gi size 400 mm, , automatic level with accessories , digital planimeter , vernier tranist theodolite , total station , gps , electronic distance measurement edm , drawing board as per is1444 and timber material as per is 399....

Rajasthan Council Of Secondary Education - Rajasthan

34513703 supply of lab item in govt swami vevikanand model school sci lab item junior medica compound microscope, dissecting microscope, forcep, scissor, test tube holder, test tube stand, stop watch, needle with plastic handle, staining rack, tripod stand, wire mess, water bath rectangular, stethosope, tripod stand wire mess ‘1 water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker beaker measuring cylinder measuring cylinder conical flask funnel ganongpotometer respirometer bell jar ( taediurn size ) specimen jar empty dropping bottle glass wash bottle plastic dropper plastic desicator , 111114z1° n• 5 thermometer clinical thermometer funnel glass pvc sprit lamp testis ( mammal ) t.s. ovary ( mammal ) t.s. n 5 liver ( mammal ) t.s. pa. n. 5 blastula t.s. n skeletal muscles n 5, cardiac muscles n 51 unstraited muscles 1 o. n 5. 1 t.s. of bone ( mammal ) 10 1 > t.s. of cartilage ( mammal ) a n epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozciite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria 1, t.s. of, monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of mot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of human circulatory system of human reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dlcot stem monocot root dlcot root igestive system of human , i life cycle of angiosperm plants sicyon tape worm liver•fluke ascaris male ascaris female earthworm leech scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone 1i fern ( pteridium ) , etc....

Food Corporation Of India - Rajasthan

34470591 auction of unserviceable dead stock articles under fci do kota ldpe ( black ) polyt hene covers polythene covers tops tarpolene cover 2 cltf covers ( blue ) 3 polythene covers tops ( under complient ) 4 wooden crates 5 c class kattas jute ( sbt ) bags 50 kg. 6 c class kattas plastic ( hdpe ) bags 50 kg. 7 empty bottle 5 ltr ( mlth ) empty bottle 1 ltr ( mlth ) empty tin of delta methrine 8 empty bottle / flask of alph 3 9 fire extingusher water co2 type fire extingusher fire bucket 10 iron chair / canning chair / revolving chair / visitors chair table ( iron ) iron box repeats ( small pieces iron ) chalna ( small ) balance ( iron ) thermometer sieve set parkhee rate cages portable balance safty spray kit tagari / tasla enamal plate torch hectolitter appartus umbralla thermal printer for moister meter ( indosaw ) thermal printer for moister meter ( sareen ) capacitor bucket / sand bucket 11 simple small lock locks ( brass ) lock godrege lock any type ( iron ) 12 cooler ( desert ) celing fan exhaust fan water motor water ro aqua guard 13 pvc water storage tank ( 500 lit ) pvc water storage tank ( 1000 lit ) delivery pipe / rubber tube empty plastic drum gas mask 14 door nets nylone ropes mf door / cover nylon nets sand snaks 15 wodden table wodden chair hand cart wooden slabe...

Department Of Revenue - Rajasthan

34447025 bids are invited for white paper , cello tape transperent , cellop tape transperent , big size register , register , attendence register , paper cutter , scissors , pencil large , rubber , sharpner , marker large , marker small , flag selfstick , envelope , envelope big size , pen , highlighter , stapler , stapler pin , stamp pad , pen stand , calculator , carbon paper , single hole machine , double hole machine , note pad dairy , white color dhaga small and large , page changing water pad , dater stamp , fevistick , suya plastic handle , whitener pen , scale 30 cms , alpin , tags , file pad , dakpad executive , file cover , note pad , file cover , suya , napkin , towel full size , pocha , water glass ,thermas flask steel bottle , glass set , tea cup , phenyle 1litre bottle , good night coil , good night machine , goodnight refill liquid , broom jhadu seenk , broom jhadu phool, washing soap , toilet soap , soap case , wheel soappowder , tray , water bottle , harpic , wiper , collin 500 ml, odonil , room freshner , toilet brush , reffil bottel , dettolhand wash liquid , spoon , torch , torch pencil cell aa ,pencil cell aaa , bucket , led bulf , hit black , tea coster ,phynile goli coloured , jug plastic , dust bin , dove soap ,dinner set , break fast plate , brush sink , vim bar , plasticbox total quantity : 3143...

Department Of Agriculture - Rajasthan

34418890 supply of lab item 1 ammonia acetate ammonium molybdate e______? ammonium ferrous sulphate activated charcoal phosphorus free dacrco gcl hydrochloric acid potassium dichromate sodium bicarbonate di phenylamine indicator 9 stannous chloride 10 soidium hydroxide pellets 11 ortho phosphoric acid 12 dtpa ( diethylene triamine penta acetic acid ) 13 sulphuric acid ( commerical grade ) 14 sulphuric acid 15 calecium chloride fused 16 potassium dihydrogen phosphate 17 triethanolamine 18 barium chloride 19 gum acacia 20 mono calcium phosphate 21 sodium floride 22 potassium sulphate 23 acetic acid glacial , 24 nitric acid 25 zinc solution 1000 ppm 26 copper solution 1000 ppm 27 iron solution 1000 ppm 28 manganese solution 1000 ppm 29 potassium chloride 30 laboline liquid detergent for laboratory, beaker, volumatric flask, auto burate, filter paper, 1 pvc reagent bottle 2 pvc beaker 3 vc reagent bottle 4 vc funnel 5 pvc funnel....

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...


34356657 supply of science lab item and equipment burette 50m1 pim burette stand complete set conical flask conical flask pipette volumetric test tube 15x125mm volumetric flask volumetric flask precision gold balance 10 periodic table 11 ph paper pkt. 12 test tube holder 13 thermometer 14 crucible tong 15 wash bottle 16 funnel 17 potassium permangnet 18 potassium dichromate 19 sulphuric acid 1 battery eliminator 2 zenor diode characterstics apparatus 3 multimeter 4 drawing board 12x 18 5 meter bridge with pencil jockey 6 one way key . 7 optical bench with two pkt and 2 lense holder .3441, gauge sani conductor diode two way key r voltmeter ( 0 3v ) d.c. with stand zinc rod 7:1 .0 n 6 8 o t. 1 ) 2 17 convex lens 18 concave lens 19 glass prism 20 glass slab 21 milli ammeter 22 denial cell 23 lechlance cell 1 torso human skeletan 2 human skelton with stand & acrilic showcase 6 arc auxonometer 7 ganong respirometer en 1 portable auto slave ganong potometer sahel hemoglobin meter . sinna tn.^. in tnegn , ::on smuric full d3 leaf tin t radtallus niphytic root ti vows plant vi 4 respiratory root simple ‘, dry fruit 15 permanent slide: i s. of mammalian b liver c stomach d intestine e lungs f pitutary gland g thyroid gland h adernal gland i morula 1 blastula k gastrula 16 starch 17 glucose / dextrose powder 11 ph paper pkt. 19 litmus paper red 20 litmus paper blue 21 potassium iodide 22 iodine solution 23 fehling solution a 24 fehling solution b 25 benedict solution _26 picric acid e n n ..7...

Department Of Animal Husbandry - Rajasthan

34323775 supply of hoffkin culture flask hoffkin culture flask , hoffikin culture flask 1.4 litre capacity made up of low expansion 3.3borosillacate glass usp type 1 certificate should attach 2.outer diameter & height approx.246x 310 mm length of neck approx.140mm internal diameter of upper end of neck approx.40mm x 0.5mm. 3. flask should bear 180c and at least 15 lbs pressure for 1 hr. without showingany ill effect. 4.weight of the hoffikin flask should be 1450gm+50gm. 5. flask should be of single mould. no joint should be there....

Indian Army - Rajasthan

34322122 bids are invited for tea costar borosil glass , tea cup , tea flask 5 ltrs total quantity : 33...

Indian Army - Rajasthan

34238403 bids are invited for flask thermos 0.5 ltrs with plastic cap total quantity : 2373...

Medical Health And Family Welfare - Rajasthan

34202460 purchase of lab reagents medical equipments bundi , items , rbc fluid , wbc fluid , edta solution , n / 10 hcl , sodium citrate 3.8% , eosinophil count fluid , reticulocite fluid , afb stain , heam test , semen diluting fluid , platelete diluting fluid , lesman stain , gimsa stain , immersion oil , distill water , methanol , sodium hypo chloride , jsb stain 1 , jsb stain 2 , glass test tube 3 , glass test tube 4 , neubar chamber , hb meter round , hb meter squre , glass slide , cover glass slip 18 mm , cover glass slip 22 mm , timer electronic , urin container , test tube plastic 3 , test tube plastic 4 , sample collection vials , serum collection vials , k3 edta vials sc , k3 edta vials dc , clot activator sc , clot activator dc , yellow tips , blue tips , dropping bottle , washbottle , test tube stand 32 hole , turnicat belt , hb tube round , hb tube squre , bt ct tubes , test tube brush , tissue paper roll , esr stand ( e 5 ) , esr tube ( no. ) , esr tube ( without no ) , esr cup , syring 2 ml , syring 3 ml , syring 5 ml , niddle 24 no. , niddle 22 no. , hand gloves , triple layer face mask , mask n 95 , cotton , lancet , bp instrument mercuray , bp instrument digital , stetoscope , weight machine analoge , weight machine digital , baby weight machine analoge , baby weight machine digital , paules oximeter , nebuliser machine , stadiometer , height mesuring scale , anti abd , multi strips , uristix , hcg card , hiv rapid card , hbsag card , vdrl card , hcv card , dengu card ns1 combo , dengu card igg / igm , widal card igg / igm , malaria card antigen , rpr test , widal kit , aso kit , rf kit , crp kit , gluco meter , gluco strips , hbsag elisa , hb scale book starter pack , hb scale book strip , blood suger , blood urea , creatinine , billirubin total & direct , sgot ( colorimeter ) , sgot ( analyser ) , sgpt ( colorimeter ) , sgot ( analyser ) , alkaline phos , total protiens & albumin , trigyceride , cholestrol , hdl cholestrol , ldl cholestrol , uric acid , amylase , lipase , ck mb , ck nak , sodium kit , pottasium kit , calcium , chloride , x ray film 12x15 ( manual ) , x ray film 12x12 ( manual ) , x ray film 10x12 ( manual ) , x ray film 8x10 ( manual ) , x ray film 6.5x8.5 ( manual ) , di hl digital x ray film 8x10 fuji / care stream , di hl digital x ray film 10x12 fuji / care stream , di hl digital x ray film 11x14 fuji / care stream , x ray developer 13.5 ltr , x ray developer 9 ltr , x ray fixer 13.5 ltr , x ray fixer 9 ltr , ecg roll 50 mm ( 108 ) , ecg roll 50 mm ( 6108 ) , ecg roll 80 mm , sonogrphy jelly , ecg jelly , sonogrphy roll , printer roll 57x10 mm , digital hb meter cuvette , mindil lmg , abx lyse bio , abx cleaner , minoclair , minotrol 16 ( 2l ) , minotrol 16 ( 2n ) , minotrol 16 ( 2h ) , minocal calibrator , diluent 20 ltr , lyse 1 ltr , clener 1 lyr , microscope , centrifuge machine , slide stand , micropipet variable , slide try , cell counter ( manual ) , lens clining paper , filter paper , spirit 5 ltr , spirit lamp , hiv tridot , bio medical waste bag ( black, yellow, red ) in various size , bio medical waste bin 16 ltr , bio medical waste bin 32 ltr , smear for filaria , test for iodin in salt , water testing by strip method , needle destroyer manual ( hub cutter ) , needle destroyer electric , foetal doppler , vein detection pedatric , vein detection adult , bleching powder , sodium hypo chloride 10% , labour table , pancture proof container 5 ltr , pancture proof container 10 ltr , pancture proof container 15 ltr , mackintose , suction machine , bed side screen with curton , revolving stool 3 legs ss top , thermal fogging sprayer machine for outdoor , foot step , examination table , patients stool , thermometer , muac tape , nursing trolly , ambu bag , artery forceps , needle holder , needle holder , kidney tray , tourniquets , ot table , cbc machine 3 part , ecg machine 3 channel , carbol fuchine ( diacontent above 85% ) ( cdh ) , methyylen blue ( aiacontent above 85% ) , sulfuric acid 5 ltr , phenol pure ( carbolic acid ) , diamond marker , aramin ( o ) , flask 5ltr , parafilm m roll , reagent bottle 1000 ml , reagent bottle 2000 ml , reagent bottle 5000 ml , long droper , absulute alcohal ( ethanol 99.9 ) , basic fuchine 25 gm ( cdh ) , disposal gown...

Department Of Agriculture - Rajasthan

34190605 supply of chemicals filter paper and instruments sulphuric acid, phosphoric acid, calcium chloride, stannous chloride, beaker, burette, conical flask, filter paper, ph meter electrode, ec meter electrode....


34164947 supply of lab items junior medical compound microscope dissectin: microscope forcep ( large ) forcep ( small ) scissor ( small ) scissor ( large ) test tube holder test tube stand test tube brush stop watch needle with plastic handle dissecting brush arc auxanometers staining rack tripod stand wire mess water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker , beaker measuring cylinder measuring cylinder conical flask funnel ga non potometer respirometer bell jar medium siz specimen jar empty dro in bottle :lass wash bottle plastic dropper plastic desicator thermometer clinical thermometer funnel glass pvc sprit lamp • testis ( mammal ) t.s. ovary ( mammal ) t.s. liver ( mammal ) t.s. blastula t.s. skeletal muscles cardiac muscles unstraited muscles t.s. of bone ( mammal ) t.s. of cartilage ( mammal ) epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozoite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria t.s. of monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of dicot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of huma circulatory system of humar reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dicot stem monocot root dicot root digestive system of human life cycle of angiosperm plants sicyon tape worm liver fluke ascaris male ascaris female earthworm leech • scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone fern ( pteridium ) steel almirah with glass doc steel almirah teacher table ( with steel rack ) , etc....

Rajasthan Council Of Secondary Education - Rajasthan

34080623 supply of in model school upani sci lab items junior medical compound microscope dissectin: microscope forcep ( large ) forcep ( small ) scissor ( small ) scissor ( large ) test tube holder test tube stand test tube brush stop watch needle with plastic handle dissecting brush arc auxanometers staining rack tripod stand wire mess water bath rectangular ( electric ) sphygmomanometer stethoscope dissecting tray electric balance digital test tube watch glass petridis slides plane per pkt. watch glass cavity slides cover slips petri dish beaker , beaker measuring cylinder measuring cylinder conical flask funnel ga non potometer respirometer bell jar medium siz specimen jar empty dro in bottle :lass wash bottle plastic dropper plastic desicator thermometer clinical thermometer funnel glass pvc sprit lamp • testis ( mammal ) t.s. ovary ( mammal ) t.s. liver ( mammal ) t.s. blastula t.s. skeletal muscles cardiac muscles unstraited muscles t.s. of bone ( mammal ) t.s. of cartilage ( mammal ) epithelium tissue nervous tissue cell division mitosis set cell division mitosis set entamoebahistolitica plasmodium w.m. sperozoite plasmodium trophozoiteplasmodium hydra w.m. spirogyra w.m ulothrix w.m. funeria t.s. of monocot leaf t.s. of dicot leaf t.s. of monocot stem t.s. of dicot stem t.s. of monocot root t.s. of dicot root t.s. of monocot root amoeba dissected frog anatomy eye ear brain l.s. human skeleton hemophilia pedigree analysis colour blindness pedigree analysis excretory system of human respiratory system of huma circulatory system of humar reproductive system of human ( male ) reproductive system of human ( female ) endocrine system of human animal tissues plants tissues monocot leaf dicot leaf monocot stem dicot stem monocot root dicot root digestive system of human life cycle of angiosperm plants sicyon tape worm liver fluke ascaris male ascaris female earthworm leech • scorpion silk worm life cycle cancer centipede pila unio octopus star fish labeo scoliodon ranatigrina hyla draco bat hydrilla valisnaria cycas male & female cone pinus male & female cone fern ( pteridium ) steel almirah with glass doc steel almirah teacher table ( with steel rack ) ...

University of Rajasthan - Rajasthan

34054037 supply of chemicals, laboratory accessories and outsourcing servicing supply of chemicals, laboratory accessories and outsourcing servicing at botany department, uor, jaipur , chemical items : , 2(4 iodophenyl) 3 (4 nitrophenyl) 5 phenyl 2h tetrazolium chloride (int) 98% , 1 kb dna ladder , 1,10 phenanthroline , 1,2 dichloroethane, hi lr , 100 bp dna ladder , 10x mops buffer , 1 amine 2 napthol 4 sulfonic acid , 1n hydrochloric acid , 1 naphthaleneacetic acid; , 2,3,5 triphenyl tetrazolium chloride , 2,4 dichlorophenoxyacetic acid , 2,4 dinitrophenylhydrazine, hi ar , 20 bp dna ladder(50 ?g) , 2 mercaptoethanol , 2 oxoglutarate , 2 thiobarbituric acid , 3,3’ diaminobenzidine , 3,3 diaminobenzidine tetrahydrochloride (dab hcl) , 5,5 dithiobis (2 nitrobenzoic acid) (dtnb) , 50 bp dna ladder 50ln (150?l) , 50 x tae buffer , 500 bp dna ladder , 5 bromo 4 chloro 3 indolyl phosphate disodium salt (bcip) extrapure, 98% , 5 bromo 4 chloro 3 indolyl ? d galactopyranoside(x gal) 98% , 6 benzylaminopurine , 6x gel loading buffer , 6x orange gel loading buffer , abscisic acid , acetic acid glacialextrapure, 99.5% , acetic acid glacial, hi ar™ , acetone hplc grade 99.9% , acetone pure 99% , acetone, hi ar , acrylamide , adenosine 5 triphosphate , adonitol (ad, sugar discs , agar powder, bacteriological , agarose special, low eeo (nuclease and protease free) , amikacin (ak 10mcg), antibiotic discs , ammonium acetate for hplc, 99% , ammonium dihydrogen phosphate , ammonium ferrous sulphate hexahydrate extrapure, 98% , ammonium molybdate tetrahydrate , ammonium molybedate tetrahydrate extrapure ar, 99% , ammonium persulfate(aps) , ammonium sulphate , amoxyclav (amc 30mcg), antibiotic discs , a napthylamine , andrade’s indicator , aniline blue , anisaldehyde , arabinose (ar), sugar discs , arsenic acid sodium salt heptahydrate , ascorbate oxidase , atp , barium chloride , beef extract powder , betaine , biscrylamide , boric acid , boric acid extrapure, 99.5% , bovine serum albumin , bovine serum albumin ph 7.0 , bromo thymol blue , bromocresol green sodium salt (water soluble) acs (3,3”,5,5 tetrabromo mcresolsulfonphthalein sodium salt) dye content — 90% , buffer capsule ph 4 , buffer capsule ph 7 , buffer capsule ph 9 , butanol extra pure , calcium carbonate extrapure 98% , calcium chloride anhydrous , calcium chloride dihydrate , calcium chloride dihydrate extrapure ar,99.5% , calcium nitrate tetrahydrate , calcium phytate , carbenicillin (cb 100mcg), antibiotic discs , carboxy methyl cellulose sodium , carboxymethyl cellulose , casein enzyme hydrolysate, type i (tryptone type i) , casein hydrolysate , catechol , ceftriaxone (ctr 30mcg), antibiotic discs , cellobiose (ce), sugar discs , chaps buffer extrapure, 99% , chitosan (high mw) , chitosan (low mw) , chitosan (medium mw) , chloroform : isoamyl alcohol (24:1) , chloroform extrapure , cholorodinitrobenzene , ciprofloxacin (cip 10mcg), antibiotic discs , citric acid anhydrous extrapure, 99% , cobalt chloride hexahydrate , colloidal chitin , congo red , coomassie® brilliant blue g 250 , coomassie® brilliant blue r 250 , copper (ii) chloride anhydrous , copper (ii) sulphate pentahydrate , copper(ii) sulfate (cuso4) , cotrimazine (cm 30mcg), antibiotic discs , cotrimoxazole (cot 25mcg), antibiotic discs , ctab , cu nanopowder , cycloheximide , cysteine , d (+) glucose anhydrous , d biotin , deacetylated chitin (high mw extrapure,90% da) , deacetylated chitin (low mw extrapure10 150m.pas, 90% da) , deacetylated chitin (medium mw extrapure, 150 500m.pas, 90% da) , dextrose (de), sugar discs , diethyl pyrocarbonate , diethylpyrocarbonate (depc) , diphenylamine , diphenylamineextrapure ar, 99% , di potassium hydrogen ortho phosphate , di sodium hydrogen phosphate dihydrate, hi ar , disodium phosphate (na2h po4) , disodium phosphate (na2h po4) , dithio nitrobenzoic acid , dithiothretiol (dtt), molecular biology grade , dl dopa , d mannitol, for molecular biology , dnase i, rnase free , dntp mix, 10 mm (2.5 mm each) , dpph , dpta , dulcitol (du), sugar discs , ecori, 5000 units , edta , electrophorsis kitone kit , ethanol (absolute) 500ml , ethidium bromide , ethyl acetate , evans blue dye , ferric chloride anhydrous , ferrous ammonium sulphate , ferrous sulphate heptahydrate, hi ar/acs , ferrric chloride (fecl3) , first strand cdna synthesis kit , fluorescein diacetate , folin ciocalteu reagent , formaldehyde sol 37 41%, hi ar , formamide 500ml , formic acid , fructose (fc), sugar discs , galactose (ga), sugar discs , gallic acid , gelatin bacteriological , gentamicin (gen 10mcg), antibiotic discs , gibberellic acid , glucosinolate , glutathione , glutathione oxidized , glutathione reduced , glutathione reductase , glycerol , glycine , guaicol , h2so4 , hemocytometer , hexane , hi pure a soil dna extraction kit , hydrogen peroxide , hydroxyl amine , hydroxylamine hydrochloride (nh2oh.hcl) , imidazole , indole 3 acetic acid (iaa); , indole 3 butyric acid(iba); , inositol (is), sugar discs , inulin (in), sugar discs , iodine , iodine resublimed , isopropyl alcohol extrapure , kanamycin (k 30mcg), antibiotic discs , kinetin , kovac’s indole reagent , l glutamic acid , l glutamine , l (+) tartaric acid, , labolene phosphate free , lactophenol , lactose (la), sugar discs , l ascorbic acid, a.r , levofloxacin (le 5mcg), antibiotic discs , lithium chloride 100gm , litmus milk , l methionine , l phenylalanine , l tryptophan , magnesium chloride anhydrous500 gm , magnesium sulphate 500gm , magnesium sulphate. 7h2o , maleic acid , maltose (ma), sugar discs , manganese (ii) sulfate tetrahydrate (500gm) , manganese (ii) sulphate monohydrate, hi ar™/acs , mannitol 500gm , mannitol, sugar discs , mannose (mo), sugar discs , melibiose (mb), sugar discs , mercuric chlorideextrapure ar, acs, exiplus, multi compendial, 98% , mercury(ii) oxide (hgo) , mesitylene extrapure, 98% (1,3,5 trimethyl benzene) , methanol , methanol extrapure , methanol pure 99% , methoxyamine hydrochloride , methyl jasmonate , methyl red sodium salt (water soluble) acs, 95% , methyl viologen , mo nanopowder , monosodium phosphate (nah2po4) , m phosphoric acid sticks, hi ar™/acs , ms medium w/cacl2& vitamine , mspi (hpaii), 3000 units , murashige and skoog (m.s) media 5lt , n(1 napthyl) ethylene diaminedihydrochloride , nadh , nadph , nano2 , naoh , napthyl etylene diamine dihydrochloride , nessler’s reagent , netillin (net 30mcg), antibiotic discs , nicotinic acid , ninhydrin , nitrobluetetrazolium chloride (nbt) , nitrofurantoin (nit 300mcg), antibiotic discs , n methyl n (trimethylsilyl) trifluoroacetamide (mstfa) , nuclease free water , nutrient agar , o dianisidine (25 g) , ofloxacin (of 5mcg), antibiotic discs , orthophosphoric acid , orthophosphoric acid extrapure, 85% (phosphoric acid) , oxalic acid , oxidase discs , p amino benzoic acid , pcr master mix 100r (2.5ml) , pda , pectin pure , peptone bacteriological grade , perchloric acid , phenol crystals 100gm , phenol saturated with 10mm tris hcl ph8.0, 1mm edta , phenol, saturated w/10% water500ml , phenol: chloroform: isoamyl alcohol mixture , phenylmethanesulphonyl fluoride , phosphate bufferph 7.2 (apha) , phytase agar media , picloram , picric acid , pikovskaya’s agar , p nitrophenol , p nitrophenyl phosphate disodium , polyethylene glycol mw6000 , polyvinyl pyrrolidone (pvp) k 30 , potassium biphosphate, hi ar , potassium chloride , potassium chloride 99.5% , potassium chromate, , potassium dichromate pure, 99.5% , potassium dihydrogen orthophosphate extrapure ar, 99.5% , potassium dihydrogen phosphate (kh2po4) , potassium hydrogen phosphate (k2h po4) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium permanganate extrapure, 99% , potassium sulfate (k2so4) , prestained protein ladder , proline 99% , protein loading dye , psti, 3000 units , putrescine dihydrochloride , pvpp , pyridine, hi ar/acs , pyridoxal 5’ phosphate anhydrous, hi lr , pyrogallol , quercetin , raffinose (rf), sugar discs , restriction digestion kit , revertaid reverse transcriptase, 10,000 u , rhamnose (rh), sugar discs , ribitol , riboflavin , rna gel loading dye (0.25ml) , rnase100mg , rnase inhibitor (20 u/?l) 2500 units , rnasezap , rochelle salt(na k tartrate) , salicin (sa), sugar discs , salicylic acid , schffs reagent , selenium dioxide (seo2) , silver nitrate, hi lr , silver sulphate pure, 98.5% , simmons citrate agar , sio2 powder , skim milk powder , sodium acetate 100g , sodium acetate 3m , ph 5.2 5.4 , sodium acetate anhydrousfor hplc & uv spectroscopy, 99% , sodium acetate trihydrate , sodium acetate trihydrate , sodium azide (nan3) , sodium bicarbonate , sodium bisulphite , sodium carbonate anhydrous, hi ar/acs , sodium chloride , sodium chloride extrapure ar, 99.9% , sodium citrate anhydrous , sodium citrate tribasic dihydrate extrapure ar, 99% , sodium citrate, 3.8% w/v , sodium dithionite , sodium dodecyl sulphate, ultrapure , sodium fluoride , sodium fluoride pure, 98% , sodium hydrogen sulphite, hi ar/acs , sodium hydroxide pellet , sodium hydroxide pellets extrapure ar, 98% , sodium hypochlorite , sodium hypochlorite, hi ar™/acs(4% w/v solution) , sodium molybdate dihydrate, hi ar™/acs , sodium phenolate , sodium phosphate dibasic anhydrous extrapure ar, 99% , sodium phosphate monobasic anhydrous extrapure ar, 99% , sodium sulfite, hi ar/acs , sodium sulphite , sodium tetraborate , sorbitol (sb), sugar discs , spermidine , spermine , stannous chloride dihydrate dihydrate pure, 97% , starch soluble , streptomycin (s 10mcg), antibiotic discs , sucrose (su), sugar discs , sulfosalicylic acid , sulphanilic acid, purified , sulphosalicylic acid (3%) , taq dna polymerase (3 u/?l) (includes enzyme: 1 vial; 10x taq buffera : 4 vials; 25 mm mgcl2: 4 vials), 1000units , taq polymerase (5 units/?l) , temed , tetra chloroacetic acid , tetracycline (te 30mcg), antibiotic discs , thiamine hydrochloride , thiobarbituric acid (tba) , thiourea, hi ar/acs , titanium (?) oxysulfate hydrate , tlc silica gel 60 f254 , toluene , toluene extrapure ar, 99.5% , toluene, rectified, l.r. , trehalose (te), sugar discs , trichloroacetic acid extrapure ar, acs, 99.5% , triclogel , triclogel dispenser bottle , trimethylsilane (tms) , tris (hydroxylmethyl) aminomethane , tris base , tris buffer ar, acs for molecular biology, 99.9% , tris hydrochloride , tris hydrochloride (tris hcl) extrapure ar, 99% , triton x 100 , trizol reagent® , trypan blue dye , tryptone, certified (casein enzyme hydrolysate) , turbo dna freetm kit , tween 20 , urea extrapure ar, 99.5% , urea extrapure, 99% , xylose (xy), sugar discs , yeast extract 500gm , yeast mannitol broth , zeatin , zinc chloride 500gm , zinc dust , zinc oxide, hi ar™500gm , zinc sulphate heptahydrate , zn nanopowder , glassware items : , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , beaker, glassware , beaker, glassware , beaker, glassware , beaker, glassware , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim,amber, glassware , cover glass, square, glassware , funnel, glassware , funnel, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , microscopic glass slides, plain, ground edges, glassware , petri plats glass, 90mm, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , stirring rod, glassware , test tubes with rim, glassware , watch glasses, borosil s line, 150 ml, glassware , plasticware items : , applied biosystems™ microamp™ optical fast well reaction plate with barcode & optical adhesive films , art™ gel loading pipette tips (20 ?l) , carboy with stopcock ( liquid storage container), 10li , centrifuge tube conical bottom sterile 15 ml (pack of 500) , centrifuge tube conical bottom sterile 50 ml (pack of 500) , conical centrifuge tube rack , draining tray , drying rack , eppendorf tubes (1.5) (pack of 500) , eppendorf tubes (2 ml) (pack of 500) , funnel, 100 mm , funnel, 50 mm , ice bucket , ice tray (1 l) , ice tray (4 l) , junior 4 way tube rack , measuring cylinder class b, material: pp autoclavable 10 ml , pcr rack with cover (pack of 6) , pcr tubes (0.2 ml) (pack of 1000) , pcr tubes box for 0.2 ml , petri plates 100 mm (pack of 12) , pipette tips 0.2 10 ?l(pack of 1000) , pipette tips200 1000 ?l(pack of 500) , pipette tips2 200 ?l (pack of 1000) , plastic pots , polygrid test tube stand , rack for micro tube , test tube basket with cover 180x170x160 , tip box for 200 1000 ?l(pack of 10) , tip box for 5000 ?l (pack of 2) , tip box of 2 200 ?l (pack of 10) , utility tray, material: pp autoclavable; 320x260x100 , utility tray, material: pp autoclavable; 320x260x70 , utility tray, material: pp autoclavable; 360x310x130 , wash bottle new type (750 ml) , wash bottles plastic, 250ml; , wash bottles plastic, 500ml; , other items : , 1kg gross aluminium silver kitchen foil roll paper , 3 step interlocking micro tube rack (24x0.2 ml,14x0.5 ml and 12x1.5 ml tubes) (pack of 6) , autoclavable bags (pack of 100) , casting tray , cheese cloth , comb set (pack of 2) , conical centrifuge tube rack (pack of 4) , cryo cube box , cryo tags , cryocan ba 11 liquid nitrogen container (20l capacity) , cryo cube box1.8ml (pack of 8) , falcon tubes (15 ml) (pack of 500) , falcon tubes (50 ml) (pack of 500) , hand protector grip , hands on™ nitrile examination gloves , hijama surgical blades size 11 , liquid nitrogen flask , magnetic stirrer bar (round) 8x30 mm (pack of 10) , magnetic stirrer bar (round) 8x50 mm (pack of 10) , microcentrifuge tubes box for 1.5 ml(pack of 4) , microchattaway spatula , mortar and pestle (suitable for crushing of plant sample in liquid nitrogen) , multipurpose labelling tape , nitrile gloves powder free large , nitrile gloves powder free medium , non absorbent cotton , nylon membrane filter , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , parafilm tape (size in inches 4 x 125) , pcr rack with cover; 96 well , pipette rack horizontal , pointer spatula (6) , purple nitrile gloves (medium size) , qualitative filter paper grade 1: 11um 150 mm 100/pk , quartz cuvette; capasity; 1.0 ml;190 nm to 2500nm , quartz cuvette; capasity; 3.5 ml;190 nm to 2500nm , romino® silicone heat resistant cooking pinch mitts , round magnetic stirrer bar 8x30 mm , round magnetic stirrer bar 8x50 mm , spatula; 200mm , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , sterial scalpel blade no.22 , syringe filter 4 mm, 0.2 micron (sterile) 100/pack , syringe filter holder, pc (reusable), 13 mm , test tube stand 12 tubes(pack of 4) , tissue roll , tough tags , vertical gel casting system, 18 x 18 cm (glass plates dimension) , whatman® qualitative filter paper, grade 2 , out sourcingservicingitems : , mrna sequencing , small rna/ micro rna sequencing , sequencing of pcr products...

Rajasthan State Pollution Control Board - Rajasthan

34034892 supply of consumables, raegent and controls for lab nitrogen oxide, sulphur dioxide, _‘ 1 2 1 flasks volumetric, with interchangeable glass stopper. class a 2 flasks volunetric. with interchangeable glass stopper. class a 3 nessler tube with graduation ( borosil ) 4 nessuer tube with graduation ( borosil ) 5 flasis volumetric, wiih interchangeable glass stopper, class a 6 flasis volumetric. with inirrchungeable glass stopper, class a_ 7 flanks volumearic. iith interchangeable glass stopper. class a pipettcs. graduated . schdihach. ( scrioloeical type ) , class as graduation divisionl 0.o1 ml witb calinratipn certificane ( ) pipettes. gradunted . scheilbach. ( seriological type ) . class as graduation division 0.n1 ml wiah calibratipn certificate 1i pipettes. graduated . schelihach. ( seriological type ) . class as graduution division 0u01 ml with calibnation certificane 1m1 pipettes. graduated . schelihach. seriological type ) . ( ‘lass as graduatinn division 0.01 ml with calibration ( ‘ertiticute 12 reg ent bottles, piain clear glass graduaied with screw cg 13 rca eat botties. plain clear glass graduated with screw cap i4 bottles. amber glass graduated with screw ca 1. bottles. amber glass graduated with screw ca 1b lm in er 17 spectro hotoineter quarie cu ettcs 0.5 ia1—n . pipette aid sucker 10 ml 2 bottle top dispenser 1 10 ml 3 — foreep 200 mm 4 spatula ( s and l size ) 5 ash bottels ( 500 ml ) 6 ( ‘oolling box ( small ) 7 — nessler tube stand bnwing .ipacity 50 and 100 ml tubes 8 silical gel ( in gel t>pe 9 pipette stand ertical ( 28 pipettes ) class vi ) 10 narrow mouth bottle ( medical grade idpe confirming to ( 60 ml ) usp amber narross mouth bottie ( medical grade iii ) p [ confirming class vi ) ( 60 ml ) usp class vt ) narrow mouth bottle ( medical grade ldpe confirming to ( 500 ml ) usp 13 amber narrow nouth bottle ( medical grade iii ) pi, confinnlinlgto class vi ) ( 500 nil ) 14 lnjection ( 10 ml ) i ) extension cord with wer plug cloth for cleaning machine rds cover apron, l9.ltest tube cleaner brush — 20? — first aid kit 21 labelling tape ( cryo tags ) 22 markers 23 tissue roll 24 liquid glassware cleaner 25 hland towels — 26 nornnnl_fiiter.paper? 27 register 28 data shcet file 29 filter paper envelop ( for pm 2.5 ) 30 filter paper envelop ( for pm 1o ) — 31 screw kit 32 gloves ( lsize ) 33 allumniniurn foil....

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Govind Guru Tribal University - Rajasthan

33934583 supply of chemical glass ware and general lab instrument 1 1, 10 – phenanthroline hydrate 2 1, 5 diphenyl carbazide a.r. 99% 3 acetic acid glacial 99.5% 4 acetic acid glacial 99.5% 5 ammonia buffer solution 6 ammonia solution ( 10% ) 7 ammonia solution sp.gr.0.89 ( 30%nh3 ) 8 ammonia solution sp.gr.0.91 9 ammonium acetate 96% 10 ammonium bicarbonate 98.5% 11 ammonium ceric sulphate 90 105% 12 ammonium chloride i.p. 99 100.5% 13 ammonium molybdate 98% 14 ammonium oxalate 99% 15 ammonium potassium oxalate solution 16 ammonium sulphate 98.5% 17 ammonium thiocyanate 97% 18 barfoed’s reagent 19 barium chloride 99% 20 barium hydroxide 97% 21 barium sulphate 97.5 100.5% 22 basic fuchsin m.s. ( dye content 88% ) 23 bees wax ( white ) 24 benedict’s reagent qualitative 25 benedict’s reagent quantitative 26 bentonite powder ( aluminium silicate hydrate ) 27 benzene 99% 28 benzoic acid 99% 29 borax ( di sodium tetraborate ) 99% 30 boric acid 99.5% 31 bromine water 32 bromocresol green 33 bromocresol purple solution 34 buffer solution ph 6.0 35 buffer solution ph 8.0 36 butylated hydroxy anisole ( bha ) 98% 37 butylated hydroxy toluene ( bht ) 99%, 38 calamine ( zno 98 100.5% ) 39 calcium carbonate 98% 40 calcium chloride fused 90% 41 calcium gluconate 98.5 102% 42 calcium hydroxide 95% 43 calcium lactate 98 101% 44 camphor 45 castor oil 46 cedar wood oil 47 ceric sulphate 98% 48 cetyl alcohol ( 1 hexadecanol ) 98% 49 chloroform 99% 50 chlorophenol red solution 51 cholesterol a.r. ( for biochemistry ) 99% 52 cholesterol stock standard 0.1% w / v 53 citric acid monohydrate 99.5% 54 cobalt nitrate 97 101% ( cobaltous nitrate ) 55 copper sulphate 98.5% ( cupric sulphate ) 56 copper sulphate solution ( sp.gr. 1.053 ) ( for haemoglobin determination in blood ) 57 cresol ( mixed ) 58 crystal violet solution oxalated 59 d ( ) fructose ( laevulose ) ( for biochemistry ) 60 dextrose i p / usp 61 d glucose anhydrous i p / usp 62 dicalcium phosphate 98% 63 diethylamine 99% 64 dimethyl sulphoxide 99% 65 edta disodium salt 98% 66 edta solution 10% w / v 67 emulsifying wax 68 esbach’s reagent 69 ethyl acetate 99% 70 fehling’s solution no. 1 71 fehling’s solution no. 2 72 ferric ammonium sulphate 98% 73 ferric chloride anhydrous 96% 74 ferric chloride solution 10%w / v ( gerhardt’s reagent ) 75 ferrous sulphate 98% 76 glycerin ( glycerol ) 98% 77 glycerine ( glycerol ) 98% 78 glycine ( amino acetic acid ) 98% 79 gum tragacanth powder 80 hydrochloric acid 81 hydrochloric acid 82 hydrogen peroxide 20 vol. ( 6% w / v ) 83 immersion oil ( for microscopy ) 84 indicator paper ph 1 14 ( full range ) 85 iodine resublimed 99.5% 86 iodine solution n / 10 87 isopropyl alcohol 99% ( benzene free ) 88 lactose monohydrate ( for biochemistry ) , 89 lamposolv ( for spirit lamp ) 90 lanolin anhydrous 91 lead acetate 99% 92 lead subacetate ( lead acetate basic ) 98% 93 leishman’s stain solution improved ( with buffer ) 94 leishman’s stain solution ( stain and solvent separate ) 95 l glutamic acid ( for biochemistry ) 99% 96 lugol’s iodine solution 97 magnesium oxide light 98% 98 magnesium sulphate 99% 99 maltose monohydrate 100 mercuric nitrate 98% 101 methanol ( methyl alcohol ) acetone free 102 methanol ( methyl alcohol ) acetone free 103 methyl orange solution 104 methyl paraben 99 101% ( methyl4 hydroxy benzoate ) 105 methyl red solution 106 methylene blue aqueous 1% w / v 107 millon’s reagent ( for protein ) 108 molisch’s reagent 109 naphthol alpha solution 110 ninhydrin solution 111 nitric acid 112 nitric acid 113 nitrobenzene 99 % 114 oxalic acid 99.5% 115 paraffin liquid heavy i p 116 paraffin liquid light i p 117 paraffin wax 58 60°c ( solid ) 118 p cresol 98% 119 petroleum jelly white ( white soft paraffin ) 120 phenol ( carbolic acid ) 99% 121 phenol reagent ( folin & ciocalteus ) 122 phenolphthalein solution 123 phenyl hydrazine 98% 124 phloroglucinol a.r. 99% 125 picric acid saturated solution 126 poly vinyl alcohol 98% 127 potassium bromate 128 potassium carbonate 99% 129 potassium chloride 99.5% 130 potassium chromate 99% 131 potassium chromate solution 5% w / ( chloride free ) 132 potassium dichromate 99.5% 133 potassium ferricyanide 99% ( potassium hexacyano ferrate ( iii ) 134 potassium ferrocyanide 99% ( potassium hexacyano ferrate ( iii ) ) 135 potassium hydrogen phthalate 99.5% 136 potassium hydroxide flakes 85% 137 potassium hydroxide solution 40%w / v, 138 potassium iodide 99% 139 potassium nitrate 99% 140 potassium permanganate i p 99 100.5% 141 potassium pyroantimonate 99% 142 propylene glycol 99% ( propane 1, 2 diol ) 143 r.b.c. diluting fluid ( hayem’s ) 144 resorcinol 99% 145 ruthenium red m.s. ( ru content 34% ) 146 seliwanoff’s reagent 147 silver nitrate solution n / 10 148 silver nitrate solution n / 50 149 soda lime with indicator 150 sodium acetate anhydrous 98% 151 sodium azide 99% 152 sodium bicarbonate i.p 99 101% 153 sodium carbonate anhydrous 99.5% 154 sodium chloride i p / usp 99 100.5% 155 sodium cobaltinitrite 95% 156 sodium hydroxide flakes 96% 157 sodium hypobromite solution 158 sodium lauryl sulphate 90% 159 sodium nitrate 98% 160 sodium nitroprusside 99% 161 sodium sulphate anhydrous 99% 162 sodium thiosulphate ( hypo ) 99% 163 stannous chloride ( tin chloride ) 95% 164 starch soluble 165 steric acid 166 sucrose 167 sudan ii 168 sudan iii solution 169 sulphosalicylic acid 99% 170 sulphosalicylic acid solution 10% w / v 171 sulphur powder 99.5% 172 sulphuric acid 97% 173 sulphuric acid 174 talcum powder ( talc ) 175 tannic acid 98% 176 thioglycolic acid 80% 177 titanium dioxide 98% ( titanium ( iv ) oxide ) 178 tri sodium citrate i p / usp 99 101% 179 triethanolamine 99% 180 vanillin 99% 181 w.b.c. diluting fluid ( turk’s ) 182 zinc oxide i.p. 183 zinc sulphate 99% 184 ammonia ammonium chloride buffer / ammonia buffer solution 185 aqueous caustic potash / potassium hydroxide pellets 186 atropine sulphate ar 98% 187 carbon tetrachloride ** make molychem 188 chlorinated lime / bleaching 189 p chloro m cresol ( 4 chloro 3 methyl phenol ) **make qualikems 190 cinnamon, 191 diethyl ether ( ether solvent ) 98% 192 disodium hydrogen orthophosphate 193 emulsifying wax 194 ethanol 95 % ( bill & lable name ethyl acetate ) imported* 195 hydroxy propyl methyl cellulose make qualikems ** 196 isopropyl myristate make qualikems ** 197 lime water ( for testing carbonates ) 198 magnesium stearate 199 magnesium trisilicate make qualikems ** 200 million’s reagent ( for protein ) 201 eriochrome black t 202 oxalic acid 99.5% 203 peppermint oil make qualikems ** 204 peroxidase make hi media ** 205 phenyl mercuric nitrate** research lab 206 pottasium ferricynide 207 propyl p hydroxy benzoate ( nipasol plain ) ** make rankems 208 saccharin sodium make qualikems ** 209 hydrochloric acid 35 38% ( thermocol pack ) 210 terpentine oil make qualikems ** 211 zinc ( metal ) granulated extra pure make rankems** glassware & general lab instrument 1 arsenic test app 2 beaker 50 ml 3 beaker 100 ml 4 beaker 250 ml 5 beaker 500 ml 6 beaker 1000 ml 7 burette 50 ml 8 burette stand 8x5x24 with clamp 9 bottle brush 10 burette brush 11 capillary tube ( pack ) superior 12 china dish 3 ( p ) 13 conical flask 250 ml 14 conical flask 500 ml 15 conical flask 1000 ml 16 cover slip ( pack ) pack of 20 pc 17 filter paper ( pack ) 12.5 cm ( ordinary ) 18 funnel glass a ) 2 b ) 3 c ) 4 19 glass rod 8 20 measuring cylinder 10 ml 21 measuring cylinder 25 ml 22 measuring cylinder 50 ml 23 measuring cylinder 100 ml 24 measuring cylinder 250 ml 25 measuring cylinder 500 ml 26 nessler’s cylinder 50 ml 27 pestle mortar small 4 ( p ) 28 pestle motar large 6 ( p ) 29 petridish 4’’ 30 pipette measuring 1 ml 31 pipette measuring 5 ml32 pipette measuring 10 ml 33 pipette volumetric 1 ml 34 pipette volumetric 5 ml 35 pipette volumetric 10 ml 36 pyknometer 10 ml 37 reagent bottle n / m 250 ml 38 reagent bottle n / m coloured 125ml 39 round bottom flask 100 ml 40 round bottom flask 250 ml 41 rubber cork pack of 12 42 rubber sucker bulb ( pipette sucker ) 43 separating funnel 250 ml 44 silica crucible 15cc 45 slides ( packs of 50 ) 46 spatulla 8 47 test tubes 15x125 pack of 100 48 test tubes brush 49 viscometer oswald’s 50 volumetric flask 250 ml 51 volumetric flask 500 ml 52 volumetric flask 1000 ml 53 watch glass ( pack of 12 ) 54 buchner funnels small 2 ( p ) 55 buchner funnels medium 3 ( p ) 56 buchner funnels large 4 ( p ) 57 folin wu tubes 58 reflux flask double necked 250 ml 59 reflux flask single necked 250 ml 60 condenser 12 long b24 61 reflux flask triple necked 250 ml 62 viscometer ( viscometer oswald’s ) 63 micropippete tips cost of one pack 64 dropper bottle 125ml 65 litmas paper ( rad&blue ) pack 66 ph paper ( pack ) 67 whatmen filter paper 1 125 pack of 100 original 68 water bath copper 6 69 tripod stand 7 x 5 heavy 70 soxhlet apparatus 200 / 500 ml 71 inoculating loops holder 72 petri dish 4....

Govind Guru Tribal University - Rajasthan

33934146 supply of pharmacy lab equipments 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall, 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a ) stage micrometer b ) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a ) single channel b ) multi channel 53 uv cabinet 2 tube , 1 refractometer / abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double / triple necked a ) double neck b ) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath ( 12 holes ) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance ( 1mg sensitivity ) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc ( desirable ) , 36 atomic absorption and emission spectrophotometer ( desirable ) 37 biochemistry analyzer ( desirable ) 38 carbon, hydrogen, nitrogen analyzer 39 deep freezer ( desirable ) 40 ion exchanger 50 ltr. cap. 41 lyophilizer ( desirable ) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer ( trinocular microscope with camera attachment ) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly ( single unit ) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer ( activity cage ) 27 rotarod 2 compartment, 29 analgesiometer ( eddys hot plate and radiant heat methods ) a ) eddy hot plate digital b ) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a ) dissection tray 12x10 gi sheet b ) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a ) levers ( i ) simple lever with pointer ( ii ) starling heart lever with pointer ( iii ) frontal writing lever b ) cannula ( i ) symes cannula ( ii ) venous cannula ( iii ) arterial cannula 41 hypodermic syringes & needles size 15, 24, 26g pharmacognosy dept. 1 compound microscope ( student microscope ) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium, 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a ) single channel b ) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill ( bark and seed grinder ) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a ) autoclave 12x12 s.s. b ) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube, 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a ) blood pressure app. mercury b ) stethoscope 14 clinical thermometer mercury....

Indian Army - Rajasthan

33912568 bids are invited for a3 7330 000218 flask thermos 0.5 ltrs with plastic cap total quantity : 2373...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...


33775824 lab equipment and material in labs supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp. 28 wash bottles 50o ml. 29 reagent bottle 12s ml. 30 reagent bottle 2so ml. 31 reagent bottle 500 ml. 32 ! reagent bottle 2so ml. 33 reagent bottle 5o0 ml. 3.4 dropping bottles 125 ml. 35 glass tube 6x10 mm. 36 fusion tube 6x10 mm. 37 centrifuge machine ( fourt.t. ) 3s centruge machine ( fourt.t. ) 39 filter paper ( sheet ) , i 4o filter paper ( v ) 41 , water bath 41 water bath 42 cork borer 43 pastel and mostars 15 cm. 44 pastel and mostars 20 cm. 4s weighing machine 1kg 1 c1nder 500 ml 47 cylinder 100o ml. i 48 condenser 500 ml. 49• separating funnel 10o0 ml. 50 ‘ gas genrator 1 bter 51 thermometer 30 cm._long 52 thermometer 3o cm. long 53 thermometer 30cm. long ! 54 thermometer indus. max mi 55_pipette stand pvc etc...


33757904 supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical Health And Family Welfare - Rajasthan

33724703 supply of mnjy_labrejants_pmosuj mnjy_labrejants_pmosuj , blood sugar kit , blood sugar kit , blood sugar kit , blood urea kit , blood urea , blood urea kit kinetic , urea end point , s. creatnine r1 2*60 ml , r2 2*60 ml , s. creatnine r1 2*50 ml , s. creatnine , s. bilirubine (t) , s. bilirubin d & t , s. bilirubine (t) , s. bilirubine t&d r1 2*60 ml ,r2 2*60 ml , s. bilirubine t&d , sgot , sgot , sgot , sgpt , sgpt , sgpt , s. alk. phosphate , s. alk. phosphate , s. alk. phosphate , total protein , total protein , total protein , s. albunum , s. albunum , s.albumin , s. calcium r1 1*50 ml, r2 1*50 ml , s. calcium , s.calcium , s. ck nac r1 2*8 ml, r2 2*2 ml , s. ck nac , ck mb , ck mb , s.ldh r1 4*8 ml, r2 1*8 ml , s. ldh , s.amylase , s. amylase , s.amylase , s. uric acid , s. uric acid , s. uricacid , s.uric acid , s. t. cholesterol , s.t. cholesterol , s.t. cholesterol , s. trigly ceride , s. trigly ceride , s. trigly ceride , s.hdl , dirrecthdl , s.hdl direct , s.hdl , ldl cholestrol , ldl cholestrol , csf dilution fluid , plueural dilution fluid , acetic dilution fluid , semen dilution fluid , urine strip for alb & sugar(uristix) , urine strip for sugar & ketone(ketodiastic) , multistrip10 para for accurex urine analyser ( express 10) , urine strip 4 para (alb,sugar,ph,sp. gravity) , pregnancy test card , sulphur powder , edta powder , nitric acid , glacial acetic acid , eosino dilution fluid , ligeul iodine for stool exam , anti abd set , anti d (igg & igm) , total rbc dilution fluid , field stain i , field stain ii , platelest dilution fluid , fouchest reagent , liesman stain , tissue paper roll , filter paper 0 no. , mp card(antigen) , dengue card antigen (day 1) ns1 iggigm , vdrl strip , jsb i stain , jsb ii stain , liquid parafine oil , crp kit , ra kit , aslo kit , widal , bovine album 22% , hiv tridols , esr tube glass , hb meter squer , hb meter round , hb tube round , hb pipate , distilled water , n/10 hcl , glass slide , riya vial , urine container with label (non sterilized 30 ml) , tips stand for yellowtips , tips stand blue tips , iron esr stand 6 tube capicity , throm bo span ls , test tube glass , test tube glass , measuring pipalte glasss 1ml , measuring pipalte glasss 2ml , measuring pipalte glasss 5ml , measuring pipalte glasss 10 ml , hbsag card , sodium citrate vial for pt test , mearing flask 250 ml , mearing flask 500 ml , mearing flasic 1 lit , glass funnel , glass beaker 50ml , glass beaker 100ml , tlc dilution fluid , 3.1% sodium citrat , for ceff steel , combs sera , cbc vial mixer , hb tube squar , syringe needle distoryed maschine , thermal paper 50mm*20 mtr , thermal paper 110mm*20 mtr , alluminiumtest tube stand 4*8 holl , new bar chamber , urine container with label(sterilized) 50 ml , cover glass , cover slip , bt ct capiliry tube , esrite esr stand , droper bottle plastic 60ml , wash bottle plastic 250ml , washbottel plastic 500 ml , blue tips , yello tips , slide box plastic (big size) , slide box plastic (smallsize) , kidney tray plastic , alluminumtest tube stand 3*8 holl , alluminum tast tube stand 3*4 holl , blood sugarstrip for glucometer , biochemistry reagent for rendox fully auto analyser , blood uria kit birthload method , gram stain , giemsa stain with fixative , sodium hypocloride solution 5% , hiv sd card , micro pipet veriable , micro pipet veriable , micro pipet veriable , stop watch , tunicate belt , disposable esr tube ( 1 to 200 mm.) , disposable serum vial , lense cleaning paper , dengu kit for alisa mathed ns1 , dengu kit for alisa mathed igg , dengu kit for alisa mathed igm , anti ab vial , centrifuse machine [ r 8cdx] , centrifuse machine , rotator machine , j.s.b. firststain , j.s.b.second stain , sterile disposable needle no 22 , sterile disposable needle no 23 , sterile disposable needle no 24 , sterile disposable needle no 26 , dispovan 5ml syringe , edta k3 non vccum blood collection tube 1 to 4 ml withtray paking , clot activator non vccum blood collection tube 1 to 4 mlwithtray paking , floride non vccum blood collection tube 1 to 4 ml withtray paking , citrate 3.2 % non vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % non vccum blood collection tube 1 to 4 mlwithtray paking , lithium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , gel non vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 5 to 6 mlwithtray paking , clot activator vccum blood collection tube 1 to 4 mlwithtray paking , clot activator vccum blood collection tube 5 to 6 mlwithtray paking , floride vccum blood collection tube 1 to 4 mlwithtray paking , floride vccum blood collection tube 5 to 6 mlwithtray paking , citrate 3.2 % vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % vccum blood collection tube 1 to 4 ml , gel vccum blood collection tube 1 to 4 mlwithtray paking , gel vccum blood collection tube 5 to 6 ml , lithium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , needle for vaccume tube , iron ball for prothombin test , cuvet for prothrombine test , dengue ns 1 elisa test , dengue igg elisa test , dengue igm elisa test , hbsag elisa test , hb test strip for hemocue hb 301 , cleaning solution , de ionised water , stool container , typhi dot rapid test , t3 for elisa reader , t4 for elisa reader , tsh for elisa reader , wash solution for elisa reader , typhoid test repid test kit , haem test for occult blood kit for stool , lancet for glucometer , methanol for fixative , slide fixative spray , sonographyroll , sonography jelly , ecg roll for single channel bpl(6108 t) , ecg roll for six channel allengers , ecg roll for twelve channel cp 200 welch allyn , ecg jelly , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray film blue base (conventional) , x ray film blue base (conventional) , x ray film blue base (conventional) , esr tube stand , x ray dental film...


33711452 supply of science lab furniture for govt sr. secondary school faachar, nimbahera supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...


33710655 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school suwaniya, gangrar...


33710651 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school kunwaliya, gangrar...


33710647 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school sadi, begun...


33710645 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school dovni, kapasan...


33710643 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school bhanuja, bari sadri...


33710481 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school melana, nimbahera...


33709138 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab items for govt sr. secondary school barwada, nimbahera...