Medical College - Rajasthan

34859739 supply of chemical and reagents biochemistry dept. 1. fhio urea sodium borate benzoc acid 4. bariun chloride 5. bromide ampuls 6. ammonium sulphate 7. egg albumin 8. , whatman filter paper no i round pathology dept. 9. formalin ( liquid ) 37.41% 10. glacial acetic acid 11. giemsa stain 12. reticulocyte stain 13. field a&b stain 14. 10% hypochlorite solution 15. j distilled water 16. sulphur powder 17. liquid paraffin oil 18. formic acid 19. i dextrose anhydrous 20. albumin ( egg ) 21.10 ( 1 / 0 acetic acid 22. sulphosalicylic acid 23. benedicts qualitative solution 24. i acetone 25. ammonium sulphate 26. sodium nitroprusside 27. liquid ammonia 28. conc. nitric acid 29. n / 10 hc1 30. naoh ( pellet ) 3 1 . lueols iodine 32. benzidine 33 hydrogen peroxide 34. bile salt powder 35. hematoxylin powder 36. imethanol acetone free ( anai, ytic grade ) 37. 1 iiematoxylin ( harris ) staining solution 3k. 1% toluidene blue stain 3471 ethyl alcohol 40 eosin y 2% w / v 41. magnesium sulfate 42 sodium bicarbonate 43. 00 6 stain 44. t ea 50 ( modified ) stain 45. i potassium nitrate 46. potassium acetate 47. t glycerine 48 pyridine 49. 1 sodium hydrosulphite ( technical grade ) 50. i thymol crystals ( laboratory ) kuviuxu.lav ( iupgm ) ( 20 / 10 ) cefixime ( 5pgm ) ceftriaxone ( 30pgm ) 53 54. 55. cefpodoxime ( 10pgm ) 56. cotrimoxaxole ( 25pgm ) clindamycin ( 2pg ) m 57. 58. doxycyclin ( 30pgm ) imipenam ( 10pgm ) 59. 60. meropenam ( 10pgm ) 61. levofloxacinnigm ) 62. ofloxacin ( 5pgm ) 63. polymyxin b ( 300u n it ) 64. vancomycin ( 30pgm ) ampicillin+salbctum ( 10+ 10 pgm ) 65. 66. cefelexin 67. ceftazidime+clavulinic acid ( 30+10pgm ) 68. carbenicillin ( 100pgm ) 69. colistin o. cefepime ( 30pgm ) 1. cefotaxime ( 30pgm ) ) cefuroxime ( 30pgm ) 73. ceftazidime ( 30pgm ) 4. ceftriaxone+salbactum ( 30+10pgm ) , , _ . erythromycin ( 15pgm ) 6 aztreonam ( 5pgm ) oxacillin ( lpgm ) 8. penicillin g 9. azithromycin 80. tigycyclin 81. teicoplanin 82. bacitracin 83. optochin 84. amphotericin b ( 100un / t ) 85. nystatin ( 100un / t ) 86. clotrimazole ( loggm ) 87. itraconazole ( loggm ) 88. ketoconazole ( 10pgm ) 89. fluconazole ( 10pgnn ) 90. oxidase disc 91. piperacillin+trazobactum 92. manitol salt agar 93. candichrome ( candida ) hiveg agar 94. lowenstein jenson media 95. loeffler serum agar 96. mac conkey agar 97. brain heart infuion broth 98. glucose broth 99. bile broth base 100. sodium polyanethol sulphonate 101. sabouraudes dextrose agar 102. pottasium hydroxide pelletes ar 103. beef extract powder 104. nutrient agar 105. mueller hinton agar 106. peptone 107. hichrome uti agar 108. ppa 109. agar powder extra pure 1i0 starch soluble ar 111. urea hiveg agar base ( cristensch ) urea 40% ( 5ml per vial ) i _i simmons citrate triple sugar iron hiveg agar 114. absolute alcohol 115. acetone 116. sodium hypochlorite 117. pottasium dichromate 118. formalin 119. lactophenol cotton blue 120. crystal violet 121. ferric chloride 122. cornmeal agar 123. methylene blue 124. dextrose broth 125. phenol crystals 126. safrenine 127. oxidase reagent 128. trunk s fluid 129. hayems fluid 130. n / 10 hcl 131. blood group antiserta 132. filter paper 133. capillary tube 134. distill water 135. lancet 136. cedar wood oil 137. leishmans stain 138. sprit ( surgical alcohol ) 139. glass slide 140. cover slip 141. acetone 142. formaldhyde solution 100% 143. glycerine 144. hydrogen peroxide 145. ethanol 99.97 fot 142 sodium hypochlorite 143 formaldhyde solution 100% 144 benzidine reagent 145 leucomalachitte green 146 lugols iodine 147 povidone iodine 148 hydrocloric acid 149 sulphric acid 150 carbolic acid 151 sodium fluride 152 hematoxilin staining fluid 153 eosin staining fluid 154 edta 155 rectified sprite >99% 56 glycerine 57 ethanol 99.97 58 fomol solution ( commercial ) ...

Medical Education Department - Rajasthan

34853022 supply of chemicals and reagents , rate contract of chemicals and reagents , biochemistry dept. , thio urea , sodium borate , benzocacid , bariun chloride , bromide ampuls , ammoniumsulphate , egg albumin , whatman filter paper no 1 round , pathology dept. , formalin (liquid)37.41% , glacial acetic acid , giemsa stain , reticulocyte stain , field a&b stain , 10% hypochlorite solution , distilled water , sulphur powder , liquid paraffin oil , formic acid , dextrose anhydrous , albumin (egg) , 10% acetic acid , sulphosalicylic acid , benedict’s qualitative solution , acetone , ammonium sulphate , sodium nitroprusside , liquid ammonia , conc. nitric acid , n/10 hcl , naoh ( pellet ) , lugol’s iodine , benzidine , hydrogen peroxide , bile salt powder , hematoxylin powder , methanol acetone free(analytic grade) , hematoxylin (harris) staining solution , 1% toluidene blue stain , ethyl alcohol , eosin y 2% w/v , magnesium sulfate , sodium bicarbonate , og 6 stain , ea 50 (modified) stain , potassium nitrate , potassium acetate , glycerine , pyridine , sodium hydrosulphite (technical grade) , thymol crystals (laboratory) , micro biology , amikacin(30?gm) , amoxyclav(30?gm)(20/10) , cefixime(5?gm) , ceftriaxone(30?gm) , cefpodoxime(10?gm) , cotrimoxaxole(25?gm) , clindamycin(2?gm) , doxycyclin(30?gm) , imipenam (10?gm) , meropenam(10 , levofloxacin(5?gm) , ofloxacin(5?gm) , polymyxin b(300 unit) , vancomycin(30?gm) , ampicillin+salbctum(10+10 ?gm) , cefelexin , ceftazidime+clavulinic acid(30+10?gm) , carbenicillin(100?gm) , colistin , cefepime(30?gm) , cefotaxime(30?gm) , cefuroxime(30?gm) , ceftazidime(30?gm) , ceftriaxone+salbactum(30 , erythromycin(15?gm) , aztreonam(5?gm) , oxacillin(1?gm) , penicillin g , azithromycin , tigycyclin , teicoplanin , bacitracin , optochin , amphotericin b(100 unit) , nystatin(100 unit) , clotrimazole(10?gm) , itraconazole(10?gm) , ketoconazole(10?gm) , fluconazole(10?gm) , oxidase disc , piperacillin+trazobactum , manitol salt agar , candichrome (candida)hiveg agar , lowenstein jenson media , loeffler serum agar , mac conkey agar , brain heart infuion broth , glucose broth , bile broth base , sodium polyanethol sulphonate , sabouraudes dextrose agar , pottasium hydroxide pelletes ar , beef extract powder , nutrient agar , mueller hinton agar , peptone , hichrome uti agar , ppa , agar powder extra pure , starch soluble ar , urea hiveg agar base(cristensch) urea 40%(5ml per vial) , simmons citrate , triple sugar iron hiveg agar , absolute alcohol , acetone , sodium hypochlorite , pottasium dichromate , formalin , lactophenol cotton blue , crystal violet , ferric chloride , cornmeal agar , methylene blue , dextrose broth , phenol crystals , safrenine , oxidase reagent , physiology , trunk ‘ s fluid , layem’s fluid , n/ 10 hcl , blood group antiserta , filter paper , capillary tube , distill water , lancet , anatomy , acetone , formaldhyde solution 100% , glycerine , hydrogen peroxide , ethanol 99.97 , forensic medicine &toxicology , sodium hypochlorite , formaldhyde solution 100% , benzidinereagent , leucomalachitte green , lugol’s iodine , povidone iodine , hydrocloricacid , sulphric acid , carbolic acid , sodium fluride , hematoxilin staining fluid , eosin staining fluid , edta , rectified sprite >99%...

Medical Health And Family Welfare - Rajasthan

34846615 supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit ( 4th gen. ) , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit ( 4th gen. ) , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clotaing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 ?l ) , blue tips for micro pipette ( 1000 ?l ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 ?l , aerosol barrier tips 20 ?l , aerosol barrier tips 100 ?l , aerosol barrier tips 200 ?l , aerosol barrier tips 1000 ?l , water molecular grade 500 ml , self locking cable tie for bmw bags , micro pipette stand , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , cryo gloves all size , falcon tube 50 ml , falcon tube 15 ml , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) . , autoclave single channel micropipettes 100 1000ul , autoclave single channelmicropipettes 0 100ul , autoclave single channelmicropipettes 0 50ul , autoclave single channelmicropipettes 0 10ul , autoclave single channelmicropipettes 0 200ul...

Medical And Health Services - Rajasthan

34806181 supply of lab reagents i hcv test tri dot rapid card ) 2 hbsag test ( rapid card ) 3 lll3sag eisa test kit ( 4th gen ) 4 iiiv test ( tr dot rapid card ) 5 hiv ehsa test kit ( 4th gen. ) 6 hcv eisa test kit 4th gen ) 7 vdrl test kit ( strip ) 8 urine pregn—cy test kit ( card ) 9 dengue tut kit ( rapid card ) 10 dengue 1gm ehsa test kit i i denue ns i elisa test kit 12 ii ) card for gel card cross matching ( for biorad machine ) 13 pt i’est reagent kit ( 4x2 ml ) 14 widal test kit 15 malaria card ( rapid test for malaria antigen ) 16 crptes 17 aslo test kit 18 r.a. factor kit ( slide method ) 19 anti a, anti b & anti d ( monoclonal tg ( &, 20 21 amid ( monoclonal igg & im ) anti d monoclonal 1gm 22 anti h lcctin 23 anti al lectine 24 bovine albumin 25 anti human globulin rcoombs sera ) 26 multistix urine test strips ( for 10 parameter ) 27 urine sthp for ketones & glucose 28 leishnan stain liguid çready to use ) 29 giemsa stain solution ( ready to use ) 30 field stain reagent ( a+b ) 31 whatmans filter paper 32 p1 i paper ( litmus paper ) 33 cover slip for slide 34 capillary tube ror clotaing time 35 esr stand 36 methanol 37 dionised water 38 sample cup for biochemistry 39 ecoshield 40 absolute isopropenol ( molecular grade ) 41 reservior trough 42 plain glass test lube, 43 96 well vtm ( for 15 ml vth4 ) 44 blood sugar test kit ( manual ) 45 s. urea ( manual ) 46 s. creatinine ( manual ) 47 s. bilirubin ( manual ) 48 s. sgot ( manual ) 49 s. sgpt ( manual ) 50 w.13.c diluting fluid 51 r.b.c diluting fluid 52 semen i ) iluting fluid 53 losinophil diluting fluid 54 platelet diluting fluid 55 sahlis ilaemoglobinomcter 56 iibtube 57 iib. pipette 58 w.b.c pipette 59 r.b.c pipette 60 improved neubauer counting chanber 61 clean sole solution ( glass ware ) 62 levermed lab airticals disinfectant 63 combystyne labairticle disinfectant 64 tourniquet, 3.2% sodium citrate coated disposabie esr tube / pipette 71 pricker disposablclancct ) 72 sulphur powder 73 glacial acetic acid 74 liquid paraffin ( heavy ) 75 iodine solution 76 xylene 77 microscope glass slide 78 k3 edta disposable vaccuta ner vial 79 plain disposable vaccuta net vial 80 sodium floride ( naf ) disposable vaccutaner vial 81 clot activator disposable vaccutaner vial 82 3.2% sodium citrate disposable vaccuta net vial 83 chikengunya 1gm elisa test kit 84 scrub typus elisa test kit 85 ethanol molecular grade ( 500 ml ) 86 aerosol barner tips 10 pl 87 aerosol barrier tips 20 pi 88 aerosol bather tips 100 lul 89 aerosol bather tips 200 ul 90 aerosol barrier tips 1000, etc....

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub should have inbuilt quality should have detection limit 0.5ng / ml / 0.1iu should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation should be based on flow through must have a long shelf life & only in the form of card not in the form of should be approved and evaluated by should be short interpretation time not more than 3 to 5 minutes should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per must have a long shelf life & only in the form of card not in the form of should be short inter preparation time 3 to 5 minutes should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per must have a long shelf life & only in the form of card not in the form of should be short inter preparation time 3 to 5 minutes should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Government Medical College - Rajasthan

33839601 supply of reagents and consumables 1 edta vial ( plain blue ) 2 acetone 3 strong ammonia ( 25% ) 4 test tube holder 5 test tubes ( 10 ml ) 6 test tubes ( 12 ml ) 7 bile salt rankam 8 suffer powder ( rankam ) 9 5 sutphosalicylic acid extra pure ( srl ) 10 sodium nitroprusside pure 98% ( srl ) 11 ammonium sulfate emplural ( 25% ) 12 benedict reagent 13 spirit 14 cubettes in autopepettes ( 10 ml ) 15 cubettes in autopepettes ( 20 ml ) 16 cubettes in autopepettes ( 0.5 ml ) 17 spirit lamp 18 blood glucose reagent kit 19 albumin ( bcg ) kit ( accurex ) , 1 slides 2 test tube 3 test tube holder 4 n / 10 hcl _ 5 hayems fluid 6 3.8% trisodium citrate 7 turks fluid 8 leishman stain 9 anti sera 10 lancet 11 spirit 12 bunsen burner 13 glacial acetic acid 14 sulphosalicy cylic acid 15 urine analysis strip 16 benedict reagent 17 acetone 18 sulphr powder 19 albumin ( ecg ) 20 cupric sulphate 21 cotton roll 22 dropper ( medium size ) 23 immersion oil ( cidarwood oil ) 24 all type of vial ( with seven different top colours ) 25 stand for slides 26 stand for test tubes, grams stain kit 2 zn stain kit 3 slide for staining 4 dropper bottle 5 slide staining rack spirit lamp 7 spirit 8 sugols iodine 9 discarding jars 10 sodium hypochlorite 11 match box 12 coverslip 13 tissue roll ....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical Health And Family Welfare - Rajasthan

33724703 supply of mnjy_labrejants_pmosuj mnjy_labrejants_pmosuj , blood sugar kit , blood sugar kit , blood sugar kit , blood urea kit , blood urea , blood urea kit kinetic , urea end point , s. creatnine r1 2*60 ml , r2 2*60 ml , s. creatnine r1 2*50 ml , s. creatnine , s. bilirubine (t) , s. bilirubin d & t , s. bilirubine (t) , s. bilirubine t&d r1 2*60 ml ,r2 2*60 ml , s. bilirubine t&d , sgot , sgot , sgot , sgpt , sgpt , sgpt , s. alk. phosphate , s. alk. phosphate , s. alk. phosphate , total protein , total protein , total protein , s. albunum , s. albunum , s.albumin , s. calcium r1 1*50 ml, r2 1*50 ml , s. calcium , s.calcium , s. ck nac r1 2*8 ml, r2 2*2 ml , s. ck nac , ck mb , ck mb , s.ldh r1 4*8 ml, r2 1*8 ml , s. ldh , s.amylase , s. amylase , s.amylase , s. uric acid , s. uric acid , s. uricacid , s.uric acid , s. t. cholesterol , s.t. cholesterol , s.t. cholesterol , s. trigly ceride , s. trigly ceride , s. trigly ceride , s.hdl , dirrecthdl , s.hdl direct , s.hdl , ldl cholestrol , ldl cholestrol , csf dilution fluid , plueural dilution fluid , acetic dilution fluid , semen dilution fluid , urine strip for alb & sugar(uristix) , urine strip for sugar & ketone(ketodiastic) , multistrip10 para for accurex urine analyser ( express 10) , urine strip 4 para (alb,sugar,ph,sp. gravity) , pregnancy test card , sulphur powder , edta powder , nitric acid , glacial acetic acid , eosino dilution fluid , ligeul iodine for stool exam , anti abd set , anti d (igg & igm) , total rbc dilution fluid , field stain i , field stain ii , platelest dilution fluid , fouchest reagent , liesman stain , tissue paper roll , filter paper 0 no. , mp card(antigen) , dengue card antigen (day 1) ns1 iggigm , vdrl strip , jsb i stain , jsb ii stain , liquid parafine oil , crp kit , ra kit , aslo kit , widal , bovine album 22% , hiv tridols , esr tube glass , hb meter squer , hb meter round , hb tube round , hb pipate , distilled water , n/10 hcl , glass slide , riya vial , urine container with label (non sterilized 30 ml) , tips stand for yellowtips , tips stand blue tips , iron esr stand 6 tube capicity , throm bo span ls , test tube glass , test tube glass , measuring pipalte glasss 1ml , measuring pipalte glasss 2ml , measuring pipalte glasss 5ml , measuring pipalte glasss 10 ml , hbsag card , sodium citrate vial for pt test , mearing flask 250 ml , mearing flask 500 ml , mearing flasic 1 lit , glass funnel , glass beaker 50ml , glass beaker 100ml , tlc dilution fluid , 3.1% sodium citrat , for ceff steel , combs sera , cbc vial mixer , hb tube squar , syringe needle distoryed maschine , thermal paper 50mm*20 mtr , thermal paper 110mm*20 mtr , alluminiumtest tube stand 4*8 holl , new bar chamber , urine container with label(sterilized) 50 ml , cover glass , cover slip , bt ct capiliry tube , esrite esr stand , droper bottle plastic 60ml , wash bottle plastic 250ml , washbottel plastic 500 ml , blue tips , yello tips , slide box plastic (big size) , slide box plastic (smallsize) , kidney tray plastic , alluminumtest tube stand 3*8 holl , alluminum tast tube stand 3*4 holl , blood sugarstrip for glucometer , biochemistry reagent for rendox fully auto analyser , blood uria kit birthload method , gram stain , giemsa stain with fixative , sodium hypocloride solution 5% , hiv sd card , micro pipet veriable , micro pipet veriable , micro pipet veriable , stop watch , tunicate belt , disposable esr tube ( 1 to 200 mm.) , disposable serum vial , lense cleaning paper , dengu kit for alisa mathed ns1 , dengu kit for alisa mathed igg , dengu kit for alisa mathed igm , anti ab vial , centrifuse machine [ r 8cdx] , centrifuse machine , rotator machine , j.s.b. firststain , j.s.b.second stain , sterile disposable needle no 22 , sterile disposable needle no 23 , sterile disposable needle no 24 , sterile disposable needle no 26 , dispovan 5ml syringe , edta k3 non vccum blood collection tube 1 to 4 ml withtray paking , clot activator non vccum blood collection tube 1 to 4 mlwithtray paking , floride non vccum blood collection tube 1 to 4 ml withtray paking , citrate 3.2 % non vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % non vccum blood collection tube 1 to 4 mlwithtray paking , lithium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , gel non vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 5 to 6 mlwithtray paking , clot activator vccum blood collection tube 1 to 4 mlwithtray paking , clot activator vccum blood collection tube 5 to 6 mlwithtray paking , floride vccum blood collection tube 1 to 4 mlwithtray paking , floride vccum blood collection tube 5 to 6 mlwithtray paking , citrate 3.2 % vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % vccum blood collection tube 1 to 4 ml , gel vccum blood collection tube 1 to 4 mlwithtray paking , gel vccum blood collection tube 5 to 6 ml , lithium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , needle for vaccume tube , iron ball for prothombin test , cuvet for prothrombine test , dengue ns 1 elisa test , dengue igg elisa test , dengue igm elisa test , hbsag elisa test , hb test strip for hemocue hb 301 , cleaning solution , de ionised water , stool container , typhi dot rapid test , t3 for elisa reader , t4 for elisa reader , tsh for elisa reader , wash solution for elisa reader , typhoid test repid test kit , haem test for occult blood kit for stool , lancet for glucometer , methanol for fixative , slide fixative spray , sonographyroll , sonography jelly , ecg roll for single channel bpl(6108 t) , ecg roll for six channel allengers , ecg roll for twelve channel cp 200 welch allyn , ecg jelly , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray film blue base (conventional) , x ray film blue base (conventional) , x ray film blue base (conventional) , esr tube stand , x ray dental film...

Medical And Health Services - Rajasthan

33713870 supply of laboratory reagents, x ray, ecg, sonography material supply blood sugar kit ,blood urea kit,blood urea, blood urea kit kinetic,7 urea end point,s. creatnine r1 2*60 ml , r2 2*60 ml,s. creatnine,s. bilirubine,s. alk. phosphate,total protein,s.albumin, s.amylase,s. uric acid,s.t. cholesterol,plueural dilution fluid, urin strip, urin strip, pregnancy test card, edta powder, sulphur powder, nitric acid, glacial acetic acid, eosino dilution fluid, ligeul iodine, anti abd set, tissue paper roll, dengue card antigen, vdrl strip, widal, riya vial, measuring pipalte glass, hbsag card, glass beaker, glas funnel, thermal paper, sterile disposable needle, dispovan syringe, sodium heptarin non vaccum blood collection tube, clot activator vcum blood collection tube, needle, iron ball, cuvet, dengue ns , dengue igm elisa, de ionised water, stool container, typhi dot rapid test, haem test, x ray film digital, x ray film blue base, x ray dental film. etc ...

Sms Medical College - Rajasthan

33636877 rate contract for chemicals and media items for microbiology department ( nit 45 ) t , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Medical College - Rajasthan

33634315 rate contract for chemical and media items for microbiology department rate contract for chemical and media items for microbiology department , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33612434 supply of glassware, reagents, chemicals, charts, photograph and other items at uch kekri list of glasswares ) 1 glass jar with lids ( rectangular ) ( 12 x 9 x 6 inches ) 2 glass jar with lids ( rectangular ) ( 9 x 6 x 6 inches ) 3 test tube ( 10ml ) 4 test tube ( 15ml ) 5 dropper 6 pipettes stand ( 12 pipette stand ) 7 pipettes ( 15ml ) 8 pipettes ( 10ml ) 9 pipettes ( 5ml ) 10 pipettes ( 2ml ) ii pipettes ( 1ml ) 12 beaker ( borosilicate high quality glass ) ( 25ml ) 13 beaker ( borosilicate high quality glass ) ( 50ml ) 14 beaker ( borosilicate high quality glass ) ( 100ml ) i5 beaker ( borosilicate high quality glass ) ( 200ml ) 16 beaker ( borosilicate high quality glass ) ( 500ml ) 17 measuring cylinder ( 10ml ) 18 measuring cylinder ( 50ml ) 19 measuring cylinder ( 100ml ) 20 conical flask ( 100ml ) 21 conical flask ( 250ml ) 22 slides 23 cover slip ( 1pkt. of 50 slips ) 24 wintrobes tube 25 funnel ( 50mm ) 26 funnel ( 100mm ) 27 clotting time ( ct ) glass capillary tubes ( pack of 100 ) 28 glass staining trays ( for pfb ) 29 pricking needles & lancets ( 1 pack of 100 needles / lancets ) 30 reagents bottles ( 125m1 wide mouth ) 31 dropping bottles plastic ( 120m1 ) 32 stirring rod glass 33 slides staining racks ( 20 slides ) 34 test tubes — stands 35 test tubes holders 36 glass jars rectangular ( with glass lids / cover ) size: 30 x 08 x 05cm 37 glass jars rectangular ( with glass lids / cover ) size: 26 x 17 x 09cm 38 glass jars rectangular ( with glass lids / cover ) size: 20 x 20 x 4cm 39 glass jars rectangular ( with glass lids / cover ) size: 15 x 15 x 5cm 40 glass jars rectangular ( with glass lids / cover ) size: 12 x 12 x 09cm 41 petri dish ( polypropylene ) 19.9 x 18 x 6.7cm weight 440 gm 42 test tube ( 10ml ) 43 test tube ( 15ml ) 44 centrifuging conical tubes ( 15ml ) 45 dropper ( 5ml ) 46 pipettes stand ( 12 pipette stand ) 47 pipettes ( 15ml ) 48 pipettes ( 10ml ) 49 pipettes ( 5ml ) 50 pipettes ( 2ml ) 51 pipettes ( 1 ml ) 52 beaker ( borosilicate high quality glass ) ( 25ml ) 53 beaker ( borosilicate high quality glass ) ( 50ml ) 54 beaker ( borosilicate high quality glass ) ( 100ml ) 55 beaker ( borosilicate high quality glass ) ( 200ml ) 56 beaker ( borosilicate high quality glass ) ( 500ml ) 57 measuring cylinder ( 10ml ) 58 measuring cylinder ( 50ml ) 59 measuring cylinder ( 100ml ) 60 conical flask ( 100ml ) 61 conical flask ( 250ml ) 62 slides 63 cover slip ( 1pkt. of 50 slips ) 64 wintrobes tube 65 pasteurs pipettes 66 funnel ( 50mm ) 67 funnel ( 100mm ) 68 cloning time ( ct ) glass capillary tubes ( pack of 100 ) 69 glass staining trays ( for pfb ) 70 pricking needles & lancets ( 1 pack of 100 needles / lancets ) 71 reagents bottles ( 125m1 wide mouth ) 72 watch glass 73 dropping bottles plastic ( 120m1 ) 74 stirring rod glass 75 slides staining racks ( 20 slides ) 76 test tubes — stands 77 test tubes holders others items 78 wash bottles plastic — 250 ml; 79 filter paper / blotting paper ( 12.5 cm ; 125 mm ) ( i pack of 100 ) 80 wintrobe tube stand 81 2 ml disposable syringes ( box of 100 ) 82 burners 83 gloves ( 8 no. ) ( free size ) ( 4 packs of 100 each ) 84 pricking needle ( 26 no. ) ( lpack of 100 ) 85 cotton roll 86 plastic transparent graduated transfer droppers —1 ml, 2 ml, 3 ml 87 porcelain tile ( for blood group test ) 88 test tube holder 89 torniquet 90 muslin cloth 91 syringes — 2 ml, 5 ml 92 test rack small 93 test rack big 94 test tube stand 95 micro pipette variable volume ( micro fillx0 100 ul ) 96 micro pipette variable volume ( micro fillx100 1000 ul ) 97 micro pipettes tips — 0 100 ul ( 1 pack of 500 ) 98 micro pipettes tips — 100 1000 ul ( 1 pack of 500 ) 99 formaldehyde 100 phenol 101 distill water list of reagents 102 acetic acid ( 500ml ) 103 acetone ( 500ml ) 104 ammonia water ( 500ml ) 105 ammonium sulphate ( 100gm ) 106 benedict solution / reagent ( 500ml ) 107 benzidine powder ( 100gm ) 108 blood group reagents ( anti sera a, b & d ) ( 10ml ) 109 cedar wood oil ( 100ml ) 110 combistix ( urine examination ) ill dextrose ( 100gm ) 112 distilled water 113 ferric chloride ( 100gm ) 114 filter paper 115 formaldehyde ( 500ml ) 116 fouchettes reagent ( 200ml ) 1 1 7 hydrogen peroxide ( 100ml ) 118 lab. detergents ( 500ml ) 119 leishman stain solution ( 500ml ) 120 litmus paper blue 121 litmus paper red 122 nitric acid ( 200ml ) 123 normal saline water ( 500ml ) 124 o tolidine ( 500gm ) 125 paper ph 126 rbc diluting fluid ( 200ml ) 127 sodium carbonate anhydrous ( 500gm ) 128 sodium chloride powder ( 300ml ) 129 sodium hydroxide ( 200gm ) 130 sodium nitropruside ( 100gm ) 131 sodium sulphate ( 500gm ) 132 spirit 133 sulphosalicylic acid solution ( 500gm ) 134 wbc diluting fluid ( turks fluid ) ( 500ml ) 135 n / i0 hcl ( 500ml ) 136 sodium citrate, 3.8% wn ( 500ml ) 137 tri sodium citrate ( 200mg ) 138 liquor ammonia ( 200ml ) 139 glacial acetic acid ( 500ml ) 140 sulphur powder ( 200gm ) 141 barium chloride ( 200gm ) 142 glucose ( 200ml ) 143 edta ( 400gm ) 144 eosin diluting fluid ( 200ml ) 145 platelet diluting fluid ( 100ml ) 146 reticulocyte diluting fluid ( 100ml ) 147 glycerol ( anatomy ) 148 double oxalate ( potassium oxalate & ammonium oxalate ) ( 500gm ) 149 barfoed reagent ( 500ml ) 150 molischs reagent ( 500ml ) 151 starch ( 100gm ) 152 iodine solution ( 100ml ) list of stains 153 gram stain kit ( 4x 100 ml ) 154 rapid afb stain kit 155 field stain a ( 4x 125 ml ) 156 field stain b ( 4x 125 ml ) 157 haemotoxylin and eosin stain ( 500 ml ) 158 aceto carmine stains ( 500 ml ) 159 methyl green ( 5 gm ) 160 pyronin ( 5 gm ) 161 triple mallory stain ( 500 ml ) 162 leishmans stain ( 500 ml ) 163 safranin ( 5x 125 ml ) chemical reagents for histopathology 164 _ acid alcohol ( 500ml. ) 165 liquid ammonia ( 500ml. ) 166 propenol ( 1 lt. ) 167 white fully refind paraffin wax ( ikg. ) 168 dpx mountant ( 250ml. ) list of clinical pathology kit 169 r p r test kit 170 r a factor test kit 171 crp test kit 172 hiv test strip 173 hbsag test strip 174 pregnancy test strip chemical reagents for pathology 175 benedicts solution ( 500 ml ) 176 fehlings solution a ( 500 ml ) 177 fehlings solution b ( 500 ml ) 178 iodine solution ( 500 ml ) 179 ringers solution ( 500 ml ) list of chemicals pathology ( bio chemestry ) 180 blood glucose reagent kit 181 blood urea reagent kit 182 s. bilirubin reagent kit 183 s. protein reagent kit 184 s. albumin reagent kit 185 s. cholesterol reagent kit material for preparation of media 186 nutrient agar ( 100 gm ) 187 nutrient broth ( 100 gm ) 188 mac conkey agar ( 100 gm ) 189 peptone water ( 100 gm ) list of reagents ( combined ) 190 10% barium chloride ( 500gm ) 191 acetic acid ( 500m1 ) 192 aceto acetic acid ( 500m1 ) 193 acetone ( 500m1 ) 194 albumin protein powder ( 100gm ) 195 ammonia water ( 200mi ) 196 ammonium sulphate ( 500gm ) 197 barfoed reagent ( 100m1 ) 198 barium chloride ( 200gm ) 199 benedict solution / reagent ( 500m1 ) 200 benzidine powder ( 500gm ) 201 blood group reagents ( anti sera a, b & d ) ( 10m1 ) 202 buffers tablets 203 carbol fuchsin dye ( 125m1 ) 204 cedar wood oil ( 100m1 ) 205 clinical spirit / rectified spirit ( 500m1 ) 206 combistix ( urine examination ) 207 conc. nitric acid ( 200m1 ) 208 crystal violet stain solution ( 125m1 ) 209 dextrose ( 100gm ) 210 distilled water 211 double oxalate ( potasium & ammonium ) ( 500gm ) 212 edta ( 500gm ) 213 ehlrich reagent ( 100m1 ) 214 eosin diluting fluid ( 200m1 ) 215 eosin staining powder ( 25gm ) 216 ferric chloride ( 500gm ) 217 filter paper 218 formaldehyde ( 500m1 ) 219 fouchettes reagent ( 500m1 ) 220 gemsa stain ( 500m1 ) 221 glacial acetic acid ( 500m1 ) 222 glucose ( 500gm ) 223 gram iodine ( 100m1 ) 224 heparin ( 100gm ) 225 hydrochloric acid n / 10 ( 500m1 ) 226 hydrogen peroxide ( 500m1 ) 227 hydroxy butyric acid ( 500m1 ) 228 iodine solution ( 100m1 ) 229 lab. detergents ( 500m1 ) 230 leishman stain solution ( 500m1 ) 231 liquor ammonia ( 200m1 ) 232 litmus paper blue 233 litmus paper red 234 macconky agar ( 100gm ) 235 methanol lr ( 500m1 ) 236 methylene blue ( 125m1 ) 237 methylene violet stain ( 125m1 ) 238 molischs reagent ( 100m1 ) 239 nitric acid ( 200mi ) 240 normal saline water ( 500m1 ) 241 nutrient agar ( 500gm ) 242 o tolidine ( 500m1 ) 243 platelet diluting fluid ( 100m1 ) 244 potassium dichromate powder ( 200gm ) 245 potassium iodide ( 100gm ) 246 rbc diluting fluid ( 200m1 ) 247 reticulocyte diluting fluid ( 100m1 ) 248 sodium carbonate anhydrous ( 500gm ) 249 sodium chloride powder ( 300m1 ) 250 sodium citrate, 3.8% wn ( 500m1 ) 251 sodium hydroxide ( 200gm ) 252 sodium nitropruside ( 100gm ) 253 sodium sulphate ( 500gm ) 254 sulphosalicylic acid solution ( 500gm ) 255 sulphur powder ( 200gm ) 256 tri sodium citrate ( 200mg ) 257 toluidine ( 500mg ) 258 wbc diluting fluid ( turks fluid ) ( 200m1 ) 259 formaldehyde 260 phenol ( 500m1 ) 261 distill water list of charts ( laminated on mdf board size: 4z2ft ) 262 abortion ( classification ) 263 age estimation from bones 264 agricultural poisoning 265 alcohol poisoning 266 alkali poisoning 267 arsenic album poisoning 268 asphyxiants 269 barbiturate 270 common household poisons 271 classification of injury 272 d.n.a finger printing 273 dactylography 274 fire arm injury 275 hydrocyanic acid poisoning 276 laceration 277 mechanical injuries 278 medicolegal importance of age in foetus 279 poisonous snakes elapids, viper, sea snake 280 snake poisoning 281 table showing period of eruption of temporary and permanent teeth 282 ulcer 283 renal stone 284 ovarian tumor 285 tonsillitis 286 thyroid swelling 287 burn 288 lymphoedema 289 classification of shock 290 haematuria 291 gall stone 292 breast cancer 293 type of fractures 294 carcinoma of tongue 295 different surgical cases 296 wound 297 keloid 298 carcinoma of stomach 299 cirrhosis of liver 300 cataract 301 refractive errors 302 nasal polyp 303 otitis media 304 gangrene 305 atherosclerosis 306 pathogenesis of alcoholic liver disorders 307 influenza virus 308 mumps virus 309 clostridium tetani 310 morphology of bacteriophage 311 emphysema 312 stages in phagocytosis of a foreign particle 313 fatty liver 314 neisseria 315 cell pathology ( inflammatory cell ) 316 streptococci gram positive 317 difference between duodenal & gastric ulcer 318 pathogenesis of amyloidosis 319 difference between wet & dry gangrene 320 life cycle of ascaris lumbricoides 321 thrombosis 322 life cycle of taenia solium 323 life cycle of taenia saginata 324 life cycle of plasmodium falciparum 325 life cycle of entamoeba histolytica 326 difference between amoebic & bacillary dysentery 327 m. tuberculosis 328 oedema & thrombosis 329 immunity 330 life cycle of leishmania donovani 331 life cycle of entamoeba histolytica 332 filariasis 333 life history of plasmodium vivax 334 contrasting features of benign & malignant tumour list of charts / booklet 335 jaegers chart / booklet 336 snellens chart / booklet 337 ishihara chart / booklet list of charts ( laminated on mdf board size: 4x2ft ) 338 physiology of labour 339 pre eclampsia / female reproductive system 340 stages of normal labour 341 permanent sterilization in females & males 342 level of uterus during pregnancy 343 function of placenta 344 phases of menstrual cycle 345 endometriosis 346 menopause 347 polysystic ovarian syndrome ( pcos ) 348 carcinoma of cervix 349 normal presentation of foetus 350 uterine prolapse 351 types of placenta previa list of photographs framed in glass ( size 12*8 inches ) 352 poisons croton tiglinum, ergot, abrus precatorious 353 ossification of bones humerus, ulna, radius 354 wounds incised wound, gunshot wound, lacerated wound, stab wound 355 signs of pregnancy 356 late sign of death putrifaction, maggot formation adipocere formation, mummified bodies...

Medical And Health Services - Rajasthan

33432679 rate contract for supply of lab reagents item at govt district hospital kekri i hb cuvettes 301 for compatibie with hemocue hemocue hb 3o1 2. abx cleaner for part cbc horiba micros es 6o .. 3partcbc test cuvettes for erba xl 640 fuulw compatible witb erba xl 640 fully auto analyzer auto anatyzer comn patible with horiba abx 4. control for horba 3 micros es 60 part cbc 3 part cbc compatible with horiba abx 5. callibrator for horiba 3 part cbc 3 part cbc micros es 6o 6 control for meril 3 compatible with ceiquant part cbc edge meril 3 part cbc 7. callibrator for meril3 compatible with ceiquant part cbc edge meril 3 part cbc 8. control for erba 5 compatible with erba h560 _ part cbc part cbc 9. callibrator for erba 5 compatible with erba h56o __ part cbc spartcbc 10. semen diluenting fluid testtube stand 12.1 lishman’s stain jsb i ii tri sodium citrate n/10 hcl , salphuric acid glacial acetic acid , sulpher powder etc ...

Department Of Agriculture - Rajasthan

33146216 tender for chemicals, glasswares, filterpapers and plasticwares 1 acetone ar 2 glacial acetic acid ar 3 ammonium oxalate ar 4 ammonia 5 ammonium chloride ar 6 ammonium metavandate 7 ammonium hydroxide ar 8 alluminium hydroxide ar 9 barium chloride ar 10 bismuth nitrate ar 11 bromocresol green indicator solution 12 citric acid anhyd ride ar 13 fiiier paper circie whatman no.1 or it’s equivalent. ( 12.5cm ) 14 fiiter paper circie whatman no.40 or it’s equivalent ( 12.5cm ) filter paper sheet ( 46x57cm ) whatman no.1 or its equivalent 16uh.drnchloric acid ar 17 nitric acid ar, 18 potassium sodium tartrate ar 19 phosphorus pentaoxide_ar 20 pohsscium hydrogen phosphate ar 21 sodium cynide ar . 22 sodium hydroxide ar 23 sodium thiosulphatear 24 sulphuric acid ar jfilter paper circie ( i2.5 cmi 10o circie pkt no. 5 equivalent 2s faiier paper circle ( 12.5 cmi 100 circle ..._ pkt_no. 42_equivalent 27 filter piper circle ii2.5 cmi 1i0 circie 28 copper sulphate ar .‘1p t indicator ar, 31 formaldehyde ar 32 hydroxylamine hydrochloride ar t. — 33 carbon di sulphide ar 34 iodine ar 35 methanol ar 36 methyl red indicator ar solution 37 nitric acid ar 38 oxalic acid ar 39 phenolphthalin indicator ar solution 40 potassium permangnate ar 41 potassium sulphate ar 42 potassium dichromate ar 43 quinoline ar 44 zinc sulphate ar 45 sodium molybdate ar 46 silicon grease, 47 — salicylic acid ar 48 sodium bi carbonate ar 49 stpbar 50 thymol blue indkator ar solution 51 universal indicator ar solution 52 zinc dust la1undim.hydroxide ar 54 phosphoric acid ar 55 rilter paper sheet ( 46x57cm ) ordinary 56 sodium potassium tartarate ar 57 mannitol ar s8 ‘glycerol ar 59 laboline liquid 60 copper standard ar 61 zinc standard ar 62 iron standard ar 63 manganese standard ar, 64 cadmium standard ar 65 lead standard ar 66 buffer tablet ph 4, e ? 67 buffer tablet ph 7 =68 budfer tablet ph 9.2 _69 benzenear 70 silver nitrate ar 71 potassium chromate ar 72 ammonia solution 73 ammonium chloride ar 74 calcium chloride ar 75 carbon tetra chloride ar 76 zefran chloride ar 77 gooch crucible glass 78 beaker 500 ml glass 79 beaker 250 ml glass 80 beaker 100 ml glass 81 beaker 1000 ml glass 82 burette with stopper cock glass 83 burette 50 ml glass 84 burette with screw cock glass, 85 adapior for crucibie 30 ml glacsirubber cone — 86 conical flask 2s0 ml glass ..__ 87 conical flask 100 ml glass 88 conical flask 500 ml glass 89 funnel 7s mm glass * 90 funnel 10o mm glass 91 funnel 150mm glass 92 flat bottom flask 250 ml glass flat bottom flask 2000 ml glass l 94 flet bottom flask 1000 ml gluss 95 4flat_bottom flusk 500 ml glass 96 t measuring_cylinder_graduated 5 ml glass 97 measuiiflg cylinder graduated lomi glass 98 measuringcvlilfdergrate2st 99 measuring cyiinier graduated 50 mald glass, 101 measuring cylinder graduated 500 ml glass 102 pipette volunlletrl ( 20 ml glass 103 pipette volumetric 25 ml glass 104 pipette graudated 25 ml glass 105 pipette graudated 10 ml glass 106 pipette graudated 5 ml glass 107 volumetric flask 50 ml glass 108 volumetric flask 10o ml glass 109 volumetric flask 250 ml glass 110 volumetric flask 50o ml glass 111 volumetric flask 1000 ml glass 112 volumetric flask 20o0 ml glass 113 watch glass 4 inch glass 114 wash bottle plastic 50o ml 115 wash bottle plastic 1000 ml 116 measuring cylinder plastic s00 ml 117 measuring cylinder plastic 10o0 ml....

National Institute Of Ayurveda - Rajasthan

33123875 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux / bd ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux / bd ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500gm , amikacin ( himedia / sigma / biomerieux / bd ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux / bd ) 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux / bd ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux / bd ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux / bd ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux / bd ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux / bd ) 50 ml , cefipime ( himedia / sigma / biomerieux / bd ) 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) 1 vial , cefoxiti ( himedia / sigma / biomerieux / bd ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux / bd ) 1 vial , citrate agar ( himedia / sigma / biomerieux / bd ) 500gm , cled agar ( himedia / sigma / biomerieux / bd ) 500gm , clindamycin ( himedia / sigma / biomerieux / bd ) 1 vial , colistin ( himedia / sigma / biomerieux / bd ) 1 vial , coplin jar ( himedia / sigma / biomerieux / bd ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux / bd ) 1 vial , cotton roll ( himedia / sigma / biomerieux / bd ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux / bd ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux / bd ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux / bd ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux / bd ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux / bd ) 5 litr , doxycline ( himedia / sigma / biomerieux / bd ) 1 vial , dpx mount ( himedia / sigma / biomerieux / bd ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux / bd ) 125 ml , erythromycin ( himedia / sigma / biomerieux / bd ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux / bd ) 500 gm , forceps ( himedia / sigma / biomerieux / bd ) 1 pc , fosfomycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) 1 strip , giemsa stain ( himedia / sigma / biomerieux / bd ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux / bd ) 5 litr , glass slides ( himedia / sigma / biomerieux / bd ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux / bd ) 500 ml , grams iodine ( himedia / sigma / biomerieux / bd ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux / bd ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux / bd ) 500 ml , imipenem ( himedia / sigma / biomerieux / bd ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux / bd ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux / bd ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux / bd ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux / bd ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux / bd ) 500 ml , levofloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , linezolid ( himedia / sigma / biomerieux / bd ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux / bd ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) 1 holder , methanol ( himedia / sigma / biomerieux / bd ) 500 ml , methylene blue ( himedia / sigma / biomerieux / bd ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux / bd ) 125 ml , mrvp media ( himedia / sigma / biomerieux / bd ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux / bd ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux / bd ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux / bd ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux / bd ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux / bd ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux / bd ) 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , novabiocin ( himedia / sigma / biomerieux / bd ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux / bd ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux / bd ) 500gm , optochin ( himedia / sigma / biomerieux / bd ) 1 vial , oxidase discs ( himedia / sigma / biomerieux / bd ) 1 vial , penicillin g ( himedia / sigma / biomerieux / bd ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux / bd ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux / bd ) 1 vial , piperacillin ( himedia / sigma / biomerieux / bd ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux / bd ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux / bd ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux / bd ) 100ml , ria vials ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux / bd ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux / bd ) 125 ml , sim media ( himedia / sigma / biomerieux / bd ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux / bd ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux / bd ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux / bd ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux / bd ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux / bd ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux / bd ) 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) 1 vial , tobramycin ( himedia / sigma / biomerieux / bd ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) 500gm , urea agar base ( himedia / sigma / biomerieux / bd ) 500gm , urea solution 40% ( himedia / sigma / biomerieux / bd ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux / bd ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux / bd ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux / bd ) 500 ml , xylene ( himedia / sigma / biomerieux / bd ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Government Medical College - Rajasthan

32800183 rate contract for drug and medicine rate contract for drug and medicine , ophthalmology , eye drop proparacaine 0.5% , eye ointment ( gel ) hpmc 0.3% , eye ointment azithromycin 1% , eye drop moxifloxacin 0.5% + ketorolac tromethamine 0.5% , eye ointment ganciclovir 0.15% , eye drop pilocarpine 2% , eye drop itraconazole 1% , eye ointment itraconazole 1% , eye ointment moxifloxacin 0.5% , eye drop sodium chloride 5% , eye ointment sodium chloride 6% , eye drop nepafenac 0.1% , eye drop moxifloxacin 0.5% + prednisolone 1% , eye drop azithromycin 1% , eye drop gatifloxacin 0.3% , eye drop gatifloxacin 0.3% + dexamethasone 0.1% , capsule antioxidant ( lutein+zeaxanthine + vitaminc +vitamin e +zinc+ selenium +magnesium ) standard combination , injection intracameral ( tropicamide 0.2 mg +phenylephrine 3 mg + lignocaine 10 mg ) preservative free , injection intracameral lignocaine 1 % ( preservative free ) , injection intraocular triamcinolone acetonide, preservative free ( 40mg / ml ) , 1ml / ampule , medicine deaprtment , somatostatin 250?g & 3mg , ethambutol 800mg , doripenem 500mg , amphotericin b liposomal 50mg , olmesartan 20mg , olmesartan + hctz 20mg , telmisartan + hctz 40mg , vildagliptin 50mg , vildagliptin + metformin 50mg / 500mg , linagliptin 5mg , dapagliflozin 10mg , moxinidine 0.3mg , sitagliptin + metformin 50mg / 500mg , sitagliptin 50mg , polystyrene sulphodnate 15mg , evogliptin 5mg , heparin+benzyl nicotinate 20gm , reagent strip for urine sugar and ketones test , reagent strip for urine sugar test , trotonin t test kits , tygecycline 50mg vial inj. , colistin 4.5million units inj. , neurology department , tenecteplase 20 mg inj. , alteplase 20 mg inj. , alteplase 50 mg inj. , nimodipine30 mg , botulinum toxin 50unit inj. , tolvaptan 15mg , rasagiline 0.5mg , amiloride 5mg , riluzole 50mg , moxinidine 0.2 , perampanel 4 mg , memantine 5mg , nicardipin 10 mg / 10ml inj. , pyridostigmine , apixaban , rivarixaban , deferoxamine , ( specific to the subject of obstetrics & gynecology ) , dienogestril2mg ( 10 tablet perstrip ) , myoinositol+acteyl cystein+l argine+astazanthine ( 10 tablet perstrip ) , progesterone only pills 75 mcg desogestrel ( 28 tablet perstrip ) , cyproterone acetate2mg+ethynil estradiol 0.035mg ( 21 tablet perstrip ) , tab. dydrogesterone 10mg ( 10 tablet perstrip ) , l argine +proanthocynadine granules 5 gm , car niitine+co q10 astaxanthine+zn +lycopene ( 10 tablet perstrip ) , astaxanthine + l arginine+ lycopene+ pyridoxine ( vitamin b6 ) + methyl cobalamine ( vitamin b12 ) + folic acid + zink+ selenium ( 10 tab per strip ) , estradiol valerate 2 mg lycopene ( 28 tablet perstrip ) , ulipristal 5 mg ( 10 tablet perstrip ) , mifepristone25mg ( 10 tablet perstrip ) , dros perinone 3mg +ethynil estradiol 0.03mg ( 21 tablet perstrip ) , ormeloxifene 30mgmg ( 15 tablet perstrip ) , levonorgestrel 1.5 mg ( emergency contraception ) , vaginal betadine pessary ( 10 pessary perstrip ) , menotropin ( fsh+lh ) 150 inj. , carbetocin 1ml / 100micro ( 5 inj / packet ) inj. , aqueous progesterone 25 mg / ml inj , follitropin 75 iu inj. , lugol iodine solution 5 % 100 ml , glacial acetic acid solution 100% 500 ml , non edl medicines – gastroenterology , rifaximin 200mg , rifaximin 550mg , polythylene glycole power for colonoscopy , cyanoacrylate glue inj. , lactulose enema , pentoxyphylline , midodrine , nephrology dept , cefaclor 250 mg , cefaclor 500 mg , darbopoietin 60 mcg inj. , nifedipine r 20 mg , l carnitine 1 gm inj. , heparin 5000 iu / 5ml inj. , alfa ketoanalogue , dialyzer ( usfda / ce ) , openable , ( a ) effective surface area – 1.1m² , ( b ) effective surface area 1.3 / 1.4m2 , ( c ) effective surface area 1.5m2 , ( d ) effective surface area 1.7m² , ( e ) effective surface area 1.9m2 , non openable , ( a ) effective surface area 1.1m² , ( b ) effective surface area 1.3 / 1.4m2 , ( c ) effective surface area 1.5m2 , ( d ) effective surface area 1.7m² , ( e ) effective surface area 1.9m2 , av blood line , dialyzer for pediatric patients , ( a ) effective surface area 0.2mm2 , ( b ) effective surface area0.8 m2 , ( c ) effective surface area1.0 m2 , av line for pediatric patients , high flux dialyzer ( usfda / ce ) , ( a ) effective surface area 0.9m² , ( b ) effective surface area 1.1m² , ( c ) effective surface area 1.4m² , ( d ) effective surface area 1.5m² , ( e ) effective surface area 1.7m² , ( f ) effective surface area 1.9m² , hd fluid part a ( 10.0 liter ) with dextrose , hd fluid part a ( 10.0 liter ) without dextrose , part b hemodialysis powder 825 895 gm , hd fluid part a ( 10.0 liter ) high sodium compatible to bi bag , heparin 25000 units inj. , automatic kidney biopsy gun18g / 20g , pd fluid ( 2 liter ) , pd set , pd catheter , plasma filter for plasma pharesis ( adult ) , plasma filter for plasma pharesis ( pediatric ) , transducer protector filter , renal transplant , atg 25mg / 5ml inj. , basiliximab 20mg / 5ml inj. , department of radiation oncology , temozolamide 250 , trastuzumab inj. , docetaxel inj. , docetaxel inj. , benzydamine 0.15% oral gargles , granisetron inj. , lenvatinib , irinotecan inj. , sunitinib , sorafenib , enzalutamide , pegylated gcsf inj. , pegylated liposomal doxorubicin inj. , pegylated liposomaldoxorubicin inj. , leuprolide inj. , heparin gel , goserline 10.8 inj. , dactinomycin inj. , chlordiazepoxide 5mg + clidinium 2.5 mg , triamcelone acetonide oromucosal paste , heparin 10 iu / ml inj. , triamcinolone acetonide inj. 10 mg. / ml. , mmr vaccine inj. , department of anaesthesia , lignocaine inj. , desflurane , dexmedetomidine inj. , ropivacaine, heavy 0.75 % inj. , palnosetron inj. , phenylephrine inj. , ephedrine inj. , nitoglycerine lingual spray , emla cream , sodalime , cardiology department , ivabrdin 5mg , orciprenalin 10mg , nicorandil 48mg inj. , nicorandil 2mg inj. , verapamil inj. , prasugrel 10mg , ticagrelor 90mg , rivarixaben 10mg , rivarixaben 15mg , art centre , lopinavir 200mg + ritonavir 50mg , dolutegravir 50mg , ritonavir 100mg , efavirenz 200mg , atazanavir 300mg+ ritonavir 100mg , olanzapine inj. 300 mg , ethinyl estradiol 0.03 mg + desogestrel 0.15 mg...

University of Rajasthan - Rajasthan

32589382 supply of chemicals and glasswares at botany department, uor, jaipur chemical items : , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

University of Rajasthan - Rajasthan

32582693 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

Medical College - Rajasthan

32468477 chemicals and glass item on rate contract for one year phenyl hydrogine hydrochloride trichloro acetic acid (tca) nin hydrin thiosemi carbozide sulphuric acid 6 hydrochloric acid 5 50 lit. 7 nitric acid 5 50 lit. 8 glacial acetic acid 5 50 lit. 9 banedicts reagent 5 50 lit. 10 bar ford reg 5 50 lit. 11 sodium hydroxide 500 gm 5 kg 12 ammonia(liq) 500 gm 5 kg 500 ml 5 lit. 13 hydrogen peroxide 14 mercuric sulphate 500 gm 5 kg 15 ammonium sulphate 500 gm 5 kg 16 sodium carbonate(na2co3) 500 gm 5 kg 500 ml 50 lit. 17 formalin 18 19 sulphosalicylic acid 500 gm 5 kg maltose 500 gm 5 kg 20 sodium tungstate 500 gm 5 kg 21 copper sulphate 500 gm 5 kg 22 23 24 glycerine 5 50 lit. a (alpha) naphthol (molischs reagent 100 gm 1 kg. peptone (bdh) 500 gm 5 kg 25 egg albumin powder powder(bdh) 500 gm 5 kg 26 ethanol 500 m1 5 lit. 27 dextose 500 gm 5 kg 28 lactose 500 gm 5 kg 29 fructose 500 gm 5 kg 500 gm 5 kg 30 sucrose 31 carbolic acid 500 gm 5 kg 32 hydrogen peroxide 500 ml 5 lit. 33 ammonia solution 10 50 lit 34 concentrated sulphuric acid 10 50 lit 35 mercuric sulphate 10 5014 36 glacial acetic acid 10 50 lit 37 tipole (for washing slides) 10 50 lit 38 methanol 10 50 lit 39 xylene 10 50 lit dettol liquid paraffin (heavy) 500 gm 2 kg 20 50 lit 500 mg 5 k 500 m 5 lc_ methylene blue pholoxin b propylene glycol lr potasium chloride lr calcium chloride fused lr sodium bi carbonate anhydrous sodium bi hydrogen phosphate 1 500 gm glycose anhydrous 500 gm z:2u22 23limited tender limitedl_chemicals limited tender docx 74 formalin (forivialdihyde 37%) ia 500 ml 75 gention voilet solution lr 500 ml 76 77 leishman stain solution caderwood oil 1000 ml 100 ml 78 clove oil 100 ml 79 cinnamon oil 100 ml glass item . 3t 4 dit wr6d) mnd 44) 31t 4 (err cr) 1 amber dark bottle(125 ml) each ni co marker pen(blue/black) each conical flask (2.5 liter) each 4 beaker (1 liter) each test tube 18x150 . 100 nos f .c, edta vial 100 500 nos 7 slide packets big size 100 500 packets 8 capillary tuve (glass) 10 cm long 100 500 packets 9 hemoglobin stirrer (glass rod 2 mm diameter) 100 200 nos 10 petridishe glass 4 diameter 100 200 nos etc ...

Public Health Engineering Department - Rajasthan

32233316 supply of lab items laboratory equipment chemical , item instruments in district lab phed rajsamand i al 1lcuiaii5? 1 lab equipments items [ 1.1 pipette bulb ( capacity upto loomi. natural rubter ) 1.2 simplex bottle top dispenser ( capacity i to 10 ml with interchangeble size or bottle ( with i00omi and500ml_bottle ) 1.3 1.4 draining tmyjmaterial pc autoclavable ) funnel holder single ( material pp ) 1.5 1.6 funnel hplder doubie ( material pp ) pipette washer ( maierial pp .pipetie length 1.7 40cm ) amber narmow mouth bottle i000ml ( capacity l0o0ml medical grade hdpe ) 1.8 amber narrow mouth bottle $ooml ( capacity sooml medical grade hdpe ) 1.9 wash bottle ( capacity 500m1. material 1.10 ldpe ) narrow mouth wash bottle ( capacity 500m1 material 1.11 , ldpe pipettor stand , five place ( material pm ma ) 1.12 variabie volume pipette ( material pvdf / ss ( capacity olmi to loml ) or ( capacity.lo00ui_to.lo0o0ul ) chemicals all chemicals should be ar grade and brand like merck, borosil, tarson, c [ ualigens, ranbaxy, himedia i— 2.1 cdia monohydrate rci 4h22n208h20 ) 2.2 lactose broth 2.3 glycerol 2.4 ethyl alcohol 95% . 2.5 barium chloride 2.6 decolourising carbon 2.7 phenolphthalejn indicator 2.8 ammonium molybdate 2.9 stannous chloride 2.10 kh2po4 2.11 toluene 2.12 eriochrome blackt 2.i3 silica gel 2.14 ammonium acetate 2.15 hydrochloric acid 2.16 glacial acetic acid 3 instruments 3.1 ph electrode epowy plastic body (support to systronics ph — meter (model no. 335) 3.2 — coductivity cell (cell k1.0+ 10% type cd — 10 support to systronics conductivity meter (model no. 308) flat bottr (support m test tubes (25 mm o) turbidity test tube with cap lo systronics ph meter (modal no.l!i5) 8 3.4 analyt (maxtm readae o.2gn respon backlit mg) cal electronics balance um capacity 220gm mtntmum lo,ad logm ility 0.1 mg repeatabtlity 0,1 mg ltneartty r tare range 22ogm, pan s|ze 90mm, ;e time 2 3 sec, display alpha ]!umer|c : lcd display, internal calibration .d= 0.1 3.5 bottle bottles i borosilice ( general and boros high prec fully aut easy to u for bubbe ptfe pir effortless easyto dir five adop the stand adaptors sizes2smr dispenser drops. manufactr polypropy accidental instrumen supply w each) mad top dispensers (l to l0ml ) (supply with raving capacity 500m1 and l000ml. made of te glass) : fully autoclavable, wetted parts will be, of ptfe ilicate glass, ision and accuracy :clavable se, simple and smooth effortless plunger movement free dispensing. ton with sililcon o ring to ensure very smooth, piston movement and high accuracy. assemnle for cleaning and servicing. 3.6 cvt. co (500va,1 cvt constant voltage transformer arranty one year) ...

Indian Army - Rajasthan

32105238 local purchase of medicine for mh jodhpur , medicines : , alkaline phosphatase ( 2x44 / 2x11 ml ) , lipase ( 1x44 / 1x11 ml ) , albumin ( 10x44 ml ) , amylase ( 5x22 ml ) , bilirubin direct ( 6x44 / 3x22 ml ) , total bilirubin ( 6x44 / 3x22 ml ) , calcium ( 10x12 ml ) , cholesterol ( 10x44 ml ) , creatinine ( 5x44 / 5x11 ml ) , glucose ( 10x44 ml ) , hdl cholesterol ( 4x30 / 4x10 ml ) , ldl cholesterol ( 2x30 / 2x10 ml ) , total protein ( 10x44 ml ) , triglycerides ( 5x44 / 5x11 ml ) , urea ( 5x44 / 5x11 ml ) , uric acid ( 5x44 / 5x11 ml ) , ggt ( 2x44 / 2x11 ml ) , erba norm ( 1x5 ml ) , erba path ( 1x5 ml ) , erba xl multical ( 4x3 ml ) , cuvette for em 360 , ck mb ( 2x44 / 2x11 ml ) , ck nac ( 2x44 / 2x11 ml ) , ldh ( 2x44 / 2x11 ml ) , phosphorous ( 10x12 ml ) , micro protein ( 10x12 ml ) , sgpt ( 6x44 / 3x22 ml ) , sgot ( 6x44 / 3x22 ml ) , crp quantitative test ( 2x22 / 1x11 ml ) , ra factor quantitative test ( 1x22 / 1x5.5 ml ) , sample cups , pm kit ( em 360 ) , completetubing set ( em 360 ) , erba auto wash ( 10x100 ml ) , appen droff tube , biored biochemistry control ( level 1 ) , biored biochemistry control ( level 2 ) , cell pack solution ( 20 ltr ) , cell cleaner solution ( 50 ml ) , wbc / hgblysed reagent ( sromatolyser ) 500 ml , control ( 1x3 ) for sysmax kx 21 , printing paper 110 mm , calibrator for sysmax kx 21 , bact / alert blood culture infants , bact / alert blood culture adults ( aerobic ) , bact / alert blood culture adults ( an aerobic ) , crp ( 100 test / kit ) , ra factor ( 100 test / kit ) , aso ( 100 test / kit ) , widal ( 4x5 ml ) , dengue ( ns1, igg / igm ) rapid test , malaria parachek card ( 50 test ) , occultblood ( 50 test ) kit , pregnancy test card , h1n1 rapid test kit , viral transport media ( 50 test ) , esr tube , typhi dot igm ( 50 test ) , ketosticks ( 100 strips ) , uristickes ( 100 stripes ) , urine container ( 50 ml ) , sterile urine container ( 50 ml ) single packed , chloroform , microscopic cover glass ( 22x50mm ) , auto pipette multi channel , auto pipette ( 5 50 ul ) , auto pipette ( 50 200 ul ) , tissue paper roll , whatman filter paper no 1 , whatman filter paper no 4 , harris haematoxylin ( readymade stain ) , parafin wax with ceresin , perl stain , grocott stain , pas stain , reticulin stain , casette for tissue hilding , l mould , liquor ammonia , rapid pap stain , disposable blade ( art no 2840700 ) for microtome ( compatable with slee ) , durham tube ( 50 test ) , petridishes , sugar set for microbiological test lactose , sugar set for microbiological test maltose , sugar set for microbiological test glucose , sugar set for microbiological test urease , sugar set for microbiological test citrate , gram stain kit , zn stain kit , kovac reagent strip ( 25 strip / vial ) , lead acetate strip ( 25 strip / vial ) , oxidase disc ( 50 disc / vail ) , l j media ( readymade ) , mpo stain , spirit , band aid , litmus paper , procalcitonin rapid , gloves ( ancelle ) non latex , surgical blade 20’ , rna extraction kit ( containing:5x50 spins, carrier rna 1550 ?g, avl buffer 155ml, aw1 wash buffer 98 ml, aw2 wash buffer 66ml ) ( 250 tests in each kit ) , covid 19 one step rt pcr kit ( for orf1ab & n gene ) ( 50 test in each kit ) , strip indicators for sterilisation control ( for testing sterility of drums ) , vacutainer: edta 3ml , vacutainer sodium fluoride / sodium fluoride+k3edta , vacutainer sterile tube with gel 5ml , vacutainer sterile tube with out gel – 5ml , vacutainer sodium citrate – 3ml , agglutination tube ( felix ) 50 mmx12 mm , elisa reader thermal paper 110mm , glass cover microscopic , 22 x 30mm , glass cover 22x50 mm , paper filter round pkt of 100 , paper filter square ( 51cm x 51cm ) pkt of 100 , printing paper roll 55 mm for semiautoanalyser , acetone commercial , glacial acetic acid , hydrochloric acid. , alcohol dehydrated , alcohol methyl , d p x mounting med , prothrombin time , pttk reagent , xylene ( xylol pure ) , rapid coliform kit / water culture kit , meropenem 10ug ( pack of five vial ) , oxacillin 1 ug ( pack of five vial ) , ampicillin10ug ( pack of five vial ) , amoxyclav ( pack of five vial ) , imipenem ( pack of five vial ) , penicillin 10ug ( pack of five vial ) , tetracyclin 30ug ( pack of five vial ) , clindamycin ( pack of five vial ) , bacitracin 0.04ug ( pack of five vial ) , cefotaxim ( pack of five vial ) , ceftriaxone ( pack of five vial ) , ceftazidim / clavulanic acid ( pack of five vial ) , optochin ( pack of five vial ) , novobicin ( pack of five vial ) , ampi sulbactum ( pack of five vial ) , cefoxitin30ug ( pack of five vial ) , ceftazidim ( pack of five vial ) , chloramphenicol ( pack of five vial ) , colistin ( pack of five vial ) , streptomycin 300ug hls ( pack of five vial ) , linezolide ( pack of five vial ) , ticoplanin30ug ( pack of five vial ) , netilmycin ( pack of five vial ) , norfloxacin ( pack of five vial ) , nitrofurantoin ( pack of five vial ) , cefepime ( pack of five vial ) , amikacin ( pack of five vial ) , azythromycin ( pack of five vial ) , co trimoxazole ( pack of five vial ) , cefoperazone ( pack of five vial ) , ciprofloxacin ( pack of five vial ) , erythromycin ( pack of five vial ) , gentamicin ( pack of five vial ) , gentamicin 120ug hsg ( pack of five vial ) , levofloxacin ( pack of five vial ) , nalidixic acid 30ug ( pack of five vial ) , piperacillin 100ug ( pack of five vial ) , vancomycin 30ug ( pack of five vial ) , polymixin b ( pack of five vial ) , piperacillin / tazobactam ( pack of five vial ) , ofloxacin 5ug ( pack of five vial ) , cifran ( pack of five vial ) , ceftriaxone / sulbacta ( pack of five vial ) , augmentin ( pack of five vial ) , cefoparazone / sulbactum ( pack of five vial ) , tigicyclin ( pack of five vial ) , fluconazole ( pack of five vial ) , minocycline 30ug ( pack of five vial ) , ceftazidime avibactam ( pack of five vial ) , aztreonam 30ug ( pack of five vial ) , ertapenem 10ug ( pack of five vial ) , rifampicin ( pack of five vial ) , doxycycline 30ug ( pack of five vial ) , fosfomycin 200ug ( pack of five vial ) , pefloxacin ( pack of five vial ) , quinapristin dalfopristin ( pack of five vial ) , gatiflox 5ug ( pack of five vial ) , peflox 5ug ( pack of five vial ) , fostomycin 200ug ( pack of five vial ) , doripenem 10ug ( pack of five vial ) , ritampin 5ug ( pack of five vial ) , oinupeistin dalopristin 15ug ( pack of five vial ) , filter barrier tips ( 10?l ) pack of 960 , filter barrier tips ( 20?l ) pack of 960 , filter barrier tips ( 50?l ) pack of 960 , filter barrier tips ( 100?l ) pack of 960 , filter barrier tips ( 200?l ) pack of 960 , filter barrier tips ( 1000?l ) pack of 960 , 8 strip 0.1 ml tubes and flat optical strip caps ( each pkt contain 125 strip tubes +caps ) , kimtec wipes , molecular grade ethanol / bott of 500ml , absolute alcohol , falcon tube ( 50ml ) , micro centrifuge tube ( 2.0 ml ) pkt of 500 tube , eppendorf tube ( 1.5 ml ) pkt of 500 tube , rnase kil , covid 19 rapid ag test ( kit of 25 test ) , vtm kit ( kit of 50 test ) , d dimer fia ( porteblein sd biosensopr ) , pct fia ( porteblein sd biosensopr ) , drabkins sol for hb estimation , kit dengue serology ( ns1, igm / igg ) rapid test ( 10 test / kit ) , kit glucose 10x50 ml for semi auto analyzer , kit hdl 2x50 ml for semi auto analyzer , kit sgot for semi auto analyzer , kit sgpt for semi auto analyzer , kit t3 elisa , kit triglyceride 10x50 ml for semi auto analyzer , kit tsh elisa , kit urea 10x50 ml for semi auto analyzer , kit uric acid 10x50 ml for semi auto analyzer , kit cholestrol 2x50 ml for semi auto analyzer , microscope slide 75mm x 25 mm ( pkt of 50 ) , kit t4 elisa , vaccum blood collection tubes with needles : edta 3ml , vaccum blood collection tubes with needles : heparin 3ml , vaccum blood collection tubes with needles : sterile tube with gel 5ml ( material plastic / glass ) , vaccum blood collection tubes with needles and additives sodium fluoride / sodium fluoride+k3edta in tubes of vol 02 ml , solution erba wash 50 ( ml ) , pregnancy stip , kit paracheck sd ( green colourlebel ) no of 100 strip , mico tips ( 5 200ul ) , mico trips ( 500 1000ul ) , spirit , urostix ( 100 test per kits ) , urine dipstick 10 parameter ( sp gravity urobilinogen, nitrates, protine / albumine, glucose, kitones, ph, bilirubin, heme / rbc , vaccutainer plain , microscope cover slip 22 x 70mm , urine container disposable , lancet disposable ( pack of 100 ) , urine analysis strips ( bott of 50 strips ) , kit malaria paracheck ( antigen ) pack of 40 test , kit creatinine 10x50 ml for semi auto analyzer...

Medical College - Rajasthan

32091903 supply of reagent and chemical consumable for bio chemistry lab at gmc dungarpur reagents 1 acetoacetic acid 2 3 acetone (amher color bottle) albumin egg 4 anmmonium sulphate 5 ammonia liquid( nh4oh) (amber color bottle) 6 barium chloride 7 baryta mixture solution 8 benedict’s reagent 9 benedicts uric acid reagent 10 bile salt 11 calcium chloride 12 copper sulphate 13 creatimne 14 dextrose powder 15 fouchets reagent solution 16 glacial acetic acid 17 ilypobromite solution 18 molybdic acid 19 nitric acid 20 orthophosphoric acid 21 phenolphthalein indicator 22 picric acid 23 potassium oxalate 24 silver nitrate 25 sodium citrate(tri) 26 sodium carbonate 27 sodium chloride 28 sodium nitropruside 29 hippuric acid 30 ethereal sulphate 31 sodium tungstate 32 sulphosalicyclic acid 20% 33 sulphur powder 34 urea 35 urease powder 36 uric acid 37 chloride 38 sulphate 39 calcium 40 test tubes 2oml 41 test tubes( plastic riya tube) 42 blue litmus paper 43 ph paper 44 rubber tit for glass pipette s 45 filter paper 46 gloves 47 cuvettes(for colorimeter) 48 dropper 49 dropper tissue paper glucometer strips , digital ph meter , urine dip 10 parameter strips , whatman filter paper , bendine solution etc ...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Rajasthan University Of Health Science - Rajasthan

31927326 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , sodium metabisulfite , capillary tubes , sprit , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n / 10 hcl , cedar wood oil , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50 ) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution ( liquid ammonia ) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate ( ammonium iron sulphate ) , ferric chloride , formalin ( formaldehyde 37 40 % ) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with ( ceresin 60 62 c ) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block ( white ) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye ( for shiff reagent ) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

31913247 supply of chemicals reagents consumable items for department of pathology anti b ( sera ) anti d ( sera ) sodium metabisulfite capillary tubes _ g6pd kit ( 12 tests ) ocutt blood kit coombs anti sera cover slip ( 18x18mm ) .__ dxposible nediles ( 24cuage ) disposible neoiues ( 22guage ) disposibue sterile urine comawer_ esr_oispoxable pipette glass marker pencil jsb stain i jsb stain ii ketone strips — — 1.ancets leishman’s stain micro glass slides microscope bulb cedar wood oil anti a ( sera ) ie thmnea? 26 ridh&e 27 reticulocyte stain semen diluting rluid 29 sodium citrate 3.2% 30 sodium citrate 3.8x 31 thermnlparllomm? 32 thermal paper 8o mm 33 thermalpaper57mm — 34 small test tube plastic small test tube glass 36. tips ( 1o04o0o11l ) 37 tips ( 10 2ooi.l ) 38 tissue paper roll — 39 torniguate ( cloth ) 4o urine multi sttips 41 urine strips for alt 42 vacutainer edta vial _ 43 vacutainer sodium citrate 3.2 % vial 44 wbc diluting fluid 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area giemsa stain liquid carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid !carbol fucihsin cover slip ( 22xso ) diamond pencil distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid _!carbol fucihsin _ cover slip ( 22xso ) diamond pencil . ? distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lo e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid hand sanitizer i ., 7o dic counter ( 8ditfrential miii ) fl acetk acid 72 acetone 73 acid fuschifl 74 acid periodic 75 activated charcoal 76 alicine blue 77 akjminftumchlo 78 mumoumhydx!h 7 ammoniun solution tliouid ammonlia 80 aniline blue 81 basic fuchsinl 82 benzidinle powder 83 biebrich scarlet — 84 brilliant cresyl blue 85 carmine power 86 celestine blue 87 chloral hvdrate 88 citric acid concentrated hcl 91 egg albumin flake 92 eosin yellow stain powder ferric ammonium sulphate ( ammonium 93 iron sulphate ) 94 ferric chloride gold chloride haematoxyline crystal hydrochloric acid ar hydrogen peroxide light green malt diastase mercuric oxide metanil yellow murcuri chloride 109 neutral red 110 nitric acid 111 nuclear fast red 112 numbering paper . 113 oxalic acid ______ _ 114 paraffin wax with ( ceresin 60 62 c ) ______ 115 peanut oil i 103 104 105 106 107 methylene blue _______ microtome blade ( low profile ) 108 9s rorman ( forrnaidehyde3 , _. _ congo red 89 90 fl6 e ? 117 phosphomolybuc acid 118 phosphotuflgstic acid .._________ i19. picric acid 120 plastic ring for block (white) 121 potassium oichromte 122 potassium hydroxi — 123 potassium metabisulphit 124 potassium permagnate 12s propaflolol — 126 readymade giemsanstanf 127 rosanilinle dye (for shiff reagent) 128 silver nitrate 135 tetrazollum chlorlde 136 toludine blue 137 xylene — 138 139 rapid pap stain kit disposable gloves sterile 140 disposable gloves unsteriliged 141 non speciheesterase kit 142 bovine albumin_22% 129 sodium nitropruside 13o sodium hydroxide 131 sodium sulphate — 132. sodium thiosuiphate 133 sudan black b 134 sulfurous acid_ ...

Medical College - Rajasthan

31880984 supply of hemodialysis machine nephrology materails hemoconcentrate part a & ba. the constituents of the hemoconcentrate are as follows: .part a(aqueous) sodium chloride: 160 1709/l; potassium chloride: 5 5.59/l, calcium chloride: 8.5 99/l; magnesium chloride: 5 5.509/l; glacial acetic acid: 8 99/l and qs purified water. (when diluted as 1:34) sodium:75 85 mmol/l, potassium: 0 2mmol/l, calcium 1.70 1.75mmol/l, magnesium: 0.75 lmmol/l, chloride: 85 90mmol/l, acetate: 3.5 4.5mmol/l. part b each powder packet weighing 800 9009m containing sodium chloride:20o3009m, sodium bicarbonate: 500 6509m which provides after dissolving sodium 55 60 mmol/l, chloride: 20 25mmol/l: bicarbonate: 30 40 mmol/1. one part a jar and three part b powder 2. arterio venous fistula needle : one presterlized set each wtth a pair of needles, i6 gauze needle with back eye and length 25 30mm with fixed wings with luer lock in the attached blood tubino of lenqth 25 3ocm. each twin pair set 3. dialyzer: single use dialyzer for hemodialysis of adult patients having synthetic hollow fibre of polysulfone, sterilized with non ethylene oxide method. lt should be able to bear blood flow of minimum 200m1/min and dialysate flow rate of 500m1/min with surface area 1 .3 1 .4m (requirement: 1o0/month). each dialyzer 4. dialyzer. dialyzer for hemodialysis of adult patients which should be presterlized with non ethylene oxide method with and reusable having synthetic hollow fibre of polysulfone able to bear blood flow of minirnum 200m1/min and dialysate flow rate of 500m|/min with surface area 1.6 1.7 rn: (requirernent: 40/month) which should be able to be rinsed effectivelv for reuse oost hemodialvsis. eacit dialyzer 5. arteriovenous line: it should be supplied with blood tubirrg to be attached to the dialyzer during dialysis. the length of pre sterilized latex fiee medical grade tubing should be 35 40crn with capacity of priming volume approximately 145 155m1 with anerial chamber, venous chamber rvith respective arterial and venous luer locks and injection ports in the tubing and ends of the tubing fitted with suitable connectors to the access a|d dialyzer. each tubing 6. pediatric dialyzer: the pediatric dialyzer should be pre sterilized by non ethylene oxide method and made of synthetic polvsulfone hollow fibre rvith each dialyzer wffr t*1 / signnturc of thc bidderwith serl lr (nephrology) s:no. item name submit rate of 0ach set/stenuitem in boq name of manufacture/ trade name/make/ mod€l compliance yes/no surface area 0.6 m? (requirement: 25lyear). the dialyzer and afieriovenous blood line of same manulacturer wou]d be prelerted. 7. pediatric dialyzer: the pediatric dialyzer should be pre sterilized by non ethylene oxide method and made of synthetic polysulfone hollow fibre with surface area 0.8m (requirement 15o/year). the dialyzer and arteriovenous blood line of sanre manulacturer aould be preferred. each dialyzer 6. pediatric arteriovenous line (blood tubing): the pediatric arteriovenous blood line should be pre sterilised and latex free witlr arletial chamber, venous chamber with respective alterial and venous luer locks and injection ports in the tubing and ends of the tubing fined with suitable connectors to the access and dialyzer. the dialyzer and arteriovenous blood line of same manufacturer would be preferred. each blood line 9. plasma filter for plasmapheresis: the plasma filter for therapeutic plasmapheresis in lenal lailure patients pre sterilised with polysulfone/polyethylene membrane with effective surface area 0.5rn2 0.6 tn:(requircntent 100/ycal) each 10. double lumen catheter for hemodialysis with kit: the double lumen catheter for hemodialysis in patients. lt should be pre sterilized by non ethylene oxide method, of flexible radio opaque polyurethane material make with j end guide wire (guidewire must be of good quality), v shaped double entry introducer needle,vessel dilator with arterial and venous port caps, syringe 5 1occ with luer lock. lt should be antimicrobial coated. slze of the double lumen catheters to be supplied are: a. 8fx 8 9cm (requirement so/year). one double lumen catheter with guide wire and items ll double lumen catheter for hemodialysis with kit: the double lumen catheter for hemodialysis in patients. lt should be pre sterilized by non ethylene oxide method, of flexible radio opaque polyurethane material make with j end guide wire (guidewire must be of good quality), v shaped double entry introducer needle,vessel dilator with arterial and venous port caps, syringe 5 1occ with luer lock. lt shoutd be antimicrobial coated. size of the double lumen catheters to be supplied are: b. 11 .5f 12f x 13 14cm (requirement50/month); one double lumen catheter with gulde wire and items 12. triole lumen catheter for hemodialysis with kit: the triple lumen catheter for hemodialysis in patients. lt should be pre sterilized by non ethylene oxide method,.of flexible radio opaque polyurethane material make with j end guide wire (guidewire iviust be of good quality), v shaped double entry introducer needle,vessel dilator with arterial and venous port caps, syringe 5 1occ with luer lock lt should be antimicrobial coated. size of the triple lumen catheters to be supplied are: c. 11.5f 12f x13 14cm (requirement50/month); each catheter ktt 3i^r{ t2 vt. ^e7 signsturc ofthe bidderrrilh seal n; ?a (nephrology) sno. item name submit rate of each set/stent/item in boq name of manufacture/ trade name/make/ model c0m pliance yes/no 13. biopsy gun: kidney biopsy gun with size a. 16 gauzexl6cm needle (requirement1oo/yearwith penetration depth 18 22mm, pre sterile, automated spring loaded. spring quality must be of good quality to ensure smoolh loading and to prevent misfire. each biopsy gun 14. biopsy gun: kidney biopsy gun with size 18 gauzexl6cm needle (requirement 50/year) with penetration depth 18 22mm, pre sterile, automated sprlng loaded. spring quality must be of good quality to ensure smooth loading and to prevent misfire. each biopsy gun 15. peritoneal dialysis catheter: kit to include pre sterilised rigid peritoneal dialysis catheter with single cuff with metal stiletto with pointed end, scalpel with holder, connector with flow regulator. the catheter to be supplied wiih pentoneal dialysis fluid administration set. peritoneal dialysis catheter with administration set (requirement adult 20oiyear. one catheter kit with administration set 16. peritoneal dialysis catheter: kit to include pre sterilised rigid peritoneal dialysis catheter with single cuff with metal stiletto with pointed end, scalpel with holder. connector with flow regulator. the catheter to be supplied with peritoneal dialysis fluid administration set. perjtoneal dialysis catheter with adminjstration set (requirement; pediatric 5o/year). one catheter kit with administration t7. high concentrate part a hemodialysis solution 1. high concentrate a hd solution compatible with dry bag part b powder. company must be iso & gmp certified. 2. fluid composition: sodium 103. mmol/1, chloride 109,5 mmol/1, calcium 1.75 mmol/l, magnesium 0.5 mmol/l, potassium 2mmol/l presence ofglucose in hd fluid solution is optional. per 10 liter 18. citrosteril 5 litre cans. each can 19. 6% sodium hypochlorite 5litre cans each can 20. acetic acid glacial 5litre cans each can 21 citric acid monohydrate 5009m. 5009m 22. hydrochloric acid 5 litre cans each can 28. injection of basiliximab 20 mg each vial 29. rabbit antithymoglobulin 250 mg each vial high flux hemodialyzer with tubing specificdtion: non ethylene oxide presterlyzed high perfotmance membrane and hollow fiber type. ultnfilt|ation coelncient (kuf) is >15 ml/h/mmhg and b2 m cleamnce >15 ml/min. compatible with most hemodialysis machines. high biocompatible materials such as polysulfone. housing polycarbonate or polyplopylene. potting compound should be polyurethane. priming volume. uf coefficient. clearance data (urea, creatinine, phosphate, vitarnin b l2). endotoxin retaining characteristics. compatible with most reprocessing machines and leprocessing fluid. should have caps for blood inlet and outlet ports for safer storage. dialyzers should nreqt one set of dialyzer and tubing .// 6 e t w . sisnafuro ofthe bidder rvith seal tllr y*,.{ l3 (nephrology) @: sno. it€m name submit rate of each seustenvitem in boq name of manufacture/ trad€ name/make/ model compliance yes/no european cg or usfda an+h99d lso standards. effective surface atea 1.6 2.0 sqm. dialyzer must be supplied with compatible tubing set. jj. purosteril s0lution 5 ltr. 1 liter j). dry bicarbonate bag for hemodialysis. 650 gram ...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Dr. S.N.Medical College - Rajasthan

31872338 hemodialysis machine nephrology materails satellite hospital mandore, jodhpur , drugs , medicines & other items , hemoconcentrate part a & b a. the constituents of the hemoconcentrate are as follows: • part a ( aqueous ) sodium chloride: 160 170g / l; potassium chloride: 5 5.5g / l, calcium chloride: 8.5 9g / l; magnesium chloride: 5 5.50g / l; glacial acetic acid: 8 9g / l and qs purified water. ( when diluted as 1:34 ) sodium:75 85 mmol / l, potassium: 0 2mmol / l, calcium 1.70 1.75mmol / l, magnesium: 0.75 1mmol / l, chloride: 85 90mmol / l, acetate: 3.5 4.5mmol / l. part b each powder packet weighing 800 900gm containing sodium chloride:200 300gm, sodium bicarbonate: 500 650gm which provides after dissolving sodium 55 60 mmol / l, chloride: 20 25mmol / l; bicarbonate: 30 40 mmol / l. , arterio venous fistula needle :one pre sterlized set each with a pair of needles, 16 gauze needle with back eye and length 25 30mm with fixed wings with luer lock in the attached blood tubing of length 25 30cm. , dialyzer: single use dialyzer for hemodialysis of adultpatients having synthetichollow fibre of polysulfone, sterilized with non ethylene oxide method. it should be able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 1.4m² ( requirement: 100 / month ) . , dialyzer: dialyzer for hemodialysis of adultpatients which should be presterlized with non ethylene oxide method with and reusable having synthetichollow fibre of polysulfone able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.6 1.7 m² ( requirement: 40 / month ) which should be able to be rinsed effectively for reuse post hemodialysis. , arteriovenous line: it should be supplied with blood tubing to be attached to the dialyzer during dialysis. the length of pre sterilized latex free medical grade tubing should be 35 40cm with capacity of priming volume approximately 145 155ml with arterial chamber, venous chamber with respective arterial and venous luer locks and injection ports in the tubing and ends of the tubing fitted with suitable connectors to the access and dialyzer. , pediatric dialyzer: the pediatric dialyzer should be pre sterilized by non ethylene oxide method and made of synthetic polysulfone hollow fibre with surface area 0.6 m² ( requirement: 25 / year ) , the dialyzer and arteriovenous blood line of same manufacturer would be preferred , pediatric dialyzer: the pediatric dialyzer should be pre sterilized by non ethylene oxide method and made of synthetic polysulfone hollow fibre with surface area 0.8m² ( requirement 150 / year ) . the dialyzer and arteriovenous blood line of same manufacturer would be preferred. , pediatric arteriovenous line ( blood tubing ) : the pediatric arteriovenous blood line should be pre sterilised and latex free with arterial chamber, venous chamber with respective arterial and venous luer locks and injection ports in the tubing and ends of the tubing fitted with suitable connectors to the access and dialyzer. the dialyzer and arteriovenous blood line of same manufacturer would be preferred. , plasma filter for plasmapheresis: the plasma filter for therapeutic plasmapheresis in renal failure patients pre sterilised withpolysulfone / polyethylene membrane with effective surface area 0.5m² 0.6 m² ( requirement 100 / year ) , double lumen catheter for hemodialysis with kit: the double lumen catheter for hemodialysis in patients. it should be pre sterilized by non ethylene oxide method, of flexible radio opaque polyurethane material make with j end guide wire ( guidewire must be of good quality ) , v shaped double entry introducer needle, vessel dilator with arterial and venous port caps, syringe 5 10cc with luer lock. it should be antimicrobial coated. size of the double lumen catheters to be supplied are: a. 8f× 8 9cm ( requirement 50 / year ) . , double lumen catheter for hemodialysis with kit: the double lumen catheter for hemodialysis in patients. it should be pre sterilized by non ethylene oxide method, of flexible radio opaque polyurethane material make with j end guide wire ( guidewire must be of good quality ) , v shaped double entry introducer needle, vessel dilator with arterial and venous port caps, syringe 5 10cc with luer lock. it should be antimicrobial coated. size of the double lumen catheters to be supplied are: b. 11.5f 12f×13 14cm ( requirement 50 / month ) ; , triple lumen catheter for hemodialysis with kit: the triple lumen catheter for hemodialysis in patients. it should be pre sterilized by non ethylene oxide method, of flexible radio opaque polyurethane material make with j end guide wire ( guidewire must be of good quality ) , v shaped double entry introducer needle, vessel dilator with arterial and venous port caps, syringe 5 10cc with luer lock. it should be antimicrobial coated. size of the triple lumen catheters to be supplied are: c. 11.5f 12f×13 14cm ( requirement 50 / month ) ; , biopsy gun: kidney biopsy gun with size a. 16 gauze×16cm needle ( requirement 100 / yearwith penetration depth 18 22mm, pre sterile, automated spring loaded. spring quality must be of good quality to ensure smooth loading and to prevent misfire. , biopsy gun: kidney biopsy gun with size 18 gauze×16cm needle ( requirement 50 / year ) with penetration depth 18 22mm, pre sterile, automated spring loaded. spring quality must be of good quality to ensure smooth loading and to prevent misfire. , peritoneal dialysis catheter: kit to include pre sterilised rigid peritoneal dialysis catheter with single cuff with metal stiletto with pointed end, scalpel with holder, connector with flow regulator. the catheter to be supplied with peritoneal dialysis fluid administration set. peritoneal dialysis catheter with administration set ( requirement adult—200 / year; , peritoneal dialysis catheter: kit to include pre sterilised rigid peritoneal dialysis catheter with single cuff with metal stiletto with pointed end, scalpel with holder, connector with flow regulator. the catheter to be supplied with peritoneal dialysis fluid administration set. peritoneal dialysis catheter with administration set ( requirement ; pediatric 50 / year ) . , high concentrate part a hemodialysis solution 1. high concentrate a hdsolution compatible with dry bag part b powder. company must be iso & gmp certified. 2. fluid composition: sodium 103 mmol / l, chloride 109.5 mmol / l, calcium 1.75 mmol / l, magnesium 0.5 mmol / l, potassium 2mmol / l presence of glucose in hd fluid solution is optional. , citrosteril 5 litre cans. , 6% sodium hypochlorite 5 litre cans , acetic acid glacial 5 litre cans , citric acid monohydrate 500gm. , hydrochloric acid 5 litre cans , injection of basiliximab 20 mg , rabbit antithymoglobulin 250 mg , high flux hemodialyzer with tubing specification: non ethylene oxide presterlyzed high performance membrane and hollow fiber type. ultrafiltration coefficient ( kuf ) is >15 ml / h / mmhg and b2 m clearance >15 ml / min. compatible with most hemodialysis machines. high biocompatible materials such as polysulfone. housing polycarbonate or polypropylene. potting compound should be polyurethane. priming volume. uf coefficient. clearance data ( urea, creatinine, phosphate, vitamin b12 ) . endotoxin retaining characteristics. compatible with most reprocessing machines and reprocessing fluid. should have caps for blood inlet and outlet ports for safer storage. dialyzers should meet european ce or usfda an+h99d iso standards. effective surface area 1.6 2.0 sqm. dialyzer must be supplied with compatible tubing set. , purosteril solution 5 ltr. , dry bicarbonate bag for hemodialysis. 650 gram...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

University of Rajasthan - Rajasthan

31779047 supply of chemical & glassware at botany department, uor, jaipur , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

University of Rajasthan - Rajasthan

31759644 supply of chemicals and glassware at botany department university of rajasthan, jaipur supply of chemicals and glassware at botany department university of rajasthan, jaipur , chemical items : , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

National Institute Of Ayurveda - Rajasthan

31740943 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Medical And Health Services - Rajasthan

31473537 supply of chemical purchase 1 4 dioxane , 1 2 dichlroethane , 1 butaol 2 6 dinitro toluene , 2 propanol , 4 p nitrobenzyl pyridine , hexane sulphonic acid sodium phenanthroline monohydrate dioxolane butan sulphonic acid sodi salt decane sulphonic acid , aminoantipyrine acetic acid glacial acetic acid glacial acetone , acetonitrile aluminum hydroxide , ammonium chloride ammonia liquid , ammonium acetate ammonium ceric sulphate , cerium sulphate ammonium ferric sulphate , ammoium ferrus sulphate hexa hydrate ammonium metavandate r137 i bromo crcsol green indicator — i eromo phenol blue indicator? — lammonium metavandate ammonium molybdate ammonium nitrate ammonium sulphate ammonum suiphamate ammonium thiocyanate 32 ammonium vandate 33 ascorbic acid 34 barium chloride 35 bismith nitrate 36 blue tatrazolium 1 37 i boric acid bromo cresol green indicator bromo phenol blue indicator 28 29 30 31 40 — biomoihymol blue indicaior? — 41 buffer tablets 4.0 42 lifier tablets 7.0 43 bufier tablets 9.2 44 calcium carbonate calcium chloride 46? — calcium d pentotheflate 98% 47 calcium nitrate 48 calcium sulphate 49 carbon di sulphide 50 carbon tetra chloride 51 carbon tetra chloride 52? — cetrimide 53 chloroform chloroform 1, cobaltus nitrate copper sulphate violet chloroform cobaltus nitrak copper sulphate cynogen bromide dextroxe di acetyl pthalate dibutyle pthalate dichloro methane dielthyl pthalate glycol di potassium hydrogen phosphate , di sodium hydrogen phosphate dithizone dye edta di sodium salt eosin vellowish , etc 1’ ferric nitrate 99% 1 hydro chioric acia 37% i 95 hydro chioric acid 37% a 96 hydrochloric acid n/40 amp i _____ hvdroch10de acid ni i l 98 hydrogen r0xide 30’q a 99 indicator paper (8.0 to 40.5) p 1a0 ioaine a 1i1 a iodine ump 102 isooctarle h 103 isoanyialchnhai a 104 isobutyl aichohal a 1i5 isobutyl methyl ketone a 1i6 isopropyl ether a 107 isoprmpyl aicohal h 1i8 lsopropyl alcohal a: kare hshcr reagent? — 0 lactic acid (4 l.cysleine hnydrochloride? b25 methyt ostge 1sdst0? 126 methyl acetate 127 methyl red indicator meihyl violet i 129 iuroxmdeth0ms baker 130 i(i.naphthyl) — ethylendiaenfedndd0? 131 n,n.dimetbyl _pphenylenediam11w / ___ ulphate 132 natural red lnaicat0t i 133 n butyl pthaiate a 134 n heptane a 135 n.heptane suiphonic acid soaium salt a 136 n hexane — 137 n hexane 138 nitric acid a 139 nitro benzene a n—n llinctltyi forininide ([)n1).)d 5jimt’enzaktehyde? öiiiophosphor1c acid — ziriihophosphoric acid osmic acid oxalic acid p nitro phenol 147 palladin charcoal active 14$ — pectin pure 1ij pentachloronilrobenlenle 150 pentane 1 sulphonic acid sodi 151 perchloric acid 0.1 mol j152 petroleum ether (40 60) i i 145 146 oxalic acid p nitro phenol palladin charcoal active pectin pure , pentachloronitrobenzene , pentane sulphonic acid sodi salt, perchloric acid , petroleoum ether , petroleum ether phenol , phenol red indicator powder , phenolphathalein indicator , 158 — potassium bicarbonate 159 potaasium bromide for ir potassium chloride 161 potassium chromate 162 potassium dichromate 163 potassium dihydrogen orthophosphate nj 12p04 64 potassium bi.hyarogen phosphate (k11:poi) 165 potassium ferrocynide 166 potassium hydrogen phthalate 167 potassium hydroxide pellets 168 potassium lodate j71 i 174 i potassium iodide jium periodate — iiassium thiocynate tassium ihiosuiphate pyrid inc ( salicylic acid 175 silica gel 176 silicon vaccume grease t77 silver nitrate 178 silver_nitrate_amp. 179 sodi. lauryl sulphate 180 sodium acetate 181 sodium bicarbonate 182 sodium carbonate 183? — sodium chloride 184 sodium di.hydrogefl phosphate fuii2po4) 1i5 sodium di.hydr0ge1 phosphate ____ juh2pon) 186 sodium hydroxide n/i amp. 187 sodium hydroxide pellets 188 sodicm perchiorate monohydrate i t89 sodicm rhodlzaflaie? — 190 sodium suiphatc(aflhydnt25) 191 iiumthiosuiphate? — 192 sodium thiosuiphate n/40 amp. i 93 starch indicator paper (pkt of 3 rou) a 194? — starch soluble? — a — 195 stronihm chloride 196 sucrose 197 sulfanilic acid acid tetr iut)l annrnoniurn hydrcvcik’ 4lx!il)h tltm but)’i aflhiflonliu ni ihy’dronik’? oo • fç)0rnl) tetra hutyte aninwniun hydroilte 40% (400nil) iera hydrofuran — thyntot blue indicanor ferric chloride , ferric nitrate ferric sulphate ferrion indicator solution ferrous ammonium sulphate , ferros sulphate , folline reagent , formeldehyde , glucose glycerol hexamine hexylamine , hydro chloric acid , hydrochloride acid indicator paper iodine 04 thyniol green indicator 205 tin metal 206 toluene 207 tolunne — 20s triethylaflnine 209 tris (1 lydroniethyl) arninonwth4tfle __e_ _ buffer 210? — tartaric acid j ii vacuum grease xanthydrol xylenol orange indicator powder , zinc dust ap , zinc sulphate , sodium metaperiodate etc ...

Public Health Engineering Department - Rajasthan

31331820 supply of chemical, glasswares and lab equipments pipette bulb, simplex bottle top despenser, drawing tray, funnel holder, pipette washer, amber narrow mouth bottle, wash bottle, narrow mouth wash bottle, pipettor stand, variable volume pipette, cdta monohydrate, lactose broth, glycerol, ethyl alcohol, barium chloride, decolourising carbon, phenolphthalein indicator, ammonium molybdate, stannous chloride, toluene, eriochrome black, silica gel, ammonium acetate, hydrochloric acid, glacial acetic acid, ph electrode epoxy plastic body, conductivity cell, flat bottom test tubes, analytical electronics balance, bottle top dispensers, cvt constant voltage transformer....

Department Of Agriculture - Rajasthan

31292723 tender for lab chemicals ferrous ammonium sulphate ammonium acetate , potassium dichromate , sodium bicarbonate ,diphenyl amine amen , ammonium molybdate , hydrochloric acid liquid ammonia , style chloride , tin granules ,diethylene triamine penta acetic acid , glacial acetic acid triethanolamine , calcium chloride , amonium chloride , vvolumetric flask , buffer tablets ph , filter paper rim ream etc ...

Medical And Health Services - Rajasthan

30888778 supply of items for path lab and blood bank xl 300/fully automated analyzer kits, billurubin direct r1 6*44/r2 3*22 / system pack erba, billurubin direct r1 6*44/r2 3*22 / system pack erba, creatnine r1 5*44/r2 5*11 / system pack erba, cholestrol 10*44 ml / system pack erba, xl wash 4*100 ml / system pack erba, glucose 10*44 ml / system pack erba, sgot r1 6*44/r2 3*22 / system pack erba, sgpt r1 6*44/r2 3*22 / system pack erba, blood urea r1 5*44/r2 5*11 / system pack erba, uric acid r1 5*44/r2 5*11 / system pack erba, alp r1 2*44/r2 2*11 / system pack erba, amylase 5*22ml / system pack erba, hdl cholestrol 4*30 + 4*10 / system pack erba, ldl cholestrol 2*30 + 2*10 / system pack erba, triglyceride r1 5*44/r2 5*11 / system pack erba, xl multical 4*3 ml / system pack erba, albumin 10*44ml / system pack erba, ck mb / system pack erba, total protine / system pack erba, xl multical 4*3ml / system pack erba, calcium 10*12ml / system pack erba, cuvates / xl 300 machine, control sera / system pack erba, semi auto analyzer kits, billurubin total 4*60ml / erba kits, billurubin direct 4*60ml / transasia bio medical ltd/erba/any other, creatnine 4*60ml / transasia bio medical ltd/erba./any other, cholestrol 5*20ml / transasia bio medical ltd/erba./any other, xl wash / transasia bio medical ltd/erba./any other, glucose 2*200ml / transasia bio medical ltd/erba./any other, sgot 5*20ml / transasia bio medical ltd/erba./any other, sgpt 5*20ml / transasia bio medical ltd/erba./any other, blood urea 5*20ml / transasia bio medical ltd/erba./any other, uric acid 5*20ml / transasia bio medical ltd/erba./any other, alp 6*6ml / transasia bio medical ltd/erba./any other, amylase / transasia bio medical ltd/erba./any other, hdl cholestrol 1*60+1*120ml / transasia bio medical ltd/erba./any other, ldl cholestrol 1*60+1*120ml / transasia bio medical ltd/erba./any other, triglyceride 5*20ml / transasia bio medical ltd/erba./any other, xl multical / transasia bio medical ltd/erba./any other, albumin / transasia bio medical ltd/erba./any other, ck mb 2*8+2*2ml / transasia bio medical ltd/erba./any other, total protine / transasia bio medical ltd/erba./any other, ck nac 2*8+2*2ml / /any other, ldh / /any other, randox fullyautomated analyzer kits, billurubin total liquid 582 / jendrassik (rx series), billurubin direct liq /, creatnine liq 1953 / jaffe (rx series), cholestrol liq 2232 / chod pap (rx series), glucose liq 2232 / god pap (rx series), sgot/ast liquid 1968 / mod,ifcc (rx series), sgpt /alt liquid 1968 / mod,dgkc (rx series), blood urea liq 1880 / kinetic (rx series), uric acid liq 1668 / color (rx series), alp / amp(ifcc) rx series, amylase 380 / eps (rx series), hdl cholestrol liq 1023 / clearance (rx series), ldl cholestrol liq 867 / clearance (rx series), triglyceride liq 1488 / gpo pap (rx series), albumin liq 1845 / bcg 1845, ck mb liq 492 / dgkc (rx series), total protine liq 2232 (mono regent) / biurut (rx daytona), calcium liquid 2637 / arsenazo (rx series), ck nac liq 480 / dgkc (rx series), calibration sera level 2 (20*5ml) / rx series, calibration sera level 3 (20*5ml) / rx series, human assayed multi sera level 3 (20*5 ml) / rx series, wash solution no.1 /, wash solution no.2 /, human assayed multi sera level 2(20*5 ml) / rx series, other goods/chemicals, abd blood group kit 10ml / jmitra, crp kit 100 test /, ra/rf kit 100 test /, widal kit 4*5ml /, aso kit 50 test /, hiv rapid card 1*50 / tulip/abbot/any other, hcv rapid card 1*50 / tulip/abbot/any other, hbsag rapid card 1*50 / tulip/abbod/any other, vdrl rapid card/strip 1*50 / tulip/abbot, ketodiosticks 1*50 /, uristicks (alubumin sugar) 1*100 / span, glass cover slip 1*100 /, uriscan gen 96 (1*100) /, jimsa stain 1*250ml / fisher scientific/nice, lismans stain 1*250ml / fisher scientific/nice, field stain a (1*250ml) / qualigens/nice/marck, field stain b (1*250ml) / qualigens/nice/marck, pregnancy card 1*50 / tulip/mankind/jmitra, gluco sticks 1*100 / accusure/any other, acetic acid 10% solution (1*500ml) / organo/nice, wbc fluid 1*50ml / qualigens/nice/marck, tri sodium citrate 3.8% (1*500ml) / organo/nice, urine container 50ml /, plane vaccutainers 1*100 / polymade/b.d./labasia, hemoglobin meter (german made) / toptech (isi/iso certified), hb tube (german made) / toptech (isi/iso certified), hb pippate (german made) / toptech (isi/iso certified), auto pippate (5 50 micro l) / erba/glexo, auto pippate (100 1000 micro l) / erba/glexo/any other, esr tube(disposable) / isi/iso certified, dengue card(nsi,igm,igg combo) / jmitra/abbot/any other, methonol 500ml / nice/marck/qualigen, glass slide 1*50 / blue star/alphhem/isi mark, pt test kits 1*50 test/2*4 ml / erba/aggappe, tissue paper(1 pack each) /, disposal esr cup 2ml 100 /pack / nice/marck/qualigen, capillary tube for ct 100 /pack / toptech (isi/iso certified), cotton roll 500gm/pack /, dengue ellisa kit 48 test/pack / jmitra, hcl solution n/10 500ml/pack / toptech (isi/iso certified), esbachs regent 125ml/pack / queligens/nice/marck, neubaurer counting chamber(german made) / toptech (isi/iso certified), platelate count fluid 250ml/pack / nice/marck/qualigen, multisticks 100 strick/pack / bayer/aspen/tulip, glucobattery each / isi mark/luprin, tincher iodine / qualigens/nice/marck, micro tips yellow 1000 /pack / tulip/isi certified, micro tips blue 1000/pack / tulip/isi certified, ecg bulb for esr 1*10 /, sodium hydrochlorite 5% 500ml/pack / qualigens/nice/marck, zn stain for afb 1*300 test / qualigens/nice/marck, absolate alcohol 500ml/pack / qualigens/nice/marck, glacial acetic acid 500ml/pack / qualigens/nice/marck, csf diluting fluid 250ml/pack / qualigens/nice/marck, tec fluid 125ml/pack / qualigens/nice/marck, immersion oil for microscopy 250ml/pack / qualigens/nice/marck, cover slip 22*22mm (100 /pack) / blue star/galaxy, coomb sera 10ml/pack / nice/tulip/erba, pti kit / erba/aggappe, test tube wahsing brush each /, liquid soap with stain 1ltr/pack / dettol/lifebuoy/santor, liquid detergent powder 5ltr/pack / organo, marker pen each / std, cuvet xl300 each / transasia bio medical ltd/erba., tube stand each /, ice box 2ltr/pack /, vtm tube /, ppe kit /, applicator / isi mark/luprin, container (plastic) 1ltr/pack /, pentra 60 c+ cbc machine regents, abx diluent 20 ltr per pack / horiba, abx cleaner 1 ltr per pack / horiba, abx eiosinophix 1ltr per pack / horiba, abx basolyse 1 ltr per pack / horiba, abx biolyse 400ml per pack / horiba, abx monoclair 500ml per pack / horiba, horiba 3 part regents, abx cleaner 1 ltr per pack / horiba, abx biolyse 1 ltr per pack / horiba, abx diluent lmg 20 ltr per pack / horiba, contol sera 2ml per pack / horiba, mindray 3 part cbc machine regents, heamo diluent 20 ltr per pack / vector, heamo detergent 20 ltr per pack / vector, heamo cleaner 100ml per pack / vector, heamo lyse 500ml per pack / vector, control sera 2ml per pack / vector, electrolyte regents, fluid pack na/k/cl 800ml / cat no. 112121d & code c, daily cleaning solution kit 52ml / cat no. me2118d & code c, electro lyte control trilevel 30*2 ml / cat no. dd92123 & code c, printer paper 10/pk / cat no. me2541d & code c, blood bank, hiv elisa kits 3rd/4th gen.(j.mitra/s.d/erba)/any other, hbs ag elisa kits (erba/j.mitra.s.d)/any other, hcv elisa kits 3rd/4th gen (erba/j.mitra.s.d)/any other, abd grouping sera kit (span & j mittra), anti d grouping kit ( span & j. mittra) 10 x 10ml, mp card test (antigan) (acon/satya/oscar/abbot)/any other, hiv card test (rapid/j.mitra)/any other, hbs ag card test (rapid/j.mitra)/any other, hcv card test (rapid/j.mitra)/any other, slides glass (blue star/glaxo), edta tube, vdrl test (card or strip), plain tubes (glass borosil), anti a (span/j.mitra) 5 x 5 ml, coombs sera (span/j.mitra), bovine albunim 22% (span/j.mitra), blood begs (cpda) (h.l., palymed), band aid (jhonson & jhonson) & detol, refrigerator chart recorder hair (remi), refrigerator chart recorder (rebonic), microtips yellow, blood begs (plain), gloves (truskin/romson) (jhonson & jhonson) 7.5 inch, sodiam hypochloride solution, anti ab (j.mitra/span), minidil lmg 20 ltr pack, abx lyse bio 1 ltr pack, minotrol 16 (2n) (minotrol), crp kit (quantitative), crp card (d dimer) rapid, glucosticks (accucheck), dengue elisa kit (ns 1) jmitra (96 test)/abbot/any other, ethanol absolute 500 ml (white bottle), elisa paper roll, glass tub (5 ml), micro tips yellow, droper, hb meter strip (hemocue), aso titen kit, serum cups (xl randox machine), calcium kit transasia/bio medical ltd/erba/any other, jsb stain 1st 500 ml, jsb stain 2nd 500 ml, sodium citrate 500 ml, leshman stain 500 ml, mircopipette 100 1000ul, n/10 hcl 500 ml, pediatric blood bags, liss reagent, pipette 50 micro, pipette 100 micro, refrigerator graph marker, btct capillary, anti a, anti b, anti d grouping kit ( span & j. mittra) 10 x 10ml, distal water, spanj ball for doner, band aid, glass tube, gel card....

Medical And Health Services - Rajasthan

30884306 supply of items for path lab and blood bank items for path lab and blood bank , xl 300/fully automated analyzer kits , billurubin direct r1 6*44/r2 3*22 / system pack erba , billurubin direct r1 6*44/r2 3*22 / system pack erba , creatnine r1 5*44/r2 5*11 / system pack erba , cholestrol 10*44 ml / system pack erba , xl wash 4*100 ml / system pack erba , glucose 10*44 ml / system pack erba , sgot r1 6*44/r2 3*22 / system pack erba , sgpt r1 6*44/r2 3*22 / system pack erba , blood urea r1 5*44/r2 5*11 / system pack erba , uric acid r1 5*44/r2 5*11 / system pack erba , alp r1 2*44/r2 2*11 / system pack erba , amylase 5*22ml / system pack erba , hdl cholestrol 4*30 + 4*10 / system pack erba , ldl cholestrol 2*30 + 2*10 / system pack erba , triglyceride r1 5*44/r2 5*11 / system pack erba , xl multical 4*3 ml / system pack erba , albumin 10*44ml / system pack erba , ck mb / system pack erba , total protine / system pack erba , xl multical 4*3ml / system pack erba , calcium 10*12ml / system pack erba , cuvates / xl 300 machine , control sera / system pack erba , semi auto analyzer kits , billurubin total 4*60ml / erba kits , billurubin direct 4*60ml / transasia bio medical ltd/erba/any other , creatnine 4*60ml / transasia bio medical ltd/erba./any other , cholestrol 5*20ml / transasia bio medical ltd/erba./any other , xl wash/ transasia bio medical ltd/erba./any other , glucose 2*200ml / transasia bio medical ltd/erba./any other , sgot 5*20ml / transasia bio medical ltd/erba./any other , sgpt 5*20ml / transasia bio medical ltd/erba./any other , blood urea 5*20ml / transasia bio medical ltd/erba./any other , uric acid 5*20ml / transasia bio medical ltd/erba./any other , alp 6*6ml / transasia bio medical ltd/erba./any other , amylase/ transasia bio medical ltd/erba./any other , hdl cholestrol 1*60+1*120ml / transasia bio medical ltd/erba./any other , ldl cholestrol 1*60+1*120ml / transasia bio medical ltd/erba./any other , triglyceride 5*20ml / transasia bio medical ltd/erba./any other , xl multical/ transasia bio medical ltd/erba./any other , albumin/ transasia bio medical ltd/erba./any other , ck mb 2*8+2*2ml / transasia bio medical ltd/erba./any other , total protine / transasia bio medical ltd/erba./any other , ck nac 2*8+2*2ml / /any other , ldh/ /any other , randox fullyautomated analyzer kits , billurubin total liquid 582/ jendrassik (rx series) , billurubin direct liq / , creatnineliq 1953 / jaffe (rx series) , cholestrolliq 2232 / chod pap (rx series) , glucoseliq 2232 / god pap (rx series) , sgot/ast liquid 1968 / mod,ifcc (rx series) , sgpt /alt liquid 1968 / mod,dgkc (rx series) , blood urealiq 1880 / kinetic (rx series) , uric acid liq 1668 / color (rx series) , alp/ amp(ifcc) rx series , amylase 380 / eps (rx series) , hdl cholestrolliq 1023 / clearance (rx series) , ldl cholestrolliq 867 / clearance (rx series) , triglyceride liq 1488 / gpo pap (rx series) , albumin liq 1845 / bcg 1845 , ck mb liq 492 / dgkc (rx series) , total protine liq 2232 (mono regent) / biurut (rx daytona) , calcium liquid 2637 / arsenazo (rx series) , ck nac liq 480 / dgkc (rx series) , calibration sera level 2 (20*5ml) / rx series , calibration sera level 3 (20*5ml) / rx series , human assayed multi sera level 3 (20*5 ml) / rx series , wash solution no.1/ , wash solution no.2 / , human assayed multi sera level 2(20*5 ml) / rx series , other goods/chemicals , abd blood group kit 10ml / jmitra , crp kit 100 test / , ra/rf kit 100 test / , widal kit 4*5ml / , aso kit 50 test / , hiv rapid card 1*50 / tulip/abbot/any other , hcv rapid card 1*50 / tulip/abbot/any other , hbsag rapid card 1*50 / tulip/abbod/any other , vdrl rapid card/strip 1*50 / tulip/abbot , ketodiosticks 1*50 / , uristicks (alubumin sugar) 1*100 / span , glass cover slip 1*100 / , uriscan gen 96 (1*100) / , jimsa stain 1*250ml / fisher scientific/nice , lismans stain 1*250ml / fisher scientific/nice , field stain a (1*250ml) / qualigens/nice/marck , field stain b (1*250ml) / qualigens/nice/marck , pregnancy card 1*50 / tulip/mankind/jmitra , gluco sticks 1*100 / accusure/any other , acetic acid 10% solution (1*500ml) / organo/nice , wbc fluid 1*50ml / qualigens/nice/marck , tri sodium citrate 3.8% (1*500ml) / organo/nice , urine container 50ml / , plane vaccutainers 1*100 / polymade/b.d./labasia , hemoglobin meter (german made) / toptech (isi/iso certified) , hb tube (german made) / toptech (isi/iso certified) , hb pippate (german made) / toptech (isi/iso certified) , auto pippate (5 50 micro l) / erba/glexo , auto pippate (100 1000 micro l) / erba/glexo/any other , esr tube(disposable) / isi/iso certified , dengue card(nsi,igm,igg combo) / jmitra/abbot/any other , methonol 500ml / nice/marck/qualigen , glass slide 1*50 / blue star/alphhem/isi mark , pt test kits 1*50 test/2*4 ml / erba/aggappe , tissue paper(1 pack each) / , disposal esr cup 2ml100 /pack / nice/marck/qualigen , capillary tube for ct 100 /pack / toptech (isi/iso certified) , cotton roll 500gm/pack / , dengue ellisa kit 48 test/pack / jmitra , hcl solution n/10 500ml/pack / toptech (isi/iso certified) , esbachs regent 125ml/pack / queligens/nice/marck , neubaurer counting chamber(german made) / toptech (isi/iso certified) , platelate count fluid 250ml/pack / nice/marck/qualigen , multisticks 100 strick/pack / bayer/aspen/tulip , glucobattery each / isi mark/luprin , tincher iodine / qualigens/nice/marck , micro tips yellow 1000 /pack / tulip/isi certified , micro tips blue 1000/pack / tulip/isi certified , ecg bulb for esr 1*10 / , sodium hydrochlorite 5% 500ml/pack / qualigens/nice/marck , zn stain for afb 1*300 test / qualigens/nice/marck , absolate alcohol 500ml/pack / qualigens/nice/marck , glacial acetic acid 500ml/pack / qualigens/nice/marck , csf diluting fluid 250ml/pack / qualigens/nice/marck , tec fluid 125ml/pack / qualigens/nice/marck , immersion oil for microscopy 250ml/pack / qualigens/nice/marck , cover slip 22*22mm (100 /pack) / blue star/galaxy , coomb sera 10ml/pack / nice/tulip/erba , pti kit / erba/aggappe , test tube wahsing brush each / , liquid soap with stain 1ltr/pack / dettol/lifebuoy/santor , liquid detergent powder 5ltr/pack / organo , marker pen each / std , cuvet xl300 each / transasia bio medical ltd/erba. , tube stand each / , ice box 2ltr/pack / , vtm tube / , ppe kit / , applicator/ isi mark/luprin , container (plastic) 1ltr/pack / , pentra 60 c+ cbc machine regents , abx diluent 20 ltr per pack / horiba , abx cleaner 1 ltr per pack / horiba , abx eiosinophix 1ltr per pack / horiba , abx basolyse 1 ltr per pack / horiba , abx biolyse 400ml per pack / horiba , abx monoclair 500ml per pack / horiba , horiba 3 part regents , abx cleaner 1 ltr per pack / horiba , abx biolyse 1 ltr per pack / horiba , abx diluent lmg 20 ltr per pack / horiba , contol sera 2ml per pack / horiba , mindray 3 part cbc machine regents , heamo diluent 20 ltr per pack / vector , heamo detergent 20 ltr per pack / vector , heamo cleaner 100ml per pack / vector , heamo lyse 500ml per pack / vector , control sera 2ml per pack / vector , electrolyte regents , fluid pack na/k/cl 800ml / cat no. 112121d & code c , daily cleaning solution kit 52ml / cat no. me2118d & code c , electro lyte control trilevel 30*2 ml / cat no. dd92123 & code c , printer paper 10/pk / cat no. me2541d & code c , blood bank , hiv elisa kits 3rd/4th gen.(j.mitra/s.d/erba)/any other , hbs ag elisa kits (erba/j.mitra.s.d)/any other , hcv elisa kits 3rd/4th gen (erba/j.mitra.s.d)/any other , abd grouping sera kit (span & j mittra) , anti d grouping kit ( span& j. mittra) 10 x 10ml , mp card test (antigan) (acon/satya/oscar/abbot)/any other , hiv card test (rapid/j.mitra)/any other , hbs ag card test (rapid/j.mitra)/any other , hcv card test (rapid/j.mitra)/any other , slides glass (blue star/glaxo) , edta tube , vdrl test(card or strip) , plain tubes (glass borosil) , anti a (span/j.mitra) 5 x 5 ml , coombs sera (span/j.mitra) , bovine albunim 22% (span/j.mitra) , blood begs (cpda) (h.l., palymed) , band aid (jhonson & jhonson) & detol , refrigerator chart recorder hair (remi) , refrigerator chart recorder (rebonic) , microtips yellow , blood begs (plain) , gloves (truskin/romson) (jhonson & jhonson) 7.5 inch , sodiam hypochloride solution , anti ab (j.mitra/span) , minidil lmg 20 ltr pack , abx lyse bio 1 ltr pack , minotrol 16 (2n) (minotrol) , crp kit (quantitative) , crp card (d dimer) rapid , glucosticks (accucheck) , dengue elisa kit (ns 1) jmitra (96 test)/abbot/any other , ethanol absolute 500 ml (white bottle) , elisa paper roll , glass tub (5 ml) , micro tips yellow , droper , hb meter strip (hemocue) , aso titen kit , serum cups (xl randox machine) , calcium kit transasia/bio medical ltd/erba/any other , jsb stain 1st 500 ml , jsb stain 2nd 500 ml , sodium citrate 500 ml , leshman stain 500 ml , mircopipette 100 1000ul , n/10 hcl 500 ml , pediatric blood bags , liss reagent , pipette 50 micro , pipette 100 micro , refrigerator graph marker , btct capillary , anti a , anti b , anti d grouping kit ( span& j. mittra) 10 x 10ml , distal water , spanj ball for doner , band aid , glass tube , gel card...

Rajasthan University Of Health Science - Rajasthan

30859312 nit for supply of various chemicals, reagents, glasswares and other items at ruhs college of medical sciences, jaipur t acetone roll 3 tidehyde? solution 4. glycerol 5. methanol 6. ethanol 7. sodium oxalate 8. turpentine oil 9. disposable gloves 10. disposable gloves ini.e disposable gloves dept. of bioc hemistry 12. 1, 2, 4 amino napthol suiphonic acid 13. acetone 14. ammonium molybdate 15. ammonium oxalate 16. a naphthol. 17. ammomnium sulphate arsenic pentaodide_ 18. 19. ammonium carbonate 20. bile salt 21. bilirubin 22. bromocresol green indicator ijiuivalu1? 23. bovine albumin 24. carbon tetra chloride 25. casein 26. chloroform 27. cholesterol powder ec 28. copper sulphate (crystalline) 29. copper acetate 30. calcium carbonate 31. chlorophenol red indicator dextrose di acetyl monoxime 32. 33. 34. diethyl ether 35. disodium hydrogen phosphate__________ 36. ethanol (95 %) 37. ferric chloride — 38. formaldehyde 39. glacial acetic acid 40. 41. hydrochloric acid lithium carbonate labolene lead acetate 42. 43. 44. mercuric sulphate 45. nitric acid 46. mercuric iodide 47. 48. methanol 0 phosphoric acid 49. phenol crystals 50. phenol red indicator 5|. phenolphthalein indicator 52. picric acid (saturated solution) 53. picric acid powder 54. potassium dihydrogen ortho phosphate 55. potassium lodide 56. resorcinol 57. silver nitrate 58. sodium bisulphite 59. sodium carbonate 60. sodium hydroxide pelietes 61. sodium chloride 62. sodium nitrite 63. sodium n itropniside 64. • socium sulphate 65. ______ sodium sulphile anhydrousd 66. soyabean meal 67. sulphuric acid (h2so4) 68. sulphanilic acid 69. ., sulphur powder 70. sodmum tungstate 71. thiosemicarbazide 72. trichloro acetic acid 73. tungstic acid 74. sodium citrate 75. nesslers reagent 76... serum total cholesterol estimation kit 77. serum triglyceride estimation kit 78. serum sgot estimation kit 79. serum sgpt estimation kit 80. alkaline phosphates estimation kit 81. blood glucose estimation kit 82. , serum calcium estimation kit 83. serum csf protein estimation kit 84. serum alb estimation kit 85. serum cpk estimation kit 86. serum glucose estimation kit 87. serum hdl estimation kit 88. serum ldh estimation kit 89. serum cretinine estimation kit 90. serum ck mb estimation kit 91. serum bilirubin 92. serum urea estimation kit 93. filter paper i pkt 94. tissue paper 95. — permanent marker pen 96. absorbent cotton 97. tips 500ul 1000w glass marking pencil 98. 99. gloves 6.5 • 100. serum vial (plastic with cap) l0l. oil 102. glass slide 103. cover slip dept. of physiology 104. leishmans stain (repdy to use) 105. eosinophil count fluid (ready to use) 106. platelets count fluid . (ready to use) 107. reticulocyte count fluid (ready to use) 108. rbc fluid 109. antisera a+b+d (rh) monoclonal 1m10.l covcr slipe (22x22 mm) ill. lancetblood 112. surgical spirit 113. glass slides 1l14.s cotton roll big 115. surgical disposable gloves — 116. paper roll for single channel 117. xylem *1ltj 118. . paper roll for three channel 1m19.e conducting jelly 120. conducting paste 121.. . surgace adhesive electrode for digital for physiography 122. ecg paper roll dept. of microbiology 123. koh pellets 124. .... sda with chloramphenical 125. dermatophyte test medium slant 126. chrom agar for candida 127. lpcb 128. skirted plate 96 well x0.2m1 (autoclavable) 129. l lysine ‘| aeearboxylasebnoth4 l ornithine decarboxylase broth 130. 131. l arginine dihydrolase broth 132. wash bottle 500 ml capacity 133. syringe filter 25hmmr 134. mannitol salt agar 135. odifiedhugh& leifson 0/f test 136. loeffler serum medium base 137. cled 138. robertson cooked meat medium 139. andrede’s indicator 140. bromocresol purple 141. glucose phosphate broth (mr vp medium) nvici.iiuiil i 142. methyl red indicator 143. alpha naphthol 144. simmon citrate agar — 145. christensen urease agar 146. triple sugar iron agar 147. peptone type i bacteriological 148. n acetyl l cysteine 149. gelatin 150. crystal violet 151. lodine resublimed 152. potassium iodide 153. absolute ethanol °%o ‘l 154. acetone 155. sairanine 156. carbol fuchsin conc. sulphuric acid 157. 158. methylene blue 159. sodium taurocholate 160. blood agarbase 161. bhlbroth 162. corn meal agar 163. coverslipbox(ix 20 small box) 164 . glass slide 75x25x1.33mm 165. petridish glass (100 mm) 166. petridish glass (75 mm) 167. petridish (disposable) individually packed 168. deionized water 169. dca 170. xld 171. wilson and blair medium 172. ferric chloride anhydrous phenol crystals 173. fluid thioglycollate broth (anaerobic) with indicator 174. filter paper sheet whartman no. i 175. immersion oil for microscopy 176. kovcks indole reagents 177. macconkey agar 178. nutrient agar 179. muller hinton agar 180. n,n.n’.n’tetra methyl pp hhenyeenedimmine dihydrochioride 181. boronic acid n,n,n’,ntetra methyl pp hhenyeenedimmine dihydrochloride |. phenol crystals 82. 183. boronic acid phenylalanine agar 84. 185. 186. plasticin selenitefbroth bacteriological simagar ,‘ 187. tcbs 188. 189. 190. thick cotton thread urea (40%) koh pellets 191. sda with chloramphenical 192. dermatophyte test medium slant 193. chromagarfor cand ida 194. lpcb 195. skirted plate 96 well x0.2ml (autoclavable) 196. l lysine decarboxylase broth 197. 198. l ornithine decarboxylase broth l arginine dihydrolase broth 199. 200. wash bottle 500 ml pacity syringe filter 25 mm 201. mann ito! salt agar 202. modified hugh& leifson o/f test 203. loeffler serum medium base dept. of pathology 204. benedict’s reagents 1 205. n/iohcl ammonia solution 206. 207. sulphur powder 208. sodium n itroprusside crystals 209. ammonium sulphate powder 210. acetic acid 211. dextrose anhydrous ‘. purified 212. distilled water 213. r.b.c. diluting fluid (hayerns) 214. w.b.c. diluting fluid (turk’s) 215. oilimmersion for microscopy 216. sulphosalicylic acid 3% 217. leishman stain 218. bariumchloride 10% 219. sodiumcitrate 3.8% 220. spirit for spirit lamp 221. buffer for leishman stain fh6.s dept. of pathology 2. glass test tube 18mm x 50mm without rim 1 glass test tube 75mm x 12mm without rim 4. test tube holder 5. 6. heniocytometer sahli hemoglobinometer ...

National Institute Of Ayurveda - Rajasthan

30729107 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Shri Karan Narendra Agriculture University - Rajasthan

30683533 open tender for chemicals and glassware 1. i , 2 dichioroethane 2. 1 naphthol ar 3. 2 3 5 tn phenyl tetrazolium chloride ( flc ) 4. 2, 4 d 5. 2, 4 dinitro phenyl hydrazine ( dnph ) 6. 2, 6. dicholorophenol mdophenol 7. 30% hydrogen peroxide ar grade 8. 5 sulphosalicylic acid dihydrate ar 9, absolute alcohol absorbant cotton 10. 11. acetic acid 12. acetic acid glacial ar 13. acetocarmine solutions — 14. acetone — 15. acetone ( hplc grade ) 16. acetone ar ( special grade ) 17. acetone ar grade 18. activated charcoal 19. acid fuchsine 20. acrylamide 21. activated charcoal ar grade 22. agar powder ( bacteriological grade ) 23. almuniumm chloride = 24. aluminium chloride hexahydrate extrapure ar, 99% — 25. aluminium foil — — 26. ammonia buffer solution — 27. ammonia solution sp. gr 0.91 — 28. ammonium acetate ar grade — 29. ammonium chloride — 30. ammoniunn dihydrogen ortho phosphate fermous sulphate ammonium hexahydrates 31. 32. 33. ammoniurn inolytxttearjradee ammonium molybdate tetrahydrate extrapure 34. ammonium oxalate monohydrate 35. 36. ammonium oxilate ugeiulphate ( iya ammonium sulphate 37. 38. anhydrous sodium carbonate 39. anthorne reagent 40, anthrone ar 41. apron coat 42. ascorbate 43. ascorbic acid 44. azoxystrobin 45. 46. azosystrobn + hexaconazole azoxystrobin +tebuconazole 47. bacillus subtilis 48. bap 49. 50, 51. 52. bap solution barium chloride dihydrate barium chloride solution ( 10% ) barium sulphate — 53. beer extract ar grade 54. benomyle 55. bis acrylamide = 56. blitox 50% wp ( coc ) — s7. borex 58. boric acid ( powder ) 59. bovine serum albumin ( bsa ) 60. bromocresol blue indicator 61. bromocresol_green 62. — bromocresol purple sodium salt 63. bromophenol blue ( bpb ) 64. bromothymol blue indicator powder 65. bsa ( bovine serum ) 66. buffer ampule ( set of 6 ) 67. buffer tablet of ph ( 4.0 ) 68. buffer tablet of ph ( 7.0 ) 69. cadmium chloride monohydrate 70. calcium nitrate tetrahydrate 71. calcium carbonate ar grade 72. calcium chloride 99% extra pure — 73. calcium chloride dihydrate 74. calcium sulphate anhydrous 75. calcium sulphate dihydrate 76. captan 77. carbandzim+ mancozcb 78. carboxin 37.5% + thiram 37.5% ( vitavaxepower ) 79. carmine powder 80. castor oil 81. catechol extrapure 99% 82. cedar wood oil medium chloroform ( ethanol stabilized ) 83. 84. chloroform ( hplc grade ) 85. chlorothalonil 86. chiortetracycline hydrochloride 87. citric acid 88. clove oil 89. cobalt chloride hexahydrate ( coci2.6h20 ) 90. cobaltus chloride 91. cobaltus nitrate hexahydrate 92. concentrated sulpburic acid 93. coomassie brilient blue r250 94. copper sulfate pentahydrate ( cuso4.5h20 ) 95. copper sulphate 96. corn meal media 97. cotton blue _, i • flflb%.its 98. cxystal violet ar grade 99. ctab ( cetyl thmethylammonium bromnide ) m 100. czapek”s dox agar 101. d ( + ) ribose 102. darco g 60 ( activated charcoal ) 103. detergent 104. dextrose 105. d fructose a / r 106. di sodium hydrogen arsenate 107. dibasic sodium phosphate 108. diehylene ti i amine penta acetic acid ( dtpa ) ear.grade 109. diethyl ether ar ( stabilised ) 110. diethyline tr amine penta actic acid ( dtpa ) 111. difenconazole 112. dinmethyl sulfoxide ( dmso ) 113. 114. diphenylamine indicator di sodium hydrogen arsenate 115. disodium tetrachloropalladat ( na2pdcl4 ) 116. dntps mix ( 10 mm ) 117. edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 118. ethanol hplc grade 119. ethidiumn bromide 120. ethyl alcohol 121. ethyl meihanesulfonate ( ems ) 122. ethylene alcohol 123. ethylene dia minetetraacetic acid jna2 edta ) eucalyptus oil ferric.chloride 124. 125. 126. ferrion indicator 127. ferrous ammonium sulphate ar grade 128. ferrous sulphate ( feso4, 7h20 ) ar 129. ferrous sulphate hypt 130. filter paper sheet i jv. i ituci paper o.iueel? 131. folin & ciocalteus phenol ( fcp ) reagent ar 132. folins uric acid 133. formaldehyde 134. fosetyl al 135. gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 136. glacial acetic acid 137. glucose ar grade 138. glutamic acid 139. glycerene 140. glycerol 141. glycine 142. gum acacia 143. haxen 144. hexaconazole 145. hexaconazole 4% + zincb 68% 146. hoaglands no. 2 basal salt mixture 147. huwasarn spray ( nanosilver & peroxide ) 148. hydrochloric acid 149. hydrochloric acid 0.5n aq. solution 150. hydrochloric acid lr hydrogen dichloroethan 151. 152. hydrogen peroxide 30% 153. hydrogen peroxide 6% 154. hydroguinone 155. hydroxyl amines ( ha ) 156. hydroxylamine hydrochloride 157. iaa 158. iaa solution 159. iba 160. iba solution 161. iodide crystals 162. iodine ar grade 163. iodine solution 1% w / v 164. iron sulphate iron tartrate isoamyl alcohol 165. 166. 167. isopropanol alcohol 168. kavach ( syngenta ) 169. kh2po4 170. laborine 171. lactic acid ar l ascorbic acid extrapure 172, 173. l glycine ( triglycine ) extrapure, 99% 174. linsecd oil 175. 176. linsced oil cake liquid nitrogen 177. l phenylalanine extrapure chr, 99% 178. l tyrosine for biochemistry 179. magnesium chloride 180. magnesium sulfate heptahydrate ( mgso4, 7h20 ) 181. malt agar 182. malts media 183. mancozeb 184. manganese sulfate monohydrate ( mnso4. h20 ) 185. manganese sulphate 186. manitol ar grade 187. martins mcdia 188. mercapto ethanol 189. mercuric chloride ar 190. metalaxyl m ( ridomil gold ) 191. metaphosphoric acid 192. methanol 193. methanol ( ar grade ) 194. methanol hplc grade 195. methionine 196. methyl blue indicator ar grade 197. methyl methanesulfonale ( mms ) 198. methyl orange indicator 199. methyl red indicator 200. mgcl2 201. molyclean ma 03 phosphate free 202. molysol ‘e’ ar 203. monobasic sodium phosphate 204. myclobutanil 205. n ( 1 naphthyl ) ethylene diamme hcl ( n ned ) 206. n n methylenebisacrylamide 207. n orthophosphoric acid 208. n propanol 209. n / 10 sodium hydroxide 210. na2co3 211. naa 212. naa solution 213. 214. 215. 212. naa solution 216. neem oil 217. nesseller reagent 218. nessler reagent ar grade 219. n hexane 99% ar 220. nicotinic acid 221 . ninhydrin ar ( 99% assay ) 222. nitric acid 223. nitro blue tetrazolium ( nbt ) 224. nutrient agar 225. nutrient agar readymade 226. oat meal media 227. 0 dianisidine methanol 228. orcinol 229. ortho pbosphodic acid 230. oxalic acid 231 . oxaloacetic acid / 232. p nitrophenyl sulphate naci nano2 naoh 233. pacelio uslilacinus 234. paraffin wax 235. pcnb ( pentachloromtrobenzene ) 236. pda readyinade 237. peg 6000 238. 239. peptone ar grade petroleum ether ( 60 1o0°c ) 240. petroleum elher 60 80c 241. phenophthalin indicator 242. phenol phenol crystalline extrapure ar 243. 244. phenol disalfonic acid 245. phenolphthalein indicator power 246. phosphoric acid 247. p nitrophenol phosphate ar grade 248. polyvenylpyrolidase 249. polyvinylpyrolidone ( pvp ) 250. potasium meta bi sulphite 251. potassium dicromnate 252. potassium hydroxide pellets — 253. potassium iodide 254. potassium acetate — 255. potassium chloride 256. potassium chromate ar 257. potassium dichromnate 258. — potassium dihydrogen phosphate 259. potassium femcyanide 260. potassium hydrogen sulphate 261. potassium iodide ( k! ) 262. potassium metabisuiphite 263. potassium oxalate potassium permanganate 264. 265. potassium permanganate ar grade 266. potassium permangnate 267. potassium sulphate 268. potassium titrate 269. potato dextrose brolh 270. pottassium hydroxide 85% ar pottassium nitrate 99% ar — propiconazole ( tilt ) 271. 272. 273. propineb ( antracol ) 70 w% 274. protein ladder marker ( mid range ) — 275. pyridoxine hc1 276. pyrogallol extrapure 277. rapd marker ( molecular markers different_series ) . 278. raxil ( bayer ) 279. resorcinol ar 280. rutin trihydrate pure 99% 281. saffranin 282. salicyclic acid 283. sesame oil 284. silver nitrate 285. sodium chloride 286. sodium acetate anhydrous 287. sodium acetate thhydrate 288. sodium arsanate 289. sodium azide 290. sodium benzoate 291. sodium bicarbonate 292. sodium chloride 293. — sodium chloride ar grade 294. sodium citrate 295. — sodium cobalt nitrite 296. sodium dthydrogen phosphate 297. — sodium dodicyl sulfate 298. sodium hydrogen carbonate ar 299. sodium hydroxide ar grade 300. sodium hydroxide extrapure ar 301. sodium hypochloride 302. sodium molybdate dihydrate ( na2moo42h2o ) 303. sodium nitrite 304. sodium phosphate 305. sodium potassium tartarate tetrahydrate 306. sodium silicate 307. sodium thiosuiphate 308. sodium tungstate dihydrate extrapure ar, _99% 309. stannous chloride dihydrate 310. streptocycline 311. streptomycin sulfate 312. sucrose 313. sulfex 315. suiphosalicylic acid 316. sulphuric acid 317. sulphuric acid 98% ar 318. tag buffer 319. taq polymerase ( su / pl ) 320. tebuconazole 321. temed 322. tergitol np 10 323. thiamine hcl 324. thiobarbituric acid 325. thiophanate methyl 7o% wp 326. toluene 327. total hardness indicator tablets 328. tri chioroacetic acid 329. trichoderma harzianum 330. tricyclozol8%+mancozeb62% 331. triethylamine ( tea ) 332. triphenyl formazan ( ipf ) ar grade 333. trishcl 334. triton x l00 335. universal indicator solution 336. v8 agar medium ( vinegar ) 337. vitavax power h2re338. wettable sulfur 339. xylene 340. yeast extract ar grade 341. zinc chloride 342. zinc oxide 343. zinc sulfate tetrahydrate ( znso4.4h20 ) 344. zinc sulphate heptahydrate 1. beaker ( graduated ) 25, 50, 100, 250, 500, 1000 ml capacity 2. bod bottle 125 ml, 300ml 3. reagent bottle reagent 100, 125, 250 ml 4. burettes 5otnl 5. conical flask graduated 50, 100, 150, 250, 500ml 6. conical flask standard ground mouth250, .500_ml 7. cotton ( in gm. ) 8. cover slip ( square ) 22 mm 9. cover slips ( round ) 22 mm 10. digestion flask 100 ml 11. dropping bottle 50 ml 12. dropping bottle 500 ml 13. filter paper ordinaryl2.5 cm ( 100 circle ) 14. filter paper sheet 15. filterpaperwhatmanno. 4112.5 cm ( 100 circles ) 16. funnel 17. glass road 18. glass tubes 19. kejldahl flask l0omi round bottom long nack 20. kejldahl flask 500ml round bottom long nack 21. laboratory tray plastic ordinary 22. measuring cylinder 50, 100, 250 ml capacity 23. measuring cylinder with pour out hexagonal base 1o0mi graduated — 24. measuring cylinder with pour out 25. measuring cylinder with pour out hexagonal base 250ml graduatcd 26. measuring cylinder with pour out hexagonal base 25ml graduated 27. measuring cylinder with pour out hexagonal base 500ml graduated 28. measuring cylinder with pour out hexagonal base soml graduated 29. measuring cylinder with pour out hexagonal base 5ml graduated 30. measuring mugs transparent 500 ml 31. micro pipette adjustable automatic 32. ocular micrometer 10mm with 100 divisions 33. permanent glass slide set of meiosis in plants 34. pemmanent glass slide set of mitosis in plants 35. permanent slide of all parts of root., leaf and_stem 36. _______ permanent slide of anatomy of dicot root 37. permanent slide of anatomy of dicot stem 38. permanent slide of anatomy of lear 39. pemmanent siide of anatomy of monocot.root 40. permanent slide of anatomy of monocot stem 41. pestle_&_mortal 42. petri culture dish 90 160 mm cover diameter 43. petri plates 5cm cover diameter 44. petri plates 10 cm cover diameter 45. petridish 46. pipette 1 ml graduated pipette 10 ml graduated pipette 2 ml graduated pipette 5 ml graduated 47. 48. 49, 50. plain slide 76x26 mm pre cleaned ready.for_use 51. reagent bottle 250rnl amber colour 52. reagent_bottle 500m1 53. reagent bottle 500ml amber colour 54. reagent bottles 125 ml 55. reagent bottlesl00 ml capacity 56. room themmometer in celsius 57. [ thermometer in celsius 58. round bottom flask 250 ml 59. slide storage tox for 25 pieces of slide 60. specimen glass jars ( 1 & 2 ltr. ) 6l stage micrometer ( l”x 3” ) 1 mm, 100 divisions 62. staining jar and rack for 24 pieces of slide 63. test tube 12 x 75 mm 64. test tube 15 x 125 mm test tube 16 x 16 x 16mm 65. 66. test_tube_25 x_100_mm 67. 68. test tube stand 69. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , flat bottom 70. volumetric flask 100ml with stopper ( size 14 / 23 ) , flat bottom 71. volumetric flask 250m1 with stopper ( size 14 / 23 ) , flat bottom 72. volumetric flask 25ml with stopper ( size_10 / 19 ) , _flat bottom 73. volumetric flask 50ml with stopper ( size 10 / 19 ) , flat bottom 74. wash bottle 500m1 75. watch glass 65 mm dia 76. watch glass 80 mm 77. whatmnan no.40 filter paper 78. graduate pipette 79. graduate pipette 80. graduate pipette 81. graduate pipette 82. filter paper whatman 42 83. m wash bottle 84. test tube stand 85. pipette stand 86. polylab polypropaline test tube stand 87. pipette filler 88. pipette filler 89. pipette filler 90. burette 91. burette stand 92. slides 93. cover slips 94. petri plates 95. inoculation nddle 96. volumetric flask 97. tissue paper roll 98. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity. transperent ) 99. wide mouth reagent bottle, graduated with screw cap ( 500 ml capacity, transperent ) 100. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, transperent ) 101. wide mouth reagent bottle graduated with screw cap ( 2000 ml capacity, transperent ) 102. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity, amber colour ) 103. wide mouth reagent bottle graduated with screw cap ( 500 ml capacity, amber colour ) . 104. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, _amber_colour ) 105. round bottom soxhiet flask 250 ml 106. rnd bottom soxhiet flask 500 ml i 107. beaker low form, heavy wall with double capacity scale, 250, 500, 1000 ml 108. brush beaker 109. brush bottle 110. burettes, 100 ml capacity, division 0.1 ill. burette brush 112. quartz crucible with lid, tolerance upto 2000oc 113. crucible holders 114. measuring cylinder with hexagonal base, cap. 5, 10, 25, 50, 100, 250, 500, 1000, 2000 ml. 115. flask volumetric with pp stoper, 20, 25, 50, 100, 200 250, 500, 1000, 2000 ml capasity 116. brush flask 117. test tube stand made of polypropylene & polycarbonate ( 3 tier ) 25 mm x 24 tubes, 25mm x 18, 25mm x 36, 32mm x 12 tubes 118. spatula, stainless steel, one end spoon & one end flat, 125 mm, 200mm, 300mm 119. forceps, straight fine points, 100, 200, 300mm size 120. micropipettes, fully autoclavable, uv, resistance, digital volume setting, .volume_range v vnuttic iauigc 121. 100 1000 ul ( 5 ul increment ) , 500 5000 ul ( 50 ul increment ) 122. funnel 75 mm 123. pipette 1 ml graduated 124. pipette 10 ml graduated 125. pipette 2 ml graduated pipette 5 ml graduated 126. 127. conical flask standard ground mouth 250 ml 128. conical flask standard ground mouth 500 ml 129. absorbant cotton 130. filter paper ordinary 12.5cm ( 100 circle ) 131. filter paper sbeet 132. filter paper whatman no. 41, 12.5 cm ( 100 circles ) 133. filter paper whatman no. 42, 12.5 cm ( 100 circles ) 134. glass road — 135, glass tubes ( 18xl50 ) 136. petriculture dish ( 90 160 mm diam. ) with cover 137. petn plates ( 10cm diam. ) with cover 138. petridish_ ( 9cm ) 139. room thermometer in celsius 140. whatman no. 40 filter paper 12.5 cm ( 100_in_pies ) 141. beaker ( graduated ) 100 ml 142. beaker ( graduated ) 250 ml 143. beaker ( graduated ) 500 ml 144. beaker ( graduated ) 1000 ml 145. bod bottle 125 ml 146. bod bottle 300 ml 147. burettes 50 ml 148. burettes_stand 149. conical flask graduated 50 ml 150. conical flask graduated 25 ml 151. conical flask graduated 100 ml 152. conical flask graduated 250 ml 153. conical flask graduated 500 ml 154. cover slip ( square ) 22 mm 155. digestion flask 100 ml 156. digestion flask 250 ml 157. kejdahl flask 100 ml round bottom long neck 158. kegdahl flask 500 ml round bottom lojnecko 159. laboratory tray ( plastic ) ordinary 160. measuring cylinder 50 ml — 161. measuring cylinder 100 ml 162. measuring cylinder 250 ml measuring cylinder 50 ml 164. measuring cylinder with pour out hexagonal base 500 nil graduated 165. measuring cylinder with pour out hexagonal base 10 ml graduated 166. measuring cylinder with pour out hexagonal base 25 ml graduated 167. measuring cylinder with pour out hexagonal base 50 ml graduated 168. measuring cylinder with pour out hexagonal base 5 ml graduated 169. mortar & pestle 170. porcelain dish 171. reagent bottle 250 ml amber colour 172. reagent bottle 500 ml amber colour a’ ;iel;5 ;g ( i i;i.; 174. soxlet apparatus — 175. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , plate bottom 176. volumetric flask 100 ml with stopper ( size 14 / 23 ) , plate bottom 177. — volumetric flask 500 ml with stopper ( size 14 / 23 ) , plate bottom 1 7q — £1 1 luppel size 1’f / 23 ) , piate bottomm — volumetric flask 250 ml with stopper ( size 14 / 23 ) , plate bottom 179. — volumetric flask 25 ml with stopper ( size 10 / 19 ) , plate bottom 180. volumetric flask 50 ml with stopper ( size 10 / 19 ) , plate botton 181. cuvette 182. hote plate 183. cleaning brush 184. tilt measuring bottle 1 ml 185. —w.. tilt measuring bottle 2 ml 186. tilt measuring bottle 5 ml 187. 188. tilt measuring bottle 10 ml apron coat 189. hand gloves 190. labolene 191. cavity block 192. tele counter 193. slide box plastic 194. 195. glass slides nematode 196. 178. sieve set 197. non absorbent cotton 198. absorbent cotton 199. round bottom flask 200. round bottom flask 20i. scalpel 202. spint lamp 2o3. trial tag plastic, aluminun 204. trial sticks 205. rubber bands 206. parafihim tape 207. inoculation needle 208. experinental diary 209. steel grip ( 3 meter, 5 meter ) 210. coconut pit ‘345. tissue paper roll etc...

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Rajasthan University Of Health Science - Rajasthan

30320541 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a (sera) , anti b (sera) , anti d (sera) , sodium metabisulfite , capillary tubes , sprit , g6pd kit (12 test ) , ocult blood kit , coombs anti sera , cover slip (18x18mm) , disposable needles (24 guage) , disposable needles (22 guage) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n/10 hcl , cedar wood oil , permanent marker thin (black) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper (110 mm) , thermal paper (80 mm) , thermal paper (57 mm) , small test tube plastic , small test tube glass , tips (100 1000? l) ( blue ) , tips (10 200? l) ( yellow ) , tissue paper roll , tourniquate (cloth) , urine multi strips , urine strips for alb/sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution (liquid ammonia) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate (ammonium iron sulphate) , ferric chloride , formalin (formaldehyde 37 40 %) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade (low profile) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with (ceresin 60 62 c) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block (white) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye (for shiff reagent) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

30302809 supply and installation of various chemicals & reagents& consumable items for department of pathology 1 antia (sera) 1x10 ml 2 anti b (sera) 1x10 ml 3 ant| d (sera) 1x10 ml 4 sodium metabisulfite 1x50 gm 5 capillary tubes 1x100 ml 6 sprit 1x 5001 7 g6pd kit (12 tests ) lx],? 8 ocult blood kit 1x50ml 9 coombs antisera 1x10ml 10 cover slip (18x18mm) 20x10 11 disposible nediles (24guage) 1x100 t2 drsposrble nediles (22guage) 1x100 13 disposible sterile urine container 1x100 t4 esr disposable pipette 1x100 15 glass marker pencil 1x10 15 jsb stain i 1x500ml l7 jsb stain ii 1x500ml 18 ketone strips 1x50 19 lancets 1x200 20 leishman,s stain 2x500ml 2l micro glass slides 1x50 22 microscope bulb mono pack 23 n/1o hcl 1x500ml 24 cedar wood oil 1x1000m1 25 permanet marker pen thin (black) mono pack 26 lrapidh&e 2x500ml 27 i reticulocvte stain 1x25ml 28 semen dilutine fluid 1x125 ml 29 sodium citrate3.2% 1x500 ml 30 sodium citrate 3.8% 1x500 ml 31 thermal paper 1lomm monopack 32 thermal paper 80 mm monopack 33 thermal paper 57mm monopack 34 small test tube plastic 1x100 35 small test tube glass 1x100 36 tips (100 1000u1) 1xs00 37 tips (10 200u1) 1x1000 38 tissue paper roll monopack 39 torniquate (cloth) monopack 40 urine multistrips 1x100 47 urine strips for alb/sug 1x100 42 vacutainer edta vial 1x100 43 vacutainer sodium citrate 3.2 % vial 1x100 44 wbc dilutine fluid 1x500 ml h 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area monopack 46 giemsa stain liquid 1x125ml dj r 47 carbol fuchsin 1x100 ml 48 cover slip (22x50) 1x20 oackets 49 diamond pencil 1x10 50 distilled water 1x5lt 51 dpx mount 1x250 ml 52 ethanol 1x500 ml 53 filter oaoer 460x570 mm 1x100 54 methanol 1x2.5 lt 55 normalsaline 1x500 ml 56 papanicolou ready to use kit 1x1 kits 57 hematoxiline powder 5gm 58 glacial acetic acid 1x500 ml 59 aluminium potassium sulphate dodecehydrate 1x500 em 60 sodium lodate lx100 em 61 potassium ferrocvanide 1x500 ml 62 mveloperoxidase 1xl kit 63 disposable syringes 2ml 1x50 64 disposable svrinees 5ml 1x50 65 disposable svrinees 10ml 1x50 66 disposable svrinees 20ml 1x50 67 cotton roll 1x500gm 58 petridish disposable 1x1 69 hand senitiser 1x500 ml 70 dlc counter ( 8 diffrential min ) monopack 7t acetic acid 1x500 ml 72 acetone 1x2.5 lt 73 acid fuschin 1x25gm 74 acid periodic 1x100 em 75 activated charcoal 1x100 em 76 alicine blue 25 em 77 aluminium chloride 1x100 em 78 aluminium hydroxide 1x100 em 79 ammonium solution (liquio ammonia) 1x500 ml 80 aniline blue 1x259m 81 basic fuchsin 1x25 em 82 benzidine powder 25 em 83 biebrich scarlet 1x25 gm 84 brilliant cresyl blue 1x25 em 85 carmine power 1x5 sm 86 celestine blue 1x100 em 87 chloral hvdrate 1x500 gm 88 citric acid 1x500 ml 89 concentrated hcl 1x500 ml 90 congo red 1x100em 91 egg albumin flake 1x500 sm 92 eosin vellow stain oowder 1x25 em 93 ferric ammonium sulphate (ammonium iron sulphate) ,i 500gm dq ferric chloride 1x500 em 95 forma lin ( forma ldehv de 37 4o o/o 1x30lt 2tl{ / (rr * 95 1x2.5 lt 97 glycer:ol 1x2.5 lt 98 gold chloride 1x1 gm 99 haematoxvline crvstal 1x5 em 100 hvdrochloric acid ar 1x2.5 lt 101 hvdrosen peroxide 500 ml t02 light green 1x25 sm 103 malt diastase 1x5 gm to4 mercuric oxide 1x100 em 105 metanilyellow 25 em 106 methylene blue 1x25 gm lo7 microtome blade (low orofile) 1x50 108 murcurichloride 100 em 109 neutral red 1x25 gm 110 nitric acid 1x500 ml llt nuclear fast red 1x25 em lt2 numberine daoer 1x100 113 oxalic acid 1x500 em ll4 paraffin wax with (ceresin 60 62 c) 1x2 ke 115 peanut oil 1x100 rnl 116 phenol 1x500 ml tt7 phosohomolvbdic acid 1x100 em 118 phosphotunestic acid 1x100 gm 119 picric acid 1x500 ml l20 plastic ring for block (white) each lzl potassium dichromte 500 em l22 potassium hvdroxide 500 em 123 potassium metabisulphit 1x500 gm 724 potassium permaqnate 1x500 em l25 propanolol 1x2.5 lt 726 readymade giemsa stain 1x125 ml l27 rosaniline dye (for shiff reagent) 1x100 gnr l28 silver nitrate 1x25 em 129 sodium nitropruside 100 em 130 sodium hvdroxide 500em 131 sodium sulphate 500 em l32 sodium thiosulphate 1x500 em 133 sudan black b 1x25 gm 134 sulfurous acid 1x500 ml 13s tetrazollum chlorlde 1x25 em 135 toludine blue 1x25 gm t37 xylene 1x2.5 tt 138 rapid pap stain kit 139 disoosable gloves sterile 1x50 t40 disposable gloves unsteriliged 1x100 14l. non soecihe esterase kit monooack 142 bovine albumin22% ...

National Institute Of Ayurveda - Rajasthan

30241226 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm...

State Forensic Science Laboratory - Rajasthan

30031031 rate contract chemical , item no.1(a)chemicals , 1   propanol , 1    propanol , 1,4 dioxane , 1,4 dioxane , 2,4 dinitro phenyl hydrazine , acetaldehyde solution , acetic acid , acetic acid glacial , acetic acid glacial , acetic acid glacial , acetone , acetone , acetone , acetonitrile , acetonitrile , acetonitrile , acetonitrile , ammonia solution 25 % , ammonia solution 25% , ammoniumacetate , ammoniumacetate , ammoniumcerric nitrate , ammonium carbonate , ammonium chloride , ammonium cyanide , ammonium hepta molybdate , ammonium meta vanadate , ammonium nitrate , ammonium oxalate , ammonium persulphate , ammonium sulphate , ammonium thiocyanate , aniline , antazoline hydrochloride , antimony trichloride , ascorbic acid , ascorbic acid , barium chloride , barium nitrate , basic fuchsine , benedict’s reagent , benzene , benzene , benzene , benzidine , bismuth subnitrate , boric acid , bromine , bromoform , bromoform , calcium carbonate , calcium chloride (fused) , calcium hydroxide , calcium hypochlorite , calcium hypochlorite , calcium oxide powder , charcoal activated , chloranil , chloroform , chloroform , chloroform , chloroplatinic acid (iv) , chromotropeb , chromotropic acid , citric acid , cobaltnitrate , cobaltnitrate , cobalt acetate tetrahydrate , cobalt thiocyanate , cobaltous acetate tetra hydrate , copper sulphate , cyclohexane , cyclohexane , cyclohexane , dichloro methane , dichloro methane , dichloro methane , diethyl amine , diethyl ether , diethyl ether , diethylamine , dihydrogen orthophosphate , dimethyl formamide , dimethyl glyoxime , dimethyl sulphoxide (dmso) , diphenyl carbazone , diphenylamine , diphenylamine , dipicrylamine , dipotassium hydrogen , disodium hydrogen orthophosphate , disodium hydrogen orthophosphate anhydrous , ethanol/absolute alcohol , ethyl acetate , ethyl acetate , ethyl acetate , ethyl benzoate , ethyl methyl ketone , ethyl methyl ketone , ethylene diamine 99% , ferric chloride , ferric sulphate , ferrous sulphate , formaldehyde 37 41% , formic acid , fuming nitric acid , fuming nitric acid , heptane , hexylamine , hydrobromic acid , hydrochloric acid , hydrochloric acid , hydrofluoric acid , hydroxyl amine hydro chloride , indicator paper(ph 1 14.0 range) , indicator paper(ph 2.0 4.5) , indicator paper(ph 2.5 10.5) , indicator paper(ph 3.5 6.0) , indicator paper(ph 5.0 7.5) , indicator paper(ph 6.5 9.0) , indicator paper(ph 8.0 10.5) , iodine , iso butyl alcohol , isopropylalcohol , isopropylalcohol , isopropylamine 99% , laboratory glassware washing thick solution with (neutral ph) , lead acetate , litmus paper blue , litmus paper red , magnesiumdioxide , magnesiumsulphate , magnesium acetate , magnessium acetate , manganese sulphate , mercuric chloride , mercuric oxide (red/yellow) , mercuric sulphate , mercury , methanol , methanol , methanol , metol , molybdic acid , morpholine , n butanol , n butanol , n hexane , n hexane , n hexane , n, n dimethyl acetamide , nickel nitrate hexahydrate , ninhydrin , ninhydrin , nitric acid , nitric acid , nitric acid , nitrobenzene , nitrobenzyl pyridine , o tolidine , o toluidine , orthophosphoric acid , orthophosphoric acid , ortho toluidine , oxalic acid , p dimethyl amino benzaldehyde , palladium chloride , p aminophenol , p dimethyl amino cinnamaldehyde , perchloric acid 60% , perchloric acid 70% , petroleum ether(400 600 c) , petroleum ether(600 800 c) , phenol , phenyl hydrazine hydrochloride , phosphomolybdic acid , phosphoric acid , picric acid , platinum (iv) chloride , polyvinyl acetate , potassium chloride , potassium chloro platinate , potassium chromate , potassium cobaltinitrate , potassium di hydrogen phosphate , potassium dichromate , potassium ferrocyanide , potassium hexacyanoferrate , potassium hydrogen orthophosphate , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium persulphate , potassium thiocynate , p toluene sulphonic acid , pyridine , pyridine , safranine , salicylic acid , selenious acid , silica gel g f 254 for thin layer chromatography , silica gel g (for tlc) , silver diethyldithio carbamate , silver nitrate , sodium acetate , sodium bisulphite , sodium carbonate anhydrous , sodium chloride , sodium chloride , sodium dihydrogen orthophosphate dihydrate , sodium dodecyl sulphate , sodium hydroxide pellets , sodium hypochlorite solution 4% w/v , sodium hypochlorite solution 4% w/v , sodium hypochlorite solution 4% w/v , sodium nitrate , sodium nitrite , sodium nitroprusside , sodium potassium tartrate , sodium sulphate (anhydrous) , sodium thiosulphate (hypo) , sodium tungstate , ß naphthol , stannous chloride , star/sq/emplurach , sulphanilic acid , sulphuric acid , sulphuric acid , tannic acid , tartaric acid , tetraethylene penta amine , tetramethyl ammonium hydroxide , toluene , toluene , toluene , tri ethyl amine , tri ethyl amine , tri ethylamine , tri sodium citrate , trichloro acetic acid , trichloroacetic acid , trifluoroacetic acid , tris buffer , tris hcl , uranyl acetate , urea , water , xylene , yellow ammonium sulphide , zinc acetate dihydrate , zinc chloride , zinc dust , zinc metal , zinc sulphate monohydrate , a naphthyl amine...

Geological Survey Of India - Rajasthan

29997982 bids are invited for sodium carbonate ar/gr pack of 500 gram as per specification , potassium dichromate ar / gr pack of 500 gram as per specification , silver nitrate 99.8% ar / gr pack of 25 gram as per specification , potassium hydroxide pellets ar / gr pack of 500 gram as per specification , potassium nitrate ar / gr pack of 500 gram as per specification , methyl iso butyle ketone ar grade pack of 500 ml as per specification , isopropyl alcohol pack of 500 ml as per specification , soap solution / neutral detergent / labolene pack of 500 ml as per specification , borax lr pack of 500 gram as per specification , glacial acetic acid pack of 500 ml as per specification , sodium thiosulphate ar / gr pack of 500 gram as per specification , sodium acetate ar / gr pack of 500 gram as per specification , barium chloride dihydrate ar / gr pack of 500 gram as per specification , ferrous ammonium sulphate pack of 500 gram as per specification , litharge ar pack of 500 gram as per specification total quantity : 1...

Medical And Health Services - Rajasthan

29959065 supply of lab regents supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clothing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 μl ) , blue tips for micro pipette ( 1000 μl ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , cryo vial 1.8 ml , micro centrifuge tube 1.5 ml , micro centrifuge tube 2.0 ml , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 μl , aerosol barrier tips 20 μl , aerosol barrier tips 100 μl , aerosol barrier tips 200 μl , aerosol barrier tips 1000 μl , 96 well sample rack ( 1.5 ml to 2.0 ml microcentrifuge tube rack ) , aluminiumfoil ( 50 mtr rolls ) , 96 well cryo box for croyo vial 1ml to 2 ml , cryo screw cap vial with o ring molecular grade 1.8 ml , reversible rack for mct and pcr tube , low profile pcr tube 01 to 0.2 ml strip of 8 tube with cap , zip lock packets for 8x4 in poly bag size ( 8x4ich. ) , zip lock packets for 8x4 in poly bag size ( 5x7 ich. ) , zip lock packets for 8x4 in poly bag size ( 6x8 ich. ) , zip lock packets for 8x4 in poly bag size ( 10x12 ich. ) , tough tags / cryo labels , autoclavable bmw discardbags 30 ltr red , autoclavable bmw discardbags 5 ltr red , autoclavable bmw discardbags 30 ltr yellow , autoclavable bmw discardbags 30 ltr black , autoclavable bmw discardbags 5 ltr yellow , autoclavable bmw discardbags 80 ltr yellow , water molecular grade 500 ml , self locking cable tie for bmw bags , 96 well cooler for pcr tube 20°c , micro pipette stand , sanitizer with ( >70% alcohol ) ( 500 ml packing ) , hypochlorite 5% to 10% , formalin , 96 well racks for 1.5 ml and 2 ml micro centrifuge tube , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , spin column for viral nucleic acid extraction , cryo gloves , viral rna extraction kit , rt pcr reagents kit for covid 19 testing , single channel micropipette 2 20μl , single channel micropipette5 50μl , single channel micropipette10 100 μl , single channel micropipette50 200 μl , single channel micropipette100 1000 μl , multi channel micropipette2 20 μl , multi channel micropipette30 300 μl , multi channel micropipette5 50 μl , falcon tube 50 ml , falcon tube 15 ml , pcr tube rack 96 well for 0.1 0.2 μl tube , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) ....