40186674 supply of ( 1 ) lincomycin 30mg. / ml injection 2ml amp. ( 2 ) moxifloxacin 4mg. / ml. inj. for i.v.use 100ml. bottle, lincomycin 30mg. / ml injection 2ml amp. , moxifloxacin 4mg. / ml. inj. for i.v.use 100ml. bottle ajmer divisional hospital , rajasthan 180.00 numbers => limited...
40077919 2 year rate contract for chemical, test kits, reagents, media and glassware for microbiology department , antibiotic sensitivity disc , amikacin ( 30?g ) , aztreonam ( 30?g ) , ampicillin ( 10 ?g ) , ampicillin + sulbactam ( 10 / 10?g ) , azithromycin ( 15?g ) , amoxicillin + clavulanic acid ( 20 / 10?g ) , bacitracin ( 10 ?nit ) , colistin ( 10mcg ) , cefoperazone ( 75?g ) , ceftazedime ( 30?g ) , cefepime ( 30?g ) , cefepime + tazobactan ( 30?g ) , cefadroxyl ( 30?g ) , carbenicillin ( 100?g ) , ciprofloxacin ( 10?g ) , co trimoxazole ( 25?g ) , cefoperazone + sµlbactam ( 75?g ) , cefotaxime / clavµlanic acid ( 30 / 10?g ) , ceftazidime / tazobactum ( 30 / 10?g ) , cephalothin ( 30?g ) , cefµroxime ( 30?g ) , cefotaxime ( 30?g ) , ceftriaxone ( 30?g ) , chloramphenicol ( 30?g ) , clindamycin ( 2?g ) , cefaclor ( 30?g ) , cefotetan ( 30?g ) , cefpodoxime ( 10?g ) , ceftizoxime ( 30?g ) , cefixime ( 5?g ) , cefoxitin ( 30?g ) , cefalexin ( 30?g ) , cefazolin ( 30?g ) , cefprozil ( 30?g ) , cefixime / clavµlanic acid ( 5 / 10?g ) , ceftrixone / sµlbactam ( 30 / 15?g ) , ceftriazone / tazobactam ( 30?g ) , doxycyline ( 10?g ) , dicloxacilline ( 1?g ) , erythromycin ( 15?g ) , fµrazolidone ( 50?g ) , feropenem 5?g , fosfomycin ( 50?g ) , gentamicin ( 10?g ) , high level gentamicin ( 120?g ) , gemifloxacin ( 5?g ) , imipenam ( 10?g ) , imipenam + cilastin ( 10 / 10?g ) , levofloxacin ( 5?g ) , lincomycin ( 15?g ) , linezolid ( 30?g ) , meropenam ( 10?g ) , mezlocilin ( 75?g ) , moxifloxacin ( 5?g ) , netilmicin ( 30?g ) , norfloxacin ( 10?g ) , nalidixic acid ( 30?g ) , nitrofurantoin ( 200?g ) , novobiocin ( 5?g ) , oxytetracyclin ( 30?g ) , oxacillin ( 5?g ) , ofloxacin ( 2?g ) , onpg , optochin ( 5?g ) , polymyxin b ( 10 ?nit ) , polymyxin b ( 300 ?nit ) , prµlifloxacin ( 5?g ) , piperacillin ( 100?g ) , piperacillin +tazobactam ( 100 / 10?g ) , pristinomycin ( 15?g ) , rifampicin ( 5?g ) , roxithromycin ( 30?g ) , sisomicin ( 10?g ) , ticarcillin ( 75?g ) , ticarcillin + clavµlanic acid ( 75 / 10?g ) , tetracycline ( 30?g ) , tecoplanin ( 30?g ) , tigecycline , tobramycin ( 10?g ) , vancomycin ( 30?g ) , anti fungal , ketoconazole , itraconazole , amphotericin b , nystatin , clotrimazole , miconazole , sugar , adonitol , arabinose , cellobiose , dextrose , dulcitol , fructose , galactose , inositol , inulin , lactose , maltose , mannitol , mannose , melibiose , raffinose , rhamnose , salicin , sorbitol , sucrose , trehalose , xylose , culture media , alkaline peptone water , agar powder bacteriological , air sampler agar strip ( a ) tsa agar for total count sd ( b ) sabourund dextrose agar sb , andrade peptone water , anaerobic indicator tablet , arginine dihydrolase broth , bacttec myco / f lytic , bacttec peds plus / f , bacttec plus aerobic / f+ , bacttec plus+ anaerobic , bacttec standard 10 aerobic / f , bacttec lytic / 10 aanerobic / f , bbl mgit tubes , beef extract agar , beef extract broth , bile esculin agar , bile salt agar , bird seed agar diphenyl supplement , blood agar base , brain heart infusion broth , cary blair medium , cetrimide agar , cled media , congo red agar , cooked meat medium r.c.medium , corn meal agar , decarboxylase base without amino acids , deoxycholate citrate agar , dermatophyte base without amino acid , emb agar levine , glucose broth , glucose phosphate broth , uti agar , hichrome improved salmonella agar , salmonella shigella agar , candida differental agar , lactose monohydrate bacteriological grade , loeffler serum medium base , lowenstein – jensen media base , lysine decarboxylase broth , lysine iron agar , mac conkey agar , muellar hinton agar , mannitol salt agar , mueller hinton agar , nnn medium , nutrient agar , nutrient broth , of basal medium , omthine decarboxylase broth , peptone bacteriological , peptone water , phenolphthalein phosphate agar , phenyl alanine agar , potassium tellurite agar , potato dextrose agar , rpmi 1640 agar w / mops & 2% glucose w / o sodium carbonet ( twin pack ) , sabouraud chloramphemcol agar , sabouraud dextrose agar , sda with cycloheximide chloramphenicol , selenite f broth twin pack ( medium 11 ) , simmons citrate agar , sulphide lndole motility ( sim ) medium , stuart transport medium , tcbs agar , tetra thionate broth , throglycollate medium fluid , throglycollate agar , trichophyton agar 1 , triple sugar iron agar , trypticase soy broth , tyi s 33 medium ( trypaticase yeast ) , urea agar base christensen , uti chrome agar , wilson & blair’s bbs agar medium 9 , xld agar , yeast carbon base agar , yeast nitrogen base agar , vitek 2 , gn test kit vtk2 , gp test kit vtk2 , yst test kit vtk2 , nh test kit , anc test kit , ast st03 test kit , ast p628 test kit , ast ys08 test kit , ast n235 urine card , kit densichek plus standards , ast n405 , ast n406 , ast n407 ( critical care card ) , unsensitized tubes 1x2000 , suspension solution 3x500 ml , antiseras , shigella dysenteriae polyvalent , vibrio cholera 01 antiserum polyvalent , subtype b ( ogawa ) , c ( inaba ) , 0:139 , salmonella o antiserum polyvalent ( a z & vi ) , o factor antiserum 0:2 ( a ) , 0:4 ( b ) , 0:7 ( c1 ) , 0:9 ( d ) , 0:13 ( g ) , vi , h factor antiserum h:a, h:b, h:i, h:g, h:m, h:z , polyvalent o antiserum for enterotoxigenic strains of e.coli , chemicals , absolute alcohol / ethanol , absolute alcohol / ethanol , acetamide , acetic acid glacial , acetone , acridine orange , aerogas pack , agarose , albert stain kit , ammomum oxalate ar , ammonia , andrade indicator , aniline , b. sterothermophilus spore strips , basic fuchsin , benzamide , buffer tablets 7.0 ph , buffer tablets 9.2 ph , calcofluor white m2r , carbamide , carbol fuchsin , catalase peroxidase test kit for mycobacterium , catalase test kit for mycobacterium , catechol , cedar wood oil , charcoal powder , chlorazole black e , chromotrope zr , conc. hydrochloric acid about 37% , conc. sulfuric acid about 98% , copper ii chlonde dihydrate , crystal violet , ctab , cycloheximide ( actidione ) , cynogen bromide , disinfectant solution surface cleaning , di sodium hydrogen phosphate anhydrous , distilled water , dntps ( datp, dgtp, dctp, dttp ) , dpx mount , edta mb grade , edta ar , eosin 2% , ethyl acetate ar , fast green , ferric chloride ar , field stain a , field stain b , formaldehyde solution min 37% , formalin tablets , formamide , gelatin , giemsa stain , glassware cleaning solution , glycerol ar , hand sanitizer , hydrogen peroxide 30% , iodine crystals ar , iso amyl alcohol , iso propanol , iso amyl alcohol , koh , kovac indole reagent , lactophenol cotton blue , leishman stain , light green sf , liquid paraffin heavy , liquid paraffin light , loeffler methylene blue , lugol iodine , lysol 5% , malachite green 1% w / v , mangnese sulphate ar , merecurous chloride ( mgcl2 ) , methyl alcohol , methyl red indicator , methylated spirit , methylene blue pure , n n dimethyl formamide , neutral red , niacin detection kit w / syringe , nigrosine , nitrate reduction test kit for mycobacterium , normal saline , nuclease eliminator for rnase / dnase , nuclease free water , nuclease free water , omeara reagent , p. nitrobenzonic acid , paraffin wax , ph paper 1 14 , phenol crystals ar , phenol red certified , phosphotungestic acid , polyvinyl alcohol a cold water soluble b hot water soluble , potassium acetate , potassium di sodium hydrogen phosphate anhydrous , potassium dichromate ar , potassium iodide ar , potassium nitrate , potassium permangnate ar , proteinase k , pyrazinamidase test kit for mycobacterium , pyrazinamide , rnase a , saffranine crystals , schaeffer & fulton’s spore stain kit , schaeffer fuchsin sulph reagent , sds , silverised h2 o2 ( h2, o2 11% w / v with silver nitrate sol.0.01% w / v compatible for fumigation with aerosol generator fogging machine , sodium acetate , sodium acetate anhydrous mb grade , sodium chloride mb grade , sodium chloride ar , sodium dihydrogen phosphate anhydrous , sodium hydroxide ar , sodium hypochlorite 4% , sodium hypochlorite 10% , sodium polyanetholesulphonate ( sps ) , sodium taurocholate , sulphanilic acid ar , sulphuric acid , taq polymerase , teepol , tetramethyl p phenylene diamine dihydrochloride ( oxidase reagent ) , thiomersal , thiophene carboxylic hydrazide test kit for mycobacterium , toluidine blue , tri potassium phenophthlin di sulphate , tris base , tris cl buffer , twine 80 , twine 20 , urea powder ar , xylene ar , zinc dust , zinc sulphate heptahydrate , ? nephthol ar , ? nephthylamine ar , plastic & consumables , aluminium foil , aspirator bottle with stopcock 10 l , aspirator bottle with stopcock 5 l , autoclavable bags non printed 8x12 , autoclavable bags non printed 12x24 , autoclavable bags non printed 24x30 , beaker 250 ml , beaker 500 ml , beaker 1000 ml , beaker 2000 ml , beaker 5000 ml , bmw disposal bags red 19x24 , bmw disposal bags red 29x39 , bmw disposal bags yellow 19x24 , bmw disposal bags yellow 29x39 , bmw container 15 20 l , biohazardous waste container 50 60 l , blotting sheet 150 gsm , cellophane tap 33 x 22 mm , centrifuge tubes 15 ml , centrifuge tubes 50 ml , cooler box 12 places 1.5 / 2 ml , cooler box 32 places 1.5 / 2 ml , cooler rack ( pcr plate ) , cotton role , cryo storage boxes 1.8 ml , cryo storage boxes 1.5 ml , cryo tape ( label ) , cryo tubes ( vials ) 5 ml , daimond pencil for glass slide , deep well plate 96 , deep well plate gf 96 well , deep well tube strip 8 well , deep well tube strip of 8 cap , disinfectant solution , disposable gloves 7.5 , elisa plate 96 wells round bottom , elisa plate 96 wells flat bottom , falcon tubes 50 ml , filter paper sheets , filter papers wattmen no 1 , glass marking pencil ( white , blue, red ) , gloves acid resistant , gloves acid resistant , gloves acid resistant , graduated cylinders 10 ml , graduated cylinders 100 ml , graduated cylinders 20 ml , graduated cylinders 250 ml , graduated cylinders 50 ml , graduated cylinders 500 ml , ice buckets , kling film , lab slippers , lab wash , laboratory apron / coat , laboratory fresh deodorising pearls , laboratory head cap , laboratory shoes cover , liquid hand wash soap , mask , mask n95 , match box , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tube stand , micro centrifuge tubes 0.5 ml , micro centrifuge tubes 1.5 ml , micro centrifuge tubes 2 ml , micro pipettes 10ul , micro pipettes 0.5 ul 10 ul , micro pipettes 10 ul 100 ul , micro pipettes 100 ul 1000 ul , micropipette filter tips reload 10 ul , micropipette filter tips reload 1200 ul , micropipette filter tips reload 300 ul , micropipette tips 5 ml , micropipette tips 0.1 10 ul , micropipette tips 1ul 200ul , micropipette tips 100ul 1000ul , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips low retention , micropipette tips low retention , micropipette tips low retention , multi channel pipette 100 to 1000 ul , multi channel pipette 10 to 100 ul , multi channel pipette 0.5 to 10 ul , nichrome loop wire d 4 ( hendal with 10 loop ) , nichrome straight wire ( hendal with 10 wire ) , nitrile powder free gloves small , nitrile powder free gloves medium , nitrile powder free gloves large , oak ridge centrifuge tubes , oak ridge centrifuge tubes , parafilm 4x125 , pcr cap ( 1x8 ) , pcr plate 96 well non skirted , pcr plate 96 well non skirted , pcr plate 96 well semi skirted , pcr plate 96 well semi skirted , pcr plate seal ( microseal b ) , pcr rack with cover , pcr tube strip 0.1 ml ( 1x8 ) , pcr tube strip 0.2 ml ( 1x8 ) , permanent marker pen , pipette 0.1 to 2.5 ul , pipette 0.5 to 10 ul , pipette 10 to 100 ul , pipette 100 to 1000 ul , pipette 2 to 20 ul , pipette 20 to 200 ul , pipette pump 25ml , plastic dropper , ppe kit ( with goggle, faceshield, shoecover and hood ) , reagent droping bottles , reagent pipettes bulb , reversible rack with cover , rnase / dnase free multichannel reagent reservoirs, disposable , rubber teats , sample tray 96 holes , screw cap tube , self adhesive autoclave tapes , self adhesive dry heat la 412 , slide staining stand , soap ( 125 gm per piece ) , spatula spoon 12 , spatula spoon 6 , specimen container , specimen container , stainless steel forceps pointed , stainless steel forcepsblunt 8 inch , sterile container , sterile disposable petri plates 120 mm. , sterile disposable petri plates 150 mm. , sterile disposable petri plates 90 mm. , sterile disposable swab stick with container , sterile scalpal blade , string sleeves ( tip combs ) gf , surf ( washing powder ) , teasing needles , test tube holder , test tube rack ( 12 holes ) for medium sized tubes , tharmocol box medium size 18x18x18 , thumbpress dropper , tissue lint free , tissue roll , uncoated micro titre plates ( 96 wells ) , utility tray 320x260x70 mm , utility tray 320x260x100 mm , utility tray 360x310x130 mm , utility tray 540x435x130 mm , vacutainer plain vial 4 ml , vtm with sterile swab stick , vtm storage rack 50 hole , wash bottle , wash bottle , waste bags black , waste bags black , waste container blue colour , waste container whitecolour , zip lock ( 4x6 inch ) , zip lock ( 10x14 inch ) , glassware , beaker with spout 100ml , beaker with spout 1000ml , beaker with spout 2000ml , beaker with spout 250ml , beaker with spout 500ml , borosilicate glass rods , candle jar , conical flask 100ml , conical flask 1000ml , conical flask 250ml , conical flask 500ml , durham tube , funnels , funnels , glass rods 10 mm x 60 cm , glass test tube ( 12mmx75mmx1.0mm ) , graduated cylinders 10ml , graduated cylinders 100ml , graduated cylinders 25ml , graduated cylinders 250 ml , graduated cylinders 50ml , graduated cylinders 500 ml , mac cartney bottle 100 ml , micro cover slip , micro glass slide , oil bottle with glass rods , petridish 90mm diameter , petridish 75mm diameter , petridish 150mm diameter , reagent bottle with dropper rubber teats , reagent bottle with dropper rubber teats , reagent bottles ( amber colour ) 100 ml , reagent bottles ( amber colour ) 1000 ml , reagent bottles ( amber colour ) 250 ml , reagent bottles ( amber colour ) 500 ml , reagent bottles ( clear ) 100 ml , reagent bottles ( clear ) 1000 ml , reagent bottles ( clear ) 250 ml , reagent bottles ( clear ) 500 ml , testube without rim 12x100x1.2 mm , testube without rim18x150x1.2 mm , thermometer mercury 20° to 50° , thermometer mercury 0° to 4° , thermometer mercury 30° to 250° , widal test tube round bottom , widal test tube conical bottom , serology & elisa , crp – latex kit ( latex agglutination method ) , ra – factor kit ( latex agglutination method ) , widal test tube method , widal test slide method , aslo titrekit ( latex agglutination method ) , hbs ag card test , rpr test for syphilis , hcv kit ( rapid test ) , hiv tri dot test , hiv rapid test , hiv comb test , vdrl rapid test ( dip stic ) , torch panel rapid test , elisa kit toxoplasma igg , elisa kit toxoplasma igm , elisa kit rubella igg , elisa kit rubella igm , elisa kit cytomegalovirus igm , elisa kit cytomegalovirus igg , elisa herpes simplex igg , elisa herpes simplex igm , elisa kit brucella igg , elisa kit brucella igm , elisa kit ttg igm , elisa dengue kit igg , elisa dengue kit igm , elisa dengue kit ns 1 , elisa kit chikungunya igm , elisa kit scrub typhus igm , elisa kithav igm , elisa kithev igm , elisa kithbsag , elisa kitrota virus antigen , tpha ( syphilis ) , elisa anti ccp , elisa antichlamydia , elisa hiv , japanese encephalitisigm , ana elisa , anti ds dna igg elisa , ebstein barr virus ( ebv ) igm elisa , hbc igm elisa , hbcab elisa , hbeab elisa , hbeagelisa , hcvigm elisa , measles igg elisa , measles igm elisa , leptospirosis igm elisa , leptospirosis igg elisa , chlamydia trachomatis igg elisa , chlamydia trachomatis igm elisa , hpv elisa igg , sars cov 2 antibody elisa , fungal marker galactomannan elisa , fungal marker 1 3 beta d glucan elisa , anti echinococcus igg elisa , anitbody detection cd4 cd3 facs count , scrub typhus igg elisa , elisa kit scrub typhus igm , elisa dengue igm , elisa dengue kit ns 1 , elisa kit chikungunya igm , sat for brucella , rbpt ( rose bengal plate test ) for brucella , leptospira rapid diagnostic test ( lateral flow assay ) , leptodipstick rapid diagnostic test for leprospira , dridot rapid diagnostic test for leptospira , lepto lat rapid diagnostic test for leptospira , molecular , neuro panel kit , respiratory pathogen panel kit [ 33 different pathogens ] , gastrointestinal panel , transplant panel kit , hiv viral load , hpv hr with 16 / 18 genotyping kit , dengue virus serotyping , cmv qt kit , rifampicin & isoniazid drug resistant mtb detection kit , mtbc one step nested kit ( mtbc and ntm ) , torch panel kit , viral rna extraction kit , dna extraction kit , ebv quantitative kit , hsv quantitative kit , panfungal dna pcr kit , xdr tb pcr kit , sepsis panel kit , fungal pcr for mucormycosis , swine flu h1n1, influenza a ( h3n2 ) & influenza b ( victoria, yamagata ) , covid seq assay 3 boxes , miseq reagent kit v3 ( 150 cycle ) 2 boxes , idt for illumina pcr indexes set 1 4 , illumina covidseq v4 primer pools , covidseq positive control ( cpc ) , miseq reagent micro kit v2 ( 300 cycles ) , miseq reagent kit v3 ( 600 cycle ) , miseq reagent kit v2 ( 500 cycles ) , miseq reagent kit v2 ( 300 cycles ) , miseq reagent nano kit v2 ( 300 cycles ) , idt ilmn pcr index set 1 ( 96 idx ) , idt ilmn pcr index set 2 ( 96 idx ) , idt ilmn pcr index set 3 ( 96 idx ) , idt ilmn pcr index set 4 ( 96 idx ) , viral surveillance panel, ruo 96 rxns , pan coronavirus panel, ruo 96 rxns , flex lysis reagent kit , s2 standard cartridge , s1 high resolution cartridge , s2 standard cartridge quantitive kit , s1 high resolution cartridge quantitive kit , quantifluor® dsdna system , others , anti hav compatible with liaison clia , hav igm compatible with liaison clia , hbsag compatible with liaison clia , anti hbs compatible with liaison clia , anti hbc compatible with liaison clia , hbcigm compatible with liaison clia , hbeag compatible with liaison clia , antihbe compatible with liaison clia , hcv ab compatible with liaison clia , anti hev igg compatible with liaison clia , anti hev igg compatible with liaison clia , chkamydia t igg compatible with liaison clia , chkamydia t igg compatible with liaison clia , c difficle toxin a &b comaptible with liaison clia , c. difficle toxin a& b comaptible with liaison clia , ds dna compatible with liaison clia , ana screen comaptible with liaison clia , anti hav compatible with cobas clia , hav igm compatible with cobas clia , hbsag compatible with cobas clia , anti hbs compatible with cobas clia , anti hbc compatible with cobas clia , hbcigm compatible with cobas clia , hbeag compatible with cobas clia , antihbe compatible with cobas clia , hcv ab compatible with cobas clia , anti hev igg compatible with cobas clia , anti hev igg compatible with cobas clia , chlamydia t igg compatible with cobas clia , chlamydia t igg compatible with cobas clia , c difficle toxin a &b comaptible with cobas clia , c. difficle toxin a& b comaptible with cobas clia , ds dna compatible with cobas clia , ana screen comaptible with cobas clia , anti hav compatible with backman coulter clia , hav igm compatible with backman coulter clia , hbsag compatible with backman coulter clia , anti hbs compatible with backman coulter clia , anti hbc compatible with backman coulter clia , hbcigm compatible with backman coulter clia , hbeag compatible with backman coulter clia , antihbe compatible with backman coulter clia , hcv ab compatible with backman coulter clia , anti hev igg compatible with backman coulter clia , anti hev igg compatible with backman coulter clia , chlamydia tigg compatible with backman coulter clia , chlamydia t igm compatible with backman coulter clia , c difficle toxin a &b compatible with backman coulter clia , c. difficle toxin a &b compatible with backman coulter clia , ds dna compatible with backman coulter clia , ana screen compatible with backman coulter clia , gentamicin 120ug , streptomycin 300ug , ceftazidim clavulanate 30 / 10ug , cefoxitin cloxacillin 30 / 200ug , enamel tray big size 24x18x2.5 inchs made up of high quality enamel, white porcelain coated , enamel tray small size 18x12x2.5 inchs made up of high quality enamel, white porcelain coated , single channel pipette , fixed volume 50ul and 100ulwith stand , multichannel pipette variable volume 100 1000 8 channels , multichannel pipette variable volume 100 1000 12 channels , chikungunya detection kit ( rt pcr with extraction kit ) , dengue detection kit , hcv genotyping kit , respiratory viral pathogen panel kit , tropical fever panel kit , amphotericin b ( ap ) ( 100 mcg ) , amphotericin b ( ap ) ( 20 mcg ) , amphotericin b ( ap ) ( 50 mcg ) , clotrimable ( cc ) ( 10 mcg ) , fluconazole ( it ) ( 10 mcg ) , itraconazole ( it ) ( 10 mcg ) , itra conazole ( it ) ( 30 mcg ) , ketoconazole ( kt ) ( 10 mcg ) , ketoconazole ( kt ) ( 30 mcg ) , ketoconazole ( kt ) ( 50 mcg ) , miconazole ( mic ) ( 30 mcg ) , miconazole ( mic ) ( 50 mcg ) , nystatin ( ns ) ( 100 mcg ) , nystatin ( ns ) ( 50 mcg ) , amphotericin b ( ap ) ( range in mg / ml .002 32 mcg / ml ) , anidulafungin ( and ) ( .002 32 mcg / ml ) , capsofungin ( cas ) ( .002 32 mcg / ml ) , clotrimazole ( cld ) ( .002 32 mcg / ml ) , fluconazole ( flc ) ( .016 256mcg / ml ) , flucytosine ( flu ) ( .002 32 mcg / ml ) , griseofungin ( gri ) ( .002 32mcg / ml ) , itraconazole ( ic ) ( .002 32mcg / ml ) , ketoconazole ( kc ) ( .002 32mcg / ml ) , micafungin { myc } ( .002 32mcg / ml ) , miconazole ( mic ) ( .002 32mcg / ml ) , natamycin ( nat ) ( .016 256mcg / ml ) , nystatin ( ns ) ( .002 32mcg / ml ) , posaconazole ( pos ) ( .002 32mcg / ml ) , terbinafine ( trb ) ( .002 32mcg / ml ) , voriconazole ( ic ) ( .002 32mcg / ml ) , isavuconazole ( isv ) ( .002 32mcg / ml ) , d.t.m agar base granulated , yeast extract powder , lysine ornithine arginine kit , bile salts , metal loops holder , bile esculin disc ( 50 discs / vl ) , oxidase disc, 1 vl ( 50 discs / vial ) , pyr broth , pyr reaganet , macconkey sorbitol agar ( sorbitol agar ) , indian ink , micro pipette rack stand, acrylic, 5 places , colistin sulphate , pfizer selective enterococcus agar , culture tube, with pp cap. cap. 10ml , vancomycin hydrochloride ( 500mg ) , bhi agar ( brain heart infusion agar ) , ceftazidime / avibactam 30 / 20mcg antibiotic disk...
39706269 supply of medicine and surgical tems in govt hospital chittorgarh. 2 abdominal drain kit all size 3 aldehydes solution for fogger machine ` 4 b p instrument non mercury 5 b.p. bulb 6 b.p. cuff ( rubber & cloth ) 7 b.t. set 8 baby dipper 9 black googles for catractract operation 10 blood doner set 11 blue dye 12 bp instrument ( mercury ) diamond / pagoda 13 bp instrument digital ( omron, bpl, infy ) 14 cannula fixator 15 cap.aerocort rotacap 16 cap. indomethacin 25 mg 17 cap. indomethacin 75 mg sr 18 cap. multivitamin + minerals + zinc 19 cap. pantoprazole 40 mg + domperidone 30 mg dsr 20 cap. progeston 200 mg 21 cap. progeston 300 mg 22 cap.rabeprazole 20mg+dom. 10mg 23 cap.vitamin e 400 mg 24 cervical color 25 clotrimazole 1 % talcum 26 cord clamp 27 corrugated drain sheet 28 cotton roll 29 cream. acyclovir 30 cream. beclomethasone0.025% + clotrimazole 1% + 31 cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% 32 cream. erythromycin + alov vera 33 cream. fusidic acid + beclometh. dipro. 34 cream. mometasone furoate 35 crepe bendage 10 inch 36 crepe bendage 6 inch 37 crepe bendage 8 inch 38 delivary kit 39 dispo needle24, 26 no. 40 dispo syringe 10 ml 41 dispo syringe 2 ml 42 dispo syringe 20 ml 43 dispo syringe 3 ml 44 dispo syringe 5 ml 45 dispo syringe 50 ml 46 dispo. e.t tube size 2.5 / 3.0 / 3.5 47 disposable ot gown 48 drop dizestive+ enzyme 30ml 49 drop hydroxyzime 15ml 50 drop. lactac enzyme 15 ml 51 drop. vitamin d 3 30ml 52 drop.chlolcicolchpherol30ml 53 drop.fungal distare+ papsine15 ml 54 drops. chloprheniramine + pcm + phenyleph 55 drops. dexamethasone + chloramphenicol 56 drops. dexamethasone + gentamycin 57 drops. dexamethasone + ofloxacin 58 drops. gentamicin eye / ear 59 drops. paracetamol 100 mg 60 drops. phenylephrine hyd + cpm. maleate 61 drops. salbutamol+ ambroxol 62 drops. sulphacetamide eye 63 drops. tobramycin 0.3 % eye 64 drops. xylometazoline 0.01% nasal 65 drops. xylometazoline 0.05% nasal 66 e.c.g. electrode ( chest lid. ) 67 eye drop prednisolo 10 ml 68 f.b.n.c. kit ( strelise iso certifyed ) 69 fast absorable poliglactin 910 70 fetal doppler 71 flatus tube 72 foleys cathater no. 12 73 foleys cathater no. 14 74 foleys cathater no. 16 75 foleys cathater no. 18 76 gallent blade 77 gel. cervi prime 78 gel. clindamycim 1% 79 gel. diclofenac 80 gel. lignocaine hydrochloride 81 gel. piroxicam 82 gloves all size6.5, 7, 7.5 83 h.i.v. kit ( strelise iso certifyed ) 84 homotropine 2% 85 hypersol eye drop 10 ml 86 i.v. canula18 , 20 , 22 87 i.v. canula 24, 26 ( romson, medicath, neocath, neocan ) 88 i.v. set 89 infant feeding tube all size 90 ing. amoxiclav 150mg ( amoxiclove ) 91 ing. ampoxin / megapain 1 gm 92 ing. ampoxin / megapain 500 mg 93 ing. ascorbicacid 500 ml 94 ing. buscogast 2ml 95 ing. calcium sandoz 10ml 96 ing. cefrin plus 375 mg 97 ing. cefrine plus 750 mg 98 ing. ceftzoxon+tezbactm 281.25mg 99 ing. ceftzoxon+tezbactm562.50 mg 100 ing. diclofanic 1ml ( aqua ) 101 ing. drotavarin 2ml 102 ing. hucog 5000 iu ( human cronic gonadotrotine 5000 iu 103 ing. liycomicen 2 ml 104 ing. mefentermin 10 ml 105 ing. netilmican 10mg 106 ing. netilmican 25mg 107 ing. netilmican 50mg 108 ing. superspas / nobalspas 2ml 109 ing. velthamate 2ml 110 ing. vit .bcomplex2 ml 111 ing.ampoxin / megapain 250 mg 112 ing.c amoxiclav 300mg ( amoxiclove ) 113 ing.cefepime500mg 114 ing.dilzem 1 ml 115 ing.liycomicen 1 ml 116 ing.meropenam 1 gram 117 ing.montaz250mg 118 ing.natuzampragestoen 100mg ( 2ml ) 119 ing.oxytocin 1 mg 120 inj. acuclav / agclav / mega cv 150 mg 121 inj. acuclav / agclav / mega cv 300 mg 122 inj. adrenaline 123 inj. alamin sn 124 inj. alpha beta arteether 2 ml 125 inj. amiadarone 126 inj. amikacin 100 mg 127 inj. amikacin 250 mg 128 inj. amikacin 500 mg 129 inj. amoxycillin + clavulanate pot. 1.2gm 130 inj. anti snake venum 131 inj. anti d 132 inj. artesunate 60 mgwith soda. bicarb 5 ml combo pack 133 inj. ascorbic acid 150 mg. 134 inj. atropine 135 inj. azithro mycin 500 ml 136 inj. betamethasone 4 mg 137 inj. botropase 138 inj. butrum 139 inj. butrum 140 inj. cefoparazone + sulbactum 1.5 gm 141 inj. ceftazidine 1 gm. 142 inj. ceftriaxone 1gm 143 inj. ceftriaxone 1gm. + sulbactum 500 mg 144 inj. ceftriaxone 1gm. + tazobactum 125 mg 145 inj. ceftriaxone 2 gm 146 inj. ceftriaxone 250mg 147 inj. ceftriaxone 250mg. + sulbactum 125 gm 148 inj. ceftriaxone 500mg 149 inj. ceftriaxone 500mg. + sulbactum 500 mg 150 inj. citicoline 4 ml 151 inj. clindmicin 2ml 152 inj. ct contrast 153 inj. ct contrast 154 inj. d 10% ( f.f.s. ) 155 inj. d 5% ( f.f.s. ) 156 inj. d.n.s. ( f.f.s. ) 157 inj. daizepam 10mg / 2ml 158 inj. dexamethasone 159 inj. diclofenac 160 inj. diclofenac+dicyclomine 161 inj. dobutamine 162 inj. dobutamine 250mg / 5 ml 163 inj. dopamine 40mg / ml 164 inj. dopanine 165 inj. enoxaparin sodium 60mg 166 inj. envas 167 inj. erythroptrin 4000 iu 168 inj. etophylline 84.7mg + theophylline 25.3mg / 2ml 169 inj. frusemide 10mg / 1ml 170 inj. gentamicin 80 mg40 mg / 1 ml 171 inj. glargine 172 inj. h.insulin 173 inj. heparin vial 174 inj. human mixtard30 / 70 175 inj. hyalase1500 iu 176 inj. hydrocoritison 200mg 177 inj. hydrocortisone 100mg 178 inj. hydroxyprogesterone 500 mg 179 inj. isolate p ( f.f.s. ) 180 inj. l orthinh l asprite 181 inj. levi taretam 182 inj. levo sulphride 183 inj. lignocaine 4% 184 inj. lignocaine hydrochloride 2% vial 185 inj. lincomycin 1ml 186 inj. lincomycin 2 ml 187 inj. linezolid 188 inj. livofloxacne 189 inj. mannitol 20% ( f.f.s. ) 190 inj. mecobalamin 500 mcg 191 inj. meg. sulf. ( 50% ) 192 inj. menadione sodium 1 ml 193 inj. meropannum 125 mg 194 inj. metoclopromide 195 inj. metronidazoleiv ( f.f.s. ) 196 inj. midazolan 197 inj. multivitamin 10 ml. vial 198 inj. multivitamin 2 ml. amp. 199 inj. n.s. ( f.f.s. ) 200 inj. naloxone hcl 201 inj. nandrolone decanoate 25mg 202 inj. nandrolone decanoate 50mg 203 inj. nitroglycerine 204 inj. nor adrenaline 205 inj. oflaxacin ( f.f.s. ) 206 inj. ondansetron2 mg / 1ml 207 inj. ondansetron2 mg / 1ml 208 inj. ornidazole ( f.f.s. ) 209 inj. ornidazole iv 210 inj. oxytocin 5 i.u. / 1 ml 211 inj. pantoprazole 40 mg 212 inj. paracetamol 150 mg / 1 ml 213 inj. pentazocine 30 mg / 1 ml amp. 214 inj. pheniramine maleate22.7 mg 215 inj. phenytion 216 inj. pilocarpinole 217 inj. piperacillin 4 gm + tazobactum 500 mg 218 inj. piperacillin / tazobactam 1.125 mg 219 inj. piracetam 220 inj. piroxicam 40 mg 221 inj. promethazine 25 mg / mlamp. 222 inj. propofol 223 inj. pyridoxime 224 inj. pyridoxime 225 inj. quinine dihydrochloride 226 inj. rabeprazole 20 mg 227 inj. rabies vaccine ( human ) ( anti ) 228 inj. ranitidine 229 inj. rl. ( f.f.s. ) 230 inj. soda. bi carb 25 ml 231 inj. stemetil 1ml / 2ml 232 inj. streptokinase 15 lakh iu 233 inj. terliprincine 234 inj. termin 10ml 235 inj. tetanus toxoid 250 iu 236 inj. tirofiban 5mg / 100ml 237 inj. tramadol hydrochloride 238 inj. tranexamic acid 500 mg 239 inj. triamcinolone 40 mg 240 inj. urokinase 5 lakh iu 241 inj. vitamin b complex 242 inj.carbaprost 250 mg. 243 inj.methargin 2ml 244 k 90, k 91 cathetor 245 knife blade 23, 24 no. 246 liquid o.r.s.packet 247 lotion. calamine 248 lotion. gamma benzene hexachloride 1 % 249 lotion. ketoconazole1 % 250 lotion. povidone iodine 251 lotion. povidone iodine 252 malecot cathetor no. 28, 30, 32 253 malt protin +multi vitamin 250 gram 254 micro i v set 255 micropore1 inch ( 3 mtr length ) 256 micropore1 inch ( 3 mtr length ) 257 micropore2 inch ( 3 mtr length ) 258 micropore3 inch ( 3 mtr length ) 259 mop ped 260 mt fog solution for fogger 261 mucas extractor 262 n 95 mask 263 n.s. 100 ml 264 n.s. 500 ml ( glass bottle ) 265 nasal prongs for cpap size 0 & 1 266 neb. mask sizeaudlt 267 nebuliser mask child 268 nebuliser mask machine 269 needle cutter ( 1000 ml capacity ) 270 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r55 ] 271 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r56 ] 272 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] 273 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] 274 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] 275 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) [ r20 ] 276 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] 277 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] 278 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] 279 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] 280 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) [ r45 ] 281 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) [ r46 ] 282 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) [ r34 ] 283 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] 284 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] 285 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] 286 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm [ r50 ] 287 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm [ r40 ] 288 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] 289 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] 290 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm [ r51 ] 291 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] 292 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] 293 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) [ r36 ] 294 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) [ r48 ] 295 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) [ r35 ] 296 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm [ r29 ] 297 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) [ r32 ] 298 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] 299 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] 300 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] 301 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] 302 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] 303 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) [ r23 ] 304 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] 305 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] 306 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] 307 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] 308 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] 309 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) [ r25 ] 310 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) [ r53 ] 311 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) [ r54 ] 312 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 [ r30 ] 313 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm [ r39 ] 314 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] 315 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] 316 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm [ r49 ] 317 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) [ r41 ] 318 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) [ r31 ] 319 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) [ r47 ] 320 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) [ r26 ] 321 o.t. sheet 322 o2 nasal canulla , neonatal , paed, adult 323 oil vitamin ad 60ml 324 oint. clobetasol 0.05 % + gentamicin 0.1 % 325 oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% 326 oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% 327 oint. heparin / thrombotas 328 oint. miconazole 329 oint. povidoneiodine10 gm 330 oint. silver sulphadiazine 331 oint. silver sulphadiazine + chlorhexidin 332 orthopaedic cotton roll 10 cm x 300 cm 333 oxygen delivery tube with mask 334 ped. blood doner set 335 pedia set 336 pilocarpinole eye drop 10 ml 337 plaster of paris 338 powderdexolac 500 gram 339 powder arginine 5 gram 340 ppe kit iso certified 341 proctoclys enema 342 prolin no. 1 length 70 cms 343 protein powder 344 prulin 2 / 0 ( suture ) 345 pv rubbergloves all size 346 r.l. 500 ml ( glass bottle ) 347 res.budecort ( budesunide ) 348 res.duolin ( levosalbutamol + ipratropium ) 349 resp. duolin 350 resp. levosalbutamol 351 romadrain under water seal bag 352 round band aid 353 ryles tube n0. 12, 14, 16, 18 354 sachatvitamin d3 355 sachet agysee d 356 sachet powder prebioatic+ lactic acid 1 gram 357 sanitary pad 358 sanitizer 100 ml70 % 359 sanitizer 500 ml70 % 360 sanitizer alcohal base 70 % 361 shampoo. ketoconazole 2 % 362 spinal needle 23 no. ( pricon ) 363 suction canula size 6 / 8 / 10 / 12 364 suction tube for suction machine 365 sup. azithromycin200mg / 5ml 366 sup. m.v.+minerals 100ml 367 sup. potasium cloride 100ml 368 swine flue vaccine .5 ml 369 swine flue vaccine 5 ml 370 syp.pre probiotic 60ml 371 syp.sod.picosulphate 100 ml 372 syp. albendazole + ivermectin 373 syp. amoxycillin + clavulanate 374 syp. antacid ( mag.hy. + allum.hy. ) 375 syp. arthmether+lumither 30 ml 376 syp. bpricilne 100ml 377 syp. cepodoxim+clavonate 30 ml 378 syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml 379 syp. cotrimoxazole 380 syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg 381 syp. cyprohepatidine + tricholin citrate 382 syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg 383 syp. dextromethorphan 10 mg + phenyl hcl2 mg 384 syp. disodium hydrogen citrate 385 syp. ferrous salt + folic acid 386 syp. haematinic with vitamins 387 syp. hydroxyzime 100 ml 388 syp. ibuprofen 100mg + pcm 125 mg + / 5ml 389 syp. lactulose 10gm / 15 ml 390 syp. levocetrizine 391 syp. levocetrizine + montelokast 60ml 392 syp. liq.paraffin + milk of magnesia 393 syp. livertonice 200ml 394 syp. longifene 200ml / buclizine 200ml 395 syp. lycopin 200ml 396 syp. magaldrate 480 mg + simeth. 20 mg 397 syp. mefanic acid 60 ml 398 syp. mefanic+ peracitamol 60ml 399 syp. moxclav / mega cv 30 ml 400 syp. moxclav / mega cv 60 ml 401 syp. multivitamin+ multiminaral + amino acid200ml 402 syp. multivitamin+ multiminaral + lycopin 200ml 403 syp. multvitamin+antioxidant 200ml 404 syp. ofloxacin + ornidazole 405 syp. ofloxacin oral 406 syp. paracetamol 125 mg 407 syp. paracetamol 250 mg 408 syp. pcm + cpm + sod. cit. + pph 409 syp. pcm + promehazine 410 syp. polybion 100ml 411 syp. racecortodil+ofloxacin 60ml 412 syp. roxithromycin 50 mg / 5 ml 413 syp. salbutamol 2 mg + ambroxol 30 mg 414 syp. solvin cold / reconite / sinerest 60 ml 415 syp. sucralfate 1 g / 10 ml 416 syp. terbutaline sul. + bromh. + guaip. 417 syp. zinc 60ml 418 syp.cefuroxime 60ml 419 syp.digsestiv enzyme 200ml 420 tab.alprazolam0.25mg 421 tab.arither and lumethar ( 400mg ) 422 tab.cabergoline 423 tab.citicolin 500 mg 424 tab.l orthinh l asprite 425 tab.linezolid 600 426 tab.linezolid 600mg 427 tab.n.t.g. sr 2.6 mg 428 tab.nicoran 5 mg 429 tab.phenytoin 100 mg 430 tab.sodium valporal 500 mg 431 tab.temsulofin0.4mg 432 tab.thyroxine 100 mg 433 tab.ursodil 300 mg 434 tab. aceclo + pcm + serra 435 tab. acelofenac 100mg 436 tab. acelofenac 100mg + serratiopeptidase 10mg 437 tab. acelofenac 100mg + thiocolchicoside 250 mg 438 tab. acyclovir 400 mg 439 tab. albendazole 400mg 440 tab. alprazolam0.25mg + propranolol 20mg 441 tab. alprazolam0.5mg 442 tab. amlodipine 2.5mg 443 tab. amlodipine 5mg + atenolol 50mg 444 tab. amlodipine besilate5mg 445 tab. amoxy 250mg + clav. acid 125mg 446 tab. amoxy 500mg + clavulanate 125 mg 447 tab. amoxyciline +lactiacid 625mg 448 tab. atenolol 25mg 449 tab. atenolol 50mg 450 tab. atorvastatin80 mg 451 tab. atorvastatin 10mg 452 tab. atorvastatin 40mg 453 tab. azithromycin 100mg dt 454 tab. azithromycin 250mg 455 tab. azithromycin 500mg 456 tab. betahistadin 16 mg 457 tab. calcium 500mg + vit. d3 458 tab. carbamazepine 100mg 459 tab. carbamazepine 200mg 460 tab. cefixime 100mg disp. 461 tab. cefixime 200mg disp. 462 tab. cefixime 200mg+ clavalunicacid 463 tab. cefpodoxime proxetil 200 mg 464 tab. cefuroxime axetil 250mg 465 tab. cefuroxime axetil 500mg 466 tab. cetrizine 10 mg ( oval ) 467 tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg 468 tab. cinnarizine 20 mg + domperidone 15 mg 469 tab. cinnarizine 25 mg 470 tab. clotrimazole vaginal 500mg 471 tab. diclo + pcm +serra 472 tab. diclofenic+chymotripcin 473 tab. dicyclomine 10mg + mefenomic acid 250mg 474 tab. dicyclomine hci 10mg + pcm 500mg 475 tab. dothiepin 75 mg. 476 tab. ethamsylate 500mg 477 tab. ethamsylate inj. 2ml 478 tab. etophylline + theophylline 479 tab. ferobact 200 mg 480 tab. ferobact 300 mg 481 tab. ferrous sult + folic acid 482 tab. fexofenadine 120 mg 483 tab. fluconazole 150 mg 484 tab. fluconazole 50 mg 485 tab. fluoxetine 20 mg 486 tab. folic acid 5 mg 487 tab. frusemide 40 mg 488 tab. glimepiride 1 mg 489 tab. glimepiride 1 mg + metformin 500 mg 490 tab. glimepiride 2 mg 491 tab. glimepiride 2 mg + metformin 500 mg 492 tab. ibuprofen 100mg + pcm 125 mg 493 tab. ibuprofen 400mg + pcm 500mg 494 tab. isosorbide mononitrate 20 mg 495 tab. itraconzole 100 496 tab. itraconzole 200 497 tab. levocetrizine 5mg 498 tab. levofloxacin500mg 499 tab. lisinopril 5 mg 500 tab. lithium carbonate 300 mg 501 tab. loperamide 2 mg 502 tab. lorazepam 2 mg 503 tab. losartan 25 mg 504 tab. losartan patassium 50 mg 505 tab. losartan pota. 50 mg + amlodipine 5mg 506 tab. losartan potassium. 50 mg + hydroch.12.5mg 507 tab. lycopin+multivitamin 508 tab. mecobalamin 1500 mcg 509 tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg 510 tab. mefloc 100mg 511 tab. metformin 500 mg 512 tab. metoclopromide 10 mg 513 tab. napra d ( napraxone + domperidone ) 514 tab. nimesulide 100 mg 515 tab. nimesulide 100mg + serratiopeptidase 10mg 516 tab. normaxin 10 mg 517 tab. nynes 518 tab. ofloxacin + ornidazole 500 mg 519 tab. ofloxacin 200mg 520 tab. olanzapine 5 mg 521 tab. ondansetron 4mg 522 tab. ondansetron 8mg 523 tab. ornidazole 500mg 524 tab. pantoprazole 20 mg 525 tab. pantoprazole 40 mg 526 tab. pantoprazole 40 mg + domperidone 10 mg 527 tab. paracetamol 500 mg 528 tab. pheniramine maleate 25 mg 529 tab. phenobarbitone 30 mg 530 tab. phenobarbitone 60 mg 531 tab. pioglitazone 15 mg 532 tab. pioglitazone 30 mg 533 tab. piracetam 800 mg 534 tab. piroxicam disp. 20 mg 535 tab. prazosin 1 mg 536 tab. prazosin 2.5 mg 537 tab. prazosin 5 mg 538 tab. prednisolone 10 mg 539 tab. primaquine phosphate 15 mg 540 tab. primaquine phosphate 7.5 mg 541 tab. prochlorperazine 5 mg 542 tab. promethazine 25 mg 543 tab. quinine sulphate 300 mg 544 tab. rabeprazole 20 mg 545 tab. rabeprazole 20 mg + domperidone 10 mg 546 tab. rabiprazole + itopride 547 tab. ramipril 10 mg 548 tab. ramipril 2.5 mg 549 tab. ramipril 5 mg 550 tab. ranitidine 150 mg 551 tab. ranitidine 150 mg + domperidone 10 mg 552 tab. risperidone 2 mg 553 tab. sertaline 25 mg 554 tab. sertaline 50 mg 555 tab. sildenafil 50 mg 556 tab. spiromicyn500mg 557 tab. superspas / nobalspas 558 tab. tramadol hyd. 20 mg + pcm. 500 mg 559 tab. tranexamic+etamcylate 560 tab. tranexamic+mefanic acid 561 tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg 562 tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg 563 tab. trypsin chymotrypsin 564 tab. ursodeoxycholic 150 mg 565 tab. ursodeoxycholic 300 mg 566 tab. vitamin c 500 +zinc 50 mg 567 tab. vitamin c 500 mg ( ascorbic acid ) 568 tab. zinc 20 mg 569 tab. zinc 50 mg 570 tab. zolpidem 10 mg 571 tab. / cap. multivitamin+ multiminaral + lycopin 572 tab.cefpodoxime 200mg+ clavalunicacid 573 tab.clarithromycin 250 mg 574 tab.clonazepam 0.5mg 575 tab.clopidogrel 75 mg 576 tab.clopidogrel 75 mg+ aspirin 75mg 577 tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) 578 tab.diazepam 5 mg 579 tab.diclo + trypsin +chymotrypsin 580 tab.diclofenac 50mg + serratiopeptidase 10mg 581 tab.etori coxib 120mg+ gabapentin300mg 582 tab.etori coxib 90mg+ gabapentin100mg 583 tab.iver mactin 12 mg 584 tab.iver mactin 6 mg 585 tab.pregabaline75 mg +methylcobaline 1500mg 586 tab.rabiprazole+domperidon d 587 tab.zinc 10mg 588 triple layer mask with nose pin 589 tropicayl plus eye drop 10 ml 590 urine collection beg 591 venoline set200 cm 592 vicryl 1 no.1 / 2 cir rb 30 / 40mm needle 70 cm, 593 vypro mesh 594 weight machine ( digital ) 595 weight machine ( manual ) 596 weight machine for paediatric / neonatal ( digital ) ...
39638085 supply of various chemicals reagents consumable items for department of microbiology supply of various chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , disposable test tube 20ml , antids dna elisa kit , antinuclear antibody ( ana ) elisa kit , dengue igm elisa kit , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , citrat agar , phenyl alanin agar , hiv tri dot testcard hiv 1 / 2ab , hiv ( rapid ) test card whole blood finger prick hiv 1 / 2ab 3rd generation , sims agar , hcv rapid card , test tube dispo. 5ml , test tube dispo. 10ml , salmonella typhianti toxin , polyvalent o , polyvalent h , salmonella ta , salmonella tb , salmonella td , vibrio choleraanti toxin , ogama , inaba , hikojima , thrmacol box...
39396928 rate contract for chemicals, test kits, reagents, media and glassware for microbiology department , antibiotic sensitivity disc , amikacin ( 30?g ) , aztreonam ( 30?g ) , ampicillin ( 10 ?g ) , ampicillin + sulbactam ( 10 / 10?g ) , azithromycin ( 15?g ) , amoxicillin + clavulanic acid ( 20 / 10?g ) , bacitracin ( 10 ?nit ) , colistin ( 10mcg ) , cefoperazone ( 75?g ) , ceftazedime ( 30?g ) , cefepime ( 30?g ) , cefepime + tazobactan ( 30?g ) , cefadroxyl ( 30?g ) , carbenicillin ( 100?g ) , ciprofloxacin ( 10?g ) , co trimoxazole ( 25?g ) , cefoperazone + sµlbactam ( 75?g ) , cefotaxime / clavµlanic acid ( 30 / 10?g ) , ceftazidime / tazobactum ( 30 / 10?g ) , cephalothin ( 30?g ) , cefµroxime ( 30?g ) , cefotaxime ( 30?g ) , ceftriaxone ( 30?g ) , chloramphenicol ( 30?g ) , clindamycin ( 2?g ) , cefaclor ( 30?g ) , cefotetan ( 30?g ) , cefpodoxime ( 10?g ) , ceftizoxime ( 30?g ) , cefixime ( 5?g ) , cefoxitin ( 30?g ) , cefalexin ( 30?g ) , cefazolin ( 30?g ) , cefprozil ( 30?g ) , cefixime / clavµlanic acid ( 5 / 10?g ) , ceftrixone / sµlbactam ( 30 / 15?g ) , ceftriazone / tazobactam ( 30?g ) , doxycyline ( 10?g ) , dicloxacilline ( 1?g ) , erythromycin ( 15?g ) , fµrazolidone ( 50?g ) , feropenem 5?g , fosfomycin ( 50?g ) , gentamicin ( 10?g ) , high level gentamicin ( 120?g ) , gemifloxacin ( 5?g ) , imipenam ( 10?g ) , imipenam + cilastin ( 10 / 10?g ) , levofloxacin ( 5?g ) , lincomycin ( 15?g ) , linezolid ( 30?g ) , meropenam ( 10?g ) , mezlocilin ( 75?g ) , moxifloxacin ( 5?g ) , netilmicin ( 30?g ) , norfloxacin ( 10?g ) , nalidixic acid ( 30?g ) , nitrofurantoin ( 200?g ) , novobiocin ( 5?g ) , oxytetracyclin ( 30?g ) , oxacillin ( 5?g ) , ofloxacin ( 2?g ) , onpg , optochin ( 5?g ) , polymyxin b ( 10 ?nit ) , polymyxin b ( 300 ?nit ) , prµlifloxacin ( 5?g ) , piperacillin ( 100?g ) , piperacillin +tazobactam ( 100 / 10?g ) , pristinomycin ( 15?g ) , rifampicin ( 5?g ) , roxithromycin ( 30?g ) , sisomicin ( 10?g ) , ticarcillin ( 75?g ) , ticarcillin + clavµlanic acid ( 75 / 10?g ) , tetracycline ( 30?g ) , tecoplanin ( 30?g ) , tigecycline , tobramycin ( 10?g ) , vancomycin ( 30?g ) , anti fungal , ketoconazole , itraconazole , amphotericin b , nystatin , clotrimazole , miconazole , sugar , adonitol , arabinose , cellobiose , dextrose , dulcitol , fructose , galactose , inositol , inulin , lactose , maltose , mannitol , mannose , melibiose , raffinose , rhamnose , salicin , sorbitol , sucrose , trehalose , xylose , culture media , alkaline peptone water , agar powder bacteriological , air sampler agar strip ( a ) tsa agar for total count sd ( b ) sabourund dextrose agar sb , andrade peptone water , anaerobic indicator tablet , arginine dihydrolase broth , bacttec myco / f lytic , bacttec peds plus / f , bacttec plus aerobic / f+ , bacttec plus+ anaerobic , bacttec standard 10 aerobic / f , bacttec lytic / 10 aanerobic / f , bbl mgit tubes , beef extract agar , beef extract broth , bile esculin agar , bile salt agar , bird seed agar diphenyl supplement , blood agar base , brain heart infusion broth , cary blair medium , cetrimide agar , cled media , congo red agar , cooked meat medium r.c.medium , corn meal agar , decarboxylase base without amino acids , deoxycholate citrate agar , dermatophyte base without amino acid , emb agar levine , glucose broth , glucose phosphate broth , uti agar , hichrome improved salmonella agar , salmonella shigella agar , candida differental agar , lactose monohydrate bacteriological grade , loeffler serum medium base , lowenstein – jensen media base , lysine decarboxylase broth , lysine iron agar , mac conkey agar , muellar hinton agar , mannitol salt agar , mueller hinton agar , nnn medium , nutrient agar , nutrient broth , of basal medium , omthine decarboxylase broth , peptone bacteriological , peptone water , phenolphthalein phosphate agar , phenyl alanine agar , potassium tellurite agar , potato dextrose agar , rpmi 1640 agar w / mops & 2% glucose w / o sodium carbonet ( twin pack ) , sabouraud chloramphemcol agar , sabouraud dextrose agar , sda with cycloheximide chloramphenicol , selenite f broth twin pack ( medium 11 ) , simmons citrate agar , sulphide lndole motility ( sim ) medium , stuart transport medium , tcbs agar , tetra thionate broth , throglycollate medium fluid , throglycollate agar , trichophyton agar 1 , triple sugar iron agar , trypticase soy broth , tyi s 33 medium ( trypaticase yeast ) , urea agar base christensen , uti chrome agar , wilson & blair’s bbs agar medium 9 , xld agar , yeast carbon base agar , yeast nitrogen base agar , vitek 2 , gn test kit vtk2 , gp test kit vtk2 , yst test kit vtk2 , nh test kit , anc test kit , ast st03 test kit , ast p628 test kit , ast ys08 test kit , ast n235 urine card , kit densichek plus standards , ast n405 , ast n406 , ast n407 ( critical care card ) , unsensitized tubes 1x2000 , suspension solution 3x500 ml , antiseras , shigella dysenteriae polyvalent , vibrio cholera 01 antiserum polyvalent , subtype b ( ogawa ) , c ( inaba ) , 0:139 , salmonella o antiserum polyvalent ( a z & vi ) , o factor antiserum 0:2 ( a ) , 0:4 ( b ) , 0:7 ( c1 ) , 0:9 ( d ) , 0:13 ( g ) , vi , h factor antiserum h:a, h:b, h:i, h:g, h:m, h:z , polyvalent o antiserum for enterotoxigenic strains of e.coli , chemicals , absolute alcohol / ethanol , absolute alcohol / ethanol , acetamide , acetic acid glacial , acetone , acridine orange , aerogas pack , agarose , albert stain kit , ammomum oxalate ar , ammonia , andrade indicator , aniline , b. sterothermophilus spore strips , basic fuchsin , benzamide , buffer tablets 7.0 ph , buffer tablets 9.2 ph , calcofluor white m2r , carbamide , carbol fuchsin , catalase peroxidase test kit for mycobacterium , catalase test kit for mycobacterium , catechol , cedar wood oil , charcoal powder , chlorazole black e , chromotrope zr , conc. hydrochloric acid about 37% , conc. sulfuric acid about 98% , copper ii chlonde dihydrate , crystal violet , ctab , cycloheximide ( actidione ) , cynogen bromide , disinfectant solution surface cleaning , di sodium hydrogen phosphate anhydrous , distilled water , dntps ( datp, dgtp, dctp, dttp ) , dpx mount , edta mb grade , edta ar , eosin 2% , ethyl acetate ar , fast green , ferric chloride ar , field stain a , field stain b , formaldehyde solution min 37% , formalin tablets , formamide , gelatin , giemsa stain , glassware cleaning solution , glycerol ar , hand sanitizer , hydrogen peroxide 30% , iodine crystals ar , iso amyl alcohol , iso propanol , iso amyl alcohol , koh , kovac indole reagent , lactophenol cotton blue , leishman stain , light green sf , liquid paraffin heavy , liquid paraffin light , loeffler methylene blue , lugol iodine , lysol 5% , malachite green 1% w / v , mangnese sulphate ar , merecurous chloride ( mgcl2 ) , methyl alcohol , methyl red indicator , methylated spirit , methylene blue pure , n n dimethyl formamide , neutral red , niacin detection kit w / syringe , nigrosine , nitrate reduction test kit for mycobacterium , normal saline , nuclease eliminator for rnase / dnase , nuclease free water , nuclease free water , omeara reagent , p. nitrobenzonic acid , paraffin wax , ph paper 1 14 , phenol crystals ar , phenol red certified , phosphotungestic acid , polyvinyl alcohol a cold water soluble b hot water soluble , potassium acetate , potassium di sodium hydrogen phosphate anhydrous , potassium dichromate ar , potassium iodide ar , potassium nitrate , potassium permangnate ar , proteinase k , pyrazinamidase test kit for mycobacterium , pyrazinamide , rnase a , saffranine crystals , schaeffer & fulton’s spore stain kit , schaeffer fuchsin sulph reagent , sds , silverised h2 o2 ( h2, o2 11% w / v with silver nitrate sol.0.01% w / v compatible for fumigation with aerosol generator fogging machine , sodium acetate , sodium acetate anhydrous mb grade , sodium chloride mb grade , sodium chloride ar , sodium dihydrogen phosphate anhydrous , sodium hydroxide ar , sodium hypochlorite 4% , sodium hypochlorite 10% , sodium polyanetholesulphonate ( sps ) , sodium taurocholate , sulphanilic acid ar , sulphuric acid , taq polymerase , teepol , tetramethyl p phenylene diamine dihydrochloride ( oxidase reagent ) , thiomersal , thiophene carboxylic hydrazide test kit for mycobacterium , toluidine blue , tri potassium phenophthlin di sulphate , tris base , tris cl buffer , twine 80 , twine 20 , urea powder ar , xylene ar , zinc dust , zinc sulphate heptahydrate , ? nephthol ar , ? nephthylamine ar , plastic & consumables , aluminium foil , aspirator bottle with stopcock , aspirator bottle with stopcock , autoclavable bags non printed , autoclavable bags non printed , autoclavable bags non printed , beaker , beaker , beaker , beaker , beaker , bmw disposal bags red , bmw disposal bags red , bmw disposal bags yellow , bmw disposal bags yellow , bmw container , biohazardous waste container , blotting sheet , cellophane tap 33 x 22 mm , centrifuge tubes , centrifuge tubes , cooler box 12 places 1.5 / 2 ml , cooler box 32 places 1.5 / 2 ml , cooler rack ( pcr plate ) , cotton role , cryo storage boxes , cryo storage boxes , cryo tape ( label ) , cryo tubes ( vials ) , daimond pencil for glass slide , deep well plate 96 , deep well plate gf 96 well , deep well tube strip 8 well , deep well tube strip of 8 cap , disinfectant solution , disposable gloves 7.5 , elisa plate 96 wells , elisa plate 96 wells , falcon tubes 50 ml , filter paper sheets , filter papers wattmen no 1 , glass marking pencil ( white , blue, red ) , gloves acid resistant , gloves acid resistant , gloves acid resistant , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , ice buckets , kling film , lab slippers , lab wash , laboratory apron / coat , laboratory fresh deodorising pearls , laboratory head cap , laboratory shoes cover , liquid hand wash soap , mask , mask n95 , match box , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tube stand , micro centrifuge tubes 0.5 ml , micro centrifuge tubes 1.5 ml , micro centrifuge tubes 2 ml , micro pipettes , micro pipettes , micro pipettes , micro pipettes , micropipette filter tips reload , micropipette filter tips reload , micropipette filter tips reload , micropipette tips , micropipette tips , micropipette tips , micropipette tips , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips low retention , micropipette tips low retention , micropipette tips low retention , multi channel pipette 100 to 1000 ul , multi channel pipette 10 to 100 ul , multi channel pipette 0.5 to 10 ul , nichrome loop wire d 4 ( hendal with 10 loop ) , nichrome straight wire ( hendal with 10 wire ) , nitrile powder free gloves , nitrile powder free gloves , nitrile powder free gloves , oak ridge centrifuge tubes , oak ridge centrifuge tubes , parafilm , pcr cap ( 1x8 ) , pcr plate 96 well non skirted , pcr plate 96 well non skirted , pcr plate 96 well semi skirted , pcr plate 96 well semi skirted , pcr plate seal ( microseal b ) , pcr rack with cover , pcr tube strip 0.1 ml ( 1x8 ) , pcr tube strip 0.2 ml ( 1x8 ) , permanent marker pen , pipette 0.1 to 2.5 ul , pipette 0.5 to 10 ul , pipette 10 to 100 ul , pipette 100 to 1000 ul , pipette 2 to 20 ul , pipette 20 to 200 ul , pipette pump , plastic dropper , ppe kit ( with goggle, faceshield, shoecover and hood ) , reagent droping bottles , reagent pipettes bulb , reversible rack with cover , rnase / dnase free multichannel reagent reservoirs, disposable , rubber teats , sample tray 96 holes , screw cap tube , self adhesive autoclave tapes , self adhesive dry heat la 412 , slide staining stand , soap ( 125 gm per piece ) , spatula spoon 12 , spatula spoon 6 , specimen container , specimen container , stainless steel forceps pointed , stainless steel forcepsblunt 8 inch , sterile container , sterile disposable petri plates 120 mm. , sterile disposable petri plates 150 mm. , sterile disposable petri plates 90 mm. , sterile disposable swab stick with container , sterile scalpal blade , string sleeves ( tip combs ) gf , surf ( washing powder ) , teasing needles , test tube holder , test tube rack ( 12 holes ) for medium sized tubes , tharmocol box medium size 18x18x18 , thumbpress dropper , tissue lint free , tissue roll , uncoated micro titre plates ( 96 wells ) , utility tray , utility tray , utility tray , utility tray , vacutainer plain vial 4 ml , vtm with sterile swab stick , vtm storage rack 50 hole , wash bottle , wash bottle , waste bags black , waste bags black , waste container blue colour , waste container whitecolour , zip lock ( 4x6 inch ) , zip lock ( 10x14 inch ) , glassware , beaker with spout , beaker with spout , beaker with spout , beaker with spout , beaker with spout , borosilicate glass rods , candle jar , conical flask , conical flask , conical flask , conical flask , durham tube , funnels , funnels , glass rods 10 mm x 60 cm , glass test tube ( 12mmx75mmx1.0mm ) , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , mac cartney bottle 100 ml , micro cover slip , micro glass slide , oil bottle with glass rods , petridish 90mm diameter , petridish 75mm diameter , petridish 150mm diameter , reagent bottle with dropper rubber teats , reagent bottle with dropper rubber teats , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( clear ) , reagent bottles ( clear ) , reagent bottles ( clear ) , reagent bottles ( clear ) , testube without rim , testube without rim , thermometer mercury 20° to 50° , thermometer mercury 0° to 4° , thermometer mercury 30° to 250° , widal test tube round bottom , widal test tube conical bottom , serology & elisa , crp – latex kit ( latex agglutination method ) , ra – factor kit ( latex agglutination method ) , widal test tube method , widal test slide method , aslo titrekit ( latex agglutination method ) , hbs ag card test , rpr test for syphilis , hcv kit ( rapid test ) , hiv tri dot test , hiv rapid test , hiv comb test , vdrl rapid test ( dip stic ) , torch panel rapid test , elisa kit toxoplasma igg , elisa kit toxoplasma igm , elisa kit rubella igg , elisa kit rubella igm , elisa kit cytomegalovirus igm , elisa kit cytomegalovirus igg , elisa herpes simplex igg , elisa herpes simplex igm , elisa kit brucella igg , elisa kit brucella igm , elisa kit ttg igm , elisa dengue kit igg , elisa dengue kit igm , elisa dengue kit ns 1 , elisa kit chikungunya igm , elisa kit scrub typhus igm , elisa kithav igm , elisa kithev igm , elisa kithbsag , elisa kitrota virus antigen , tpha ( syphilis ) , elisa anti ccp , elisa antichlamydia , elisa hiv , japanese encephalitisigm , ana elisa , anti ds dna igg elisa , ebstein barr virus ( ebv ) igm elisa , hbc igm elisa , hbcab elisa , hbeab elisa , hbeagelisa , hcvigm elisa , measles igg elisa , measles igm elisa , leptospirosis igm elisa , leptospirosis igg elisa , chlamydia trachomatis igg elisa , chlamydia trachomatis igm elisa , hpv elisa igg , sars cov 2 antibody elisa , fungal marker galactomannan elisa , fungal marker 1 3 beta d glucan elisa , anti echinococcus igg elisa , anitbody detection cd4 cd3 facs count , serum pct , molecular , flu panel with rsv detection kit , neuro panel kit , uti id panel , respiratory pathogen panel kit [ 33 different pathogens ] , gastrointestinal panel , transplant panel kit , hiv viral load , hpv hr with 16 / 18 genotyping kit , dengue virus serotyping , cmv qt kit , rifampicin & isoniazid drug resistant mtb detection kit , mtbc one step nested kit ( mtbc and ntm ) , torch panel kit , viral rna extraction kit complete , viral rna extraction kit , dna extraction kit , covid seq assay 3 boxes , miseq reagent kit v3 ( 150 cycle ) 2 boxes , idt for illumina pcr indexes set 1 4 , illumina covidseq v4 primer pools , covidseq positive control ( cpc ) , miseq reagent micro kit v2 ( 300 cycles ) , miseq reagent kit v3 ( 600 cycle ) , miseq reagent kit v2 ( 500 cycles ) , miseq reagent kit v2 ( 300 cycles ) , miseq reagent nano kit v2 ( 300 cycles ) , idt ilmn pcr index set 1 ( 96 idx ) , idt ilmn pcr index set 2 ( 96 idx ) , idt ilmn pcr index set 3 ( 96 idx ) , idt ilmn pcr index set 4 ( 96 idx ) , viral surveillance panel, ruo 96 rxns , pan coronavirus panel, ruo 96 rxns , flex lysis reagent kit , s2 standard cartridge , s1 high resolution cartridge , s2 standard cartridge quantitive kit , s1 high resolution cartridge quantitive kit , quantifluor® dsdna system...
39265008 supply of generic medicine , abiraterone 250mg tab , acarbose 50 mg tab , aceclofenacsr 200 mg tab , aceclofenacsr 100 mg tab , aceclofenac 100 mg tab , aceclofenaic + para tab , aciclovir 800 mg tab 1x10 , acyclovir 200 mg inj , acyclovir 200 mg tab , acyclovir 400 mg inj , acyclovir cream , adrenaline inj , albendazole drop 10ml , albendazole syp , albumin 100ml inj , alkaliser 100ml syp , all hydr + mag hydro+ dim. + sorb syp 200ml , alphal ipoic acid +mv +antioxi +ch , alprazolam 0.25 mg tab 1x10 , alprazolam 0.25 mg tab 1x15 , alprazolam 0.5 1x15 , alprazolam 0.5 tab , amikacin 500 mg inj , amlodipin 10mg tab , amlodipin+ atenolol tab , amlodipine + atenolol tab , amlodipine 2.5 mg tab , amlodipine besilate 5mg tab , amoxicillin 500 mg cap , amoxycillin + claul 625 tab , amoxycillin 1.2 mg inj , amoxycillin 125 dry sup , amoxycillin 125 mg 30 ml syp , amoxycillin 250 mg 30 ml syp , amoxycillin 250 mg cap , amoxycillin+clav 625 mg tab , anacid 170ml syp , anstrazole 1mg tab , antacid chew tab , antacid tab 1x9 , antacids syp 200 ml , antacids tab , anti oxi+ lyco+ miner cap , anti oxidant cap , anticold tab , arsinix trioxide inj , artesunatge 50 mg tab , atenol 50 mg tab 1x14 , atenolol 100 mg tab , atenolol 100 mg tab 1x14 , atenolol 25mg tab , atenolol 50 mg + amlodipine 5 mg ta , atenolol 50 mg tab , atenolol 50 mg tab 1x14 , atorvastain 10 mg + ezetimibe 10 mg tab , atorvastatin 10 mg tab , atorvastatin 10mg +aspirin 75mg , atorvastatin 10mg +aspirin 75mg , atorvastatin 20 mg tab , atorvastatin 40 mg tab , azaciticline inj , azithromycin +cefixime tab 1x6 , azithromycin 250 mg tab 1x10 , azithromycin 250 mg tab 1x6 , azithromycin 500 mg tab 1x10 , azithromycin 500 mg tab 1x3 , azithromycin 500 mg tab 1x6 , azithromycin syp , azthromycin susp 100 mg 10 ml , azthromycin susp 200 mg 10ml , bandage 15 mtr , bandage 2x2.5 , bandage 5mtr , bandaid , b com+mv+mine+zinc forte cap , b com6mv+mine+zinc forte cap , b complex 200 ml syp , b complex cap 1x15 , b complex forte+ vit , b complex tab1x10 , beclo+clotri+neomy 10 gm oint , beclo+clotri+neomy 5 gm , beclomethason dipro , bendamustin 100 mg inj , benzyl benzoate lotion 100 ml , betahistine 16 mg tab , betahistine 8mg tab , betahistine tab , betamethasone lotion , betnameta sone tab , bevacizumnabinj 100 mg , bisacodyl 5mg tab , bleomycininj15 mg , boric acid 20gm , bortezumib 2 mg inj , bortezumib 3.5mg inj , bromaxin dia cpm syp , bromhexine syp , buprenorphine 0.3 mg 2ml inj , c.p. 5 lac inj , cal carbonate + vitd3 syp , calamine 100 ml lotion , calamine 3% diphen 1% lot 100 ml , calamine 50ml lotion , calcitrol seachet , calcium + vita c inj 10 ml , calcium + vitamin syp , calcium + vitd3 tab , calcium carbon + calcitriol + zinc , calcium carbon+ calcitriol + zinc , calcium citrate, calcitriol & vitamin k2 7tab , calcium citrate, calcitriol & vitamin k2 7tab , calcium gluconate inj. 10 ml , capecitabine500 mg tab , capecitbine tab , capecitbine tab500 mg , carboplatin 150 mg inj , carboplatin 450 mg inj , carvedilol 12.5 mg tab , carvedilol 6.25 mg tab , caspofun xgin 50 mginj , caspofunxgin 70 mg inj , cefadroxil 250 mg in , cefadroxil 250 mg tab , cefadroxil 500 mg inj , cefadroxil 500 mg tab , cefixime 100 mg tab , cefixime 200 mg tab , cefixime 50 dt tab , cefixime 50 mg tab , cefixime drops 10ml , ceforperazone 1gm inj , ceforperazone 500mg + sulbactum , cefotaxime 1gm inj , cefotaxime 500 mg inj , cefpodoxime proxetil 200 mg tab , cefpodoxime proxetil 50mg syp , cefpodoxime proxetil disp. 100 m , ceftazidime 1gm inj , ceftriaxone 1g+ tazobacctum 12 , ceftriaxone 1gm +sulbact , ceftriaxone 1gm inj. , ceftriaxone 1gm+ sulbactm 500mg , ceftriaxone 250inj , ceftriaxone 250 mg + sulbactm 250 , ceftriaxone 250 mg + sulbactm 500 , ceftriaxone 250 mg inj , ceftriaxone 250mg + sulbactm 125 , ceftriaxone 500 inj , ceftriaxone 500 mg inj , cefuroxim 250 mg tab , cefuroxime 125 mg oral susp , cefuroxime axetil 250 mg , cefuroxime axetil 250 mg tab , cefuroxime axetil 500 mg , cefuroxime axetil 500mg tab , cefuroxime axetil 500mg tab 1* , cephalexin 125 mg dt tab , cephalexin 250 mg dt tab , cephalexin 250 mg tab , cephalexin 500 mg tab , cephalexin drop 10ml , cephalexin dry syp , cepodoxim 100mg tab , cepodoxim 200mg tab , cepodoxim syp , cetrizine + ambroxol tab , cetrizine + phenyl prop+ dextro s , cetrizine + pph+ ammo chlo + menth , cetrizine + pph+ammo chlo+menth , cetrizine 10 mg tab , cetrizine 30ml syp , cetrizine hyd +pseudeph hyd +pcm , child tonic iron / calcium / vit , chiloramphenicol 1 mg inj , chiloramphenicol 1gm inj , chiloramphenicol 500mg cap , chiloramphenicol syp , chilrpheniramine 4mg + codeine 1 , chloramphenicol 125 mg 60ml syp , chloramphenicol 250 mg cap , chlorhexidine3% mouth wash 10 , chloroquine phosphate 250 mg ta , chlorpheniramine + codein phos , chlorpheniramine + dextra + pcm +p , chlorpheniramine + pcm + phenylep , chlorquine 250 mg tab , chlorquine 500 mg tab , chlorquine ds tab , chlorquine syp , cholecalciferol tab 1x4 , cilnidipine 10 mg +telmisartan 40mg , cilnidipine 10mg , cilnidipine 10mg , cilnidipine 20 mg , cilnidipine 20 mg , cilnidipine 5mg , cinnarizine + domperidon tab , cinnarizine 25mg tab , cinnarzine 10mg tab , cipro +dexa eye drop , cipro +flucinolane + clorti cream , cipro 250 mg tab , ciprofloxacin250mg , ciprofloxacin + fluocin + clotri , ciprofloxacin 500 + tinidanzole500mg tab , ciprofloxacin eye / ear drop , ciprofloxacin iv inj , ciprofloxin 500 mg , cisplatin 10 mg , cisplatin 10 mg inj , cisplatin 50 mg inj , citicolin 500 mg tab , citicoline 500mg +piracetam 400mg , citicoline 500mg +piracetam 800mg , clarithromycin 250 mg tab , clavulanate pot + amoxycillin , clindamycim 1% gel , clobetasol 0.5 + miconazol 2 , clobetasol 0 05%+gentamicin 0 , clobetasol pro 0.5% + miconazole , clonazepam 0.5 mg tab , clonazepam 1mg tab , clopidogrel 75mg + aspirin 75 ta , clotriamazole tab , clotrimazol veg , clotrimazole + beclometh + neo , clotrimazole + beclomethasone , clotrimazole + beclomethasone + n , clotrimazole + fluclinolone + neom , clotrimazole 50 ml syp , clotrimazole oint , clotrimazole power , co trimaxazole syp , codin + cpm + menthol , cotrimaxazole d.s. tab , cotton 500 gm , cotton woll 20gm , cpm 2.5 + ammonium chloride 125 +sod syp , cpm 2.5 ml + ammo+ chloride 1.25 + sod syp , cyprohepatidine + sorbi+ tricho , cyprohepatidine + tricholine ci syp , cyproheptadine 200ml syp , cyproheptadine 4mg tab , cytrabine 100 mg inj , cytrabine 1000mginj , cytrabine 500 mg inj , d 1.0% 500ml , d 5% 1000ml inj , d 5% 500ml inj , d 25% 500ml inj , dacarbizine 200 mg inj , dacarbizine 500 mg inj , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 5mg , dapagliflozin 5mg , darbepoetin 25mginj , darbepoetin 40mg inj , darbepoetin 60mg inj , daxotelinj 120 mg , daxotelinj 120 mg , ddripemem 500mginj , deca anabolin 50mg inj , deflazcort 6mg tab , dexamethason inj , dexamethasone + chloramphenicol , dexamethasone + ciprofloxacin 1 , dexamethasone + neomycin 10ml , dexamethasone + ofloxacin 10ml , dexamethasone 0.5 mg tab , dexamethasone 5mg + phenyleph 5 , dexamethasone phos inj , dextro 5ml + pheny 12.5 +cpm 2mg , dextromethopen + hydro+ bromhx +am , dextromethorphan 10+ cpm+phenyl , dextromethorphan 10+ guai 100 +br , dextromethorphan 5mg + pph+diphe , dextroproposyphen & hydroclo , dextroproposyphen + acetominophe , dextroproposyphene 65ml + para+ , dextropropoxiphen 65mg +pcm 325 , diazepam 10mg tab , diazepam 2ml inj , diclo+ para+ chlorzox tab , diclofenac + diethyla+ met salt + oint 30gm , diclofenac + para+ tab , diclofenac + serra tab , diclofenac 50mg + serratiopeptidase 10mg tab , diclofenac 50mg tab , diclofenac eye drop , diclofenac inj , diclofenac oint 30gm , diclofenac poto 100 + pcm 500+ ser , diclofenic + para+ serra tab , diclofenic 100mg sr tab , dicyclomine + para , dicyclomine 10+ mefenamic 250mg , dicyclomine 10mg 2 ml inj , dicyclomine drop , diltiazem 30mg , diltiazem 60mg tab , diphenhydramine 14.08 + amni 38 syp , diphenhydramine 14.08+ amni 38+ x , diphenhydramine 25mg cap , disodium hydrogencitrate syp , dns 1000 ml , dns 500 ml , dobutamine 250 mg 5ml inj , docetaxel 20 mg inj , docetaxel 80mg , docetaxel 80mg inj , domeperidone 10mg tab , domeperidone dt 10mg tab , domeperidone syp , domperidone 10+ pcm 500 mg tab , domperidone tab , doxarubacininj10 mg , doxarubacininj 10 mg , doxarubacin inj 50 mg , doxarubacininj50 mg , doxycycline 100 mg tab 1x8 , doxycycline caps , doxylamine + pyridoxine + folic ac , drotaverine & mefenamic tab , dycerin 50 mg+ glucosamin 750 mgtab , ecitabinecap500 mg , electrolyte m 500 ml , enalapril 10mg tab , enalapril 2.5mg tab , enalapril 5mg tab , enapil 5 mg + amlodipine 5 mg tab , enoxaparin sodium 60mg inj , enzymes cap , enzymes cap1x15 , enzymes syp200ml , epirubicin 10 mg inj , epirubicin 10 mg tab , epirubicin 100 mg inj , epribucin 50 mginj , epribucin 50 mg inj , erlotinib 100mg tab , erlotinib 150 mg tab , erythro protine inj , erythromycin +aloevera cream , erythromycin 250 mg , erythromycin 500mg tab , erythropoietin inj 4000 , erythropoietin 10000 inj , erythropoietin 40000 inj , escitalopram 10mg + clonazepam0.5 ml , escitalopram 10mg tab , escitalopram 20mg tab , esomeprazole 40mg , esomeprazole 40mg , esomeprazole 40mg +domperidone , esomeprazole 40mg +domperidone , etaner cept 250mg inj , etaner cept 50 mg inj , ethambutol 800mg tab , ethamsylate 250 tab , ethamsylate 2ml inj , ethamsylate 500 tab , etophylin + theeophylin 2ml inj , etophylin + theophyl in 300mg tab , etophylin + theophylin 150mg tab , etophyll ine 84.7mg + theoph 25.3 , etophyllin + theophyllin tab , etoricoxib 120mg tab , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60mg tab , etoricoxib 90mg tab , face mask , febuxostat 40mg tab , febuxostat 80mg tab , ferric + folicacid + cyanoco + sorbi syp , ferric+ folicacid tab , ferrous salt + folic acid syp 200 , ferrous salt + folic acid tab , fexofenadine 120mg , fexofenadine 180mg tab , filgrastim pfsinj300mg , filgrastim pfsinj 6mg , filgrastim pfsinj 300mg , fluconazole 150 + azithromycin 1 , fluconazole 150 tab , fluconazole 50mg tab , fludocyte 50 mginj , fluoxetine + alprozolam tab , fluxoetin cap , folic acid 5mg tab , folic acid 5mg tab , folic acid 5mg tab1x30 , fosapre ptant 150mg inj , frusemide 40mg tab , fungal diastase 50 pcpsin 10 , furazol idone 100 metronidazole , furazol idone tab , fusidic acid + beciomfth+ dipro c , fusidic acid cream , gabapentin 300 mg + mecobalamine 500mg , gabapentin 300mg cap , gabapentin 400 mg cap , gamabanzyl lot , gamma benzene hexachloride 1% , gatifloxacin 200mg + ornidazole , gatifloxacin 400 mg tab , gatifloxacin eye drop , gauze , geftinmib tab 250 mg , gemcitabine inj 1 gm , gemcitabine inj 1 gm , gemcitabine inj 20 mg , gemcitabineinj 200 mg , gemcitabine 1.4 mg inj , gentamicin 0.2% dexamethasone , gentamicin 80mg inj 2 ml , gentamicin inj 2 ml , gentamycin eye drop , ginsang + multi vit , ginsang + multi vit cap , glibenclamide 5mg + metformin 500 tab , glibenclamide smg tab , gliclazide 40mg tab , gliclazide 80mg + metformin 500 , gliclazide 80mg tab , glime 1mg + metfor 500 mg+ piogl 15mg tab , glime 2 mg + metfor 500+ piogl 15 mgtab , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 500 t , glimepride 1 mg tab , glimepride 2 mg + metformin 1000t , glimepride 2 mg + metformin 1000t , glimepride 2mg +metformin 500 tab , glimepride 2mg tab , glipizide 5mg + metformin 500 , glucos c 100 + 200 gm , glucosamine 500mg tab , glucosamine 750mg+ diacerein 50 mg+msm tab , griseofulvin 250 mg tab , hacmatinic with vitamins 200ml , haematinic + vitamin+ folic acid cap , haematinic + zing cap 1x15 , haematinic with vitamins cap , haematinic with vitamins syp , heparin sodium 50 iu gel , heparin sodium 50 i u +bengyl n , human erythropoetin alfainj2000 iv , human erythropoetin alfa inj4000 iv , human erythropoetin alfa inj 4000 iv , human erythropoetin alfainj 2000 iv , hydrocortisone 100 inj , hydrogen peroxide 100ml , hydroxyprogesterone 250 inj , hydroxyprogesterone 500 inj , hyoscine butylbromide 10mg , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibandronate tab , ibuprofen 100pcm 125 mg 60ml sy , ibuprofen 100pcm 125 mg tab , ibuprofen 100 pcm 125 syp , ibuprofen 100 pcm 500 mg tab , ibuprofen 100 pcm 500 tab 1x15 , ibuprofen 400 +para 325 mg tab , imatinibtab 100mg , imatinib tab 400 mg , imatinibtab400 mg , imatinibtab 100mg , imatinib tab100mg inj , indomethacin 75mg sr cap , indomethacin cap , intazyme cap 1x15 , irenotacan 100mg inj , irenotacan 40 mg inj , iron ( 111 ) hydr. poly cap , iron + folic acid cap , iron + folic acid cap ( g ) 1x15 , iron 200ml syp , iron 60ml syp , iron polymaltose comphfolic ac , isabgol 100 gm , iso sorbide monoitrate tab , isolyte p500mg , isosorbide dinitrate 10mg tab , isosorbide mononitare 40mg ta , isosorbide mononitrare 20mg tab , isosrbide dinitrate 5mg tab , isosrbide mononitrare 10mg tab , ketoconazole 1% lot , ketoconazole 2% lot , lacobactllus tab , lacto bacillus tab 1x15 , lactobacillus 60mill tab , lactolus tab 1x15 , lactoluse 100ml syp , lactoluse syp 20, ml , lansprazole 30mg cap , lefotaxime 1gm inj , lefotaxime 250mg inj , lenalidmide 10mgtab , lenalidmide 5mg tab , letrazol 2.5 mg tab , levamisole 150mg tab , levetiracetam 250mg , levetiracetam 500 mg , levetiracetam 500 mg , levetiracetam 750 mg , levocetrizine + montelukast syp , levocetrizine syp , levocetrizine tab , levofloxacin 150mg 1x5 , levofloxacin 250 mg , levofloxacin 500mg , levofloxacin 500mg tab 1x5 , levofloxacin 500mg tab 1x5 , levofloxacin 750mg tab , levofloxacin iv inj 100ml , levonorgestrol 0.75 mg pills , levprolideinj 3.75mg , lignocaile 30ml + adrenal in inj , lignocain hydroclorid 2% inj , lignocaine hydro 2% adrenaline , lin oil + diclo sod+ methyl+ ment , lincomycin 2ml inj , lincomycin cap , liq. paraffin + milk or magnesia , lisinopril 10mg tab , lisinopril 5mg tab , lisinopril 5mg+amlodipin 5mg , lithium carbonate 300mg tab , liver tonic 100 syp , liver tonic 200 syp , loeramide 2mg tab , loperamide 2mg tab , loratadine + ambroxol hci tab , loratadine 10mg tab , loratadine 5mg +pseudoephedrine , lorazepam 1mg tab , lorazepam 2mg tab , los pot 50mg tab , losartan 50+ amlodipine 5 tab , losartan 50mg tab , losartan 50mg+ hydroch 12.5 mgtab , losartan pota 50+ amlodipine 5mg tab , losatan 50 + hydro 12.5 , luprolide depot 11.25inj , luprolide depot 22.5 inj , lycopen cap , lycopen+vitamin tab 1x15 , lyophillzed doxetaxel inj 20 mg , lyophillzed doxetaxel inj 80 mg , magaldrate540 + simeth 50mg syp , mandrolone dacanote 50 inj , mcp inj , mcp tab , mecobalamin + thiamine +pyridoxi , mecobalamin 1500mg tab , mecobalamin 500mg inj 2ml inj , mecobalamin 500mg tab , mecobalaminia lipo +facid +pyri , mefenamic acid 500mg + diclo hyd , melphalantab 2 mg , menadione sod 1 ml inj , meropenem 1gm inj , metformin 500mg tab , metformin 500mg tab 1x20 , metformin 850mg tab , metformin sr 1gm tab , metformin sr 500mg tab , metformin+gl imepride tab , metformine 500mh+gliclazide 80 mhtab , metformin sr 1000mg tab , metformin sr 500mg tab , methycobalamine 2ml 1500mg inj , methyl + prednisolan tab , methyl cobalami tab , methylcobalami + mincrals cap , methylcobalami od tab , methylcobalamin alpha lip.+ro , methylcobalamin ivit , methylergometrine inj , methylergometrine inj 1x1 , methylergometrine tab , methylpredsolone 16 mg tab , methylpredsolone 4mg tab , methylpredsolone 8 mg tab , metoclopramide inj , metoprolol 25mg tab , metoprolol 50mg tab , metoprolol xl 50mg tab 1x10 , metoprolol xl 25mg tab , metro 100 ml , metronidazole + norfloxacin susp , metronidazole 200mg tab , metronidazole 400mg tab , metronidazole inj 100ml , miconazole nitrate + flucinole , miconazole oint 10gm , mifepristone 200mg tab , mimesulide 100mg tab , minesulide + serrapep tab , minesulide gel , mirtazapine 15mg tab , misoprostol 200mg tab , misoprostol 200mtab , momemtasone creasm , montelukast 10mg + levo.d hcl 5 , mosapride 5mg tab , mosapridecitrate 5mg tab , multivitamin +min+zinc cap , multivitamin 10ml inj , multivitamin 2ml inj , multivitamin and minerals cap , multivitamin drop , multivitamin soft gel cap , multivitamin syp 200ml , mvi inj ( g ) , mycophenolate 500mg tab , nab paclitaxel 100 inj , nandrolone dacanote 25 inj , nano paclitaxel 100mg inj , nebivolol hydrochloride 2.5mg tab , nebivolol hydrochloride 5mg tab , nicorandil 5mg tab , nifeditine rt 20mg , nimesu+praa+serra tab , nimesulide + para tab , nimesulide 1% +methysalicylate oint , nimesulide 100mg + para 500 +ser tab , nimesulide 100mg +dicyclomine 2 , nimesulide 100mg mouth diss tab , nimesulide 100mg+tizanidine 2mg tab , nimesulide 200mg tab , nimesulide 50+paracetamol 125m , nimesulide 50mg+para 125 ( neula , nimesulide dt 50mg tab , nitroglycerin 2.6 tab 1x30 , norfloxacin 400 tab , norfloxacin+tinidazole +betacyc , ns 500 ml , ofloxacin +metronidazole syp , ofloxacin +ornidazole syp , ofloxacin +tinidazole tab , ofloxacin 200mg tab , ofloxacin eye / ear drop , ofloxacin inj , ofloxacin oral drop , ofloxacin syp , ofloxacin+dexamethasone drop , ofloxacin+ornidazol tab , olanzapine 5mg tab , olemesartan 40mg tab 1x10 , oleu 3% diclof 1.16% methyl 10 , olmesartan 20mg& hydroch 12.5tab , olmesartan 20mg tab , omeprazole 20 cap 1x15 , omeprazole 20mgcap , omeprazole 20mg +dom 10 mg cap , omeprazole 40mg tab 1x15 , omeprazole+domp cap 1x15 , ondansetron 2ml inj , ondansetron 8mg tab , ondansetron md 4mg tab , ondensetron 4mg inj , ondensetron 4mg tab , ondensetron 8mg tab , ondensetron drop , ornidazole 500mg tab , ornidazole iv inj 100ml , ors 21.8 gm , ors 4 gm , ors powder 21gm , oxaplatin 100mg inj , oxaplatin 50 mg inj , oxaplatin 50 mg tab , oxymethazole ine hydro nasla ors , oxytocin inj , paclitaxel inj 260mg , paclitaxelinj 260mg , paclitaxel 100mg inj , paclitaxel 200 mg inj , paclitaxel 30 mg inj , paclitaxel 300 mg inj , pain kill oil , pantoprazole 40mg , pantoprazole 40mg+domp 30 mg sr cap , pantoprazole 40mg + domperidone 30mg sr , pantoprazole inj , pantoprazole+domp tab , pantoproazole 40mg , paracetamol650mg tab , paracetamol 100mg drop , paracetamol 125mg syp , paracetamol 250mg syp , paracetamol 2ml inj , paracetamol 500mg tab , paracetamol 650mg tab , paracetamol d / s syp , paracetamol tab 1x15 , paracetamol+domperi ab , parafin 100ml , paralfin & milkof magnesia , pcm 125 mg +chlophe+sod cit+phe syp , pcm 450+brom 8mg +gui 100mg +cpm tab , pcm 500+serratio +aceclofenac tab , pcm 500mg tab , pegylated interferon alfainj1180mg , pemetrexed inj100mg , pemetrexed inj 100mg , pemetrexedinj500mg , penicillin g potassium 200000 , penicillin g potassium 400000 , penicillin g potassium 4000000 , penicillin g potassium 800000 , pheniramine maleate 22.7 mg inj , pheniramine maleate 25mg inj , phenobarbitone 30mg tab , phenobarbitone 60mg tab , piogilitazone 15mg tab , piogilitazone 30mg tab , piracetam 400mg tab , piracetam 800mg tab , piroxicam 40mg 2ml inj , piroxicam disp 20mg tab , piroxicam dt tab , polymer degarded gelatin 500m , porpanolol 10mg tab , potassium permegnate 20gm , povidone 100ml liq , povidone 15gm oint , povidone 20gm oint , povidone 250gm oint , povidone 500ml liq , povidone oint 5gm , povidone powder , prazocin xl 2, 5mg tab 1x15 , prazocin xl 5mg tab 1x15 , prazosin 1mg tab , prazosin 2.5mg tab , prazosin 5mg tab , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , pre & probiotic sachet 1x1 , prednisolone 10mg tab , pregabalin 75mg & methycobalmin750 mg cap , pregnancy test card , pregnency test card / kit , primaquine phosphate 15mg tab , primaquine phosphate 7.5 mg tab , promethazine 25mg 2mlinj , promethazine 25mg tab , propanolol 40mg tab , propranolol40mg & alprazolam 0.25mg tab , protine powder20gm , pyra 1500 +rifa450+isonia , pyramethamine 25ml +sulpha 500 , pyrazinamide 500mg , pyrazinamide 750 mg , quinine dthydrochloride inj , quinine sulpate 300mg tab , rabeprazole 20mg + dom 10mg tab , rabeprazole 20mg + dom 30mg cap , rabeprazole 20mg tab , ramipril 2.5mg tab , ramipril 5mg tab , ranitidine 150+domperidone 10m , ranitidine 150mg tab , ranitidne 2ml inj , ranolazine 500mg , ranolazine 500mg , rifamicin 450 tab , rijoximabinj500 mg , rijoximabinj 100 mg , risperidone 2mg tabroxithromyc , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg tab , rosuvastatin 20mg tab , roxithromycin syp , roxituromycin 50mg tab , salbutamol 2mg +ambroxol 30mgsyp , salbutamol 4mg tab , salbutamol tab , secnidazole 1gm tab , serratiopeptidase tab10mg , sertaline 100mg tab , sertaline 50mg tab , sildenafil citrate 100mg tab , silodosin 8 mg cap. , silodosin 8 mg cap. , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg tab , simvastatin 10mg tab , simvastatin 20mg tab , sitagliptin 100mg , sitagliptin 100mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50mg , sitagliptin 50mg , soda bi carb 25ml inj , sodium valaporate 200mg tab , sodium valproate cr 500mg tab , sodiumbicarbonate inj 10ml , sorafenib 200mgtab , sparfloxacin 200mg tab , sparfloxin 100mg tab , sponge rolder , sterile gloves , streptomycin 1gm inj , streptomycin 2.75 inj , sucralfate 100ml susp , tacrolimus cap 1mg , tacrolimuscap 0.5mg , tacrolimus cap 0.5mg , tacrolimus 0.01% w / w ointment , tacrolimus 0.03% w / w ointment , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin .4mg +dutasteride .5mg , tamsulosin .4mg +dutasteride .5mg , tamsulosin 0.4mg tab , tamsulosin 0.4mg tab 1x15 , tamzolamid tab250 mg , tamzolamidtab 100mg , tamzolamid tab100mg , tamzolamid tab 250 mg , telmisartan 20+amlodipine +hydroch tab , telmisartan 40 mg + amlodipin 5mg tab , telmisartan 40+amlodipine +hydroch tab , telmisartan 40mg+ hydroch 12.5 mgtab , telmisartan 40mg tab , telmisartan 80 mg tab , telmisartan 80+hydrochlorothiazide tab , telmisartan 80+hydrochlorothiazide tab , temozolomidecap20mg , temozolomidecap 100mg , temozolomidecap 100mg , temozolomidecap 20mg , teneligliptin 20mg , teneligliptin 20mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin 500mg , teneligliptin 20mg + metformin 500mg , terbipression inj , terbutalinesfsyp , terbutaline + guai+brom +menthol syp 100ml , teripratide 750mg / ml inj , testosterone 250mg 1ml inj , tetanus toxoid inj , tetra cycline 250 mg cap , tetracycline 250mg tab , thyroxine 100mg tab 1x1 , thyroxine 25mg tab 1x1 , ticagrelor 60 mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , tigercyclin inj , tinidazole 500mg tab , tobramycin & dexamethasone e / d , tobramycin 40mg inj , tobramycing 3% eye drop , tramadol 50mg+ paracetamol 375 mg tab , tramadol hydrochloride inj , tramadol hydrochloride tab , tramadol inj 2ml , trastozumab 440 inj , uniron inj , urokinase 5lakh tu inj , ursodeoxycholic acid 300 mg tab , ursodeoxycholic acid 300 mg tab , vildagliptina 50mg , vildagliptina 50mg , vildagliptina 50mg+ metformin 500mg , vildagliptina 50mg + metformin 1000mg , vildagliptina 50mg + metformin 500mg , vitamin b complex cap 1x15 , vitamin c 500mg tab , vitamin e tab 400ng , vitamine b complex cap ( conci , vitamine e 200mg tab , vitamine e 400 mg tab , voglibose 0.2mg tab , voglibose 0.3mg tab , voriconazole 200ml tab , zinc sulphate 60ml syp , zoledronic acidinj 4 mg , zoledronic acidinj 4 mg , zoledronic acid 5mg inj , zolpidem 5mg tab , torsimide 5 / 10 / 20 , orciprenaline 10 , quimine sulphate 300 , quimine sulphate 600 , primaquine 7.5mg , primaquine 15mg , pautaprazole+levosulpuride , rabaprazole+levosulpuride , pantaprazole 20mg , depagliflozin+metformin , esomeprazole+levosulpuride , lansaprazole 15 , levosulpuride 25 , valthamate bromide , hydroxy chloroquine 300 , hydroxy chloroquine 200 , nitro furantain 100mg , biotin 10mg , flupentixol + melitracen , pre probiotic , tretinion , hydroquinoun, tretinion, & mometasone , amorolfine 0.25% , halobetasol propionate 0.05% , sulfasalazine 1gm 500mg...
38842725 lab reagent purchase in district hospital hanumangarh , lab reagent items ( must see instruction in technical part before filling this boq ) , anti a, b antibody , anti a1 ( dolichos biflorus ) lectin , anti d biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d monoclonal ( igg ) blood grouping sera, 10 ml pack , anti h ( ulex europeus ) lectin, 10 ml pack , antibody elution kit, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 mlcpda ( double ) , blood bag 350 ml cpda ( single ) , blood bag 350 ml sagm ( triple ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , blood grouping antisera ( anti ab sera ) , 10 ml pack , blood grouping antisera ( anti abd ) , 10 ml pack , blood grouping antisera ( anti h sera ) , 10 ml pack , blood grouping antisera ( bovine albumin 22% ) , 10 ml pack , blood grouping antisera ( liss blood grouping ) , 10 ml pack , blood grouping antisera ( liss card ) , 10 ml pack , blood grouping antisera ( liss coombs ) , 10 ml pack , blood grouping antisera ( liss diluent ) , 10 ml pack , blood grouping antisera, coombs sera ( ahg ) 10 ml pack , blood grouping gel card ahg c3d card ( crossmatch ) , 24 card ( biorad ) , blood grouping gel card forward & reverse grouping, 24 card ( biorad ) , blood grouping gel card forward grouping, 24 card , calcium chewable tablets ( 10 tablets / per pack ) , check cells ( coombs control cell ) , 10 ml pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge machine , gel card for gel card centrifuge, 24 card , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , haemo cue microcuvette , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss ( low ionoc strength saline solution ) 500ml pack , lyoplastin kit. , ph calibration fluids of ph 4.01, 7 and 10.01; 10 ml pack , phenotyping anti sera kit, 10 ml pack , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , reagentredcellpanels ( elevencellpanel ) forantibody identifiction ) , 10 ml pack , reagent red cells for antibody screen ( three or two cell panel ) , 10 ml pack , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) , calibration kit for biochemistry semi auto analyzer , s. albumin kit ( for semi auto analyzer ) , s. alkaline phosphate ( for semi auto analyzer ) , s. amylase kit ( for semi auto analyzer ) , s. aptt kits ( for semi auto analyzer ) , s. aslo kit ( for semi auto analyzer ) , s. bilirubin direct kit ( for semi auto analyzer ) , s. bilirubin total kit ( for semi auto analyzer ) , s. calcium kit ( for semi auto analyzer ) , s. chloride kit ( for semi auto analyzer ) , s. ck nac kit ( for semi auto analyzer ) , s. ck mb kit ( for semi auto analyzer ) , s. creatinine kit ( for semi auto analyzer ) , s. crp quantitative kit ( for semi auto analyzer ) , s. glucose kit ( for semi auto analyzer ) , s. hdl kit ( for semi auto analyzer ) , s. ldh kit ( for semi auto analyzer ) , s. magnesium kit ( for semi auto analyzer ) , s. potasium kit ( for semi auto analyzer ) , s. pt test kit ( for semi auto analyzer ) , s. ra / rf ( rheumatoid factor ) kit ( for semi auto analyzer ) , s. sgot kit ( for semi auto analyzer ) , s. sgpt kit ( for semi auto analyzer ) , s. sodium kit ( for semi auto analyzer ) , s. total cholsterol kit ( for semi auto analyzer ) , s. total protein kit ( for semi auto analyzer ) , s. triglyceride kit ( for semi auto analyzer ) , s. urea kit ( for semi auto analyzer ) , s. uric acid kit ( for semi auto analyzer ) , s.ldl kit ( for semi auto analyzer ) , s.vldl kit ( for semi auto analyzer ) , s.ggt kit ( for semi auto analyzer ) , absorbent cotton wool ( 5 / pack ) , amies media 500 gm / pack , anaerobic gas pack 6 set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , autoclave biological indicator 250 / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar 500gm / pack , blood agar plate , blood culture bottle , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 70 ml. adult for blood culture , cary blair’s transport media 500 gm / pack , cavity slide ( 10 per pack ) , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , handrub ( alcohol hand rub with moisturizer ) 500 ml , hbv viral load kit , hcv viral load kit , hiv diagnostic rt pcr kit , hot plate , hsv viral qualitative rt pcr kit , loeffler’s medium 500 gm / pack , lowenstein jensen media. 500 gm / pack , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilm d m250 , peptone water , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , raffinose 10gm / pack , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , stained salmonella antigen set for widal tests ( tube ) , sterile cotton swab with wooden stick , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vibrio tcbs agar 500gm , vtm vial , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , crystal violet stain 100 gm pack , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , giemsa stain solution ( 500ml bottle ) , gram stain kit , india ink stain , j.s.b. stain 1 for malaria parasite, 500ml / bottle , j.s.b. stain 2 for malaria parasite, 500ml / bottle , leishman stain 250 ml pack , lpcb stain 1 kit , new methylene blue stain for recticulocute count , nucleic acid stain , pap stain kit ( 1x250 test ) , rapid h&e stain kit 250 smear / kit , trichrome stain solution , z.n. stain for afb , sudan black stain solution ( 500ml / pack ) , 3.8% sodium citrate solution for esr, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute ethanol 500ml pack , absolute methanol ( 95% ) 500ml pack , acetic acid 100ml / pack , acetone ar 500 ml pack , ammonia , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , amonium sulphate , bacl2 ( barium chloride ) 10%, 500ml / pack , barium chloride 500gm pack , benedicts reagent 500 ml pack , bouins liquid 1 liter pack , buffer solution 500ml pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , deionised water 20 liter pack , di ethyl ether 500ml pack , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , drabkins solution 500 ml pack , edta powder 100gm pack , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs reagent ( 125ml pack ) , ferric chloride 100 gm pack , fouchet reagent ( 100ml / pack ) , glacial acetic acid 10 % solution, 500ml pack , glutaraldehyde ( 5 liter / pack ) , gluteraldehyde 100ml / pack , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hi chrome uti 500gm , iodine 100 gm pack , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , leishman powder 25gm pack , liquid ammonia 500 ml pack , lugols iodine 100 ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methyl red 125ml / pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro protien reagent ( csf ) 25ml pack , nitric acid ( 250 ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , rbc diluting fluid ( 100 ml / pack ) , semen diluting fluid 125 ml pack , sodium chloride 500gm / pack , sodium hydroxide 250ml / pack , sodium hydroxide 500gm / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 500 ml / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sodium nitropruside crystal 50gm pack , sorbitol 500gm / pack , sprit rectified clinical / surgical sprit ( 500ml / pack ) , sulfosalicylic acid 3% , tincher iodine ( 5 liter / pack ) , total eosinophil count fluid 125 ml / pack , w.b.c diluting fluid 500ml pack , xylene ( sulphur free ) ar 2.5 liter pack , clot activator vial, non vacume, double cap, red cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , plain serum vial, non vacume, double cap, red cap 4 ml , ria vial, non vacume 4 ml , sodium citrate vial, non vacume, double cap, black cap ( 3.8% ) 2 ml , sodium citrate vial, non vacume, double cap, blue cap ( 3.2% ) 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , elisa borrelia igg kit ( 96 test / kit ) , elisa borrelia igm kit ( 96 test / kit ) , elisa chickungunya kit ( 96 test / kit ) , elisa cmv igg kit ( 96 test / kit ) , elisa cmv igm kit ( 96 test / kit ) , elisa dengue igg kit ( 96 test / kit ) , elisa dengue igm kit ( 96 test / kit ) , elisa dengue ns 1 kit ( 96 test / kit ) , elisa dengue ns1, igg & igm kit ( 96 test / kit ) , elisa hav igm kit ( 96 test / kit ) , elisa hbsag kit ( 96 test / kit ) 3rd generation , elisa hbsag kit ( 96 test / kit ) 4th generation , elisa hcv kit ( 96 test / kit ) 3rd generation , elisa hcv kit ( 96 test / kit ) 4th generation , elisa hiv kit ( 96 test / kit ) 3rd generation , elisa hiv kit ( 96 test / kit ) 4th generation , elisa hsv 1 / 2 igm kit ( 96 test / kit ) , elisa hsv1 / 2 igg kit ( 96 test / kit ) , elisa igg for measles kit ( 96 test / kit ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e kit ( 96 test / kit ) , elisa igm for leptospirosis kit ( 96 test / kit ) , elisa igm for measles kit ( 96 test / kit ) , elisa leptospira igm kit ( 96 test / kit ) , elisa rotavirus antigen kit ( 96 test / kit ) , elisa rubella igg kit ( 96 test / kit ) , elisa rubella igm & igg kit ( 96 test / kit ) , elisa rubella igm kit ( 96 test / kit ) , elisa scrub typhus kit ( 96 test / kit , elisa toxoplasma igg kit ( 96 test / kit ) , elisa toxoplasma igm kit ( 96 test / kit ) , elisa varicella zoster virus igg kit ( 96 test / kit ) , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , rapid ag test for backterial meningitis ( menigococci ) , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card test for chalmydia antigen , rapid card test for chickungunya igm , rapid card test for covid 19 antigen card , rapid card test for cryptococcal antigen , rapid card test for dengue day 1 test , rapid card test for dengue lgg & lgm , rapid card test for dengue ns1 antigen , rapid card test for h.pylori , rapid card test for dengue ns1, igg, igm , rapid card test for hbsag , rapid card test for hcv , rapid card test for hcv tri dot , rapid card test for hiv , rapid card test for hiv 4th generation , rapid card test for hiv combaids , rapid card test for hiv tri dot , rapid card test for hiv tri dot+ag , rapid card test for igg / igm ab , rapid card test for kala azar ( 2k39 ) , rapid card test for leptospira igm / igg , rapid card test for malaria ( pv & pf ) , rapid card test for microfilaria antigen , rapid card test for occult blood in stool ( guaiac method ) , rapid card test for rotavirus antien , rubella igm / igg rapid , rapid card test for scrub typhus , rapid card test for sickle cell anaemia , rapid card test for toxoplasma , rapid card test for treponema screening , rapid card test for troponin i , rapid card test for troponin t , rapid card test for typhoid igm & igg , rapid card test for varicella zoster virus ( igm ) , rapid card test for vdrl / rpr ( syphilis ) card , rapid card test for widal test kit ( slide method ) 4x5ml , rapid card test for widal test kit ( tube method ) 4x5ml , rapid combi card test for hiv & hcv , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid latex slide test for aso kit , rapid latex slide test for crp kit , rapid latex slide test for rf / ra kit , rapid pregnancy ( hcg ) test card , rapid pregnancy ( hcg ) test strip , rapid strip test for vdrl , rpr ( rapid plasma reagin ) for syphilis , test for iodine in salt kit , urine ketone strips ( 100 strips / pack ) , urine micro albumin strip ( 100 / pack ) , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multi parameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , uristicks ( albumin sugar ) ( 100 / pack ) , water testing by strip method kit , amikacin 30 ?g ( antibiotic disks ) , amoxicillin + clavulanic acid 20 +10 ?g ( antibiotic disks ) , amoxicillin 25 ?g ( antibiotic disks ) , ampicillin + sulbactam 10 +10 ?g ( antibiotic disks ) , ampicillin 10 ?g ( antibiotic disks ) , ampicillin 2 ?g ( antibiotic disks ) , azithromycin 15?g ( antibiotic disks ) , aztreonam 30 ?g ( antibiotic disks ) , bacitracin 130 ?g / 10 ui ( antibiotic disks ) , carbenicillin 100 ?g ( antibiotic disks ) , cefaclor 30 ?g ( antibiotic disks ) , cefalexin 30 ?g ( antibiotic disks ) , cefamandole 30 ?g ( antibiotic disks ) , cefazolin 30 ?g ( antibiotic disks ) , cefepime 30 ?g ( antibiotic disks ) , cefixime sµg 10 ?g ( antibiotic disks ) , cefoperazone + sulbactam 75 +30 ?g ( antibiotic disks ) , cefoperazone 30 ?g ( antibiotic disks ) , cefoperazone 75 ?g ( antibiotic disks ) , cefotaxime 30 ?g ( antibiotic disks ) , cefotaxime 5 ?g ( antibiotic disks ) , cefotetan 30 ?g ( antibiotic disks ) , cefoxitin 30 ?g ( antibiotic disks ) , cefpirome 30 ?g ( antibiotic disks ) , cefpodoxime 10 ?g ( antibiotic disks ) , cefprozil 30 ?g ( antibiotic disks ) , cefsulodin 30 ?g ( antibiotic disks ) , ceftazidime 10 ?g ( antibiotic disks ) , ceftazidime 30 ?g ( antibiotic disks ) , ceftibuten 30 ?g ( antibiotic disks ) , ceftriaxone 30 ?g ( antibiotic disks ) , cefuroxime 30 ?g ( antibiotic disks ) , cephalotin 30 ?g ( antibiotic disks ) , chloramphenicol 30 ?g ( antibiotic disks ) , ciprofloxacin 5 ?g ( antibiotic disks ) , clarithromycin 15 ?g ( antibiotic disks ) , clindamycin 2 ?g ( antibiotic disks ) , colistin 10 ?g ( antibiotic disks ) , colistin 50 ?g ( antibiotic disks ) , doripenem 10 ?g ( antibiotic disks ) , doxycycline 30 ?g ( antibiotic disks ) , ertapenem 10 ?g ( antibiotic disks ) , erythromycine 15 ?g ( antibiotic disks ) , flumequine 30 ?g ( antibiotic disks ) , fosfomycin 200?g ( antibiotic disks ) , fosfomycin 50 ?g ( antibiotic disks ) , fusidic acid 10 ?g ( antibiotic disks ) , gentamicin ( high load ) 120 ?g ( antibiotic disks ) , gentamicin ( high load ) 500 ?g ( antibiotic disks ) , gentamicin 10 ?g ( antibiotic disks ) , gentamicin 15 ?g / 10 ui ( antibiotic disks ) , gentamicin 30 ?g ( antibiotic disks ) , imipenem 10 ?g ( antibiotic disks ) , isepamicin 30 ?g ( antibiotic disks ) , kanamycin ( high load ) 1mg ( antibiotic disks ) , kanamycin 30 ?g ( antibiotic disks ) , levofloxacin 5 ?g ( antibiotic disks ) , lincomycin 15 ?g ( antibiotic disks ) , linezolid 10 ?g ( antibiotic disks ) , linezolid 30 ?g ( antibiotic disks ) , mecillinam 10 ?g ( antibiotic disks ) , meropenem 10 ?g ( antibiotic disks ) , metronidazole 4 ?g ( antibiotic disks ) , mezlocillin 75 ?g ( antibiotic disks ) , minocycline 30 ?g ( antibiotic disks ) , moxalactam 30 ?g ( antibiotic disks ) , moxifloxacin 5 ?g ( antibiotic disks ) , mupirocin 5 ?g ( antibiotic disks ) , nalidixic acid 30 ?g ( antibiotic disks ) , neomycin 30 ui ( antibiotic disks ) , netilmicin 10 ?g ( antibiotic disks ) , netilmicin 30 ?g ( antibiotic disks ) , nitrofurantoin 100 ?g ( antibiotic disks ) , nitrofurantoin 300 ?g ( antibiotic disks ) , nitroxolin 20 ?g ( antibiotic disks ) , norfloxacin 10 ?g ( antibiotic disks ) , norfloxacin 5 ?g ( antibiotic disks ) , ofloxacin 5 ?g ( antibiotic disks ) , oxacillin 1 ?g ( antibiotic disks ) , oxacillin 5 ?g ( antibiotic disks ) , oxolinic acid 10 ?g ( antibiotic disks ) , pefloxacin 5 ?g ( antibiotic disks ) , penicillin 1 iu ( antibiotic disks ) , penicillin 6 ?g / 10 iu ( antibiotic disks ) , pipemidic acid 20 ?g ( antibiotic disks ) , piperacillin + tazobactam 100 + 10 ?g ( antibiotic disks ) , piperacillin + tazobactam 30 + 6 ?g ( antibiotic disks ) , piperacillin + tazobactam 75 + 10 ?g ( antibiotic disks ) , piperacillin 100 ?g ( antibiotic disks ) , piperacillin 30 ?g ( antibiotic disks ) , piperacillin 75 ?g ( antibiotic disks ) , polymixin 50 ?g / 300 ui ( antibiotic disks ) , pristinamycin 15 ?g ( antibiotic disks ) , quinupristin dalfopristin 15 ?g ( antibiotic disks ) , rifampicin 30 ?g ( antibiotic disks ) , rifampicin 5 ?g ( antibiotic disks ) , sparfloxacin 5 ?g ( antibiotic disks ) , spectinomycin 100 ?g ( antibiotic disks ) , spiramycin 100 ?g ( antibiotic disks ) , streptomycin ( high load ) 300 ?g ( antibiotic disks ) , streptomycin ( high load ) 500 ?g ( antibiotic disks ) , streptomycin 10 ?g ( antibiotic disks ) , sulfonamides 200 ?g ( antibiotic disks ) , sulfonamides 300 ?g ( antibiotic disks ) , teicoplanin 30 ?g ( antibiotic disks ) , telithromycin 15 ?g ( antibiotic disks ) , tetracycline 30 ?g ( antibiotic disks ) , ticarcillin + clavulanic acid 75 + 10 ?g ( antibiotic disks ) , ticarcillin 75 ?g ( antibiotic disks ) , tigecycline 15 ?g ( antibiotic disks ) , tobramycin 10 ?g ( antibiotic disks ) , tobramycin 30 ?g ( antibiotic disks ) , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g ( antibiotic disks ) , trimethoprim 5 ?g ( antibiotic disks ) , vancomycin5 ?g ( antibiotic disks ) , vancomycin 30 ?g ( antibiotic disks ) , 100x lens for binocular microscope , 10x lens for binocular microscope , 40x lens for binocular microscope , blood cell counter 8 key + 1 totaliser , blood mixer / roller / rotator / shaker , bone marrow aspiration needle , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , electonic analytical balance for laboratory, capacity 200gm , esbachs albuminometer , esr fluid ( 500ml pack ) , esr pipette with vaccum plug, 100 / pack , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , filter paper ( round ) 125 mm ( 1x50 pack ) , funnel ( conical ) keep plastic transparent , funnel conical, 250 gram capacity , funnel conical, 500 gram capacity , glass slide box ( 75x25x1.35 mm ) ( 100 slides / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strip ( 100 / pack ) , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hydrometer ( for specific gravity ) , immersion oil for binoculer microscope ( 30ml / pack ) , immersion oil for binoculer microscope ( 30ml / pack ) , lancet ( 100 / pack ) , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , pasteur pipette ( dropper ) glass , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter , ph paper packet ( 20 piece / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , ppd syringe 100 / pack , r.b.c pipette , semen / sputum / urine / stool container plastic with cap 30 ml , semen / sputum / urine / stool container plastic with cap 50 ml , spatula with brush , spirit lamp , staining jar trough glass for 10 slides each , syringe holder for fnac ( 20ml syringe ) , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , urinometer , vaccutainer 10 ml plain , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , w.b.c pipette , wooden slide storage box for 50 slides , zip lock plastic bag 4*6 inch ( 100 piece / pack ) , zip lock plastic bag 6*8 inch ( 100 piece / pack ) , zip lock plastic bag 8*10 inch ( 100 piece / pack ) , band aid adhesive strip , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , cuscos speculum large , cuscos speculum medium , cuscos speculum small , disposable abg syringe without needle 3 ml , disposable glove with powder size 6 , disposable glove with powder size 6.5 , disposable glove with powder size 7 , disposable glove with powder size 7.5 , disposable glove without powder ( nitrile ) size 6 , disposable glove without powder ( nitrile ) size 6.5 , disposable glove without powder ( nitrile ) size 7 , disposable glove without powder ( nitrile ) size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 3 ml , disposable syringe 5 ml , dropper glass 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , hand wash liquid soap ( 100ml / pack ) , hitachi sample cup 2 ml 500 / pack , hitz cuvatte , hypodermic needle, 21g, 1.5 , icebox ( 2liter capacity ) , lens paper kit ( 50 sheets pack ) , liquid soap ( 1liter / pack ) , measuring cylinder 0 to 100 ml graduated glass , measuring cylinder 0 to 1000 ml graduated glass , measuring test tube glass 0 10 ml graduated conical , micro tips blue, 100 1000 micro liter ( 1000 / pack ) , micro tips blue, 10 200 micro liter ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , microcentifuge tude 0.5 ml , microcentifuge tude 1.5 ml , microcentifuge tude 2.0 ml , micropipette 0 10 ul capacity , micropipette 100 ul fix volume , micropipette 100 1000 ul capacity , micropipette 10 100 ul capicity , micropipette 50 ul fix volume , micropipette 5 50 ul capacity , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , pasteur pipettes 0.25 ml capacity 500 / pack , pasteur pipettes 0.50 ml capacity 500 / pack , pasteur pipettes 1 ml capacity 500 / pack , pasteur pipettes 10 microliter capacity 500 / pack , pasteur pipettes 3 ml capacity 500 / pack , pasteur pipettes 5 ml capacity 500 / pack , petridish 90 mm diameter, 15 mm height 1 piece , pipette stand plastic for 5 pipette , pipette stand plastic vertical 28 holes 12 mm , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , smear for filaria ( kit ) , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush , thermocal box ( 5 liter capacity ) , tissue paper ( 10 roll / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , tuberculine syringe , urine container, plastic, 30 ml, sterilized , urine container, plastic, 50 ml, sterilized , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...
38609501 tender for supply of generic drugs and medicine supply rate contract , medicine and injectables : , 3rd gereration recombinant factor viii ( rdna ) solvent detergent treated and nonofiltered 20nm 250 iu , 3rd gereration recombinant factor viii ( rdna ) solvent detergent treated and nonofiltered 20nm 500 iu , 3rd gereration recombinant factor viii ( rdna ) solvent detergent treated and nonofiltered 20nm 1000 iu , 3rd gereration recombinant factor viii ( rdna ) solvent detergent treated and nonofiltered 20nm 1500 iu , acth cmc 60 iu / ml , sodium acid phosphate sachet 3.2gm , amino acid based formula feed , antacid liquid containing: aluminium hydroxide magnesium hydroxide simethicone etc 170ml , anti inhibitor coagulation complex ( human plasma with a factor viii inhibitor bypassing activity of 500iu , arginine sachet 5gm , bacillus subtilis suspension 2 billion spores / 5ml , basic diet for disorders of amino acid metabolism 400 gm , basic diet for disorders of carbohydrate metabolism 400 gm , basic diet for disorders of fatty acid metabolism 400 gm , bisacodyl 5mg tab , bisacodyl suppo. 5 mg , blood ketone strip , blood sugar test strip single foil pack. , boric acid powder 10gm , brivaracetam 50mg tab , brivaracetam syp 100 ml , budesonide resp. 2ml , calcitriol softgel 0.25m , calcium folinate tab.15mg , calcium polysterine sulphonate powder 15 gm , cap indomethacin 50 mg , cap rifampicin 150 mg , cap. all trans retinoic acid 25mg / m , cap. cis trans retinoic acid 20 mg / m , cap. docasaheaenoic 100mg , cap. amoxicillin 250 mg , cap. amoxicillin 500 mg , cap. ampicillin 250 mg + cloxacillin 250 mg , cap. calcitriol 0.25mcg , cap. cholecalciferol 60000k , cap. cod liver oil 300mg , cap. co enzyme 100mg , cap. co enzyme q10+l carnitine 100mg , cap. cyclosporine 100 mg , cap. cyclosporine 25 mg , cap. cyclosporine 50 mg , cap. deferiprone 250mg , cap. deferiprone 500mg , cap. diazoxide 25mg , cap. doxycycline 100mg , cap. etoposide 50mg , cap. flunarizine 10mg , cap. flunarizine 5mg , cap. hydroxyurea 500 mg , cap. indomethacin 25 mg , cap. isotretinoin 20mg , cap. omeprazole 20 mg , cap. pancreatin 10000 iu , cap. penicillamine 250 mg , cap. penicillamine 500 mg , cap. prebiotic & probiotic 500 mg , cap. rifampicin 300mg , cap. rifampicine 150mg , cap. thalidomide 100mg , cap. ubiquinol acetate 100mg , cap. vitamin a 100000 iu , cap. vitamin a 200000 iu , cap. vitamin a 25000 iu , cap. vitamin e 200 iu , cap. vitamin e 400 iu , chlorhexidine mouth wash 30ml , cholestyramine sachet 5gm , chorionic gonadotrophin 5000iu , citric acid powder 500 gm , clot activator tube 3ml , clotrimazole 1% mouth paint 10 ml , clotrimazole ear drops 1%w / v 10 ml , clotrimazole powder 75gm , colistin sulphate syp 30 ml , cough syr.containing each 5ml dextromethorphan 10mg 100 ml , cream phenylpherine .10%w / w+beclomethasone .02%w / w+lidocaine2.5%w / w 20gm , cream clobet.+oflo+orni+terb cr 20 gm , cream clobetasol+salcylc acid 20 gm , cream clotrimazole 2% w / v 15gm , cream desonide cream 15 gm , cream framycetin 1% 100 gm , cream hydrocortisone 1% 15 gm , cream ketoconazole 2% 20 gm , cream miconazole nitrate 2% 15 gm , cream mometasone 15 gm , cream mometasone 0.1% + fusidic acid 2% 10 gm , cream mometasone 0.1% + salicylic acid 5% 10 gm , cream mometasone 0.1% + terbinafine 1% 10 gm , cream mupirocin 2% 7.5gm , cream nifedipine&lidocaine 15 gm , cream propylene glycol and diazolidinyl urea 15 gm , cream silver sulphadiazine 20gm , cream tretinoin 20gm , cream triamcinolone acetonide 0.01% 15gm , creosol with soap soln. 5 ltr. , dabigatran etexilate 150mg , denatonium benzoate 1% 15 gm , desmopression 0.1mg nasal spray , desmopression 0.2mg nasal spray , desmopression 1200mg nasal spray , desmopression 60mg nasal spray , desonide lotion 0.05% 30 ml , diclofenac sod. suppository 100 mg , disodium hydro citrate syp. 100 ml , drop levosalbutamol sulphate+ambroxol hydrochloride +guaiphenesin 0.5mg / 1ml 15 ml , oral digoxin 50mcg / ml 60 ml , oral frusemide 10mg / ml 30 ml , drop simethicon 40mg+ dilloil 0.005ml + fennel oil 0.0007ml 30 ml , drops haemocoagulase 0.2 iu 10ml , drops cefixime 10mg / 5ml 10ml , cefpodoxime 100mg / 5ml 30 ml syp. , drops cetirizine 10mg / ml 10ml , drops dicyclomine 10mg / ml 10 ml , oral domperidone 10mg / ml 5 ml , drops domperidone 1mg / ml 10 ml , syrup elemental zinc 20 mg / 5ml 30 ml , drops enzymes 30 ml , drops ferrous ascorbadate 10mg / ml 15 ml , drops folic acid 100mcg 15ml , drops hydroxyzine 6mg / ml 15ml , drops multivitamin with zinc 15 ml , drops multivitamins, minerals & antioxidents 15 ml , eye drops ofloxacin 0.3% 5ml , drops vitamin d3 400 iu / ml 15 ml , drops vitamin d3 800 iu / ml 15 ml , drops vitamin e 50mg / ml 15 ml , drops. containing: chlorpheniramine 2mg + phenylephrine 5 mg 15ml , ear drop para dichlorobenzene, benzocaine, chlorbutol & turpentine oil 10 ml , enema glycerin 15% sodium chloride 15% 20 ml , syp. ofloxacin 50mg+metronidazole120mg+simethicone 10mg 60ml , etopside 50mg cap. , chlorinated lime & boric acid solution 400ml , eye drop atropine 1% 5 ml , eye drop betaxolol 0.5% 5 ml , eye drop bimatoprost 0.3% 5ml , eye drop ciprofloxacin + dexamethasone 5 ml , eye drop genta+cpn+zinc 10ml , eye drop gentamicin 10 ml , eye drop hydroxypropyl methylcellulose 10 ml , eye drop moxifloxacin 0.05% w / v 10ml , eye drop ofloxacin + dexamethasone 10 ml , eye drop sodium chromoglycate 2% w / v 5 ml , eye drop timolol 5 ml , eye drop tropicacyl+phenylephrine 0.8% / 0.5% 5ml , eye drops carboxymethycellulose sodium 20% 5 ml , eye drops ciprofloxacin 0.3% 5ml , eye drops fluconazole 0.30% 5 ml , eye drops tobramycin + dexamethasone 5 ml , eye drops tobramycin 0.3% 5ml , eye drops tropicamide 1% 10 ml , flaxseed oil 200ml , fluconazole gel oint.0.5% 15 gm , framycetin cream 30 gm , full length recombinant factor viii 1000 iu with provisions of pk guided prophylaxis in 2ml dilution. , full length recombinant factor viii 250 iu with provisions of pk guided prophylaxis in 2ml dilution. , full length recombinant factor viii 500 iu with provisions of pk guided prophylaxis in 2ml dilution. , gel clindamycin 1% 20 gm , gel diclofenac 1% 20gm , absorbable gelatin compressed sponge , gel lidocaine hcl 2 % , gention violet paint 15ml , eeg conductive adhesive paste in wax nature , methylcobalamine500 mcg+thiamine 10mg+pyridoxime 3mg folic acid 500 mcg + d pantenol 5mg + l lysine 150 mg syp. 200 ml , glycerin ( glycerol ) 100ml , glycerin+sod. chloride enema 50 ml , glycerine suppositories 1 gm , glycerol 100gm , glycerol 400gm , glycopegylated extended half life recombinant factor ix 1000 iu , glycopegylated extended half life recombinant factor ix 500 iu , glycopegylated extended half life recombinant factor viii 1000 iu , glycopegylated extended half life recombinant factor viii 500 iu , glycopyrrolate 1mg tab ( gl , granules esmoprazole 10mg , haemocoagulase sol 10 ml , haloperidol 0.5mg tab , halothane 250 ml , halothane 30 ml , hepatitis b vac. 1 ml , human growth hormone 10mg pfs , human growth hormone 15mg pfs , human milk oligosaccharides based fortifier 1gm sachet , human milk oligosaccharides based fortifier 0.6 gm sachet , human rabies immune globulin 300 iu 2ml , hydrogen peroxide 11 % + silver nitrate 0.1% 1ltr , hydrogen peroxide 6% 100 ml , hydrogen peroxide 6% 400 ml , hyoscine bromide 10 mg tab. , pidotimod liq. 400mg 200ml , infant milk substitute lactose & sucrose free soya based formula approx 400gm , infant milk substitute lactose free casein based formula approx 400gm , infant milk substitute pre term & lbw formula approx 400gm , inhaler beclomethasone 0.200mg , inhaler budesonide 100 mcg + formoterol fumarate 6 mcg. , inhaler budesonide 200 mcg + formoterol fumarate 6 mcg. , inhaler budesonide 400 mcg + formoterol fumarate 6 mcg. , inhaler budisonide 100mcg , inhaler budisonide 200mcg , inhaler budisonide 400mcg , inhaler salbutamol 100mcg , inhaler salbutamol 2.5 mg + ipratropium 500 mcg 2.5 ml , inj heparin 5000 iu 5ml , inj heparin 5ml / 25000 iu , inj infliximab 100 mg 1ml , inj streptomycin 0.5 gm , inj streptomycin 1gm , inj. remdesivir 100 mg 20 ml , inj. abciximab 10mg 5ml , inj. acetylcysteine 200mg / ml 1ml , inj. acetylcysteine 200mg / ml 2ml , inj. acetylcysteine 200mg / ml 5ml , inj. acyclovir 250 mg , inj. adalimumab 20mg / 0.4 ml , inj. adalimumab 40mg / 0.8 ml , inj. adenosine 3mg / ml, 2ml , inj. adrenaline 1:1000 w / v 1ml , inj. adreno corticotropin hormones 30 iu / ml ( acth / cmc ) , inj. adreno corticotropin hormones 60 iu / ml ( acth / cmc ) , inj. albumin 20% 100 ml , inj. albumin 20% 50 ml , inj. amikacin 100 mg 2ml , inj. amikacin 250 mg 2 ml , inj. amikacin 500 mg 2ml , inj. amino acid 10% 100ml ( sorbitol free and cystine free ) , inj. amiodarone hydrochloride 50mg / ml , inj. aminophylline 25 mg / ml 10 ml , inj. amoxicillin 1000 mg clavulinic acid 200 mg , inj. amoxicillin 125 mg clavulinic acid 25 mg , inj. amoxicillin 250 mg clavulinic acid 50 mg , inj. amoxicillin 500 mg clavulinic acid 100 mg , inj. amphotericin b 10 mg lipid complex , inj. amphotericin b 10 mg liposomal , inj. amphotericin b 10 mg lypholized , inj. amphotericin b 100 mg lipid complex , inj. amphotericin b 100 mg liposomal , inj. amphotericin b 100 mg lypholized , inj. amphotericin b 25 mg liposomal , inj. amphotericin b 50 mg lipid complex , inj. amphotericin b 50 mg liposomal , inj. amphotericin b 50 mg lypholized , inj. amphotericine b deoxycholate 50 mg , inj. ampicillin 250 mg cloxacillin 250 mg , inj. ampicillin 500 mg , inj. ampicillin 500 mg salbactum 250 mg , inj. anidulafungin 100mg , inj. anti inhibitor coagulant complex 500 units , inj. anti snake venom 10 ml , inj. antithymocyte globulin equine 250 mg , inj. arginine 200mg / ml 3 ml , inj. arteether 75 mg / ml 2ml , inj. artesunate 60 mg , inj. atracurium besylate 25 mg 2.5 ml , inj. atropine 0.6 mg / ml 1 ml , inj. azithromycin 500 mg , inj. aztreonam 1.0 gm , inj. aztreonam 250 mg , inj. aztreonam 500 mg , inj. benzathene penicillin g 12 lac iu , inj. benzathene penicillin g 6 lac iu , inj. benzyl penicillin 10 lac iu , inj. benzyl penicillin 5 lac iu , inj. bevacizumab 100mg , inj. bevacizumab 400mg , inj. bleomycin 15 u , inj. bupivacaine 0.5% 20 ml , inj. bupivacaine 0.5% 4 ml , inj. butorphanol tartrate 1 mg 1ml , inj. caffeine cirate 20mg / ml 1 ml , inj. caffeine cirate 20mg / ml 2 ml , inj. caffeine cirate 20mg / ml 3 ml , inj. calcium gluconate 10% 10 ml , inj. carboplatin 450mg 5 ml , inj. carnitine 2gm / 5ml , inj. caspofungin 50 mg , inj. caspofungin 70 mg , inj. cefazoline 250 mg , inj. cefazoline 500 mg , inj. cefepime 1.0 gm , inj. cefepime 1.0 gm + amikacin 250 mg , inj. cefepime 1000 mg + salbactum 500 mg , inj. cefepime 1000 mg + tazobactum 125 mg , inj. cefepime 250 mg , inj. cefepime 250 mg + tazobactum 31.25 mg , inj. cefepime 500 mg , inj. cefepime 500 mg + amikacin 125 mg , inj. cefepime 500 mg + salbactum 250 mg , inj. cefepime 500 mg + tazobactum 62.50 mg , inj. cefoperazone 1 gm , inj. cefoperazone 1.0 gm + salbactum 1.0 gm , inj. cefoperazone 1.0 gm + salbactum 500 mg , inj. cefoperazone 125 mg + salbactum 125 mg , inj. cefoperazone 250 mg , inj. cefoperazone 250 mg + salbactum 250 mg , inj. cefoperazone 500 mg + salbactum 500 mg , inj. cefoprazone 1 gm + tazobactum 125 mg , inj. cefoprazone 500 mg + tazobactum 62.50 mg , inj. cefotaxime 1.0 gm , inj. cefotaxime 1.0 gm + salbactum 500 mg , inj. cefotaxime 250 mg , inj. cefotaxime 250 mg + salbactum 125 mg , inj. cefotaxime 500 mg , inj. cefotaxime 500 mg + salbactum 250 mg , inj. cefpirome 1.0gm , inj. cefpirome 250mg , inj. ceftazidime 1.0 gm , inj. ceftazidime 1.0gm , inj. ceftazidime 1000 mg + salbactum 500 mg , inj. ceftazidime 1000 mg + tazobactum 125 mg , inj. ceftazidime 250 mg , inj. ceftazidime 250 mg + tazobactum 31.25 mg , inj. ceftazidime 2gm + 0.5gm avibactum , inj. ceftazidime 500 mg , inj. ceftazidime 500 mg + salbactum 250 mg , inj. ceftazidime 500 mg + tazobactum 62.50 mg , inj. ceftizoxime 1.0 gm , inj. ceftizoxime 250 mg , calcium carbonate 625 mg eq. to elemental calcium 250mg with vitamin d3 125 i.u. syp. 200 ml , inj. ceftriaxone 1000 mg + salbactum 500 mg , inj. ceftriaxone 1000 mg + tazobactum 125 mg , inj. ceftriaxone 1000 mg + vancomycin 500 mg , inj. ceftriaxone 125 mg + salbactum 62.50 mg , inj. ceftriaxone 125 mg + tazobactum 15.62 mg , inj. ceftriaxone 1gm , inj. ceftriaxone 250 mg , inj. ceftriaxone 250 mg + salbactum 125 mg , inj. ceftriaxone 250 mg + tazobactum 31.25 mg , inj. ceftriaxone 500 mg , inj. ceftriaxone 500 mg + salbactum 250 mg , inj. ceftriaxone 500 mg + tazobactum 62.50 mg , inj. cefuroxime 1.5 gm , inj. cefuroxime 250 mg , inj. cefuroxime 750 mg , inj. chloramphenicol sodium succinate 1.0 gm , inj. ciprofloxacin 200 mg 100 ml ffs bottle , inj. ciprofloxacin 200 mg 100 ml bfs bottle , inj. ciprofloxacin 200 mg 100 ml glass bottle , inj. cisplatin 10 mg 10 ml , inj. cisplatin 50 mg 50 ml , inj. cistracurium 10mg / 5ml , inj. cistracurium 20mg / 10ml , inj. clarithromycin 500mg inj. , inj. clindamycin 300 mg 2ml , inj. clindamycin 600 mg 4ml , inj. clonidine 150 ?g / ml 1 ml , inj. cloxacillin 1gm , inj. cloxacillin 250 mg , inj. cloxacillin 500 mg , inj. colistimethate sod. 0.5 miu , inj. colistimethate sod. 1 miu ( 80mg ) , inj. containing etophylline 169.4 mg theophylline 50.6 mg 2 ml , inj. containing filgrastim recombinant human granulocyte colony stimulating factor ( gcsf ) 300 mcg , inj. containing essential amino acids 10% 100 ml sorbitol free , inj. containing essential amino acids 10% 20 ml , inj. containing essential amino acids 10% 200 ml , inj. containing essential amino acids 10% 50 ml , inj. containing essential amino acids 5% 20 ml , inj. containing polymer from degraded gelatin 3.5% w / v for iv infusion 500 ml , inj. containing: parentral nutrition 1000 ml , inj. containing: parentral nutrition 600 ml , inj. cotrimoxazole 80mg 5 ml , inj. cyclophosphamide 200 mg 10 ml , inj. cyclophosphamide 500 mg 25 ml , inj. cytocin arabinoside 100 mg 1ml , inj. cytocin arabinoside 500 mg 5 ml , inj. dacarbazine 200 mg , inj. dacarbazine 500 mg , inj. dactinomycin 0.5 mg , inj. daunorubicin 20 mg 10 ml , inj. deriphyllin 2ml , inj. desferrioxamine 0.5 gm , inj. dexamethasone 4 mg / ml 2ml , inj. dexmedetomidine 100mcg / ml 0.5ml , inj. dexmedetomidine 100mcg / ml 1ml , ferrous ascorbate eq. to elemental iron 30mg with folic acid 550 mcg syp 200ml , lycopene with vitamins & minerals syp. 200 ml , inj. dextran 40 plasma expender 500ml , inj. dextran 70 plasma expender 500ml , inj. dextranomer 50mg + hyaluronic acid + stabilized 15mg , inj. dextrose 10% 500 ml glass bottle , inj. dextrose 10% 500 ml ffs bottle , inj. dextrose 10% with sod. chloride 0.9% 500 ml ffs bottle , inj. dextrose 10% with sod. chloride 0.9% 500 ml glass bottle , inj. dextrose 25% 100 ml glass bottle , inj. dextrose 25% 100 ml ffs bottle , inj. dextrose 5% 500 ml glass bottle , inj. dextrose 5% 500 ml ffs bottle , inj. dextrose 5% with sod. chloride 0.9% 500 ml ffs bottle , inj. dextrose 5% with sod. chloride 0.9% 500 ml glass bottle , inj. dextrose 5% 500 ml , inj. diazepam 5 mg / ml 2 ml , inj. diclofenac sodium 75mg 3 ml ( im ) , inj. diclofenac sodium 75mg 3 ml ( iv ) , inj. dicyclomine 10 mg / ml 2 ml , inj. digoxin 0.25 mg / ml 2 ml , inj. dobutamine 50 mg / ml 5 ml , inj. dopamine 40 mg / ml 5 ml , inj. dorepenem 250mg , inj. dorepenem 500mg , inj. doxorubicin 10 mg 5 ml , inj. doxycycline 100mg , inj. drotaverin 20mg , inj. electrolyte fluid isotonic plasma adopted 500 ml , inj. electrolyte g 5% 500 ml glass bottle , antioxidant with multivitamin & multiminerals 200 ml syp. , inj. electrolyte g 5% 500 ml ffs bottle , inj. electrolyte m 5% 500 ml glass bottle , inj. electrolyte m 5% 500 ml ffs bottle , inj. electrolyte p 10% 500 ml ffs bottle , inj. electrolyte p 10% 500 ml glass bottle , inj. electrolyte p 5% 500 ml glass bottle , inj. electrolyte p 5% 500 ml ffs bottle , inj. epirubicin 10 mg , inj. epirubicin 100 mg , inj. ertapenem 1gm , inj. esmolol hcl. 100 mg , inj. esomeprazole 40mg , inj. espentaprazole 20 mg , inj. etomidate 1% 10 ml , inj. etoposide 100 mg , inj. etoposide 50mg , inj. factor ix 500 iu , inj. factor ix 600 iu , inj. factor viii 1000 iu , inj. factor viii 250 iu , inj. factor viii 500 iu , inj. fat emulsion 20% 250ml , inj. fat emulsion 20%100ml , inj. fentanyl citrate 100 mg 2 ml , inj. flucloxacillin sodium 1 gm , inj. flucloxacillin sodium 500mg , inj. fluconazole 200mg 100 ml , inj. fluconazole 50mg / 25ml , inj. flumazenil 0.1mg / ml , inj. fosfomycin 4gm , inj. fosphenytoin 150 mg 2 ml , inj. frusemide 10 mg / ml 2ml , inj. gadodiamide 287 mg / ml 0.5 mm 0l / ml 10ml , inj. gadopentetate di meglumine 469mg / ml 10 ml , inj. gadopentetate di meglumine 469mg / ml 20 ml , inj. gemcitabine 1 gm , inj. gemcitabine 200 mg , inj. gencyclovir 1gm , inj. gentamicin 80 mg 2 ml , inj. glutathione 600mg , inj. glycopyrolate 0.2 mg / ml 10ml , inj. glycopyrolate 0.2 mg / ml 1ml , inj. glycopyrolate 0.5 mg + neostigmine 2.5 mg 5 ml , inj. granisetron 1mg / ml 3ml , inj. haemocoagulase 1 ml , inj. heaprin 10u / ml ( 10ml ) , inj. heparin 1000 iu / ml 5ml , inj. heparin 5000 iu / ml 5ml , inj. hepatitis –b immunoglobulin 100 iu iv 1ml , inj. hepatitis –b immunoglobulin 100 iu iv 2ml , inj. hepatitis –b immunoglobulin 100 iu im , inj. hepatitis –b immunoglobulin 200 iu im , inj. hepatitis –b immunoglobulin 200 iu sc , inj. hepatitis –b immunoglobulin 500 iu iv 10ml , inj. hepatitis –b immunoglobulin 500 iu iv 3ml , inj. human albumin 20% 100 ml , inj. human albumin 20% 50 ml , inj. human albumin 5% 100 ml , inj. human anti tetanus immuno globulin 250 iu , inj. human anti tetanus immuno globulin 500 iu , inj. human chorionic gonadotropin 1000 iu , inj. human chorionic gonadotropin 2000 iu , inj. human chorionic gonadotropin 5000 iu , inj. human erythropoetin 1000 iu , inj. human erythropoetin 10000 iu , inj. human erythropoetin 2000 iu , inj. human erythropoetin 4000 iu , inj. human growth hormone 4mg , inj. hydrocortisone sodium succinate 100 mg , inj. hydroxocobalamine 1ml , inj. hyoscine butyl bromide 20mg / ml 1 ml , inj. ifosfamide 1 gm , inj. ifosfamide with mesna , inj. igm enriched immunoglobulin 0.5gm / 100ml , inj. igm enriched immunoglobulin 2.5gm / 50ml , inj. igm enriched immunoglobulin 5gm / 10ml , inj. imiglucerase 400iu 10ml , inj. imipenam 125 mg + cilastatin 125 mg , inj. imipenam 250 mg + cilastatin 250 mg , inj. imipenam 500 mg + cilastatin 500 mg , inj. imipenam 62.50 mg + cilastatin 62.50 mg , inj. indomethacin lyophilized powder 1mg , inj. insulin glargine 100iu / ml 3ml pen , inj. insulin glargine 100iu / ml 3ml , inj. insulin lispro 100iu / ml 3ml pen , inj. insulin lispro 100iu / ml 3ml , inj. insulin lispro 25 / 75 100iu / ml 3ml , inj. insulin lispro 25 / 75 100iu / ml 3ml pen , inj. insulin mixtard 30 / 70 40 iu 10 ml , inj. insulin nph , inj. insulin regular 40 iu / ml10 ml , inj. iohexol 300 mg / ml 10 ml , inj. iohexol 300 mg / ml 20 ml , inj. iohexol 300 mg / ml 50 ml , inj. iohexol 350 mg 50 ml , inj. iopamidol 612.4mg equivalent to 300 mg iodine / ml 20 ml , inj. iron sucrose 2.5ml , inj. iron sucrose 5ml , inj. isoprenaline 2mg , inj. isotonic human albumin 5% 250 ml , human normal immunoglobulin for iv administration 5% 100 ml , human normal immunoglobulin for iv administration 5% 50 ml , inj. ketamine 50 mg / ml 10 ml , inj. labetalol hydrochloride 5mg / ml 20 mg , inj. lacosamide 200mg / 20 ml , inj. l asparaginase 10000 iu , inj. l asparaginase 5000 iu , inj. leucovorin 10mg ( inj. calcium folinate ) , inj. levetiracetam 500mg , inj. levofloxacin 5mg / ml 100 ml , inj. lidocaine hydrochloride 1% 20 mg , inj. lignocaine 2% with adrenaline 30 ml , inj. lignocaine 2% 30 ml , inj. lincomycin 300 mg / ml 1 ml , inj. lincomycin 300 mg / ml 2 ml , inj. linezolid 200 mg 100 ml , inj. low molucular weight heparin 40 mg , inj. low molucular weight heparin 60 mg , inj. lorazepam 2mg / ml 2 ml , inj. l ornithine l aspartate 5 gm 10 ml , inj. magnesium sulphate 50 mg / ml 2ml , ferric ammonium citrate 200mg + cyanocobalamin 7.5mcg + folic acid 0.5mg +zinc sulphate 7mg + pyridoxine 1.5mg syp. 450 ml , inj. mannitol 10% + glycerine 10% 100 ml ffs bottle , inj. mannitol 10% + glycerine 10% 100 ml glass bottle , ferrous ammonium citrate 160mg+cyanocobalamine 7.5mcg+folic acid 500mg syp. 200 ml , inj. mannitol 20% 100 ml ffs bottle , inj. mannitol 20% 100 ml glass bottle , inj. melatonin 2ml , inj. menadione 10mg / ml 1 ml ( menaphthone ) , inj. meropenem 1.0 gm , inj. meropenem 250 mg , inj. meropenem 500 mg , inj. mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , inj. methotrexate 15mg , inj. methotrexate 50 mg , inj. methotrexate 500 mg , inj. methyl prednisolone 125 mg , inj. methyl prednisolone 500 mg , inj. methylcobalamine 1500mcg , inj. methylcobalamine 1000 mcg + pyridoxine 100mg + nicotinamide 10mg+ d panthenol 50mg, 2ml , inj. metoclopramide 5 mg / ml 2 ml , inj. metoprolol 5mg , inj. metronidazole 0.5% 100 ml ffs bottle , inj. metronidazole 0.5% 100 ml glass bottle , inj. micafungin 100mg , inj. micafungin 50mg , inj. midazolam 1 mg / ml 10 ml , inj. midazolam 1 mg / ml 5 ml , inj. midazolam 5mg / ml 1 ml , inj. milrinone 10mg / 10ml , inj. milrinone lactate 1mg / ml 10ml , inj. milrinone lactate 1mg / ml 20ml , inj. minocycline 100mg , inj. multi vitamins 10 ml , inj. naloxone 0.4mg / ml , inj. neostigmine 0.5 mg / ml 1 ml , inj. neostigmine 0.5 mg / ml 5 ml , inj. netilmycin 10 mg , inj. netilmycin 100 mg , inj. netilmycin 25 mg , inj. netilmycin 50 mg , inj. nitroglycerin 5mg / ml 10 ml , inj. nor adrenaline 2 mg / ml 2ml , inj. octreotide 50mcg / ml 1 ml , inj. ofloxacin 200 mg / 100 ml , inj. ofloxacin 200mg + ornidazole 500mg 100ml , inj. omeprazole 40 mg , inj. ondansetron 2mg / ml 2 ml , inj. ornidazole 500mg / 100 ml , peritoneal dialysis fluid 1000 ml , peritoneal dialysis fluid 2000 ml , inj. pamidronate 30mg , inj. pamidronate 60mg , inj. paracetamol 150 mg / ml 2 ml , inj. paracetamol iv 1gm 100 ml , inj. peg asparaginase 3750 iu 5 ml , inj. pentaprazole 40 mg , inj. pentastarch / hydroxyethylstarch 3% 500ml , inj. pentastarch / hydroxyethylstarch 6% 500 ml , inj. pentazocine 30 mg / ml 1 ml , inj. pheniramine maleate 22.75 mg / ml 2 ml , inj. phenobarbitone 200 mg 1 ml , inj. phenytoin sodium 50 mg / ml 2ml , inj. physostigmine 2mg / 2ml , inj. phytomenadione 10mg 1ml , inj. phytomenadione 1mg 0.5ml , inj. piperacillin 1 gm + tazobactum 125 mg , inj. piperacillin 2 gm + tazobactum 250 mg , inj. piperacillin 4 gm + tazobactum 500 mg , inj. polymixin b 500000 iu , inj. potassium chloride 15% 10ml , inj. pralidoxime 500mg ( aq , inj. promethazine 25 mg / ml 2 ml , inj. propofol 10 mg / ml 10 ml , inj. propofol 10 mg / ml 20 ml , inj. propofol mct / lct 1% 10 ml , inj. propofol mct / lct 1% 20 ml , inj. prostaglandin 500 mcg 1 ml ( alprostil ) , inj. protamine sulphate 10mg / ml , inj. pyridoxine 100mg / ml 1ml , inj. quinine 300 mg / ml 2 ml , inj. rabeprazole 40 mg , inj. ranibizumab 0.5mg , inj. ranibizumab 2.3 mg single use vial , inj. ranitidine 25 mg / ml 2 ml , inj. recombinant factor rfviia 1mg , inj. recombinant factor rfviia 2mg , inj. recombinant factor rfviia 3mg , inj. recombinant tissue plasminogen activator ( reteplase ) kit 18 mg , inj. ringer lactate 500 ml ffs bottle , inj. ringer lactate 500 ml glass bottle , inj. rituximab 10mg / ml 10 ml , inj. rituximab 10mg / ml 50 ml , inj. rocuronium br. 50 mg 5 ml , inj. romiplostim 250mcg / 0.5ml , inj. ropivacaine 0.2% , inj. sildenafil citrate 10mg / 12.5ml , inj. sodium bi carbonate 7.5% 10ml , inj. sodium chloride 0.45% 500 ml ffs bottle , inj. sodium chloride 0.45% 500 ml glass bottle , inj. sodium chloride 0.9% 100 ml ffs bottle , inj. sodium chloride 0.9% 100 ml glass bottle , inj. sodium chloride 0.9% 500 ml ffs bottle , inj. sodium chloride 0.9% 500 ml glass bottle , inj. sodium chloride 3% 100 ml ffs bottle , inj. sodium chloride 3% 100 ml glass bottle , inj. sodium meglumine diatrazide 20 ml 60% , inj. sodium meglumine diatrazide 20 ml 76% , inj. sodium nitropruside 50mg / 2ml , inj. sodium valproate 100mg / ml 5 ml , inj. steptomycin 0.75gm , inj. sterile water 10 ml , inj. streptokinase 15lac , inj. streptomycin 0.75 gm , inj. succinyl choline 50 mg / ml 10 ml , inj. teicoplanin 200 mg , inj. teicoplanin 400 mg , inj. terbutaline 0.5 mg 1 ml , inj. terlipressin 0.1mg / ml 10ml , inj. testosterone 100 mg / ml , inj. testosterone 25mg / ml 1ml , inj. tetanus toxoid 0.5 ml , inj. tetrastarch isotonic plasma adopted 6% 500 ml , inj. thiopentone sod. 0.5 gm , inj. thiopentone sod. 1 gm , inj. ticarcilin 3.0 gm + clavulinic acid 100 mg , inj. tigecycline 50 mg , inj. tobramycin 20 mg , inj. tobramycin 40 mg , inj. tobramycin 80 mg , inj. tocilizumab 200 mg , inj. topotecan 1 mg / ml 4 ml , inj. trace elements 3ml ( chromium chloride+cupric sulphate+magnesium sulphate+selenious acid ) , inj. tramadol 50 mg / ml 1 ml , inj. tramadol 50 mg / ml 2 ml , inj. tranexanic acid 100 mg , inj. trastuzumab 150mg , inj. trastuzumab 440mg , inj. vancomycin 250 mg , inj. vancomycin 500 mg , inj. vasopressin 20unit / ml 1mg , inj. vecuronium 10mg / 5 ml , inj. vecuronium 4 mg 2ml , inj. vinblastine 10mg 2 ml , inj. vincristin 1 mg 2 ml , inj. vitamin a 40000 iu / ml 2.5 ml , inj. vitamin b1 , inj. vitamin b1+ b6+ b12 3 ml , inj. vitamin b12 3 ml , inj. vitamin b6 100 mg / ml 2 ml , inj. vitamin d3 600000 iu / ml 1ml , inj. voriconazole 200 mg , inj. ?ß arteether 75mg / ml 1ml , inj. ?ß arteether 75mg / ml 2ml , inj.acetylcysteine 20% mu , intralipid 20% 100ml , irinotecan 20mg inj , iron fortified baby cereals ( oats khichdi ) 300gm , iron fortified baby cereals ( rice + ragirice+wheat apple ) 300 gm , iron fortified infant cereal 125 gm , isoflurane 100 ml , isoflurane 250 ml , isoflurane 30 ml , jelly lignocaine 2% 30gm , powder calcium polystyrene sulphate 5gm , ketaconazole 2% shampoo 100 ml , ketoconazole 200mg tab , ketocozole shampoo 1% 100 ml , ketorolac tromethamine 10 mg , lactose free & alpha amylase baby weaning food approx 400gm , lactose free baby weaning food approx 400gm , lactose free formula feed 400 gm , lbw infant milk formula approx 500gm , levamisole 150mg tab , levamisole 50mg tab , levetiracetam 100 mg inj , levetiracetam 500mg tab. , levocarnitin inj 4mg / 5ml , levocarnitine tab 500 mg , levocetirizine syp 30 ml , levodopa 250 mg +carbidopa 25 mg tab. , levofloxacin 60ml syp , lidocaine 2% w / w + choline salicylate 8.7% w / w + benzalkonium chloride 0.01% w / w 20 gm , lignocaine 2% w / w + choline salicylate 8.7% w / w + benzalkonium chloride 0.01% w / w , 10 gm , lignocaine spray 10% 30 ml , lipid extract surfactant bovine containing: phospholipid approx 25 30mg / ml 5 ml , lipid extract surfactant bovine containing: phospholipid approx 25 30mg / ml 8 ml , lipid extract surfactant bovine containing: phospholipid approx 25 30mg / ml 1.5 ml , lipid extract surfactant bovine containing: phospholipid approx 25 30mg / ml 3 ml , lipid extract surfactant bovine containing: phospholipid approx 25 30mg / ml 4 ml , lipid extract surfactant porcine 80mg / ml 1.5 ml , lipid extract surfactant porcine 80mg / ml 3 ml , liquid paraffin 100 ml , liquid paraffin 400 ml , lotion haemocoagulase 10 ml , lotion beclomethasone 0.05% w / w 60 ml , lotion betamethasone 30ml , lotion calamine 100ml , lotion calamine 50ml , lotion containing calamine + zinc oxide 100 ml , low birth weight infant milk substitute approx 400gm , low birth weight infant milk substitute lactose free approx 400gm , low birth weight infant milk substitute sucrose free approx 400gm , magnesium sulphate oint. 75gm , medium chain triglycerides oil 100 ml , medium chain triglycerides oil 50 ml , hemocoagulase nasal packing , metronidazole gel 1.0% , barium sulphate ( microbar ) 300 gm , midazolam nasal spray 0.5 mg , minoxidil 5mg tab , mometasone nasal spray 50 mcg , montelukast 10 mg & fexofenadin 20 mg tab , polyethylene glycol, sodium chloride, sodium bi carbonate, potassium chloride for oral solution 6.85 gm , mycophenolate sodium 180mg tab , naphazoline +chlorphenraimine+methylcellulose eye drop 10 ml , infant formula powder 0 12 month baby 400 gm powder , neomycin sulph cream 10gm , nitazoxanide 200mg tab , nitisinone 10mg tab , nitisinone 2 mg tab , nitisinone 5mg tab , norethisterone 5mg tab , oint momentasone 1mg, 10gm , oint mupirocin 2% 5gm , oint. clobetasol 0.05%, 20 gm , oint. clobetasol propionate + ofloxacin + miconazole + terbinafine hydrochloride + dexpanthenol 15 gm , oint. clobetasol propionate + ofloxacin + ornidazole + itraconazole + 30 gm , oint. clobetasol propionate 0.5% + ofloxacin 0.75% + ornidazole 2% + terbinafine hydrochloride 1%, 15 gm , oint. clobetasol+salcylic acid 20 gm , oint. containing per gm heparin 50 iu benzyl nicotinate 2 mg 20 gm , oint. containing: neomycin bacitracin polymyxin –b zinc 20 gm , oint. desonide 0.05%, 10gm , oint. fluconazole 0.5% 15 gm , oint. fluticosone 0.005% 20gm , oint. hydrocortisone 20 gm , oint. itraconazole 15 gm , oint. lignocaine 5% 20 gm , oint. luliconazole 1%w / w 20gm , oint. magnesium sulphate 58% +urea 1% + sulphacetamide 2.5% + proflavin 0.01%, glycerin base, 75gm , oint. neomycin 20 gm , oint. neomycin 5mg + bacitracin 500iu / gm 20 gm , oint. povidone iodine 15gm , oint. povidone iodine 5% & metronidazole 1%, 15gm , oint. povidone iodine 5% 15 gm , oint. povidone iodine 5% 250 gm , oint. propylene glycol 4.96% w / w, carbomer 0.76% w / w, silver colloid 32 ppm, triethanolamine 0.32% , oint. salicylic acid 20 gm , oint. sodium fusidate 15 gm , oint. triamcinolone acetonide 0.5% 15 gm , oint. zinc oxide 20gm , ointment itraconazole 15 gm , ointment lignocaine+cholin 10 gm , ointment lignocaine+cholin+benz 15 gm , ointment metro+povidone 2% 15 gm , oral rehydration salts ( who formula ) 20 gm , oral soln. caffeine citrate 20mg / ml 1 ml , oral soln. caffeine citrate 20mg / ml 1.5 ml , oral soln. caffeine citrate 20mg / ml 2ml , oral soln. caffeine citrate 20mg / ml 3ml , ear drop 4 carboxymethylamino 4 amino diphenyl sulphone, dibucaine and n, n dihydroxymethyl carbamide 10 ml , oxcarbazepine syp 60 ml , poly ethy.glycol sachet 17 gm , potassium phophates inj 15ml , powder calcium polystyrene sulphate 15gm , powder neomycin 5 mg + bacitracin 250units+ sulphacetamide 60mg 10 gm , pre term & lbw formula whey protien 400gm , probiotic amp.5 ml , probiotic blend 10 bilion cfu sachet 5 gm , probiotic susp. 5 ml , protein powder 200gm , pulv sodium benzoate 100 gm , reagent test strips for crp , reagent test strips for hs crp , reagent test strips for procalcitonin , recombinanat factor ix 250 iu in 5ml dilution. , recombinanat factor ix 500 iu in 5ml dilution. , rectal route diazepam 2mg / ml 2.5 ml , resp. ambroxol 15mg 2 ml , resp. budisonide 0.5 mg salbutamol 2.5 mg 2.5 ml , resp. budisonide 0.5 mg / ml 2ml , resp. levo salbutamol 0.31 mg 2.5 ml , resp. levo salbutamol 0.63 mg 2.5 ml , resp. salbutamol 2.5 mg + ipratropium 500 mcg 2.5 ml , resp. salbutamol 2.5 mg / 2.5 ml , rho ( d ) immuno globulin ( human ) 300mcg polyclonal iv , rho ( d ) immunoglobulin ( human ) 150mcg im , rho ( d ) immunoglobulin ( human ) 150mcg polyclonal iv , rho ( d ) immunoglobulin ( human ) 300mcg im , riboflavin+folic acid+ niacinamide + lactic acid tab. , dry powder inhaler capsule salbutamol 200mcg , dry powder inhaler capsule beclomethasone 100mcg + levosalbutamol 100mcg , dry powder inhaler capsule beclomethasone 50mcg + levosalbutamol 50mcg , dry powder inhaler capsule budesonide 100 mcg + formoterol fumarate 6 mcg. , dry powder inhaler capsule budesonide 100mcg , dry powder inhaler capsule budesonide 200 mcg + formoterol fumarate 6 mcg. , dry powder inhaler capsule budesonide 200mcg , dry powder inhaler capsule budesonide 400 mcg + formoterol fumarate 6 mcg. , dry powder inhaler capsule budesonide 400mcg , dry powder inhaler capsule salbutamol 200mcg , dry powder capsule inhalation device , rapid urease test kit for h pylori , sterile water for irrigation 500 ml , sachet calcium polystyrene sulphonate 15gm , sachet cholecalciferol 60, 000 iu / 1gm , sachet cholestyramine 5gm , sachet esomeprazole junior 10 mg 1gm , sachet glutamine 10gm , sachet glutamine 5gm , sachet human milk fortifier 1gm , sachet human milk fortifier 2gm , sachet lactobacillus 150 million 1gm , sachet potassium chloride, sodium bicarbonate, polyethylene glycol, sodium chloride, and sodium sulphate 6.85 gm , sachet polyethyene glycol + sodium chloride+ sodium bi carbonate+ potassium chloride 137.15 gm , sachet probiotics not less than 1.25 billion cells in1gm , sachet probiotics not less than 1.25 billion cells with zinc 1 gm , sachet racecadotril 10mg , sachet racecadotril 30mg , sachet saccharomyces boulardi 282.5mg , sachet sodium acid phosphate 500mg , sodium bi carbonate 300 ml syp , sachet sodium benzoate 5 gm , sachet vigabatrin 500 mg , sachet vitamin e 5 gm , sevoflurane 250 ml , shampoo ketaconazole 2% 100 ml , sildenafil citrate 50mg tab , silver nitrate powder 25 gm , skin cream containing calamine 1.5% zinc oxide 7.5% simethicone / dimethicone 20% 20gm , skin cream containing clotrimazole 1% beclomethasone 0.025% neomycin 0.5% 10gm , sodium benzoate powder 100 gm , sodium hypochlorite 4% 5 ltr , sodium phosphate enema 100 ml , sodium di chloroi socyanurate effervesent tablets 500 mg , soln. haemocoaglunase 10 ml , soln. risdiplam 0.75mg / 1 ml , soln. salbutamol 2.5 mg 10ml , soln. vitamin a conc. 50 ml , soy oil free amino acid based hypoallergenic formula for cow milk protein allergy babies 400 gm , soya milk 200 ml , sublingual cap nicardia 10mg , sublingual cap nicardia 5mg , sucrose free soln. 24% 2ml , suppository bisacodyl 10mg , suppository diclofenac 100mg , suppository glycerine 3 gm , suppository paracetamol 120 mg , suppository paracetamol 170 mg , suppository paracetamol 250 mg , suppository paracetamol 325 mg , suppository paracetamol 80 mg , susp sodium bicarbonate 15ml / 1000mg , susp. erythromycin 125mg / 5ml 30ml , syp nitrofurantoin 100 ml , syp fungal diastase 50mg +pepsin10mg+dill oil mg+ caraway oil 1mg+ anise oil 1mg 200 ml , syp. aceclofenac 50mg +pcm 125mg 60ml , syp. artemether 40mg + lumefantrine 240 mg 30ml , syp. deflazacort 6mg / 5ml 30 ml , syp. baclofen 1mg / 1 ml 100 ml , syp. b complex 200ml , syp. caffeine 50mg + melatonin 3mg 5ml , syp. cefadroxil 30 ml , syp. cephalexin 125mg 60 ml , syp. cetirizine 2.5 mg + dextromethorphen 10mg + phenylephrine 5mg paracetamol 250mg 60ml , syp. cetirizine 2.5mg + phenylepherine 2.5mg + paracetamol 125mg 30 ml , syp. cetirizine 2.5mg + phenylepherine 5mg + paracetamol 250mg 60 ml , syp. cetirizine 2.5mg + phenylepherine 2.5mg 60 ml , syp. chloroquine 60 ml , syp. chlorpheniramine maleate 1mg + phenylepherine 2.5mg + paracetamol 125mg 30 ml , syp. chlorpheniramine maleate 1mg + phenylepherine 5mg + paracetamol 250mg 60 ml , syp. ciprofloxacin 60 ml , syp. clarithromycin 30ml , syp. clobazam 2.5mg 1ml , syp. dextromethorphan 10mg +phenylephrine 5mg+chlorphenaramine 2mg100 ml , syp. dextromethorphan hydrobromide + chlorpheniramine maleate 2mg + phenylepherine 5mg 100 ml , syp. dextromethorphan hydrobromide + chlorpheniramine maleate 2mg + phenylepherine 5mg 60 ml , syp. dicyclomine hcl + mefenemic acid 30 ml , syp. dicyclomine simethicone 60 ml , syp. disodium hydrogen citrate 0.335gm / 5ml, 100ml , syp. terbutaline 1.25mg+bromhexine 2mg+guaiphenesin 50mg+menthol0.5mg 100 ml , syp. erythromycin 60 ml , syp. ethosuximide 100 ml , syp. fexofenadine 100ml , syp. iron histidine 30mg / 5ml , syp. l carnosine 100mg / 5ml, 200 ml , syp. levocetirizine 2, 5mg+ montelukast 4mg 60ml , syp. levocetirizine 2.5mg / 5ml 30 ml , syp. levocetirizine2.5mg + montelukast 4mg 30 ml , syp. levocetirizine2.5mg + montelukast 4mg 60 ml , syp. levofloxacin 60 ml , syp. levosalbutamol sulphate+ambroxol hydrochloride +guaiphenesin 1mg / 5ml 100 ml , syp. magnesium citrate malate 150mg l glutamic acid 25 mg 10 ml , syp. mefenamic acid + dicyclom 30 ml , syp. mefenemic acid 50 mg + paracetamol 250 mg 60 ml , syp. mefenemic acid 50 mg + paracetamol 125 mg 60 ml , syp. melatonin 3mg / 5ml 60 ml , drop. melatonin 1mg / ml 5ml , syp. metronidazol 100 ml , syp. montelukast + levocetirizine 60ml , syp. nitazoxanide 100mg / 5ml 30 ml , syp. ofloxacin & ornidazole 60ml , syp. ofloxacin 60ml , syp. ofloxacin+metronidazole 60 ml , syp. ondansetron 2mg / 5ml 60 ml , syp. oseltamivir 60ml , syp. oxcarbamazepine 300mg / 5ml 100 ml , syp. phenobarbitone 100ml , syp. phenytoin 25mg / ml 200 ml , syp. phenytoin 30mg / 5ml 200 ml , syp. picosulfate 100 ml , syp. posaconaxole 105 ml , syp. potassium citrate 1100mg + citric acid 334 mg 200 ml , syp. pseudoephedrine 30mg + dextromethorphen 10mg + cetirizine 5 mg 60ml , syp. ranitidine 75mg / 5ml 100 ml , syp. risperidone 1mg / 1ml 30 ml , syp. sildenafil 10mg / ml 112 ml , syp. sodium benzoate 100 ml , syp. sodium picosulphate 100 ml , syp. sorbitol and tricholine citrate 100 ml , syp.. colistimethate 60 ml , syr. vitamin e 200 ml , syr. acyclovir 400 mg / 5ml 50ml , syr. albendazole 200mg / 5ml 10ml , syr. amoxicillin 125 mg / 5 ml 60 ml , syr. azithromycin 100mg / 5ml 15 ml , syr. azithromycin 100mg / 5ml 60 ml , syr. azithromycin 200mg / 5ml 15 ml , syr. azithromycin 200mg / 5ml 60 ml , syr. bromhexine 4mg / 5ml 120 ml , syr. calcium phosphate 200 ml , syr. cyproheptadine 2mg+tricholine citrate ( 66% ) 275gm, sorbitol ( 70% ) 2gm 200 ml , syr. carbamazepine 100mg / 5ml 100ml , syr. cefadroxyl 125 mg / 5 ml 30 ml , syr. cefixime 50mg / 5ml 30 ml , syr. cefpodoxime 50mg / 5ml 30 ml , syr. cefuroxime 125mg / 5ml 30ml , syr. cephalexin 125mg / 5ml 30ml , syr. cetirizine 5mg / 5ml 30 ml , syr. chloroquine 50 mg / 5 ml 60 ml , syr. chlorpheniramine 4mg / 5ml 60ml , syr. ciprofloxacin 250mg / 10ml 60ml , syr. clarithromycin 125mg / 5ml 30 ml , syr. containing : diatrizoic acid salts meglumine 66% sodium 10% iodine content 370 mg / ml 30 ml , syr. containing : each 5 ml amoxicillin 200 mg clavulinic acid 28.5 mg 30ml , syr. containing : each 5 ml amoxicillin 400 mg clavulinic acid 57 mg 30ml , syr. containing each 5 ml ambroxol 15mg salbutamol 1 mg 100 ml , syr. containing each 5ml calcium carbonate + vit. d3 100 ml , syr. containing each 5ml calcium salts 250 mg 100 ml , syr. containing each 5ml calcium salts 250 mg 200 ml , syr. cotrimoxazole 40 mg + 200 mg / 5 ml 50 ml , syr. cyclosporine 100mg / ml 50ml , syr. cyproheptadine 2mg / 5ml 200ml , syr. dicyclomine 10mg / 5ml 30ml , syr. dicyclomine simemethicon 30 ml , syr. digoxin 0.05mg / ml 60 ml , syr. docusate 20mg / 5ml 100ml , syr. domperidone 5mg / 5ml 30ml , syr. each 15 ml contains: milk of magnesia 1.25 ml liquid paraffin 3.75 ml sodium picosulfate 3.33mg 170 ml , syr. each 5 ml containing ofloxacin 50mg+ ornidazole 125mg 30 ml , syr. each 5 ml containing paracetamol 125 mg + ibuprofen 100 mg 60 ml , syr. each 5 ml contains: chlorpheniramine 2.5mg ammonium chloride 125mg 100 ml , syr. each 5ml containing chlorpheniramine 2mg + phenylepherine 5mg 60ml , syr. elemental zinc 20 mg / 5ml 60 ml , syr. enzymes 200 ml , syr. fluconazole 10mg / ml 30 ml , syr. fluconazole 50 ml , syr. frusemide 10mg / ml 30ml , syr. hydroxyzine 10mg / 5ml 100 ml , syr. ibuprofen 100mg / 5ml 60ml , syr. iron 100mg / 5ml 100 ml , syr. iron 100mg / 5ml 200 ml , syr. lactulose 10 gm / 15 ml 100 ml , syr. lecithin 125mg with silymarin 35mg 200 ml , syr. levetiracetam 100mg / ml 100 ml , syr. levo carnitine 500 mg / 5ml 30ml , syr. levosalbutamol 1mg / 5ml 100 ml , syr. linezolid 100mg / 5ml 30ml , syr. magnesium sulphate , syr. methyl cobalamine with zinc 200ml , syr. metoclopramide 5mg / 5ml 30 ml , syr. metronidazole 100mg + norfloxacin 100mg / 5ml 60ml , syr. metronidazole 200 mg 60 ml , syr. multivitamin 200 ml , syr. multivitamin with zinc 200ml , syr. nitrofurantoin 25mg / 5ml 100ml , syr. ofloxacin 50mg / 5ml 60ml , syr. ondansetron 2mg / 5ml 30 ml , syr. paracetamol 125 mg / 5 ml 60ml , syr. pheniramine maleate 15mg / 5ml 30 ml , syr. phenobarbitone 20mg / 5ml 60ml , syr. phenytoin 30mg / 5ml 200 ml , syr. piracetam 500mg / 5ml 100 ml , syr. potassium chloride 500mg / 5ml 100ml , syr. prednisolone 5mg / 5ml 60ml , syr. ranitidine 75mg / 5ml 100 ml , syr. salbutamol 2 mg / 5 ml 100 ml , syr. sodium valproate 200 mg / 5 ml 100 ml , syr. triclophos 500 mg / 5ml 30 ml , syr. urosodeoxycholic 125mg / 5ml 100ml , syr. urosodeoxycholic 125mg / 5ml 60ml , syr. vitamin b. complex 100ml , syr. vitamin b12 100 ml , syr.tinospora cordifolia 200ml , syrup sucralfate 200 ml , tab atomoxetin 10 mg , tab atomoxetin 18 mg , tab atomoxetin 25 mg , tab atrovastatin 10mg , tab bosentan 62.5mg , tab eltrmbopag 25mg , tab eltrmbopag 50mg , tab flavoxate 200mg , tab glycopyrolate 2mg , tab imatinib 100mg , tab imatinib 400mg , tab levodopa 100mg + carbidopa 10mg , tab levodopa 250mg + carbidopa 25mg , tab levodopa+ carbidopa , tab metoprolol xl 2.5mg , tab metoprolol xl 5mg , tab mycophenolate mofetil 360 mg , tab mycophenolate mofetil 250 , tab mycophenolate mofetil 500 mg , tab nifedipine 10mg sr , tab nifedipine 20mg sr , tab nitisinone 10mg , tab nitisinone 2mg , tab nitisinone 5mg , tab praziquantal 600 mg , tab prazosin 5mg xl , tab quinine 300 mg , tab rifaximin 200mg , tab rifazmin 400mg , tab sulfasalazine , tab tofacitinib 5mg , tab vitamin k 10mg , tab warfarin 5mg , tab. diclofenac 50 mg + serratiopeptidase 10 mg. , tab. diclofenac 50 mg + serratiopeptidase 10 mg. + paracetamol 325 mg , tab. 6 mercaptopurine 50mg , tab. aceclofenac 100mg + paracetamol 325 mg+ serratiopeptidase 15mg , tab. acetazolamide 250 mg , tab. acetylcysteine 600mg , tab. nicoumalone 2mg , tab. acyclovir 200mg , tab. acyclovir 400mg , tab. albendazole 400mg , tab. alendronate 10mg , tab. alendronate 35mg , tab. alendronate 5mg , tab. alendronate 70mg , tab. allopurinol 100mg , tab. alpha d3 0.5mg , tab. alpha ketoanalogue , tab. alprazolam 0.25mg , tab. alprazolam 0.5mg , tab. amitriptyline 25mg , tab. amlodipine 10 mg , tab. amlodipine 2.5 mg , tab. amlodipine 5.0 mg , tab. amoxicillin 125 mg , tab. amoxicillin 200 mg clavulinic acid 28 mg , tab. amoxicillin 250 mg , tab. amoxicillin 250 mg clavulinic acid 125 mg , tab. amoxicillin 400 mg clavulinic acid 57 mg , tab. amoxicillin 500 mg clavulinic acid 125 mg , tab. amoxicillin 500mg + clavulinic acid 125mg + lactobacillus 60 million spores , tab. ampicillin 125 mg + cloxacillin 125 mg , tab. aripiprazole 5mg , tab. artemether 20mg + lumefantrine 120mg , tab. artemether 40mg + lumefantrine 240mg , tab. artemether 80mg + lumefantrine 480mg , tab. artesunate 150 mg , tab. artesunate 50 mg , tab. aspirin 300 mg , tab. aspirin 75 mg , tab. atenolol 25mg , tab. atroxentine 250mg , tab. azathioprine 25mg , tab. azathioprine 50mg , tab. azithromycin 100 mg , tab. azithromycin 250 mg , tab. azithromycin 500 mg , tab. baclofen 10 mg , tab. baclofen 5 mg , tab. betahistine 16mg , tab. betahistine 8mg , tab. biotin 10mg , tab. biotin 40mg , tab. biotin 5mg , tab. bisacodyl 5mg , tab. bosentan 125mg , tab. bosentan 62.5mg , tab. caffeine ( 100mg ) + ergotamine ( 1mg ) + paracetamol ( 250mg ) + prochlorperazine ( 2.5mg ) , tab. calcium containing elemental calcium 250mg , tab. calcium containing elemental calcium 500mg , tab. calcium + vit. d 3 500mg , tab. calcium lactate 300mg , tab. carbamazepine 100 mg , tab. carbamazepine 200 mg , tab. carvedilol 3.125mg , tab. cefadroxyl 250 mg , tab. cefadroxyl 500 mg , tab. cefixime 100 mg , tab. cefixime 200 mg , tab. cefpodoxime 100 mg , tab. cefpodoxime 200 mg , tab. cefpodoxime 200mg + clavulinic acid 125mg , tab. cefpodoxime 50 mg , tab. cefuroxime 125 mg , tab. cefuroxime 250 mg , tab. cephelexin 250 mg , tab. cetirizine 10 mg , tab. chloroquine 250 mg , tab. chlorpheniramine 4 mg , tab. trypsin chymotrypsin with 100000 au enzyme , tab. cilostazol 50mg , tab. ciprofloxacin 250 mg , tab. ciprofloxacin 500 mg , tab. clarithromycin 500 mg , tab. clarithromycin 250 mg , tab. clindamycin 150 mg , tab. clindamycin 300 mg , tab. clobazam 10 mg , tab. clobazam 5 mg , tab. clonazepam 0.25 mg , tab. clonazepam 0.5 mg , tab. clonazepam 1 mg , tab. clonidine 100 microgram , tab. co trimoxazole d.s , tab. containing tranexamic acid 500 mg mefenamic acid 250 mg , tab. containing trimethoprim 20 mg + sulphamethoxazole 100 mg , tab. containing trimethoprim 40 mg + sulphamethoxazole 200 mg , tab. containing trimethoprim 80 mg + sulphamethoxazole 400 mg , tab. containing: cetirizine 5mg + phenylephrine 10mg + paracetamol 325mg , tab. co trimoxazole 960 mg , tab. cyclophophamide 50mg , tab. cyclophosphamide 100mg , tab. cyclophosphamide 50mg , tab. cycloserine 250 mg , tab. cyproheptadine 4mg , tab. dapson , tab. deferasirox 190 mg ( film coated ) , tab. deferasirox 250 mg , tab. deferasirox 360 mg ( film coated ) , tab. deferasirox 500 mg , tab. deferasirox 90 mg ( film coated ) , tab. deflazacort 6 mg , tab. deflazacort 12mg , tab. deflazacort 18mg , tab. deflazacort 30mg , tab. desmopression 0.1mg , tab. desmopression 0.2mg , tab. desmopression 120mg , tab. desmopression 60mg , tab. dexamethasone 4mg , tab. diazepam 2mg , tab. diazepam 5mg , tab. diclo+serra , tab. diclofenac 100mg , tab. diclofenac 50mg , tab. diclofenac sodium 50mg + paracetamol 325 mg , tab. diclofenac sodium 50mg + paracetamol 500 mg , tab. dicyclo+mefenamic , tab. dicyclomine 10 mg + mefenemic acid 250 mg , tab. dicyclomine 10mg , tab. digoxin 0.25mg , tab. diltiazem hydrochloride , tab. domperidone 10mg , tab. drotaverine 40mg , tab. elemental zinc 10 mg , tab. elemental zinc 20 mg , tab. eltrombopag 25mg , tab. eltrombopag 50mg , tab. enalapril 2.5 mg , tab. enalapril 5 mg , tab. entacavir 0.5mg , tab. erythromycin 250 mg , tab. escitalopram 10mg , tab. esmoprazole 10mg , tab. esomeprazole 40 mg , tab. ethambutol 200mg , tab. ethambutol 400mg , tab. everolimus 5mg , tab. feropenam 200mg , tab. ferric citrate 1gm , tab. ferric citrate 210mg , tab. fexofenadine 120mg , tab. flavoxate 100mg , tab. fluconazole 150 mg , tab. fluconazole 200 mg , tab. fluconazole 50 mg , tab. flucytosine 500 mg , tab. fludrocortisone 100 , tab. flunarizine 5mg ) , tab. folic acid 5 mg , tab. folic acid 5 mg + cynocobalamin 15mcg , tab. folinic acid 15 mg , tab. formalin 800 mg to 1000 mg , tab. frusemide 100 mg , tab. frusemide 20 mg + spironolactone 50 mg , tab. frusemide 40 mg , tab. furosemide 20mg + spironolactone 50mg , tab. gencyclovir 250mg , tab. glycopyrolate 1mg , tab. haloperidol 0.5mg , tab. haloperidol 1mg , tab. haloperidol 5mg , tab. heloperidol 0.5mg , tab. hydrocortisone 100mg , tab. hydroxyzine 10mg , tab. hydroxyzine 25mg , tab. hyoscine butylbromide 10mg , tab. ibu 400mg + pcm 325mg , tab. ibuprofen 200 mg , tab. ibuprofen 400 mg , tab. imatinib 100mg , tab. imipramine 25mg , tab. imipramine 75mg , tab. iron folic acid large 100mg , tab. iron folic acid small 20mg , tab. iron with multivitamin tab. , tab. isoniazid 100mg , tab. isoniazid 300mg , tab. isoxsuprine 20mg , tab. isoxsuprine 40mg , tab. ivermectin 3mg , tab. ivermectin 6mg , tab. labetalol 100 mg , tab. labetalol 20 mg , tab. lacosamide 1000mg , tab. lacosamide 50mg , tab. lactobacillus 60 million ( lactic acid bacillus ) , tab. lamivudine 150 mg , tab. lamotrizine 100 mg , tab. lamotrizine 25 mg , tab. lamotrizine 50 mg , tab. lansoprazole 15 mg , tab. lansoprazole 30 mg , tab. nicoumalone 3 mg , tab. levamisole 150mg , tab. levamisole 50mg , tab. levetiracetam 250mg , tab. levetiracetam 500mg , tab. levo carnitine 500 mg , tab. levo cetrizine 10 mg , tab. levofloxacin 250mg , tab. linezolid 100 mg , tab. linezolid 600 mg , tab. l methylfolate, pyridoxal 5 phosphate mecobalamine 25mg , tab. loperamide hcl 2mg , tab. lorazepam 2mg , tab. losartan 100 mg , tab. losartan 25 mg , tab. losartan 50 mg , tab. mefenamic acid 500mg , tab. melatonin 10 mg , tab. melatonin 3 mg , tab. mercaptopurine 50 mg , tab. mesalamine 400mg , tab. methotrexate 10mg , tab. methotrexate 2.5mg , tab. methyl cobalamine 500 mg , tab. methyl phenidate 10mg , tab. methyl phenidate 20mg , tab. methyl prednisolone 20mg , tab. methylprednisolone 8mg , tab. metoclopramide 10mg , tab. metolazone 2.5mg , tab. metolazone 5mg , tab. metoprolol 25mg , tab. metronidazole 200 mg , tab. metronidazole 400 mg , tab. minoxidil 5mg , tab. montelucast 10 mg , tab. montelucast 10 mg levocetrizine 5 mg , tab. montelucast 4 mg levocetrizine 2.5 mg , tab. montelucast 5 mg , tab. multivitamins , tab. multivitamins containing vit a 2500 iu vit b1 2 mg vit b6 0.5mg calcium pantothenate 1mg folic acid 0.2 mg , tab. nicoumalone 1mg , tab. nicoumalone 2mg , tab. nicoumalone 3mg , tab. nifedipine 10 mg , tab. nifedipine 20mg , tab. nifedipine 5 mg , tab. nilotonib 200mg , tab. nitazoxanide 200 mg , tab. nitazoxanide 500 mg , tab. nitrazepam 10mg , tab. nitrazepam 5 mg , tab. nitrofurantoin 100mg , tab. norfloxacin 100 mg , tab. norfloxacin 200 mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. ofloxacin 200mg + ornidazole 500mg , tab. omeprazole 10 mg , tab. ondansetron 4 mg , tab. oxcarbazepine 150 mg , tab. oxcarbazepine 300 mg , tab. oxcarbazepine 600 mg , tab. oxybutynin 2.5mg , tab. oxybutynin 5mg , tab. pacitane 2mg , tab. pancreatic enzyme preparation 10000 units , tab. pancreatinin 170 mg dimethicone 80 mg , tab. pantid 200mg , tab. pantid 400mg , tab. pantoprazole + domperidone , tab. pantoprazole 40mg , tab. paracetamol 325 mg + ibuprofen 400 mg , tab. paracetamol 500 mg , tab. penicillin v 200 mg , tab. penicillin v 400 mg , tab. pentoxifylline 400 mg , tab. perampenal 2mg , tab. peran panel 4mg , tab. phenobarbitone 30 mg , tab. phenobarbitone 60 mg , tab. phenytoin sodium 100 mg , tab. phenytoin sodium 50 mg , tab. phytomenadione 10mg , tab. prazosin 2.5 mg , tab. prazosin 5 mg , tab. prazosin xl 2.5 mg , tab. prednisolone 10 mg , tab. prednisolone 20 mg , tab. prednisolone 5 mg , tab. primaquine 2.5mg , tab. primaquine 7.5mg , tab. procarbazine 20 mg , tab. procarbazine 50 mg , tab. prochlorperazine 5mg , tab. propranolol 10mg , tab. propranolol 40mg , tab. pyrazinamide 500mg ( py , tab. pyridostigmine 60mg , tab. pyridoxal phosphate , tab. pyridoxine 10 mg , tab. pyridoxine 100 mg , tab. pyridoxine 40 mg , tab. racecadotril 30mg , tab. ramipril 2.5 mg , tab. ramipril 5mg , tab. ranitidine 150 mg , tab. ranitidine 300 mg , tab. reserpine 10 mg , tab. riboflavin 50 mg , tab. rifampicin 100mg + pyrazinamide 300mg + isoniazid 50 mg , tab. rifampicin 225mg + pyrazinamide 750mg + isoniazid 150 mg , tab. rifaximine 200mg , tab. rifaximine 400mg , tab. risperidone 1 mg , tab. risperidone 2 mg , tab. rizatriptan 5mg , tab. rocicadotril kid , tab. rosuvastatin 10mg , tab. salbutamol 2mg , tab. secnidazole 500 mg , tab. serratiopeptidase 10 mg , tab. serratiopeptidase 15mg , tab. serriopeptidase 5 mg , tab. sertaline 50mg , tab. sevelamer carbonate 400mg , tab. sevelamer carbonate 800 mg , tab. sildenafil citrate 25mg effervescent. , tab. sildenafil citrate 50mg , tab. sodium benzoate 250mg , tab. sodium benzoate 500mg , tab. sodium bicarbonate 1gm , tab. sodium bicarbonate 500mg , tab. sodium valproate 200 mg , tab. sodium valproate 300 mg , tab. sodium valproate 500 mg , tab. sofosbuvir 400 mg , tab. spironolactone 100 mg , tab. spironolactone 25 mg , tab. spironolactone 50 mg , tab. sublingual nifedipine 10 mg , tab. sublingual nifedipine 5 mg , tab. sulfasalazine 500mg , tab. tacrolimus 0.5 mg , tab. tacrolimus 1 mg , tab. terbinafine 250mg , tab. tetrabenazine 25 microgram , tab. tetrabenazine 25mg , tab. thiamine 100 mg , tab. thioguanine 40 mg , tab. thyroxin 100 mcg , tab. thyroxin 25 mcg , tab. thyroxin 50 mcg , tab. tinidazole 300mg , tab. tizanidine 2 mg , tab. tofacitinib 5mg , tab. tolterodine tartrate 2mg , tab. tonofovir 300 mg , tab. topiramate 100mg , tab. topiramate 25mg , tab. topiramate 50mg , tab. torsemide 10mg , tab. torsemide 40mg , tab. tranexamic acid 500 mg , tab. trientine 250mg , tab. trientine 333mg , tab. trihexyphenidyl 2 mg , tab. trypsin chymotrypsin , tab. urosodeoxycholic 150mg , tab. urosodeoxycholic 300mg , tab. urosodeoxycholic 75mg , tab. valaciclovir 1.0gm , tab. valaciclovir 500mg , tab. valgancyclovir 450mg , tab. vigabatrin 500mg , tab. vitamin b. complex ( prophylactic ) , tab. vitamin b. complex ( therapeutic ) , tab. vitamin b12 1500 mcg , tab. vitamin b6 40 mg , tab. vitamin c 500 mg , tab. vitamin k 10 mg , tab. voriconazole 200mg , tab. voriconazole 50mg , tab. warfein 5mg ( warf ) , tab. xantinol nicotinate 500 mg , tab. zonisamide 100mg , tab. zonisamide 200mg , tab. zonisamide 25mg , tab. zonisamide 50mg , tab. / cap. coq 100mg , tab. / cap. coq 300mg , tacrolimus 0.5 mg cap , tamsulosin tab 400 mcg , terbinafine cream 15 gm , terbinafine tab 250 mg , term formula with whey protien + lactose ca:pratio 2:1 400 gm , tetanus vac , timolol eye drop 0.5% 5ml , total p.nutri. 900kcal in , tretinoin cream 30 gm , triamcinolone acetonide 15 gm , tropicamide+phenylephrine eye drop 5ml , urine ketone strip 100s , urine ph strip 100s , vac. chiken pox , vac. cholera , vac. diphtheria & tetanus , vac. diphtheria, tetanus and pertusis ( acellular component ) , vac. diphtheria, tetanus, pertusis ( acellular / wholecell component ) , hepatitis b, poliomyelitis and haemophilus type b conjugate. , vac. dtap + hib + hep.b + ipv , vac. dtap 0.5 ml , vac. dtap+ipv+hib+hep b , vac. dwpt + hep.b+ + hib , vac. h1, n1 influenza killed virus 0.25 ml , vac. h1, n1 influenza killed virus 0.5 ml , vac. hepatitis a 0.5ml live , vac. hepatitis a 0.5ml killed , vac. hepatitis b + dpt 0.5 ml , vac. hepatitis b + dpt+hib ( pfs ) , vac. hepatitis b + dpt+hib ( sd ) , vac. hepatitis b 10 mcg 0.5 ml , vac. hepatitis b 20 mcg 1ml , vac. hib , vac. hib + dpt , vac. hib+ dtap + ipv , vac. hpv , vac. inactivacted polio , vac. influenza nasal live attenuated human 0.5ml , vac. measles & rubella 0.5ml , vac. meningococcal acwy 0.5 ml , vac. meningococcal conjugate 0.5 ml , vac. mmr , vac. mmr + chicken pox , vac. pneumococcal conjugate , vac. pneumococcal polysaccharide , vac. rabies , vac. rotavirus 1 ml , vac. rotavirus 2 ml , inactivated influenza vaccine , vac. tdap 0.5 ml , vac. typhoid ( pfs ) , vac. typhoid conjugate , vac. yellow fever , vac.hepatitis a + hep. b 0.5 ml , hydrocolloid stomahesive paste 57gms , niconicate 2ml inj , xylometazoline nasal spray , hydrocolloid powder 28.3gms , midazolam spray 5mg / ml , inj. mitoxantrone 20mg , tab. thioguanine 50 mg , inj. rasbusicase 1.5mg , inj. plerixafor 20mg / ml 2 ml , tab. azacytidine 100mg , tab. azacytidine 300mg , inj. crizanlizumab , inj. idarubicin 1 mg / ml 5 ml , tab. dasatinib 50mg , inj. vinblastin 6mg , inj. arsenic trioxide 1mg / ml 10 ml , inj. busulfan 60 mg , inj. melphalan 50 mg , benzyl c 12 18 alkyl diemethyl ammonium chlorides 19.9g dodecylbispropyle tramine 5 gm surfactants, corrosion inhibitors 500 ml , combination of sodium laureth sulphate +nacl+peg7+peg120+glycerin sodium benzonate sodium salicylate perfume 500 ml , dodecyl bis propyle triamine didecyl dimethyl ammonium chloride 13.0 g surfactants, corrosion inhibitors, foam regulators, ph regulators, fragrance 1000ml , didecyldimethyl ammonium chloride 7g corrosion inhibitors fragrance, excipients q.s. 500 ml , glutaraldehyde 15.2 g 1.6 dihydroxy 2, 5 dioxahexane : 19.7 g rust inhibitors and hi tech cleansors. at 4% solution : ph value approx 7 . 500 ml , respule sodium chloride 3% 4 ml , respule iptratropium 500mcg+levosalbutamol 1.25mg 2.5 ml , fluticasone furoate 27.5mcg nasal spray , tab. montelukast 10mg+fexofenadine120mg+ambroxol 75mg sr , tab. montelukast 10mg+fexofenadine120mg , ear drop neomycin 0.5%+beclomethasone0.025%+clotrimazole1% w / v + lignocaine 2% , ear drop paradiclorobenzene 2% w / v + benzocaine 2.7% w / v + chlorbutol 5% w / v + turpentine oil 15% , cap. rabeprazole 20mg & domperidone 30 mg sr , tab. pregabalin 75 mg + nortryptaline 10mg + methylcobalamine 15mcg , fluticasone furoate 27.5mcg + azelastine 140 mcg nasal spray , lignocaine spray 10% , blood culture vial 40 ml , transfer blood bag 300 ml , triple blood bag 350ml sagm totm , quadriple blood bag 450 ml , ck nac liquid, linearity above 1500 u / l ( creatinine kinase kinetic ifcc method ) 100 ml , ck mb with control, linearity up to 2000 u / l, kinetic liquid stable will be preferred ( nadh kinetic ) with control & calibrator. 100 ml , iron liquid stable, linearity up to 600mg / dl programmable on auto analyzer ( ferrozine ) 125 ml , tibc liquid stable, linearity up to 600mg / dl programmable on auto analyzer ( ferrozine ) 125 ml , sterile sample collection universal contaier, self standing with screw cap and label. date of sterilization and expiry should be mentioned gamma irradiated. capacity 30 ml...
38101845 tender for medicine and drug purchase in district hospital hanumangarh , drug and medicine purchase , 3rd generation recombinant f viii 1000 iu with diluent injection , 3rd generation recombinant f viii 250 iu with diluent injection , acetylcystine 200mg/ml2ml injection , acth synacthen 250 mcginjection , acyclovir iv infusion250mg injection , acyclovir iv infusion 500mg injection , adalimumab 40 mg vial / ampinjection , adenosine 3mg/ml 2mlinjection , ado trastuzumab 100 mgvial / ampinjection , ado trastuzumab 160 mg vial / amp injection , adrenaline1 mg/ml (1 ml amp) injection , albumin 5% infusion injection , alha iterferoninjection , alpha beta arteether 2 mlinjection , amikacin 100 mg inj 2ml vial injection , amikacin 250 mg inj 2ml vial injection , amikacin 500 mg2ml vial injection , amino acid 10%100ml size injection , amino caproic acid 5gm/20ml injection , aminophylline 25 mg/ml10 ml amp injection , amiodarone 50mg/3ml(3ml) injection , amoxicillin and clavulanic acid 1.2gmwith diluent injection , amoxicillin and clavulanic acid 150mg(5ml) with diluent injection , amoxicillin and clavulanic acid 600mgwith diluent injection , amoxycillin & clavulanic acid 300 mgvial / ampinjection , amphotericin b inj ip 50 mg injection , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mg gel injection , ampicillin + salbactum 1.5gvial / ampinjection , ampicillin 125mg with diluent (5ml) injection , ampicillin 250mg with diluent (5ml) injection , ampicillin 500 mgwith diluent (5ml) injection , anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) injection , artisunate 120 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w/w 5ml injection , artisunate 60 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w/w 5ml injection , atezolizumab 1200 mg vial / ampinjection , atracurium besilate 10 mg/ml(10ml) injection , atracurium besilate 10 mg/ml(2.5ml) injection , atropine sulphate 0.6 mg/ml(1 ml amp ) injection , atropine sulphate 100 ml(100ml) injection , avelumab 200 mgvial / ampinjection , azacitidine 100mg vial / ampinjection , azacitidine 50mgvial / ampinjection , azetronam 1000mg (20ml) injection , azetronam 500mg (10ml) injection , azithromycin 10 ml vial equaivelent to 500 mginjection , bacitracin for25,000 iuvial / ampinjection , balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag injection , balanced salt calcium free 500 ml [solution], non pvc polyolefin sterile free flex bag injection , bendamustine100 mg injection , benzathine benzylpenicillin10 lac units (600 mg benzylpenicillin)(vial) injection , benzathine benzylpenicillin 12 lac units(vial) injection , benzathine benzylpenicillin 24 lac units(vial) injection , benzathine benzylpenicillin 6 lac units(vial) injection , betamethasone sodium phosphate 4 mg/ml(1 ml vial) injection , bevacizumab100 mg injection , bevacizumab400 mg injection , biphasic isophane insulin30/70 (30% soluble insulin & 70% isophane insulin)40 iu / ml (10 ml vial) injection , bleomycin 15mginjection , bortezomib2.5 mg injection , botrophage(haemocagulase enzyme) (1ml) injection , botulinum toxin type a for /botulinum toxin type b for 100 iuvial / ampinjection , botulinum toxin type a for /botulinum toxin type b for 50 iuvial / ampinjection , bupernorphineinjection , bupernorphine transdermal patch 5mcg/hr injection , bupivacaine0.25% (20 ml vial) injection , bupivacaine0.5% (20ml vial) injection , bupivacaine hydrochloride in dextrose 5mg+80mg per ml (4 ml amp) injection , busulfan 60mg/1mlvial / ampinjection , butrophanol tartrate 1mg/ml(1ml) injection , butrophanol tartrate 2mg/ml(1ml) injection , cabazitaxel 20 mgvial / ampinjection , cabazitaxel 40 mgvial / ampinjection , caffein citrate 20 mg/ ml ( 1 ml ) injection , caffein citrate 20 mg/ ml ( 2 ml ) injection , caffein citrate 20 mg/ ml ( 3 ml ) injection , calcium chloride 5ml vialvial / amp injection , calcium folinate injection , calcium gluconate 10%(10 ml amp ) injection , camylofin hcl 25mg/ml(2ml) injection , carbetocin 1ml/100micro.vial / amp injection , carboplatin 150mg (15 ml) injection , carboplatin 450mg (45 ml) injection , carboprost tromethamine 250 mcg/ml(1ml) injection , carfilzomib 20 mg vial / amp injection , carfilzomib 60 mg vial / amp injection , carmustine 100 mgvial / ampinjection , caspofungin 50 mgvial / ampinjection , caspofungin 70 mgvial / amp injection , cefepime 500 mgwith diluent injection , cefipime 1000mg + tazobactum 125mgvial / ampinjection , cefoperazone 1gm+tazobactum 125mgvial / ampinjection , cefoperazone 1mg vial / ampinjection , cefoperazone 500mgvial / amp injection , cefoperazone and sulbactum 1 g + 0.5 gwith diluent injection , cefotaxime 1 gm+dw (30ml) injection , cefotaxime 250 mgwith diluent injection , cefotaxime with sulbactum (250+125)mg with diluent injection , ceftazidime 1 gmwith diluent injection , ceftazidime 1gm+sulbactam500 mgvial / amp injection , ceftazidime 250 mgwith diluent injection , ceftazidime 500 mgwith diluent injection , ceftazidime+ avibactum 2gm+500mgvial / amp injection , ceftizoxime 1 gmvial / amp injection , ceftriaxone +salbactum+ disodium edtavial / amp injection , ceftriaxone 1 gm(vial) with dw injection , ceftriaxone 1 gm with tazobactum 125 mgwith diluent injection , ceftriaxone 125 mg(vial) with dw injection , ceftriaxone 2 gm with tazobactum 250mgwith diluent injection , ceftriaxone 250 mg(vial) with dw injection , ceftriaxone 500 mg(vial) with dw injection , ceftriaxone with sulbactam 1.5 gmwith diluent injection , ceftriaxone with sulbactam 375 gmwith diluent injection , cefuroxime250 mg with dwinjection , cefuroxime 1500 mg with dwinjection , cefuroxime 1gmvial / amp injection , cefuroxime 750 mg with dwinjection , cetrorelix acetate 0.25 mgvial / amp injection , cetuximab 100 mg vial / amp injection , cetuximab 500mgvial / ampinjection , chloramphenicol 1gm/vialvial / amp injection , chloroquine phosphate 40 mg/ml(5 ml amp ) injection , chlorpromazine 25mg/mlinjection , cholecalciferol 60000 iu/ml(1ml) injection , ciprofloxacin 200mg/ 100ml(100 ml bottle) injection , cis atracurium besylate2 mg/ml in 5 ml vial injection , cisplatin 10mg/10ml(10ml) injection , cisplatin 50mg/50mlinjection , citicoline 250mg/ml(2ml) injection , cladrabine 10 mgvial / amp injection , clarithromycin infusion 500mlinjection , clindamycin phosphateip 300 mg injection , clindamycin phosphate 150mg/ml(4ml) injection , clonidine 150mcg/mlvial / amp injection , cloxacillin sodium 500 mgwith diluent injection , colistimethate 1million iu/mlinjection , colistimethate 2million iu/mlinjection , compound sodium lactate( ffs/bfsbottle) 1000ml injection , compound sodium lactate( ffs/bfs bottle) (500ml bottle) injection , compound sodium lactate( pp bottle) (500ml bottle) injection , compound sodium lactate( pp bottle) 1000ml injection , compound sodium lactate 500 ml( 500 ml glass bottle) injection , crystilline penicillin 2 lakh vial / amp injection , cyanocobalamine 100 mcg/ ml(2 ml amp ) injection , cyclophosphamide 200mginjection , cyclophosphamide 500mginjection , cytarabine 1000 mgvial / ampinjection , cytarabine 500mginjection , dacarbazine500 mg ip injection , daratumumab 100 mgvial / amp injection , daratumumab400 mgvial / amp injection , darbepoietin alfa 100mcgvial / ampinjection , darbepoietin alfa 200 mcg vial / amp injection , darbepoietin alfa 500mcgvial / amp injection , daunorubicin 20 mg inj ip (10 ml) injection , decitabine 100 mgvial / amp injection , decitabine 50 mgvial / amp injection , degarelix 120 mgvial / amp injection , degarelix 80 mgvial / amp injection , degludec insulin 300iu/3mlvial / amp injection , denosumab 120 mgvial / amp injection , desferrioxamineip 500 mg / vial (for i.m. inj and i.v s.c. infusion) injection , detemir insulinevial / amp injection , dexamethasone 8 mg/2ml(2 ml vial ) injection , dexmedetomidine hcl 100mcg/ml (1ml) injection , dexmedetomidine hcl 100mcg/ml (2ml) injection , dextran 40vial / amp injection , dextrose25% ( ffs/bfs bottle)(100 ml bottle) injection , dextrose25% ( glass bottle)(100 ml bottle) injection , dextrose25% ( pp bottle)(100 ml bottle) injection , dextrose 10% 1000 ml(ffs/bfs bottle)injection , dextrose 10% 1000 ml(ppbottle)injection , dextrose 10% 500 ml(ffs/bfs bottle)injection , dextrose 10% 500 ml (glassbottle) injection , dextrose 10% 500 ml (ppbottle) injection , dextrose 5% (ppbottle) 1000 mlinjection , dextrose 5% 1000 ml(ffs/bfsbottle)injection , dextrose 5% 500 ml(ffs /bfsbottle)injection , dextrose 5% 500 ml (glassbottle) injection , dextrose 5% 500 ml (ppbottle) injection , diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) injection , diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) injection , diazepam 10 mg/ 2ml(2ml amp ) injection , diazoxide 300 mg/20mlvial / amp injection , diclofenac aqua 75mg/ml (1ml) injection , diclofenac sodium 25 mg/ml(3 ml amp ) injection , dicyclomine 10 mg/ml(2 ml amp ) injection , digoxin 0.25mg/mlinjection , diltiazem 5 mg/mlinjection , dinoprostone cream/ gel 0.5 mg dinoprostone in syringe injection , diptheria antitoxin 10000 iuinjection , distilled water 10ml injection , dobutamine 50mg/ml (5ml ) injection , docetaxel 120 mg vial / amp injection , docetaxel 20mginjection , docetaxel 80 mginjection , dopamine40mg/ml (5ml) injection , doxorubicin 50 mg/25mlinjection , doxycycline for100 mg usp injection , dried factor viii fraction ip (iv use) 1000 iu/vial injection , dried factor viii fraction ip (iv use) 500 iu/vial injection , dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) injection , drotaverine hydrochloride 40 mg/2ml(2 ml amp ) injection , durvalumab 120 mgvial / amp injection , durvalumab 500mgvial / amp injection , enalapril1.25 mg 1 mlvial / ampinjection , ephedrine 30mg/ml(1ml) injection , epirubicin 150mg/mlvial / ampinjection , epirubicin 50mg/mlvial / ampinjection , eribulin 0.5mgvial / ampinjection , eribulin 1 mgvial / amp injection , ertapenem sodium 1gm = ertapenem 1.046 gmvial / ampinjection , esmolol hcl10mg/ml (10 ml ) injection , etanercept 25mg/0.5mlvial / amp injection , ethamsylate 250 mg/ 2ml(2 ml amp ) injection , etomidate 20 mginjection , etomidate mct/lct10ml vialvial / ampinjection , etophylline 84.7mg +theophylline 25.3 mg/ml. (2ml. ) injection , etoposide 100mg(5 ml) injection , factor ix concentrate 600 iuinjection , fentanyl citrate 50mcg/ml2ml injection , ferric carboxymaltose 50mg/ml(10ml) injection , filgrastim 300 mcg/mlwith prefilled syringe injection , fluconazole 100mg vial / amp injection , fluconazole 200 mg (100ml )injection , fludarabine phosphate100mgvial / amp injection , fludarabine phosphate50mgvial / amp injection , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography vial / amp injection , fluorouracil 250mg/5mlinjection , fluorouracil 500mg/5mlinjection , fluphenazine deconate(long acting) 25mg/ml ampulevial / amp injection , folic acid +methylcobalamine 10 ml pack vial / amp injection , folinic acid 200mg injection , fondaparinux 2.5mgvial / amp injection , fosphenytion 150 mg/ ml2mlinjection , fsh 150 iuvial / amp injection , fsh 75 iuvial / amp injection , fulvestrant 250mgvial / amp injection , furosemide 10 mg/ml(2 ml amp) injection , gadodiamide 0.5mml/ml vial injection , ganciclovir sodium500mg (lyophilized powder for reconstitution) injection , gemcitabin 1000mginjection , gemcitabin 200mginjection , gentamycin 80 mg/ 2ml(2 ml amp ) injection , glucagon forusp 1 mg injection , glyceryl trinitrate , diluted 5mg/mlvial / amp injection , glycine irrigation 1.5 % 3ltr inj /solution injection , glycopegylated extended half life factor viiiinjection , glycopegylated extended half life nonacog beta pegol f ixinjection , glycopyrrolate 0.2 mg/ml(1 ml amp) injection , glycopyrrolate 0.2 mg/ml(10 ml) injection , goserelin acetate implant 3.6 mgvial / amp injection , granisetron1mg./ml. 3ml. amp. injection , haemocoagulase1 mlvial / amp injection , haloperidol (long acting) 50mg/ml ampoulevial / amp injection , haloperidol 5 mg/ml (2ml) injection , halothane (250ml ) injection , halothane 100ml injection , halothane 50ml injection , heparin sodium 1000 i.u./ml( 5ml) injection , heparin sodium 5000 i.u./ml(5ml) injection , hepatitis b immunologlobinip 100 i.u injection , hepatitis b immunologlobinip 200 i.u injection , horse atg(anti thymocyte globulin) 250 mgvial / amp injection , hp hmg (highly human menopausal parodied gonadotropin)150 iuvial / amp injection , hp hmg (highly human menopausal parodied gonadotropin)75 iuvial / amp injection , human albumin solution 20% (100 ml bottle) injection , human anti d immunoglobulin 150 mcginjection , human anti d immunoglobulin 300 mcg(im use) (prefilled syringe/vial) injection , human chorionic gonadotropinip 2000 i.u. injection , human chorionic gonadotropinip 5000 i.u. injection , human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) injection , human rabies immunoglobulin150 iu/mlinjection , hyaluronidase 1500 iuinjection , hydralazine 20mg/mlvial / amp injection , hydrocortisone sod. succinate 100 mg injection , hydrocortisone sod. succinate 200 mg injection , hydrocortisone sod. succinate 400 mg injection , hydroxyethyl starch (130/0.4) 6% w/v with sodium chloride 0.9% w/v intravenous infusion(500 ml bottle) injection , hydroxyprogesterone 250 mg/ml(1 ml amp ) injection , hydroxypropylmethyl cellulose solution 20 mg/ ml (2ml) injection , hydroxypropylmethyl cellulose solution 20 mg/ ml (5ml) injection , hylan g f 20injection , hyoscine butylbromide 20 mg/ml(1 ml amp ) injection , ifosfamideip 1gm injection , imipenem + cilastatin500mg/500mg ip powder for solution injection , indomethacin lyophilized powder 1mgvial / ampinjection , inj poractant alpha 80 mg/ml in pack of 1.5 ml injection , inotuzumab1 mgvial / amp injection , insulinaspartvial / amp injection , insulinip (soluble insulin/neutral insulin )40 iu/ml(r.dna origin) (10ml) injection , insulin glargine 10 ml vial (100 iu/ml) injection , insulin glargine 3 ml vial (100 iu/ml) injection , insulin glargine 300 iu per ml/prefilled pen vial / ampinjection , insulin glulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml cartridgesvial / amp injection , insulin glulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml prefilled penvial / amp injection , insulin lispro vial / amp injection , insuline 50/50vial / ampinjection , interferon beta 1 a 30mgvial / ampinjection , intralipdsvial / amp injection , intravenous fat emulsion 20% w/v 250ml injection , intravenous immunoglobulin (ivig)ip 10gm/100 ml injection , intravenous immunoglobulin (ivig)ip 5gm/100 ml injection , invert sugar 10% (fructodex 10%) 500 ccvial / amp injection , iohexol usp (solution for ) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 50 ml injection , iohexol usp(solution for ) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml 50 ml injection , ipilimumab 50 mgvial / amp injection , irinotecan 100 mg/5mlvial / amp injection , irinotecan 40mg/5mlvial / amp injection , iron sucrose 20mg/ml(5ml) injection , isoflurane liquid for inhalation (100ml) injection , isoflurane liquid for inhalation (250ml) injection , isoflurane liquid for inhalation (30ml) injection , isolyte g (each 100ml contains: sodium chloride usp 0.53 g; sodium gluconate usp 0.5 g sodium acetate trihydrate usp 0.37 g; potassium chloride usp 0.037)(500ml) injection , isophane insulin 40 iu / ml(10ml vial) injection , isoprenalineip 2mg / ml injection , isoxsuprine 5 mg/ml(2ml amp) injection , ketamine50 mg/ ml (10 ml vial ) injection , labetalol hydrochloride 20 mg/ 4ml(4 ml amp) injection , lacosamide10 mg/ ml( 20 ml ) injection , l asparaginase inj 10000 iu injection , leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml ( 5 ml) injection , leurprolide acetate depot 11.25 mg injection , leurprolide acetate depot 3.75 mg injection , levetiracetam500mg/5ml injection , levobupivacaine 0.25 % 5mg/ml (20ml) injection , levobupivacaine 0.5 % 5mg/ml (20ml) injection , levobupivacaine 0.5 % in dextrose(4 ml) injection , levofloxacine 500mg/100 ml ip 100ml infusion injection , levosulpride 12.5 mg/mlvial / amp injection , lidocaine ( lignocaine ) hcl topical solution usp 4% (30 ml ) injection , lidocaine ( lignocaine )hcl topical solution usp 4% (20 ml ) injection , lidocaine1% intra cameralvial / ampinjection , lignocaine (preservative free) 2% vial / amp injection , lignocaine 10% sprayvial / amp injection , lignocaine 2%(30 ml vial) injection , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg (30ml) injection , lignocaine and dextroseip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg injection , lignocaine hcl 2%(50ml i.v.) injection , lignocaine hcl and dextrose(2ml) injection , lincomycin 600mg/2mlinjection , linezolid inj 200mg/100ml (300ml) injection , liposomal doxorubicin 20mgvial / amp injection , liposomal doxorubicin 50 mg vial / amp injection , liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd eob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran)vial / amp injection , lorazepam inj ip 2 mg/ml (2ml) injection , l orinithine l aspartate10 ml vial / amp injection , l orinithine l aspartate 10 mlinjection , low mol. wt. heparin 60mg/0.6ml (enoxaparin) injection , low molecular wt. heparin 0.4mgvial / amp injection , magnesium sulphate 500mg/ml ( 2 ml ) injection , mannitol 10% w/v glycerin 10% w/v(100 ml ) injection , mannitol 20%(350ml ) injection , mannitol inj ip 20% w/v(100 ml ) injection , mecobalamin 500 mcg/mlinjection , mephentermine 30 mg/ml(10ml) injection , mephentermine 50mg/mlvial / ampinjection , meropenem 125 mginjection , meropenem 1gminjection , meropenem 250 mginjection , meropenem 2gm vial / amp injection , meropenem 500 mginjection , mesna 200 mg/2ml (sod. mercaptoethanevial / ampsulphate) injection , methotrexate 1000 mgvial / amp injection , methotrexate 250 mg vial / amp injection , methotrexate inj ip 50 mg/2 ml ( 2 ml ) injection , methylcobalamin 1000 mcg vit.b 6 100mg nicotinamide 100mg(2ml) injection , methylcobalamin 1500 mcginjection , methylene bluevial / amp injection , methylergometrine 0.2 mg/ml(1ml amp) injection , methylprednisolon acetate 125mg vial / amp injection , methylprednisolon acetate 40mg ip injection , methylprednisolone sodium succinate 500 mg (vial) injection , metoclopramide10 mg/2ml (2 ml amp) injection , metoprolol 5ml vial injection , metotrexate 15mg (preservative free) vial / amp injection , metronidazole500 mg/ 100ml (100ml ffs /bfs bottle) injection , metronidazole500 mg/ 100ml (100ml pp bottle) injection , midazolam 1 mg/ml(10 ml vial) injection , midazolam 1 mg/ml(5 ml vial) injection , midazolam 5mg/ml 1 ml vial / amp injection , milrinone 10 mg vial / amp injection , mitomycin 2 mg vial / amp injection , mitomycin 40 mgvial / amp injection , mitoxanthrone infusion 10 mg vial / amp injection , mitoxanthrone infusion 20mgvial / amp injection , morphine sulphate 10mg/mlinjection , moxifloxacin intra cameral 0.5%vial / amp injection , moxifloxin 400mg/100mlinjection , multiple electrolytes and dextrosetype i ip (electrolyte p) glass bottle (500ml bottle) injection , multiple electrolytes and dextrosetype i ip (electrolyte p) ( ffs / bfs bottle)(500ml bottle) injection , multiple electrolytes and dextrosetype i ip (electrolyte p) ( pp bottle)(500ml bottle) injection , multiple electrolytes and dextrosetype iii ip (electrolyte m ) ( ffs / bfs bottle)(500ml bottle) injection , multiple electrolytes and dextrosetype iii ip (electrolyte m ) ( pp bottle)(500ml bottle) injection , multiple electrolytes and dextrosetype iii ip (electrolyte m ) glass bottle (500ml bottle) injection , multivitamin 10 mlinjection , nabpaclitaxel (paclitaxel nano particle)100 mg vial / ampinjection , naloxone inj ip 0.4mg/ ml (1ml) injection , nandrolone decanoate25 mginjection , nandrolone decanoate 100mg vial / ampinjection , nandrolone decanoate 50 mginjection , natalizumab 300 mgvial / ampinjection , neostigmine inj ip 0.5 mg/ml (1ml amp) injection , neostigmine inj ip 0.5 mg/ml (5ml amp) injection , neostigmine+ glycopyrrolate 2.5 mg/ 0.5 mgvial / ampinjection , netilmicin sulphate 300mginjection , netilmicin sulphate 50mginjection , nicardipin 10mgvial / ampinjection , nicorandil 48 mginjection , nimodipine infusion 10mg/50 mlvial / ampinjection , nimotuzumab 50 mgvial / ampinjection , nitroglycerin inj 5 mg/ ml (1ml amp) injection , nitroglycerin inj 5 mg/ ml (5ml amp) injection , nivolumab 100 mgvial / ampinjection , nivolumab 40 mgvial / ampinjection , noradrenalineip 2 mg/ml (2mlamp) injection , noradrenalineip 2 mg/ml (5mlamp) injection , normal human intravenous immunoglobulin 5g/100ml injection , normal saline(sodium chloride) 0.9% 10mlinjection , normal saline(sodium chloride) 3% 100ml glass bottle injection , normal saline (sodium chloride)0.9% 100ml ( ffs / bfs bottle) injection , normal saline (sodium chloride)0.9% 100ml (pp bottle) injection , normal saline (sodium chloride) 0.9% 100ml glass bottle injection , normal saline (sodium chloride)0.9% 3ltr injection , normal saline 1000 mlglass bottlevial / ampinjection , octreotide50 mcg/ml injection , octreotide 100mg vial / ampinjection , octreotide lar (long acting release) 20 mg vial / ampinjection , octreotide lar (long acting release) 30 mg vial / ampinjection , ofloxacin inj 200 mg / 100 ml injection , omalizumab 150 mg vial vial / ampinjection , ondansetron 2 mg/ml(2 ml amp) injection , ornidazole 500mg100 ml( ffs/ bfs bottle) injection , ornidazole 500mg100 ml( pp bottle) injection , oxaliplatinusp 50 mg ( 25 ml ) injection , oxytocin 5 iu/ml(1ml amp) injection , paclitaxel 100mg(16.7 ml ) injection , paclitaxel 260mg(43.4 ml ) injection , palonosetron 0.25mgvial / ampinjection , pantoprazole 40 mg(vial) injection , papaverineinjection , paracetamol 150 mg/ml(2 ml amps ) injection , paracetamol infusion 1000 mg with both temper evident caps spray 10%vial / ampinjection , paracetamol infusion 500 mg with both temper evident caps spray 10% vial / ampinjection , paracetamol infusion ip 1% w/v 100ml injection , peg asparaginase 3750 iu 5 mlvial / ampinjection , peg filgrastim6mgvial / ampinjection , pembrolizumab 50 mgvial / ampinjection , pembrolizumab100 mg vial / ampinjection , pemetrexed 100mgvial / ampinjection , pemetrexed 500 mgvial / ampinjection , pentazocine 30 mg/ml(1 ml amp ) injection , pertuzumab 100 mg vial / ampinjection , pheniramine 22.75 mg/ml(2ml amp ) injection , phenobarbitone 200 mg/ml(1ml ampoule/ vial) injection , phenylephrine hcl 50mcg/ml(10ml) injection , phenytoin sodium 50 mg/ml(2ml amp ) injection , pilocarpine0.5% mg/ml (1 ml ) injection , piperacillin2 gm + tazobactom 250mg ip injection , piperacillin and tazobactam 4 gm + 500 mg for(vial) with diluent injection , piperacillin with tazobactam 1gm + 125 mgwith diluent injection , piracetam 200mginjection , placental extract 2mlvial / ampinjection , plerixafor 24 mgvial / ampinjection , polygeline 3.5% solution with electrolytes for i.v. infusion injection , polymixin b 500000iuinjection , polymyxin b for1 millionvial / ampinjection , potassium chloride0.15 gm/ml (10ml amp) injection , pottasium phosphate 15mlinjection , pralidoxime chloride 25mg/ml (20ml ) injection , pralidoxime iodide 25mg/ml (20 ml lnjection) injection , procaine penicillin fortified 2 lackvial / ampinjection , procaine penicillin with benzylpenicillin 3 + 1 lac units (vial) injection , prochlorperazine mesylate12.5mg/ml 5ml injection , progesterone50vial / ampinjection , progesterone 200 mg /2ml(2 ml amp ) injection , promethazine 25 mg/ml(2 ml amp) injection , propofol 10mg/ml(10ml) injection , propofol 10mg/ml(20ml) injection , propofol mct/lct with oleic acid iv (10 ml ) injection , prostaglandin 500mcg/mlvial / amp injection , prostaglandin e1 500mcg/mlinjection , prostaglandin e2 0.5mg/2.5mlinjection , protamine sulphate 50mg/5mlinjection , quinine dihydrochloride 300 mg/ml(2ml amp ) injection , rabbit atg (anti thymocyte globulin) 250 mgvial / ampinjection , rabbit atg (anti thymocyte globulin)100 mgvial / ampinjection , rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments( 5 ml ) injection , rabies vaccine human (cell culture) (intradermal) 2.5 iu (1 ml vial with 1.0 ml diluent ) injection , rabies vaccine human (cell culture) (intramuscular) 2.5 iu/dose(single dose vial with 0.5/1.0 ml diluent and syringe with needle) injection , ramucirumab 100 mg vial / ampinjection , ramucirumab 500 mg vial / ampinjection , ranitidine hcl 50 mg/2ml(2 ml amp) injection , ranizumab 10mg/mlvial / ampinjection , rasburicase 1.5 mgvial / ampinjection , recombinant coagulation factor viia 1mg injection , recombinant coagulation factor viia 2mg injection , recombinant f ix 500 iu with diluent injection , recombinant fsh 150 iuvial / ampinjection , recombinant fsh 300iuvial / ampinjection , recombinant hcg 250 iuvial / ampinjection , recombinant human growth hormone 4iu vial with syringe vial / ampinjection , recombinant lh 75iu vial / ampinjection , remdesivir 5mg/ml 20ml vial injection , reteplase 18 mginjection , rh erythropoitin2000 iu injection , rh erythropoitin4000 iu injection , rh erythropoetin inj ip 10000 iu injection , ringer acetate infusion 500 ml ( glass bottle ) injection , ringer acetate infusion 500 ml (ffs / bfs ) injection , ringer acetate infusion 500 ml (pp bottle ) injection , risperidone prolonged released depot 25 mgvial / ampinjection , risperidone prolonged released depot 50mg vial / ampinjection , rituximab500 mg vial / ampinjection , rituximab 100 mgvial / ampinjection , rocuronium 100mg/10mlvial / ampinjection , romiplostim 125 mcgvial / ampinjection , romiplostim 250 mcgvial / amp injection , romiplostim 500 mcgvial / ampinjection , ropivacaine 0.75% 20ml vialvial / ampinjection , ropivacaine 0.75% 3 ml ampule (heavy)vial / ampinjection , ropivacaine hcl 0.2 % 20 mlinjection , ropivacaine hcl 0.5 % 20 mlinjection , ropivacaine hcl 0.75 % in dextrose (4 ml ) injection , secukinumab 150 mgvial / ampinjection , sevoflurane for inhalation 250ml injection , sevoflurane for inhalation 50ml injection , sildenafil 0.8mgvial / ampinjection , snake venom antiserum (polyvalent anti snake venum)(10ml vial) injection , sodium bicarbonate 7.5%(10 ml amp ) injection , sodium chloride (500ml pp bottle) injection , sodium chloride 0.45% w/v polypack 500 ml injection , sodium chloride 1000 ml(ffs/bfs bottle)injection , sodium chloride 1000 ml(pp bottle)injection , sodium chloride 3% 100mlpp bottle injection , sodium chloride 500 ml(ffs/bfs bottle)injection , sodium chloride and dextrose 0.45% infusion 500ml injection , sodium chloride and dextrose 0.9 % + 5 % ( ffs/bfsbottle)(1000ml bottle) injection , sodium chloride and dextrose 0.9 % + 5 % ( ffs/bfsbottle)(500ml bottle) injection , sodium chloride and dextrose 0.9 % + 5 % ( glass bottle)(500ml bottle) injection , sodium chloride and dextrose 0.9 % + 5 % ( pp bottle)(1000ml bottle) injection , sodium chloride and dextrose 0.9 % + 5 % ( pp bottle)(500ml bottle) injection , sodium chloride( normal saline ) 500 ml (glass bottle)injection , sodium fluroresceine dye 20%vial / ampinjection , sodium hyaluronate 1.4mgvial / ampinjection , sodium nitropruside 25mg/ml 2mlinjection , sodium valproate 100 mg/ml(5 ml vial) injection , soluble insulin 40 iu / ml(10 ml vial) injection , streptokinase15 lac unitsinjection , streptomycin1 gmwith diluent injection , streptomycin500mgvial / ampinjection , streptomycin 0.75 gmwith diluent injection , succinylcholine 50 mg/ml(10 ml vial ) injection , sugammadex 100 mg /ml ( 2 ml ) injection , sugmadexvial / ampinjection , swine flu vaccineinjection , teicoplanin 200mginjection , teicoplanin 400mginjection , tenecteplase 20mgvial / amp injection , tenecteplase 40 mgvial / ampinjection , terlipressin acetate1mg 10ml amp injection , testosteron propionate 250mgvial / ampinjection , testosteron propionate 50mgvial / ampinjection , tetanus immunoglobulin 250 iuinjection , tetanus vaccine (adsorbed) ip 5 ml vial injection , tetanus vaccine 0.5 ml (adsorbed) ipamp injection , thiamine 100 mg / ml( 2 ml ) injection , thiamine 100mlvial / ampinjection , thiopentone inj ip 0.5 gm injection , thiopentone inj ip 1 gm injection , ticarcillinand clavulanic acidvial / ampinjection , tigecycline for100mgvial / ampinjection , tigecycline for50mgvial / ampinjection , tirofiban hcl5mg/100ml injection , tobaramycin 80mgvial / ampinjection , tocilizumab 20 mg/ml 10ml vial injection , tocilizumab 20 mg/ml 20ml vial injection , tocilizumab 20 mg/ml 4ml vial injection , topotecan1 mgvial / ampinjection , topotecan2.5 mgvial / ampinjection , topotecan4 mgvial / ampinjection , torsemide 10 mg/ml(2 ml amp) injection , t pa 20mg alteplase for vial / ampinjection , t pa 50mg alteplase for vial / ampinjection , trabectedin 1 mgvial / ampinjection , tramadol 50 mg/ml(2 ml amp) injection , tranexamic acidip 100mg/ml (5ml ) injection , trastuzumab 440 mgvial / ampinjection , trastuzumab150mgvial / ampinjection , triamcinolone 40mg/ml(1ml) injection , triamcinolone acetonide 10 mg per mlvial / ampinjection , triptorelin 0.1mgvial / amp injection , triptorelin 11.25 mgvial / ampinjection , triptorelin 3.75 mgvial / amp injection , trypan blue 0.6%vial / ampinjection , urokinase5 lac unit (lyophilized) injection , valethamate bromide 8 mg/ml(1 ml amp ) injection , vancomycin 1 gm(vial) injection , vancomycin 500mg(vial) injection , varicella immunoglobulin for iv usevial / ampinjection , vasopressin 3mlvial / ampinjection , vecuronium bromide 4 mg for(freeze dried) (2ml) injection , verapamil2.5 mg/mlvial / ampinjection , vinblastine inj ip 10mg/ 10ml injection , vincristine inj ip 1mg(vial)/vincristinusp 1mg/ml (amp) injection , vinorelbine 10mgvial / ampinjection , vinorelbine 50mgvial / ampinjection , vitamin b complex(10 ml vial) injection , vitamin d3 (600000 iu) ip injection , vitamin keach ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione injection , vitamin k 1 (phytomenadione) ip 1mg/0.5mlinjection , voriconazole200mg/vial injection , water forip (10 ml amp ) injection , water forip (5 ml amp ) injection , zoledronic acidip 4mg injection , acyclovir cream 5 % (5 gm tube ) , betamethasone and neomycin cream (0.10% and0.5%) (15 gm ) , beclomethasone, neomycin and clotrimazole cream 0.025%+0.5%+1% (10g tube) , betamethasone dipropionate cream 0.05% (15gm) , betamethasone with salicylic acid (15 gm ointment) , betamethasone lotion 0.05% (50ml) , calamine lotion ip (100ml bottle) , cetrimide 0.5%cream ip 15gm , cetrimide tincture 0.5% (200ml bottle) , clindamycin phosphate gel 1% (20 gm) , crotamiton 10% and hydrocortisone 0.25% cream , clobetasolpro pionate 0.05 % cream(20gm) , clotrimazole 1% mouth paint (15ml) , cream aloe vera moisturizing 50 gm , creamamophous hydrogel with colloid silver wound dressing 100gm , creamamorolfine 0.25% 15gm , creamazelaic acid 20% 15gm , creambenzoyl peroxide 2.5 % 20gm , creamdesonide0.05% 15gm , creamfenticonazole 2%15gm , creamglycolic acid 6%30gm , creamhydrocortisone 1%15gm , creamhydroquinone 2%20gm , creamkojic acid 2%, arbutin,niacinamide30gm , creammometasone 0.1 %30gm , creammometasone 2% 30gm , creamneomycin sulphate cream20gm , cream permethrin 1%rinse 60gm , cream estradiolvalerate , clotrimazole cream ip 2% w/w (15gm) , coal tar 6% & salicylic acid 3% ointment(20gm) , compound benzoic acid ointment ip 6%+ salicylic 3% (15gm tube , compound benzoin tincture (500ml bottle) , chlorhexidine mouthwash 0.2% (50 ml) , clotrimazole beclomethsone lotion 50ml , powder clotrimazole 1% w/w 30gm , powder clotrimazole 1% w/w 100gm , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream (30gm) , dental gel: choline salicylate 8.70% + benzalkonium chloride 0.01% + lignocaine hcl 2%(10gm) , diclofenac 1% gel (30 gm) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% ( 20 gm ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% ( 30 gm ) , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , dinoprostone 0.5 mg (3gm cream) , formula milk type i for above 2.5 kg baby (400gm pack size) , formula milk lbw/spacial care for below 2.5 kg baby (400 gm pack size) , framycetin sulphate cream 1 o/o 100 gm pack , framycetin sulphate 1% cream (30gm tube) , fusidic acid cream bp 2% 10gm tube(10 gm tube) , fusidic acid ointment 2% (10 gm. packing) , geladaplene (0.1% w/w) 20 gm , geldilitiazem 2 % 20 gm , gelnifedipine + lidocaine20 gm , gamma benzene hexachloride 2% lotion (lindane lotion usp) (100 ml bottle) , gentian violet topical solution 1%(200 ml bottle ) , glycerin (100ml) , glycerin ip (400 ml) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% (15ml) , ketoconazole 2% cream (15gm) , ketoconazole 2% zpto 1% shampoo 100ml , luliconazole 1% cream ip 30 gm , lidocaine 25 mg + prilocaine 25mg 15 gm cream , lignocaine 1% mouth paint , lignocaine 2% gel(30gm) , lignocaine 5% ointment (10gm) , liquid paraffin100 ml pack , liquid paraffin ip (400ml bottle) , lotionasceptic ( chlorhexadine gluconate 7.5% + 15%cetrimide solu + isopropyl17%(50 ml ) , lotion ketaconazole 2% 50ml , lotion minoxidil2% 50ml , lotionminoxidil5%50ml , lotion minoxidil10 %50ml , lotionpodophyliin toxin50ml , lotionsulphur + calamine50ml , lotion sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 50ml , mouthwash 1.5% hydrogen peroxide50ml , metronidazole 1% and chlorhexidine 0.25% gel (10gm) , miconazole nitrate 2% cream ip (15g tube ) , methotrexate gel 1% , mupirocin 2% ointment (5 gm) , neomycin sulphate 5 mg and bacitracin 500 iu/gm ointment (10gm) , ointmentneomycin sulphate and bacitracin zincusp 5 mg + 500 iu/gm20 gm , ointment magnesium sulphate, sulphacetamide, urea75 gm , ointment clobetasol+salicylic acid 0.5%+6% 20gm , ointment heparin 50 iu benzyl nicotinate , ointment fluticasone 20gm , ointmentneomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , ointmenttacrolimus 0 .03%15 gm , ointmenttacrolimus 0 .1% 15 gm , ointmentzinc oxide +alo vera +semethicone20 gm , ointment containing : lidocaine 3% , zinc oxide 5%, hydrocortisone 0.25% , allantoin 0.5% (15 g tube) , paste coloplast60 gm , pasteeeg 400gm , permethrin cream 5% (30 gm pack) , permethrin lotion 5% (30ml pack) , permethrin lotion 5% (50ml pack) , permethrin soap 5% 75gm , povidone iodine ointment 5% (15 gm tube) , povidone iodine ointment 5% (250 gm pack) , povidone iodine ointment 5% (500 gm pack) , silver sulfadiazine 1% cream (50 gm tube) , silver sulfadiazine cream 1% 500 g pack(each) , tobramycin ophthalmic 0.3% (5gm ointment) , tretenoin cream 0.025% (20 gm) , terbinafine 1% w/w (10 gm) cream , tooth gel with sodium mono fluoro phosphate 0.7% & pot. nitrate 5 % (50gm) , acyclovir suspension 400 mg/ 5ml (60ml. bottle) , albendazole oral suspension 400 mg/ 10ml (10 ml bottle) , albendazole 200mg/5ml, ivermectin 1.5mg/5ml (10ml) , alkylizer 1.4gm to 1.53 gm per 5 ml(disodium hydrogen citrate) syrup/solution ( 100 ml ) , alkalizer disodium hydrogen citrate 1.25 gm /5ml (100 ml) , amoxicillin 200 mg & clavulanic acid syrup 28.5 mg / 5 ml (30ml) , amoxicillin oral suspension125 mg/5ml(dry syrup) (30ml) , amoxicillin 100mg/ml drop (15ml) , amoxy and clavulanic acid 80 mg+11.4 mg/ml ( 10 ml drop) , antacid liquid(dried al hydroxide 250 mg, magnesium hydroxide 250 mg, simethicone 20mg)(60 ml ) , antacid liquid(dried al hydroxide 250 mg, magnesium hydroxide 250 mg, simethicone 20mg)(170 ml ) , antacid liquid(dried al hydroxide 250 mg, magnesium hydroxide 250 mg, polydimethylsiloxane (60 ml ) , antacid liquid(dried al hydroxide 250 mg, magnesium hydroxide 250 mg, polydimethylsiloxane (100 ml ) , anti cold syrup: phenylephrine hcl , cetirizine and paracetamol(60 ml bottle) , anti cold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol2.5mg+1mg+125mg/5ml(60 ml ) , azithromycin syrup 100 mg/5ml (15ml) , azithromycin syrup 200 mg/5ml (15ml) , azithromycin syrup 200 mg/5ml (30ml) , calcium carbonate 250mg & vitamin d3 125iu suspension (100 ml bottle) , carbamazepine oral suspension 100 mg/5ml (100 ml bottle) , cefixime 25mg/ml drop (10ml) with diluent , cefixime 50mg/5ml suspension (30ml) with diluent , cefixime 100mg/5ml suspension (30ml) with diluent , cefpodoxime 25mg/ml (10 ml drop ) with diluent , cefpodoxime syrup 100 mg/5ml (30 ml) with diluent , cefpodoxime syrup 50 mg/5ml (30 ml) with diluent , cephalexin 100mg/ml (15ml drop) with diluent , cephalexin oral suspension 125 mg/ 5ml(30 ml ) with diluent , cetirizine syrup 5mg/ml (30ml) , chloroquine 50 mg/ 5ml syrup (60ml) , chloroquine suspension 50 mg/5ml (60ml) , chlorpheniramine oral solution 2.5 mg/ 5ml (50 ml) , co trimoxazole oral suspension 40mg + 200mg per 5ml (50ml) , cough syrup [terbutaline 2.5mg bromhexine2mg ambroxol 15mg] (50ml) , cough syrup [terbutaline 2.5mg bromhexine2mg ambroxol 15mg] (100ml) , cough syrup [terbutaline 2.5mg guaiphensin 50mg ambroxol 15mg ] (50 ml) , cough syrup [terbutaline 2.5mg guaiphensin 50mg ambroxol 15mg ] (100ml) , cough syrup [levosalbutamol 1mg guaiphensin 50mg ambroxol 15mg ] (100ml) , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup (100ml) , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup (50ml) , cough syrup each 5 ml contains chloropheniramine maleate ip 2 mg, phenylepherin hcl 5mg dextromethorphan hbr 10mg (100ml) , cyproheptadine hcl 2mg / 5ml syrup i.p.100 ml , cyproheptadine hcl 2mg / 5ml syrup i.p.200 ml , dextromethorphan hydrobromide 13.5mg/5ml syrup (100 ml) , dextromethorphan hydrobromide 13.5mg/5ml syrup (30 ml) , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml (10 ml bottle with dropper ) , domperidone oral drops 10mg/ ml (10ml) , dicyclomine oral solution 10mg/5ml(30ml) , drotavarine hcl 20mg / 5ml syrup/suspension , domperidone suspension 5 mg/5ml (30 ml bottle) , dropambroxol15ml , drop vitamin c+ essential amino acid 15ml , drop iron (ferrous ascorbate) 30ml , drop simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , drops docosahexaenoic 30ml , drop caffiene citrate oral solution 3ml , drop anti cold (paracetamol 125mg/ml, phenyephrine 2.5mg/ml & chlorpheniramine maleate 1mg/ml (15 ml drop) , diastase, pepsin with simethicone 15ml drop each ml contains diastase (1:1200) 33.33mg, pepsin (1:3000) 5mg and simethicone emulsion 40mg , enzyme drop each ml contains (alpha emylase 20mg + papain 10mg + dill oil 2mg + anise oil 2mg + caraway oil 2mg) (15ml) , erythromycin estolate 125 mg/ 5ml oral suspension (30ml bottle) , feracrylum 1% w/v sterile solution 100 ml , hydroxyzine hydrochloride oral solution / drop 6mg/ml ( 30 ml ) , ibuprofen 100 mg+paracetamol 162.5 mg syrup (60 ml bottle) , ibuprofen 100 mg/5ml oral suspension (60 ml bottle) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg(100ml bottle) , lactase enzyme (15 ml drop ) , lactulose solution 10gm/15ml (100ml) , levetiracetam oral solution/suspension 100mg/ml (100 ml ) , syrup levocetirizine with montelukast 2.5mg+4mg/5ml (60 ml) , levofloxacin oral solution/ syrup 125mg /5ml (100 ml ) , mefenamice acid 100mg/5ml syrup (60 ml ) , multi vitamin syrup ( 100 ml ) , multi vitamin syrup ( 200 ml ) , multivitamin drop (vitamin a, thiamine 0.4mg, riboflavin 0.8mg, pyridoxine hydrochloride 0.8mg, nicotinamide 8mg, ascorbic acid 40mg (15ml) , metronidazole 100 mg and norfloxacin 100 mg/ 5ml suspension (30 ml bottle) , metronidazole benzoate 100 mg/ 5ml oral suspension (60 ml bottle) , metochlopramide hcl 5mg/5ml (30ml syrup) , nevirapine syrup , ondansetron 2mg/5ml (30ml syrup ) , ondansetron 4mg/5ml (30ml syrup ) , oseltamivir phosphate for oral suspension ip 12 mg/ml (75ml) , ofloxacin suspension 50 mg/5ml (30 ml bottle) , ofloxacin suspension 100 mg/5ml (30 ml bottle) , paracetamol 150 mg/ml drops (15ml bottle) , peritoneal dialysis solution ip (1000ml pack ) , potassium chloride 500 mg/ 5ml oral solution(200 ml ) , povidone iodine scrub solution 7.5% (500 ml bottle) , povidone iodine solution 10 % (100 ml bottle) , povidone iodine solution 5% (100 ml bottle) , povidone iodine solution 5% (500 ml bottle) , promethazine 5 mg/ 5ml syrup (60 ml bottle) , paracetamol 125 mg/5mlsyrup (60ml bottle) , phenobarbitone 20mg/5ml (60 mlsyrup) , phenytoin 25 mg/ml oral suspension (100ml bottle) , pheniramine maleate 15 mg/5ml syrup (30ml bottle ) , syrup cefaclor each 5 ml contain cefaclor 125 mg (30 ml ) , syrup codienephosphate (100 ml ) , syrup amlodipine oral solution 1 mg/ ml (150 ml ) , syrup artemether 40mg + lumefantrine 240 mg (30ml ) , syrup b. complex ( 100 ml ) , syrup baclofen oral solution 5mg/ml ( 50 ml ) , syrup calcium phosphate (200 ml ) , syrup cefuroxime axetil oral suspension 125mg/5ml (30 ml ) , syrup clarithromycin for oral suspension 125mg/5ml ( 30 ml ) , syrup cyclosporine oral solution 100mg/ml (100 ml ) , syrup dextromethorphan hcl + chlorpheniramine ( 50 ml ) , syrup dextromethorphan hcl + chlorpheniramine ( 100 ml ) , syrup diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml (30 ml ) , syrup each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin 3.75 ml ( 170 ml ) , syrup each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg(60 ml) , syrup enzyme (200 ml ) , syrup enzyme (100 ml ) , syrup esomperazole ( 100 ml ) , syrup fluconazole oral suspension (60 ml ) , syrup furosemide oral solution 10mg/ml (30ml ) , syrup l carnitine 500mg/5ml in (30 ml ) , syrup l carnosine 100mg/5ml in (200ml ) , syrup linezolid 100mg/5ml in (30ml ) , syrup mefenemic acid 50 mg + paracetamol 250 mg /5 ml (60 ml ) , syrup melatonin (60 ml ) , syrup nitrofurantoin oral suspension 25mg/5ml (100 ml ) , syrup oxybutynin oral suspension5 mg/5 ml (100 ml) , syrup piracetam 500mg/5ml(100ml ) , syrup potassium magnesium citrate (200 ml ) , syrup ranitidine 75 mg /mloral suspension (100 ml ) , syrup rifaximin 100 mg/5ml (60 ml ) , syrup sodium bicarbonate 1000 mg/ 15 ml oral suspension ( 300 ml ) , syrup sodium picosulphate 5 mg /ml ( 100 ml ) oral suspension , syrup sorbitol 2.55 gm/ 10 ml + tricholine citrate 7.15 gm/10 ml (100 ml ) , syrup sucralphate 1000 mg/ 10 ml ( 200 ml ) , syrup triclofos oral suspension500 mg/ 5ml( 30ml ) , syrup ursodeoxycholic oral suspension 125mg/5ml (100ml ) , syrup posacozazole 40mg/ml( 105ml ) , solution silver nitrate 2% (100 ml ) , solution silver nitrate 5% (100 ml ) , solution silver nitrate 10% (100 ml ) , sodium valproate (200 mg/ 5ml) oral solution (100ml bottle) , surgical spirit(70 % alcohol ) (500 ml bottle) , surgical spirit (70% alcohol) (100 ml bottle) , salbutamol syrup 2 mg/5ml (100 ml bottle) , turpentine oil (100 ml) , vitamin c and vitamin e drop ( 15 ml ) , vitamin d3 400iu/ml drop ( 15 ml ) , vitamin d3 800iu/ml drop ( 15 ml ) , vitamin d3 oral solution 60000 i.u./ 5 ml( 5 ml ) , vitamin a solution 1 lac iu/ml (100ml bottle) , topical heparin solution 1000iu/ml ( 5 ml ) , zidovudine50 mg/ 5 ml syrup (100 ml ) , zinc sulphate 20 mg/ml ( 60 ml ) syrup , artificial saliva solution (200 ml ) , alkaline nasal douches (sodium bicarbonate and sodium biborate and sodium chloride) , beclomethasone inhalation 200 mcg/ dose (200 metered doses container ) , formoterol fumerate & budesonide powder for inhalation ip 12 mcg + 400 mcg rotocap (30 capsule) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg rotocap (30 capsule) , betamethasone with clotrimazole with lignocaine 5ml ear drop , acyclovir eye ointment ip 3% w/w 5gm size , atropine eye ointment ip 1% 5 gm size , atropine sulphate ophthalmic solution usp 1% , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , betaxolol eye drops 0.5 o/o (5ml) , beclomethasone dipropionate 0.064% and salycylic acid 3% lotion ( 30 ml ) , budesonide nebulizer suspension 0.25 mg/ml (2ml amp ) , budesonide powder for inhalation 200 mcg (rotocap 30 capsules ) , chloramphenicol 1%, polymyxin b sulphate (10000 units) and dexamethasone 0.1% sodium phosphate eye ointment 5 gm size , chloramphenicol and polymycin eye ointment 5 gm size , chloramphenicol 0.5%eyedrop , carbolic acid 50% in 500 ml solution , carbolic acid 100% in 500 ml solution , chlorhexidine gluconate solution 5% (250ml) , chlorhexidine gluconate solution 5% (100ml) , chlorhexidine gluconate 2%, cetrimide solution (100ml) , cholecalciferol granules 60000 iu/1gm (1 gm sachet) , continuous ambulatory peritoneal dialysis fluid 2 ltr , ciprofloxacin 0.3% and dexamethasone 0.1% ear drops , ciprofloxacin 0.3% and dexamethasone 0.1% eye drops , ciprofloxacin 0.3% eye drops , ciprofloxacin ophthalmic ointment usp 0.3% 5gm , chloramphenicol 1% w/w eye ointment ip, 3gm size , clotrimazole 1% with beclomethasone 0.025% drops , clotrimazole 1% with lignocaine 1% ear drops , concentrated haemodialysis fluid b.p acetate concentrate in 10 litre cans. each 1000ml after 1:34 dilutions should provide sodium chloride 135 to 140 meq(10 litres plastic can ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , deca peptide 6 mg / mllotion ( 6 ml ) , black disinfectant fluid (phenyl) as per schedule o grade iii ( 5 liter can ) , dorzolamide 2% eye drop ip , eye drop carboxymethylcellulose and glycerin , eye drop carboxymethylcellulose sodium lubricant0.5% , ear drop acetic acid otic solution 2% 5ml , ear / eye drop gentamycin , eye drop betadin 5% , eye drop brinozolamide+brimonidine5ml , eye drop cpm+cmc+nephazoline5ml , eye drop cyclopentolate 1%5ml , eye drop fluromethalone 0.1%5ml , eye drop hpmc (hydroxy propyl methyl cellulose) 0.3% 5ml , eye dropitraconazole 1%5ml , eye droploteprednol 0.25% 5ml , eye dropmoxifloxacin 0.5%+ketorolac tromethamine 0.5% 5ml , eye dropmoxifloxacin and dexamethasone5ml , eye drop nepafenac 0.1% 5ml , eye droppilocarpine5ml , eye/ear drop prednisolone sodium phosphate 1%5ml , eye drop proparacaine 0.5% w/v , eye drop gatifloxacin 0.3% , eye droptravapost+timolol , eye drop voriconazole , eye ointmentazithromycin 1%5gm , eye ointmentchloramphenicol0.5% 5gm , eye ointmentganciclovir 0.15%5gm , eye ointmentitraconazole 1% 5gm , eye ointmentmoxifloxacin0.5%5gm , eye ointment sodium chloride 6%5gm , ear drops each ml contain chloramphenicol 4mg and dexamethasone 1mg and polymyxin b (5000iu) , ear drops hydrocortisone 1%w/v and acetic acid 2%w/v , enema lactulose 10ml , elixir digoxin 0.25% , fluconazole 0.3% eye drops , flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v , gatifloxacin 0.30% and prednisolone acetate 1% ophthalmic suspension , formaldehyde solution (34.5 per. 38 per.) ( 450 ml ) , garglepovidone iodine 50ml bottle , granulesesmoprazole 10mgper sachet , glutaraldehyde 2% solution (5 ltrs can) , homatropine eye drop(2%)5 ml , hydrogen peroxide solution 6% (400 ml bottle) , hydrogen peroxide solution 6% (100 ml bottle) , inhaler tiotropium + glycopyrolate 25mg , inhaler tiotropium 9mcg inhaler , ipratropium bromide 500 mcg&levosalbutamol 2.5 mg respulessolution 2.5 ml , ipratropium bromide nebulizer 250 mcg/ml solution (15 ml vial) , indacaterol andglycopyronium inhalation powder110/50 mcg , ipratropium powder for inhalation ip 40 mcg (rotocap 30 capsule) , ketorolac tromethamine 0.5% w/v eye drop 5ml , levosalbutamol 0.63 mg/2.5 ml respules , levosalbutamol 1.25 mg/2.5 ml respules , liquid soap (1000 ml) , liquid soap (500 ml) , liquid soap (5000 ml) , lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) (5 ltrs can) , lignocaine viscous , dry powder inhaler ( dpi )salmetrol 50mcg+fluticasone 500 mcg ( 30 cap ) , dpi budesonide 400 mcg( 30 cap ) , dpi glycopyrronium 25 + formoterol 6 mcg ( 30 cap ) , dpi glycopyrronium 25 ( 30 cap ) , dpi glycopyrronium 50 ( 30 cap ) , dpi levosalbutamol 100mcg+ ipratropium bromide 40mcg ( 30 cap ) , metered dose inhaler ( mdi ) budesonide 200 mcg. , mdi formeterol 6mcg.+ fluticasone 250 mcg. inhalation , mdiformoterol 6 mcg. + budesonide 400 mcg. , mdileosalbutamol 50mcg.+ ipratopium 40mcg. , mdilevosalbutamol inhalation solution 50ml/gm , methoxsalen 1% / ml lotion ( 25 ml ) , miconazole 1% eye drops , moxifloxacin 0.5% and prednisolone 1% ophthalmic solution , moxifloxacin and difluoprednate eye drop , moxifloxacin (0.5% w/v) eye drop , natamycin opthalmic suspension 5% eye drop ip , nasal drops haemcoagulase topical solution each ml contain aqueous solution of haemocoagluase 0.2 cu , nasal spray fluticasone ( 10 ml ) , nasal spray midazolam 0.5mg/ml( 5 ml ) , nasal spray azelastine 140 mcg with fluticasone 50 mcg ( 10 ml ) , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp ( 5 ml ) , oil (medium chain triglyceride)50ml , omega 3fatty acid 50ml , ors powder , olapatadine 0.1% and ketorolac 0.4% ophthalmic solution , olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size , polymyxin b 10000iu/gm and neomycin 3400iu/gm eye drop , polymixin b, chloramphenicol, dexamethasone ear drop 5ml , phenylephrine opthalmic drops 5% (5 ml drop) , pilocarpine hydrochloride 2%5 ml vial , pilocarpine hydrochloride 4%5 ml vial , patchfentanyl 25iu patch , patchfentanyl 50iu patch , paintmercunium chloride100gm , paint salicylic acid 16.7% + lactic acid 16.7%10ml , paintdiclofenac each transdermal patch contain 200 mg diclofenac , pessarypovidone iodine , powder neomycin, bacitracin withsulfacetamide 5mg+250units+60mg (10 gm plastic bottle) , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) , prednisolone acetate opthalmic suspension 10 ml eye drop , root canal sealer (calcium carbonate) , revolizer/ rotahaler device , resp. enterogermina 2billion spores 5ml , resp.formeterol 20mcg +budesonide 0.5mg , respulesrespule n acetylcysteine (nac) 200mg/ml , respulesbudesonide 0.5mg/ml , respules budesonide 1ml , respules glycopyrronium 25mcg. inhalation 2ml. , respules sodium chloride 3 % , respules tiotropium bromide dry powder inhaler30 cap pack , sachetfosfomycin3gm , sachethmffor pretem 1 gm sachet each , sachetl arginine+proanthocynadine granules 3mg3mgsachet each , sachetpolyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride 2gm sachet , sachet racecadotril sachet 30 mgeach sachet , sachet mesalazine1gm sachet each , suppsitory glycerin2 gm/ml , suppsitoryparacetamol 170 mg each suppsitory contain paracetamol 170 mg 2x5 , solutiondesfluraneusp 240 ml bottle , solution hydrogen 11% + silver nitrate .01% 5 litre can , solution polyethyene glycol with elctrolyte approx (130gm pack ) , solution hormonalintra uterine device , spray lidocaine10%20ml , spray superoxidized 100ml , salbutamol inhalation 100 mcg/ dose (200 metered dose container ) , salbutamol nebuliser solution 5 mg/ml (10 ml vial) , saline nasal solution (drops) (sodium chloride 0.65 o/o) (10ml bottle with dropper / squeeze bottle) , sodium chloride 5%w/v opthalmic soln. 10ml , savlon / dettol soap (100 gm) , savlon / dettol soap (75 gm) , sodium phosphates enema bp (100 ml polypropylene pack) , sulfacetamide 20% eye drops (10 ml drop) , surfactant for intratrecheal instillation (natural bovine lung surfactant) , triamcinolone oromucosal paste bp 0.1% w/w , timolol eye drops ip 0.5 o/o w/v5 ml , tobramycin ophthalmic ointment usp 0.3% 5 gm size , tobramycin 0.3% eye drops 5ml , tobramycin and dexamethasone 0.3%+0.1% ophthalmic suspension (5ml) , tropicamide 0.8% w/v and phenylphrine hcl 5% w/v eye drop , tropicamide eye drop 1% 5 ml , trichloroacetic acid (tca) 50% w/v lotion , travoprost eye drops ip 0.004 o/o 5ml , wax dissolving ear drops: paradichlorobenzene 2%, benzocaine 2.7%, chlorobutanol 5%, turpentine oil 15% , xylometazoline nasal drops 0.1% (10 ml drop) , abacavir 600 mg+lamivudine 300 mg (al adult) tablet , abacavir 60 mg+lamivudine 30 mg (al pedia) tablet , abacavir300 each tablet contain abacavir 300mg ip tablet , abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) , alendronate sodium tablets usp / bp 35 mg , act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) , act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) , act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) , each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg , act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) , acamprosate calcium 333 mg tablet , acarbose 25mg tablet , aceclofenac & thiocolchicoside 100 mg+4mg tablet , aceclofenac 100 mg and paracetamol 325 mg tab , aceclofenac 100 mg, paracetamol 325 mg, chlorzoxazone 250mg tab , aceclofenac 100 mg, paracetamol 325 mg, serratiopeptidase 15mg tab , acebrophylline100 mg tab / cap , acebrophylline 200 mg srtab /cap , acenocoumarol / nicoumalone 1 mg tablet , acenocoumarol /nicoumalone 2 mg tablet , acenocoumarol /nicoumalone 3 mg tablet , acetazolamide 250 mg tablets , acyclovir 200 mg tablets , acyclovir 400 mg tablets , acyclovir 800 mg tablets , acetyl cystein 600mg tablet , albendazole 400 mg tablets , albendazole 400 mg, ivermectin 6mg tablets , alprazolam 0.25 mgtablets , alprazolam 0.5 mg tablets , amitriptyline hcl 25 mg tablet , amitriptyline hcl50 mg tablet , amlodipine & lisinopril 5mg+ 5 mg tablet , amlodipine 2.5 mg tablets , amlodipine 5 mg tablets , amlodipine and atenolol 5 mg +50mg tablet , amlodipine and enalapril maleate 5 mg +5mg tablets , amoxycillin and potassium clavulanate 500mg + 125mg tablet , amoxycillin trihydrate 125 mg dispersible tablets , antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , artemether & lumefantrine tab artemether 80mg + lumefantrine 480mg , artemether & lumefantrine tab artemether 40mg + lumefantrine 240 mg , artemether and lumefantrine tab artemether 20mg+lumefantrine 120mg , ascorbic acid 500 mg tablets , aspirin 300 mg tablets , aspirin 150 mg tablets , amiodarone tab ip 100 mg , amisulpride 100 mg tablet , amisulpride 50 mg tablet , amiodarone tab ip 200 mg , allopurinol tablets ip 100 mg , allopurinol tablets ip 300 mg , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , aspirin delayed release tablets 75 mg (enteric coated gr tablet) , atenolol 25 mg tablets , atenolol 50 mg tablets , atorvastatin 10 mg tablets , atorvastatin 20 mg tablets , atorvastatin 40 mgtablets , atazanavir300 and ritonavir100, each tablet contain atazanavir sulphate ip 300mg and ritonavir ip100mg , azithromycin 100 mg dt tablets , azithromycin 250 mg tablets , azithromycin 500 mg tablets , azathiopurine 50mg tablet , biotin 5 mg tablet , biotin 10mg tablet , biotin 10mg, acetylcystine 50mg, calcium pantothenate 100mg, selenium 65mcg, copper 3mg, zinc oxide 22.5mg tablet , betahistine 8mg tablet , betahistine 16mg tablet , betahistine 24mg tablet , baclofen 10mg tablet , baclofen 20mg tablet , baclofen 30mg tablet , betamethasone 0.5 mg tablets , bicalutamide 50 mg tablet , bisacodyl 5 mg tablets , bisoprolol 5 mg tab , bromocriptine tablets ip 2.5 mg , calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) , carbamazepine 100 mg tablets , carbamazepine 200 mg tablets , carbamazepine 400 mg tablets , carbimazole 10 mg tablets , carbimazole 5 mg tablets , cholecalciferol 60000 iu tablet , cefixime 100 mg tablets , cefixime 200 mg tablets , cefpodoxime 200 mg tablets , cefpodoxime 50 mg dispersible tablets , cefpodoxime proxetil 100 mg tablet , cefuroxime500 mg tablet , cefuroxime 250 mg tablet , cephalexin 125 mg tablets (dt) , cetirizine 10 mg tablet , cetirizine 5mg, phenylephrine 10mg& paracetamol 325 mg tablet , chlordiazepoxide + trifluoperazine 5mg+1mg tablet , chlordiazepoxide 10 mg tablets , chlordizepoxide 25 mg tablet , chlorine 500 mg tablet , chloroquine phosphate tablets 250mg , chlorpheniramine maleate 4 mg tablets , chlorpromazine 100 mg tablets , chlorpromazine 25 mg tablets , chlorpromazine 50 mg tablets , chlorpromazine 10 mg tablets , chlorzoxazone 250mg, diclofenac sodium 50mg & paracetamol 325 mg tablet , chymotrypsin 20 mg + trypsin 20mg tablet , cinnarizine + domperidone20 mg + 15 mg tablet , cinnarizine tab 25 mg tablet , cinnarizine tab 75 mg tablet , ciprofloxacin 250 mg tablets , ciprofloxacin 500 mg tablets , clarithromycin 500mg tab. i.p. , clobazam10 mg tab / cap , clobazam5 mg tab/ cap , clonazepam 0.25 mg tablets , clonazepam 0.5 mg tablets , clonazepam 1 mg tablets , clopidogrel 75 mg and aspirin 75 mg tablet , clopidogrel 75 mg tablets , clotrimazole vaginal 500 mg tablets , clozapine 50 mg tablet , clozapine 25 mg tablet , cloimpiramine 25mg tablet , co trimoxazole tablets ds [trimethoprim + sulfamethoxazole] 160mg + 800mg tablet , co trimoxazole tablets ds [trimethoprim + sulfamethoxazole] 80mg + 400mg tablet , co trimoxazole tablets p [trimethoprim + sulfamethoxazole] 20 mg + 100mg tablet , co trimoxazole tablets ss [trimethoprim + sulfamethoxazole] 40mg + 200mg tablet , citicoline 500mg tablet , conjugated estrogen 0.625mg tablet , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen , clomifene 25mg tablet , clomifene 50mg tablet , carvedilol 3.125mg tablet , cefadroxil 250mg tablet , cefadroxil 500mg tablet , cabergoline 0.5mg tablet , calcitriol 0.25mg tablet , cerebroprotein hydrolysate 90mg tablet , chlorambucil 5mg tablet , cyclosporine 50 mg tablet / cap , cyclosporine 100 mg tablet / cap , combikit of (tab fluconazole150mg and azithromycin 1gm and secnidazole1gm) each kit contain 1tab fluconazole150mg and 1 tab.azithromycin 1gm and 2 tab.secnidazole1gm , capecitabine 500mg tablet , clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) , cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) , dacalatasvir 60 mg tab./cap , dapagliflozin 10 mg tab. , dapsone 100mg tablet , deflazacort6 mg tablet , deflazacort12 mg tablet , deflazacort24 mg tablet , deflazacort 30 mgtablet , dexamethasone 0.5 mg tablet , dexamethasone 4 mg tablet , diazepam 5 mg tablet , diclofenac 100 mg (sr) tablets , diclofenac potassium 50mg + serratiopeptidase 15mg + paracetamol 325mg tablet , diclofenac sodium + paracetamol tab 50+325mg tablet , diclofenac sodium 50 mg tablets , dicyclomine 10 mg tablets , dicyclomine 20 mg + paracetamol 325 mg tablet , diethylcarbamazine 100 mg tablets , digoxin 0.25 mg tablet , diltiazem30 mg tablet , diltiazem 60 mg tablet , diltiazem 90 mg tablet , divalproex sodium500 mg tablet , divalproex sodium250 mg tablet , divalproex sodium750 mg tablet , disulfiram 500mg tablet , desloratadine 5mg tablet , doxofyline 400mg tablet , domperidone 10 mg tablets , doxylamine succinate 20mg + pyridoxine 20mg + folic acid 2.5 mg tablets , drotaverin 40mg tablet , drotaverine 80 mg & mefenamic acid 250 mg tab(10 tab strip) , drotaverine 80 mg tablets , dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg , donepezil hcl 5mg tablet , donepezil hcl 10mg tablet , duloxetine 20mg tablet , duloxetine 30mg tablet , duloxetine 40mg tablet , dutasteride 0.5mg tablet , deferasirox tab 100 mg , deferasirox tab 500 mg , dasatinib tab 100 mg , efavirenz 200 each film coated tablet contain efavirenz 200 mg , efavirenz 600 each film coated tablet contain efavirenz 600 mg , entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) , entecavir 1mg tab./cap film coated , enalapril maleate 10 mg tablets , enalapril maleate 2.5 mg tablets , enalapril maleate 5 mg tablets , erythromycin stearate 250 mg tablets , erythromycin stearate 500 mg tablets , escitalopram 5 mg tablet , escitalopram 10 mg tablet , escitalopram 20 mg tablet , esomeprazole 40 mg tab /cap , ethamsylate 250 mg tablet , ethamsylate 500 mg tablet , etoricoxib 90mg tablet , etoricoxib 120mg tablet , etoricoxib 60mg tablet , etoricoxib 60mg + thiocolchicoside 4 mg tablet , ethinyloestradiol 50mcg tablet , etizolam 0.5mg tablet , etizolam 0.25mg tablet , favipiravir 200 mg tablets , favipiravir 400 mg tablets , famotidine 20 mg tablets , famotidine 40 mg tablets , febuxostat 80 mg tab. , febuxostat 40 mg tab. , flavoxate 200 mg tablet , fluconazole 150 mg tablet , fluconazole 50 mg dt tablet , flunarazine 10 mg tablet , flunarazine 5 mg tablet , fluoxitine 20 mg tab/cap , fluoxitine 60 mg tab/cap , flupentixol 1 mg. tablet , flupentixol 0.5mg, melitracen 10mg tablet , folic acid tablets ip 5 mg tablet , formalin tablet , frusemide 40 mg tablet , fexofenadine 120mg tablet , feropenum 200mg tablet , fenofibrate 200mg tablet , fenofibrate 160mg tablet , finasteride 5mg tablet , gabapentin 100mg tab / cap , gabapentin 300mg tab / cap , gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) , griseofulvin 125mg tablet , glyceryltrinitratecontrolled release 2.6mg tablet , glibenclamide 5 mg tablets , glibenclamide and metformin hydrochloride 5 mg + 500 mg (sr) tablets , gliclazide 40 mg tablets , gliclazide 80 and metformin 500 mg tablet , glimepiride 1 mg tablets , glimepiride 2 mg tablets , glimepiride, pioglitazone and metformin hydrochloride 2mg+15mg + 500mg (sr) tablets , glipizide 5 mg tablets , glipizide and metformin hydrochloride 5 mg + 500 mg tablets , haloperidol 1.5 mg tablets , haloperidol 5 mg tablet , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , hydrochlorothiazide 12.5 mg tablets , hydrochlorothiazide 25 mg tablets , hydroxychloroquine sulphate 200 mg , hydroxychloroquine sulphate 300 mg , hydroxychloroquine sulphate 400 mg , hydroxyzine 25 mg tablets , hyoscine butylbromide 10 mg tablets , ibuprofen 200 mg tablets , ibuprofen 400 mg tablets , ibuprofen and paracetamol 400 mg + 325 mg tablets , imiatinib 100mg tablet , imiatinib 400mg tablet , imipramine 25mg tablet , imipramine 75mg tablet , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , isosorbide dinitrate 5 mg tablets , isosorbide mononitrate 20 mg tablets , isoxsuprine 20 mg tablets , ivermectin 6 mg tab , ivermectin 12 mg tab , ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) , labetalol 100 mg tablets , lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) , leflunomide tablets ip 10mg(film coated) , leflunomide tablets ip/usp 20mg (film coated) , levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) , lactic acid bacillus tab 60 million spores , lamivudine 100 each tablet contain lamivudine 100 mg , levetiracetam250 mg tablet , levetiracetam500 mg tablet , levocetirizine 5mg with montelukast 10mg tab , levocetirizine 2.5mg with montelukast 4mg tab , levocetrizine 5mg tablet , levofloxacin 250 mg tablet , levofloxacin 500 mg tablet , levofloxacin 750 mg tablet , levothyroxine sodium 25 mcg tab. i.p. , linezolid 600 mg tablet , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , lithium carbonate 300 mg tablet , lopinavir 100 mg + ritonavir 25 mg tablets , lopinavir 200 mg + ritonavir 50 mg tablets , loperamide 2 mg tablets , lorazepam2 mg tablet , lorazepam1 mg tablet , losartan 25 mg tablets , losartan 50 mg tablets , losartan potassium & amlodipine 50 mg + 5mg tablets , losartan potassium & hydrochlorothiazide 50 mg + 12.5mg tablets , lamotrigine 25mg tablet , lamotrigine 50mg tablet , lamotrigine 100mg tablet , levodopa 100mg + carbidopa 10mg tablet , levodopa 250mg + carbidopa 25mg tablet , levosulpiride 25mg tablet , letrozole 2.5mg tablet , loratidine 10mg tablet , leflunomide 10mg tablet , leflunomide 20mg tablet , melphalan 5mg tablet , mercaptopurine 50mg tablet , mefenamic acid 500 mg tablet , mefenamic acid 125 mg tablet , mefenamic acid 250mg and dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg and dicyclomine hydrochloride10mg , mefenamic acid 250 mg tablet , mefloquine 250 mg tablet , minocycline 50 mg tablet/ cap , mesalamine800 mg tablet , mesalamine 400 mg tablet , mesalamine1.2gm tablet , medroxyprogestrone acetate 10mg tablet , metformin 500 mg tablets , metformin hydrochloride (sr) and glimepiride 500 mg + 1 mg tablets , metformin hydrochloride (sustained release) and glimepiride 500 mg + 2 mg tablets , metformin hydrochloride 1000 mg sr tablets , methotrexate 7.5 mgtablet , methotrexate 2.5 mgtablet , methotrexate 10 mgtablet , methyldopa 250 mg tablets , methylergometrine0.125 mg tablets , methylprednisolone 4 mg tablets , methylprednisolone 8 mg tablets , methylprednisolone 16 mg tablets , metoclopramide 10 mg tablets , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , metronidazole 200 mg tablets , metronidazole 400 mg tablets , misoprostol 200 mcg tablets , mifepristone tab ip 200mg tab/cap , monteleukast 10 mg and fexofenadine 120 mg tablet , moxifloxacin 400 mg tablet , molnupiravir tablet , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mirabegron 50mg er tablet , mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) , mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) , micronized purified flavonoid fraction 500 mg (diosmin 450mg+hesperidin 50 mg) , nevirapine 200 each tablet contain nevirapine 200mg , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg (sr) tablets , nifedipine 5 mg (sr) tablets , naproxen tablet ip 250mg , naproxen tablet ip 500mg , neostigmine tab ip 15 mg , nicardipine tab. , nimesulide and paracetamol 100 mg+325 mg tablet , nitrazepam 5mg tab. i.p. , nitrofurantoin 100 mg tablets , nitroglycerin controlled release 2.6mg tablets , norethisterone 5 mg tablets , nortryptyline 10mg tablet , norfloxacin 400 mg tablets , ofloxacin 200 mg and ornidazole 500 mg tablet , ofloxacin 200 mg tablets , ofloxacin 400 mg tablets , olanzapine 10 mg tablet , olanzapine 5 mg tablet , ondansetron 4 mg md tablet , oxcarbazepine 300 mg tablet , oxcarbazepine 150 mg tablet , pantoprazole 40mgtablet , paracetamol 500 mg tablets , paracetamol 650 mg tablets , paroxetine 12.5 mg tablet , phenobarbitone 30 mg tablets , phenobarbitone 60 mg tablets , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 100 mg tablets , pioglitazone 15 mg tablets , prazosin hcl 2.5 mg tablets , prednisolone 10 mg tablets , prednisolone 20 mg tablets , prednisolone 5 mg tablets , primaquine 2.5 mg tablets , primaquine 7.5 mg tablets , prochlorperazine 5 mg tablet , prochlorperazine 10 mg tablet , promethazine25 mg tablet , propranolol 40 mg tablets , propranolol 10 mg tablets , propylthiouracil tablet 100mg , pyridoxine 10 mg tablet , pyridoxine 40mg tablet , pyrimethamine 37.5 mg and sulphadoxine 750 mg tablet , phenazopyridine tablet 5 mg , piracetam 400mg tablet , pramipexole tab. , pyridestigmine 60mg tablet , phenolphathaline 0.19gm tablet , quinine sulphate 300 mg tablets , quitiapine100 mgtablet , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , raltegravir 400 each film coated tablet contain raltegravir 400 mg , rabeprazole 20 mg tablet , ramipril 2.5 mg tablets , ramipril 5 mg tablets , ramigliflozin 100mg tablet , rifaximin 200mg tablet , rifaximin 400mg tablet , ranitidine 150 mg tablets , ranitidine 300 mg tablets , resperidone 2 mg tablet , resperidone 1 mg tablet , ribavirin 200 mg tab./cap film coated , ritonavir 25 mgtablet ip , ritonavir 50 mgtablet ip , roxithromycin 150 mg tablet , rosuvastatin 10mg tablet , rosuvastatin 20mg tablet , rosuvastatin 40mg tablet , rosuvastatin 10mg and fenofibrate 160mg tab. i.p. , serratiopeptidase 10mg tab. i.p. , silymarin 70mg tablet , silodosin 8 mg tablet / cap , silodosin 4mg tablet / cap , salbutamol 2 mg tablets , salbutamol 4 mg tablets , sodium valporate500 mg cr tablet , sodium valproate 200 mg tablets , sodium valproate 300 mg tablets ( sodium valproate 200+ valproic 87 mg, both corresponds 300 mg ) , sodium valproate 500 mg tablets , sofosbuvir 400 mg tab./cap , spironolactone 25 mg tablets , spironolactone 50 mg tablet , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit( per kit ) tablet , sertaline 50mg tablet , sotalol hcl 40mg tablet , sodiumbicarbonate 1gm tablet , sacubitril 24 mg and valsartan 26 mg tablet , savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , tapentadol 50 mg tablet , tapentadol 100 mg tablet , tamoxifen 10 mg tablet , tamoxifen 20 mg tablet , tamsulosin hcl 0.4 mgtablet , tamsulosin with dutasteride 0.4mg+0.5mg tablet , tamsulosin with finasteride 0.4mg+5mg tablet , telmisartan40mg and hydroclorothiazide12.5 mg, i.p. each tablet contain telmisartan40mg and hydroclorithiazide12.5 mg, , telmisartan80mg and hydroclorothiazide25 mg, i.p. each tablet contain telmisartan80mg and hydroclorithiazide 25 mg, , telmisartan 40 mg tablet , telmisartan 80 mg tablet , tenofovir alafenamide fumerate (taf) 25 mg tab./cap , tenofovir 300 mg+lamivudine 300 mg +dolutegravir 50 mg tablet , tenofovir 300 and lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg and lamivudine300 mg , tenofovir alafinamide25 and emtricitabine200 and doultegravir 50 each tablet contain tenofovir alafinamide25 mg and emtricitabine200mg and doultegravir 50mg , tenaligliptin 20 mgtablet , terbutaline sulphate 2.5mg tablet , theophylline 400 mg tablets (sr) , theophylline and etofylline 23mg + 77mg tablet , thiamine 100mg tablet , thyroxine sodium 100 mcg tablets , thyroxine sodium 50 mcg tablets , thyroxine sodium 25 mcg tablets , tinidazole 300 mg tablets , tinidazole 500 mg tablets , topiramate 50 mg tablet , topiramate 25 mg tablet , topiramate 100 mg tablet , torsemide 10 mg tablets , torsemide 10 mg + spironolactone 50mg tablets , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , tranexamic acid 500 mg tablet , tranexamic acid 500 mg, mefanimic acid 250mg tablet , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , tranexamic acid 250 mg, ethamsylate 250mg tablet , trifluoperazine 5 mgtablet , trihexyphenidyl2 mg tablet , trypsin chymotripsin tablet (each enteric coated tablet contains 1 lacks unit of enzymetic activity) , temozolomide 100mg tablet/capsule , thalidomide 100mg tablet/capsule , 6 thioguanine 40mg tablet , tizanidine 2mg tablet , terbinafine 250mg tablet/capsule , ursodeoxycholic acid 300 mg tablet , ursodeoxycholic acid 150 mg tablet , venlafaxine 37.5 mg tablet , vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg , verapamil 40mg tablet , valganciclovir tablet 450 mg , vildagliptin 50mg tab. i.p. , voglibose 0.2 mg tab tab. i.p. , voglibose 0.3 mg tab tab. i.p. , vitamin c 500mg, zinc sulphate 50mg & vitamin d 400iu chewable tablet , warfarin sodium 5mg tablet , warfarin sodium 2mg tablet , zinc sulphate dispersible 10 mg tablets , zinc sulphate dispersible 20 mg tablets , zinc sulphate dispersible 50 mg tablets , zidovudine 300 mg and lamivudine 150 mg tablet , zidovudine 60 mg and lamivudine 30 mg tablet , zolpidem 5mg tablet , zolpidem 10mg tablet , amoxicillin 250 mg capsules , amoxicillin 500 mg capsules , acitretin 150 mg capsules , acitretin 25 mg capsules , acitretin 10 mg capsules , all trans retinoic acid 10 mg capsules , alpha and lipoic acid and leycopen and multivitamin and miltiminerals capsule , aprepitant 125 mg capsules , aprepitant 125 / 80 mg capsule / tablet kit (each kit contains 1 capsule / tablet of 125 mg and 2 capsule / tablet of 80mg) , anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) cap. , amoxicillin and cloxacillin 250mg+250mg capsules , ampicillin 500 mg capsules , budesonide 9 mg capsules , calcium dobesilate 500mg capsules , cephalexin 250 mg capsules , ceritinib 50 mg capsules , ceritinib 100 mg capsules , ceritinib 200 mg capsules , ceritinib 250 mg capsules , cephalexin 500 mg capsule , clindamycin 300 mg cap , cap. d penicillamine 250mg , cap. l ornithine l aspartate (150mg) + pancreatin (100mg) , cap. trametinib 0.5mg + davarafenide 150mg , clindamycin150mg cap , calcitriol capsules ip 0.25 mcg , dacarbazine 200 mg capsules , diacerin 50mg capsule , diacerin 50mg, glucosamine 500mg capsule/tab , glucosamine and hydrochloride and methylsulfonylmethane capsule , deferiprone 250mg capsule , deferiprone 500mg capsule , danazol 100 mg capsules , danazol 50 mg capsules , doxycycline 100 mg capsules , eveningprimosa 1000 mg capsules , fluoxetine 20 mg capsules , fluoxetine 60 mg capsules , fenofibrate 150mg capsules , indomethacin 25 mg capsules , iron & zinc & folic acid capsule , isotretinoin 10mg capsules , isotretinoin 20mg capsules , itraconazole 100 mg capsule , itraconazole 200 mg capsule , lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) , multivitamin tablet/capsules , nifedipine 10 mg capsules , nifedipine 5 mg capsules , netupitant + palonosetron 300 mg + 0.5 mg capsules , omeprazole 20 mg+ domperidone 10 mg capsules , omeprazole 20 mg capsules , oseltamivir 30mg capsule , oseltamivir 45 mg capsule , oseltamivir 75 mg capsule , orlistat 120mg capsule , pantoprazole 40mg & domperidone 30mg sr capsule , pregabalin 75 mg + methylcobalamin 750 mcg capsule , pregabalin 75mg capsule , pregabalin 75mg, nortryptyline 10mg capsule/tablet , pregabalin 75mg, nortryptyline 10mg and methylcobalamine 500 mcg capsule/tablet , preprobiotic capsule each capsule contains (streptococcus faccalis 30million, clostridium butyricum 2million, bacillus mesntericus 1million, lactic acid bacillus 50million) , procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) , rabeprazole20 mg and domoeridone 10 mg capsules , esomeprazole 40 mg and domperidone 10 mg tab /cap , rucaparib 200 mg capsules , rucaparib 300 mg capsules , rabeprazole 20 mg and levosulpiride 75 mgcapsule , racecadotril 100mg cap. ip , natural micronised progesterone 200 mg (capsule) , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , temozolamide 250 mg capsules , tramadol 50 mg capsules , thiocolchicoside 4mg tablet/capsule , thiocolchicoside 8mg tablet/capsule , tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) , vitaminb complex capsules , vitamin a 25000 iu capsules , vitamin a 10000iu capsules , vitamin e 400 mg capsules , tab. hp kit(pantoprazole 40 mg+metronidazole 400 mg+clarithromycin 500 mg , tab. hydrocortisone oromucosal5 mg , tab. hydrocortisone oromucosal10 mg , tab. hydrocortisone oromucosal20 mg , lozenses clotrimazole 10mg , tab. prednisoloneip 50mg , tab. midodrine 5mg , tab./cap. hydroxyurea 500mg , tab. coq 300mg (capsule of co enzyme q10 with lycopene,selenium & omega 3 fatty acid ) , tab./cap. everolimus 5mg , tab./cap. everolimus 10mg , tab./cap. tacrolimus 0.25 , tab./cap. nintedanib 150mg , tab. 6 mercaptopurine 20 mg , tab. aceclofenac sr 200 mg , tab. afatinib 20 mg , tab. afatinib 30 mg , tab. afatinib 40 mg , tab. alendronate sodium 70 mg , tab. alfuzosin 10 mg , tab. alpelisib 150 mg , tab. alpelisib 200 mg , tab. alpelisib 250 mg , tab. amantidine 100mg , tab. apixaban 2.5 mg , tab. apixaban 5mg , tab. aripiprazole 10 mg , tab. aripiprazole 5 mg , tab. aspirin dispresible 325mg , tab. atomoxetin 10 mg , tab. atomoxetin 18 mg , tab. atomoxetin 25 mg , tab. atroxentine 250mg (trientine hcl) , tab. axitinib 5 mg , tab. bilastin 20 mg , tab. bosentan62.5 mg , tab. bosutinib 500 mg , tab. brivaracetam 50mg , tab. buprinorphine 2 mg , tab. calcium acetate 667 , tab. calcium folinate 15 mg , tab. capmatinib 200 mg , tab. cefixime + potassium clavulanate 200+125mg , tab. cefpodoxime 200 mg + clavulanate 125 mg , tab. chlordiazsepoxide 10 mg + clidinium 25 mg , tab. chlorthalidone 6.25 mg , tab. cholchicine 0.5mg , tab. cilostazol 50mg , tab. cilostazol 100mg , tab. clarithromycin 250 mg , tab. cilnidipine 5 mg , tab. cilnidipine10 mg , tab. cilnidipine 20 mg , tab. clozapine 100 mg , tab. cotriamazole 480mgs , tab. cyproheptadine 4mg , tab. cyproterone acetate 2 mg+ethynil estradiol. 035mg , tab. dabigatran 150 mg , tab. dabigatran 110 mg , tab. dabrafenib 50 mg , tab. dacomitinib 15 mg , tab. dacomitinib 30 mg , tab. dapoxetine 30 mg , tab. desvenlafaxine 50mg , tab. diclofenac 50 mg + thiocolchicoside 4 mg , tab. dienogest 2mg , tab. dimethyl fumarate120 mg , tab. dimethyl fumarate 240mg , tab. disulfiram 125 mg , tab. disulfiram 250mg , tab. dydrogesterone 10mg , tab. eltrombopag 25mg , tab. eltrombopag 50mg , tab. empagliflazone 10mg , tab. empagliflazone 25mg , tab. entacapone 200 mg , tab. erlotinib 150 mg , tab. erlotinib 100mg , tab. estradiolvalerate 2 mg , tab. enzalupamide 40mg , tab. ethynil estradiol 0.02mg+ tab desogestral 0.15mg , tab. etoricoxib 60 mg +thiocolchicoside 8 mg , tab. exemestane 25 mg , tab.fexofenadine180 mg , tab.fingolimod 0.5 mg , tab.fludrocortisone 100mcg , tab.fluvoxamine 100 mg , tab.fluvoxamine 50 mg , tab.folinic acid 15mg , tab.furosemide 20mg + spironolactone 50mg , tab.ibrutinib 140mg , tab.indomethacin 75 mg sr , tab.inositol + myoinositol 1000mg , tab.ivabradine 5mg , tab.ketoconazole 200 mg , tab.lacosamide 50 mg , tab.lapatinib 500mg , tab.lenalidomide25mg , tab.lenalidomide 10 mg , tab.lenvatinib 4 mg , tab.lenvatinib 10 mg , tab.levodopa+carbidopa 125 , tab.levodopa+carbidopa+entacapone 100mg/25mg/200mg , tab.levosulpride 75mg , tab.levothyroxine sodium75 mcg , tab.linaglipitin 2.5mg , tab.linaglipitin 5mg , tab.lorlatinib 25 mg , tab.lorlatinib 100 mg , tab.megestrol acetate 160 mg , tab.melatonin 3 mg , tab.melphalan 2mg , tab.metolazone 5mg , tab.methimazole5 mg , tab.methimazole10mg , tab.methotrexate 15mg , tab. methylphenidate 10 mg , tab.meverberine 135 mg + chlordiazepoxide 10 mg , tab.midostaurin 25 mg , tab.mirabegeron 25 mg , tab.mirtazapine 7.5mg , tab.mirtazapine 15mg , tab.mifepristone25mg , tab.montelukast 4mg , tab.montelukast 5 mg , tab.montelukast 10 mg , tab.morphine10mg , tab.morphine30mg , tab.moxonidine 0.2 mg , tab.moxonidine 0.3 mg , tab.n acetylecystine effervescent form, orange flavour, 600 mg , tab.naltrexone50 mg , tab.nebivolol 5mg , tab.nebivolol 10mg , tab.nicorandil 5mg , tab.nifidipine 20mg , tab.nifidipine 20mg sr , tab.nilotinib 150 mg , tab.nilotinib200 mg , tab.nilotinib 300mg , tab.nitazoxanide 500mg , tab.nitrazepam 10 mg , tab.olaparib 50 mg , tab.olaparib 150 mg , tab.olmesartan medoxomil 20 mg , tab.orciprenaline 10 mg , tab.osimertinib 80 mg , tab.oxcarbazepine 450mg , tab.oxazepam 15mg , tab.pancreatin gastroresistant 10,000mg(with proteiase & amylase) , tab.pantoprazole 20mg , tab.paroxetine 25mg , tab.pazopanib 200mg , tab.pazopanib 400mg , tab.penicillin v 400mg , tab.pentoxifylline extended release/sr 400mg , tab.perampanel 2 mg , tab.perampanel 4mg , tab.pheniramine 25 mg , tab.phenozopyridine 200mg , tab.pirfenidone 200 mg , tab.pirfenidone 400 mg , tab.piroxicam dt 20mg , tab.pomalidomide 2 mg , tab.pomalidomide 4 mg , tab.posacozazole 100mg , tab.prasugrel 10mg tab , tab.prazosin 5mg , tab.prednisoloneip 40mg , tab.primidone 50 mg , tab.primidone 250 mg , tab.progesterone only pills , tab.propylthiouracil 100 mg , tab.pyridoxine100 mg , tab.ranolazine 500mg , tab.rasagiline1mg , tab.regorafenib 40 mg , tab.repaglinamide 0.5mg , tab.repaglinamide 1mg , tab.ribociclib 200 mg , tab.rifampicin 150 mg , tab.rifampicin 450 mg , tab.rifampicin 600 mg , tab.rifaximin 550mg , tab.rivaroxaban 10mg , tab.rivaroxaban 15mg , tab.rivaroxaban 20mg , tab.rizatriptan 10mg , tab.ropinirole 0.25mg , tab.ruxolitinib 5 mg , tab.ruxolitinib 10 mg , tab.ruxolitinib 15 mg , tab.ruxolitinib 20 mg , tab.selegiline 5mg , tab.serratiopeptidase 20 mg , tab.sevelamer carbonate 800 mg , tab.sildosin 8 mg+ dutasteride 0.5 mg , tab.sildosin 4 mg+ dutasteride 0.5 mg , tab.itagliptine + metformin (50/500) , tab.sildenafil 20 mg , tab.sofosbuvir 400 mg+ velpatasvir 100 mg , tab.solifenacin succinate10 mg , tab.sorafenib 200 mg , tab.sultamicin 375 mg , tab.sunitinib 12.5 mg , tab.sunitinib 25 mg , tab.sunitinib 50 mg , tab.tacrolimus 1mg , tab.tegafur + uracil 100 mg , tab.tenofovir 300mg , tab.tetrabenazine 25mg , tab.ticagrelor 90mg , tab.tofacitinib 5 mg , tab.tolvapatan 15mg , tab.torsemide20mg , tab.tramadol 37.5mg + paracetamol 325mg , tab.trimetazidine 35mg , tab.trimetazidine 60mg , tab.trypsin + rutoside+bromelain , tab.ulipristal 5mg , tab. voriconazole 200 mg , tab. verapamil hydrochloride sustained release 120 , tab. warfarin 1mg , tab. warfarin 3mg , tab. zonisamide 50mg , tab. zonisamide 100 mg...
38101740 lab reagent purchase in district hospital hanumangarh , lab reagent items (must see instruction in technical part before filling this boq) , anti a, b antibody , anti a, b antibody , anti a1(dolichos biflorus) lectin , anti a1(dolichos biflorus) lectin , anti a1(dolichos biflorus) lectin , anti d biclonal (igg+igm) blood grouping sera, 10 ml pack , anti d biclonal (igg+igm) blood grouping sera, 10 ml pack , anti d monoclonal (igg) blood grouping sera, 10 ml pack , anti d monoclonal (igg) blood grouping sera, 10 ml pack , anti h (ulex europeus) lectin, 10 ml pack , anti h (ulex europeus) lectin, 10 ml pack , antibody elution kit, 10 ml pack , antibody elution kit, 10 ml pack , banchtop blood bag tube sealer with battery backup , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping gel card ahg c3d card (crossmatch), 24 card , blood grouping gel card forward & reverse grouping, 24 card , blood grouping gel card forward grouping, 24 card , calcium chewable tablets (10 tablets/ per pack) , check cells (coombs control cell), 10 ml pack , check cells (coombs control cell), 10 ml pack , copper sulphate of 1.053 specific gravity, 100gm/pack , copper sulphate solution of 1.053 specific gravity, 500ml/pack , copper sulphate solution of 1.053 specific gravity, 500ml/pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate reader , elisa plate washer , elisa reader printer roll (multiscan) , elisa reader printer roll (robonic) , elisa reader printer roll (robonic) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , fully automated elisa plate reader with washer , gel card centrifuge machine , gel card for gel card centrifuge, 24 card , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , haemo cue microcuvette , hb strips of hemocue (per strip) , hb strips of mission (per strip) , insulated box , insulated box , liss (low ionoc strength saline solution) 500ml pack , lyoplastin kit , lyoplastin kit , ph calibration fluids of ph 4.01, 7 and 10.01; 10 ml pack , phenotyping anti sera kit, 10 ml pack , phenotyping anti sera kit, 10 ml pack , plasma expressor , plasma expressor , platelet agitator cum incubator , platelet agitator cum incubator , portable tube sealer with battery backup , reagentredcellpanels(elevencellpanel)forantibody identifiction), 10 ml pack , reagent red cells for antibody screen (three or two cell panel), 10 ml pack , red circuler chart recorder pen (10 piece per pack) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , squeeze ball for donors (per piece) , tscd cutting blade / wafers (10/pack) , tscd cutting blade / wafers (10/pack) , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , absorbent cotton wool (5/ pack) , amies media (500 gm / pack) , amies media (500 gm / pack) , amies media (500 gm / pack) , anaerobic gas pack (6 piece/pack) , anaerobic system mark ii , andrades (indicator) 125ml / pack , arabinose (10gm/pack) , arabinose (10gm/pack) , arabinose (10gm/pack) , autoclave biological indicator (250 piece/pack) , bacteroides bile esculin agar (500 gm/pack) , bacteroides bile esculin agar (500 gm/pack) , bacteroides bile esculin agar (500 gm/pack) , blood agar 500gm / pack , blood agar 500gm / pack , blood agar 500gm / pack , blood agar plate , blood agar plate , blood agar plate , blood culture bottle , blood culture bottle , blood culture bottle , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 70 ml. adult for blood culture , brain heart infusion 70 ml. adult for blood culture , brain heart infusion 70 ml. adult for blood culture , cary blair’s transport media 500 gm / pack , cary blair’s transport media 500 gm / pack , cary blair’s transport media 500 gm / pack , cavity slide (10 per pack) , cetrimide agar 500 gm / pack , cetrimide agar 500 gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , chocolate agar 500 gm / pack , chocolate agar 500 gm / pack , cryo precipitate plasma thawing bath , cryo precipitate plasma thawing bath , cryo water bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , deoxycholate agar 500 gm / pack , deoxycholate agar 500 gm / pack , durham tube 100 piece/box , durham tube 100 piece/box , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , hot plate , loeffler’s medium 500 gm / pack , loeffler’s medium 500 gm / pack , loeffler’s medium 500 gm / pack , lowenstein jensen media. 500 gm / pack , lowenstein jensen media. 500 gm / pack , lowenstein jensen media. 500 gm / pack , mac cartney bottle 100ml (for blood culture) / pack , mac cartney bottle 100ml (for blood culture) / pack , mac cartney bottle 100ml (for blood culture) / pack , mac conkey agar plate , mac conkey agar plate , mac conkey agar plate , mannitol 25 gm / pack , mannitol 25 gm / pack , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set (each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard) , mcfarland standard set (each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard) , metal loops holder ( (w/o loop) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted) 1 x 8 / pack , metal loops holder ( (w/o loop) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted) 1 x 8 / pack , mueller hinton agar 500 gm / pack , mueller hinton agar 500 gm / pack , mueller hinton agar 500 gm / pack , nichrome loop d 4 (diameter : 4 mm, double wound, calibrated to 0.01ml.) 10x10 /pack , nichrome loop d 4 (diameter : 4 mm, double wound, calibrated to 0.01ml.) 10x10 /pack , nutrient agar 500 gm / pack , nutrient agar 500 gm / pack , nutrient agar 500 gm / pack , parafilm d m250 , parafilm d m250 , parafilm d m250 , peptone water , peptone water , peptone water , ph paper (range 2 to 10.5) 200 /pack , ph paper (range 2 to 10.5) 200 /pack , phenol red indicator 125ml /pack , phenol red indicator 125ml /pack , ppa broth and ppa reagent 500gm / pack , ppa broth and ppa reagent 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr broth500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , pyr reagent 500gm / pack , pyr reagent 500gm / pack , raffinose 10gm / pack , raffinose 10gm / pack , raffinose 10gm / pack , rcm broth 100gm / pack , rcm broth 100gm / pack , rcm broth 100gm / pack , safranin 0.5% w/v 500ml / pack , safranin 0.5% w/v 500ml / pack , safranin 0.5% w/v 500ml / pack , salmonella shigella agar 500gm / pack , salmonella shigella agar 500gm / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , sda agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , selenite f broth 500gm / pack , selenite f broth 500gm / pack , stained salmonella antigen set for widal tests (tube) , stained salmonella antigen set for widal tests (tube) , stained salmonella antigen set for widal tests (tube) , sterile cotton swab with wooden stick , sterile disposable petri plates polystyrene, size 120x15 mm 100 /pack , stock vial 5ml 50 / pack , stock vial 5ml 50 / pack , sucrose500gm/pack , sucrose500gm/pack , sucrose500gm/pack , tcbs agar 500gm / pack , tcbs agar 500gm / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thioglycolate broth 500gm / pack , thioglycolate broth 500gm / pack , tinsdale agar for diphtheria500gm , tinsdale agar for diphtheria500gm , tinsdale agar for diphtheria500gm , tissue roll 6/pack , tissue roll 6/pack , toothpick 100/pack , vdrl rotator/shaker , vibrio tcbs agar 500gm , vibrio tcbs agar 500gm , vibrio tcbs agar 500gm , vtm vial , vtm vial , zinc dust 500gm/pack , zinc dust 500gm/pack , ? napthol 100gm/pack , ? napthol 100gm/pack , ? napthol 100gm/pack , ? napthylamine 25gm/pack , ? napthylamine 25gm/pack , ? napthylamine 25gm/pack , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , india ink stain , india ink stain , india ink stain , india ink stain , india ink stain , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 2 for malaria parasite, 500ml/bottle , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , nucleic acid stain , nucleic acid stain , nucleic acid stain , nucleic acid stain , nucleic acid stain , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , trichrome stain solution , trichrome stain solution , trichrome stain solution , trichrome stain solution , trichrome stain solution , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , distilled water 10 ml pack , distilled water 10 ml pack , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ltr. pack , distilled water 5 ltr. pack , distilled water 5 ml pack , distilled water 5 ml pack , distilled water 5 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , edta powder 100gm pack , edta powder 100gm pack , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosinophil diluting fluid (100 ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hi chrome uti 500gm , hi chrome uti 500gm , iodine 100 gm pack , iodine 100 gm pack , koh 500gm pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , micro protien reagent (csf) 25ml pack , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , nitric acid , nitric acid , nitric acid , nitric acid , nitric acid , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , phenol (5%w/v, aqueous) 500 gm/pack , phenol (5%w/v, aqueous) 500 gm/pack , platelet diluting fluid 100ml/pack , platelet diluting fluid 100ml/pack , platelet diluting fluid 100ml/pack , potassium iodide 50 gm pack , powder sulphur (500gm/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sorbitol 500gm / pack , sorbitol 500gm / pack , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , clot activator vial, non vacume, double cap, red cap 4 ml , clot activator vial, non vacume, double cap, red cap 4 ml , clot activator vial, non vacume, double cap, red cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , plain serum vial, non vacume, double cap, red cap 4 ml , plain serum vial, non vacume, double cap, red cap 4 ml , plain serum vial, non vacume, double cap, red cap 4 ml , ria vial, non vacume 4 ml , ria vial, non vacume 4 ml , ria vial, non vacume 4 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , g 6 pd dificiency quantitative test kits (12 tests / kit) , glucometer strips, 100 strips per pack , glucometer strips, 100 strips per pack , rapid haem test for ocult blood in stool (guaiac test) , rapid haem test for ocult blood in stool (guaiac test) , rapid haem test for ocult blood in stool (guaiac test) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for filariasis , rapid card test for filariasis , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv tri dot , rapid card test for hiv tri dot , rapid card test for hiv tri dot+ag , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , test for iodine in salt , test for iodine in salt , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , water testing by strip method , water testing by strip method , amikacin 30 ?g , amikacin 30 ?g , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , amoxicillin 25 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , ampicillin 2 ?g , ampicillin 2 ?g , azithromycin 15?g , azithromycin 15?g , azithromycin 15?g , aztreonam 30 ?g , aztreonam 30 ?g , aztreonam 30 ?g , bacitracin 130 ?g/10 ui , bacitracin 130 ?g/10 ui , bacitracin 130 ?g/10 ui , carbenicillin 100 ?g , carbenicillin 100 ?g , carbenicillin 100 ?g , cefaclor 30 ?g , cefaclor 30 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefalexin 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefamandole 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefazolin 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefepime 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefixime sµg 10 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefoperazone 75 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 30 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotaxime 5 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefotetan 30 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefoxitin 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpirome 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefpodoxime 10 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefprozil 30 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , cefsulodin 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 10 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftazidime 30 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftibuten 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , ceftriaxone 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cefuroxime 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , cephalotin 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , chloramphenicol 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , ciprofloxacin 5 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clarithromycin 15 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clindamycin 2 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 10 ?g , colistin 10 ?g , colistin 50 ?g , colistin 50 ?g , colistin 50 ?g , doripenem 10 ?g , doripenem 10 ?g , doripenem 10 ?g , doxycycline 30 ?g , doxycycline 30 ?g , doxycycline 30 ?g , ertapenem 10 ?g , ertapenem 10 ?g , ertapenem 10 ?g , erythromycine 15 ?g , erythromycine 15 ?g , erythromycine 15 ?g , flumequine 30 ?g , flumequine 30 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 200?g , fosfomycin 200?g , fosfomycin 50 ?g , fosfomycin 50 ?g , fosfomycin 50 ?g , fusidic acid 10 ?g , fusidic acid 10 ?g , fusidic acid 10 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 500 ?g , gentamicin (high load) 500 ?g , gentamicin (high load) 500 ?g , gentamicin 10 ?g , gentamicin 10 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 15 ?g / 10 ui , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , gentamicin 30 ?g , gentamicin 30 ?g , imipenem 10 ?g , imipenem 10 ?g , imipenem 10 ?g , isepamicin 30 ?g , isepamicin 30 ?g , isepamicin 30 ?g , kanamycin (high load) 1mg , kanamycin (high load) 1mg , kanamycin (high load) 1mg , kanamycin 30 ?g , kanamycin 30 ?g , kanamycin 30 ?g , levofloxacin 5 ?g , levofloxacin 5 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , lincomycin 15 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 10 ?g , linezolid 10 ?g , linezolid 30 ?g , linezolid 30 ?g , linezolid 30 ?g , mecillinam 10 ?g , mecillinam 10 ?g , mecillinam 10 ?g , meropenem 10 ?g , meropenem 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , metronidazole 4 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , mezlocillin 75 ?g , mezlocillin 75 ?g , minocycline 30 ?g , minocycline 30 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxalactam 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , moxifloxacin 5 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , mupirocin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , nalidixic acid 30 ?g , nalidixic acid 30 ?g , neomycin 30 ui , neomycin 30 ui , neomycin 30 ui , netilmicin 10 ?g , netilmicin 10 ?g , netilmicin 10 ?g , netilmicin 30 ?g , netilmicin 30 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 100 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitrofurantoin 300 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , nitroxolin 20 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 10 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , norfloxacin 5 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , ofloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 1 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxacillin 5 ?g , oxacillin 5 ?g , oxidase discs , oxidase discs , oxidase discs , oxolinic acid 10 ?g , oxolinic acid 10 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , pefloxacin 5 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 1 iu , penicillin 1 iu , penicillin 6 ?g / 10 iu , penicillin 6 ?g / 10 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , pipemidic acid 20 ?g , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 100 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 30 ?g , piperacillin 30 ?g , piperacillin 75 ?g , piperacillin 75 ?g , piperacillin 75 ?g , polymixin 50 ?g/ 300 ui , polymixin 50 ?g/ 300 ui , polymixin 50 ?g/ 300 ui , pristinamycin 15 ?g , pristinamycin 15 ?g , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , quinupristin dalfopristin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 30 ?g , rifampicin 30 ?g , rifampicin 5 ?g , rifampicin 5 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , sparfloxacin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spectinomycin 100 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , spiramycin 100 ?g , spiramycin 100 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 500 ?g , streptomycin (high load) 500 ?g , streptomycin (high load) 500 ?g , streptomycin 10 ?g , streptomycin 10 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 200 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , sulfonamides 300 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , teicoplanin 30 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , telithromycin 15 ?g , telithromycin 15 ?g , tetracycline 30 ?g , tetracycline 30 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , ticarcillin 75 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tigecycline 15 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 10 ?g , tobramycin 10 ?g , tobramycin 30 ?g , tobramycin 30 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , trimethoprim 5 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin5 ?g , vancomycin5 ?g , vancomycin 30 ?g , vancomycin 30 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , blood cell counter 8 key + 1 totaliser , blood cell counter 8 key + 1 totaliser , blood mixer/roller/rotator , bone marrow aspiration needle (metal, salah type) , bone marrow aspiration needle (metal, salah type) , bone marrow biopsy needle (jamshidi) , bone marrow biopsy needle (jamshidi) , bt/ct capillary tube, 100/pack , centrifuge machine (08 tubes) , centrifuge machine (08 tubes) , centrifuge machine (08 tubes) , centrifuge machine (16 tubes) , centrifuge machine (16 tubes) , centrifuge machine (16 tubes) , centrifuge machine (24 tubes) , centrifuge machine (24 tubes) , centrifuge machine (24 tubes) , centrifuge machine (36 tubes) , centrifuge machine (36 tubes) , centrifuge machine (36 tubes) , conical flask glass 250ml , conical flask glass 500ml , container (plastic), 1 liter , coplins jar (vertical) glass with cap , coplins jar (vertical) plastic with cap , cotton swab (50 piece pack) , cover slip 18x18 mm (50/pack) , cover slip 18x18 mm (50/pack) , cover slip 18x36 mm (50/pack) , cover slip 18x36 mm (50/pack) , cover slip 22x22 mm (50/pack) , cover slip 22x22 mm (50/pack) , cover slip 22x50 mm (50/pack) , cover slip 22x50 mm (50/pack) , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling (30 ml / pack) , dpx mount for sickling (30 ml / pack) , dropper plastic 1 ml, (100/pack) , dropper plastic 2 ml, (100/pack) , dropper plastic 3 ml, (100/pack) , dropper plastic 5 ml, (100/pack) , esbachs albuminometer , esr fluid (500ml pack) , esr fluid (500ml pack) , esr fluid (500ml pack) , esr fluid (500ml pack) , esr pipette with vaccum plug, 100/pack , esr pipette with vaccum plug, 100/pack , esr pipette with vaccum plug, 100/pack , esr stand (westergreen iron 6 key) , esr stand (westergreen iron 6 key) , esr stand (westergreen iron 6 key) , esr stand (westergreen plastic 6 key) , esr stand (westergreen plastic 6 key) , esr stand (westergreen plastic 6 key) , esr tube (0 200) westergreen glass, 2ml , esr tube (0 200) westergreen glass, 2ml , esr tube (0 200) westergreen glass, 2ml , esr tube (disposable) , esr tube (disposable) , esr tube (disposable) , esr tube with cap , esr tube with cap , esr tube with cap , esr tube with cap reusable , esr tube with cap reusable , esr tube with cap reusable , funnel (conical ) keep plastic transparent , funnel conical, 250 gram capacity , funnel conical, 500 gram capacity , glass slide box (75x25x1.35 mm) (100 slides/pack) , glass slide box (75x25x1.35 mm) (100 slides/pack) , glass stirring rod , glass test tube (12x100 mm) , glass test tube (12x75 mm) , glass test tube (15x100mm) , glass test tube (15x150mm) , glucometer , glucometer , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb meter(top square) , hb pipette top square , hb tube round , hb tube square , hydrometer (for specific gravity) , hydrometer (for specific gravity) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , lancet (100/pack) , lancet (100/pack) , litmus paper (acidic & basic) (20 piece / pack) , litmus paper (acidic & basic) (20 piece / pack) , microscope binocular with led illumination with battery backup , microscope binocular with led illumination with battery backup , microscope binocular with led illumination with battery backup , microscope bulb (low voltage halogen lamp & led) , microscope bulb (low voltage halogen lamp & led) , microscope bulb (low voltage halogen lamp & led) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , pasteur pipette (dropper) glass , pcv tube (wintrobe tube) , pcv tube (wintrobe tube) , ph meter , ph paper packet (20 piece / pack) , ph paper packet (20 piece / pack) , plastic slide storage box for 50 slides , plastic slide storage box for 50 slides , plastic test tube 3 inch (100/pack) , plastic test tube 3 inch (100/pack) , plastic tray for lab , plastic tray for lab , ppd syringe 100 / pack , ppd syringe 100 / pack , r.b.c pipette , r.b.c pipette , semen/ sputum/ urine / stool container plastic with cap 30 ml , semen/ sputum/ urine / stool container plastic with cap 50 ml , spatula with cytobrush , spirit lamp , spirit lamp , staining jar trough glass for 10 slides each , staining jar trough glass for 10 slides each , storage vial , syringe holder for fnac (20ml syringe) , syringe holder for fnac (20ml syringe) , syringe holder for fnac (20ml syringe) , thermal printer roll for 3 part cbc horiba (57mm x 10 meter) , thermal printer roll for 3 part cbc vector (50mm x 20 meter) , thermal printer roll for sd 120 urine analyzer (55mm x 20 meter) , thermal printer roll for stago coagulation analyzer (110mm x 25 meter) , urinometer , urinometer , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vaccutainer needle , vaccutainer needle , vaccutainer needle , vacutainer pack , vacutainer pack , vacutainer pack , vacutainer pack , w.b.c pipette , whatman filter paper (round) 125 mm (1x50 pack) , whatman filter paper (round) 125 mm (1x50 pack) , wooden slide storage box for 50 slides , wooden slide storage box for 50 slides , zip lock plastic bag 4*6 inch (100 piece / pack) , zip lock plastic bag 4*6 inch (100 piece / pack) , zip lock plastic bag 6*8 inch (100 piece / pack) , zip lock plastic bag 6*8 inch (100 piece / pack) , zip lock plastic bag 8*10 inch (100 piece / pack) , zip lock plastic bag 8*10 inch (100 piece / pack) , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , disposable abg syringe without needle 3 ml , disposable abg syringe without needle 3 ml , disposable abg syringe without needle 3 ml , disposable glove without powder (nitrile) size 6 , disposable glove without powder (nitrile) size 6.5 , disposable glove without powder (nitrile) size 7 , disposable glove without powder (nitrile) size 7.5 , disposable needle no. 22 , disposable needle no. 22 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 23 , disposable needle no. 23 , disposable needle no. 24 , disposable needle no. 24 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 10 ml , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 2 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 20 ml , disposable syringe 20 ml , disposable syringe 3 ml , disposable syringe 3 ml , disposable syringe 3 ml , disposable syringe 5 ml , disposable syringe 5 ml , disposable syringe 5 ml , dropper glass 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , hand wash liquid soap (100ml / pack) , hitachi sample cup 2 ml 500/pack , hitz cuvatte , hitz cuvatte , hypodermic needle, 21g,1.5 , icebox (2liter capacity) , measuring cylinder 0 to 100 ml graduated glass , measuring cylinder 0 to 1000 ml graduated glass , measuring test tube glass 0 10 ml graduated conical , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , microcentifuge tude 0.5 ml , microcentifuge tude 1.5 ml , microcentifuge tude 2.0 ml , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , pasteur pipettes 0.25 ml capacity 500/pack , pasteur pipettes 0.50 ml capacity 500/pack , pasteur pipettes 1 ml capacity 500/pack , pasteur pipettes 10 microliter capacity 500/pack , pasteur pipettes 3 ml capacity 500/pack , pasteur pipettes 5 ml capacity 500/pack , cd/dvd/ohp fine tip marker pen, red , cd/dvd/ohp fine tip marker pen, red , cd/dvd/ohp fine tip marker pen, black , cd/dvd/ohp fine tip marker pen, black , petridish 90 mm diameter, 15 mm height 1 piece , pipette stand plastic for 5 pipette , pipette stand plastic for 5 pipette , pipette stand plastic vertical 28 holes 12 mm , pipette stand plastic vertical 28 holes 12 mm , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , sticker (50/pack) , stop watch racer (plastic ) , test tube holder , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand stainless steel ( 12x75 mm) , test tube stand stainless steel ( 12x75 mm) , test tube stand stainless steel ( 15x100 mm) , test tube stand stainless steel ( 15x100 mm) , test tube stand stainless steel ( 15x150 mm) , test tube stand stainless steel ( 15x150 mm) , thermocal box (5 liter capacity) , torniquet , torniquet , tube holder for 10 ml tubes , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , tube holder for 5ml tubes , urine container, plastic, 30 ml, sterilized , urine container, plastic, 30 ml, sterilized , urine container, plastic, 50 ml, sterilized , urine container, plastic, 50 ml, sterilized...
37884415 supply of medicine in govt bdm hospital kotputli , injection list , adenosine inj. 3mg / ml , adrenaline 1 ml , aipha beta artemether inj 2ml , alpha beta artemether inj 1ml , alpha beta arteether [ lp.26 ] [ m ] , amikacin 100mg inj 2ml , amikacin 250mg inj 2ml , amikacin 500mg inj 2ml , aminophyllin inj 10ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj 1.2gm , amoxicillin and potassium clavulanic inj 600mg , ampicillininj 1gm , ampicillininj 500mg , ampicillin + cloxacillin inj 1gm , anti d human immunoglobulin inj 300 mcg , anti tetanus serum inj ( tetanus immunoglobulin ) 250 iu / vial , ars inj ( rabies antiserum ) 5 ml vial , artesunate inj 60mg vial , artisunate inj 120mg , asv inj ( snake venum antiserum ) lyophilized , atracurium inj 10 mg / ml , atropine sulphate inj 1 ml , azithromycin 10 ml vial equivalent to 500 mg , benzathine benzylpenicilline inj 12 lac units , benzathine benzylpenicilline inj 6 lac units , betamethasone sod phos inj 1 ml , botropase inj 1ml , bupivacaine 0.5% inj 20ml , bupivacaine in dextrose inj ( heavy ) 4ml , butorphanol tartrate inj 1 ml , caffein 10 mg , caffeine citrate inj 3 ml , calcium gluconate 10% inj 10ml , carboprost tromethamine inj 1ml , cefepime injection ip 500 mg [ 510 ] , cefoperazone 1 gm & sulbactum 0.5 gm inj , cefotaxime + salbactam inj 375mg , cefotaxime inj 125mg , cefotaxime inj 1gm , cefotaxime inj 250mg , cefotaxime inj 500mg , ceftazidime inj 1 gm , ceftazidime inj 250 mg , ceftazidime inj 500 mg , ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] , ceftriaxone inj 125mg , ceftriaxone inj 1gm , ceftriaxone inj 250mg , ceftriaxone inj 500mg , chloroprozmine inj 25 mg / ml , chloroquine phosphate inj 5ml , ciprofloxacin inj 100ml , clindamycin phosphate inj 300mg , cloxacillin sodium inj 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexamethasone inj 2ml , dextrose 10% inj 500ml , dextrose 25% inj 100ml , dextrose 5% inj 1000ml , dextrose 5% inj 500ml , diazepam inj 2ml , diclofenac sodium inj 1 ml , diclofenac sodium inj 3ml , dicyclomine inj 2ml , digoxin inj 2ml , diltiazem inj 5ml , distal water 10ml ( water for inj. ) , dns inj 1000ml , dns inj 500ml ( sodium chloride 0.9% & dextrose 5% ) , dobutamine inj 250 mg / 5ml , dopamine hcl inj 5ml , doxycycline100 mg , dried factor viii fraction 1000 iu / vial ( iv use ) , dried factor viii fraction 500 iu / vial ( iv use ) , dried human anti haemophlic fraction inj ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine hydrochloride inj 2ml , electrolyte m inj500 ml , enaxoparine sodium 60mg inj , esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] , ethamsylate inj 2ml , etophylline + theophylline 2ml inj , fentanyl citrate inj 2 ml , ferric carboxy maltose 500mg / 10 ml vial , ferric carboxymaltose inj 10 ml , fluconazole 200mg , fructodox 10% inj 500ml , frusemide inj 2ml , gdw 5% glass bottle , gentamycin 80mg inj 2ml , gentamycin inj 20mg , glycopyrrolate inj 0.2 mg / ml , haemaceel inj ( polygeline+ nacl+ kcl+cacl2 ) 500ml , haloperidol inj 1ml , halothane inj 250 ml , heparin sodium 5000 iu / ml inj 5 ml , hepatitis b immunoglobulin inj 100 iu , human albumin solution 20% 100 ml , human chorionic gonadotropin inj 5000 iu , hyaluronidase inj ( hylase ) 1500 iu , hydrocortisone inj 100mg , hydrocortisone inj200mg , hydroxyethyl starch 6% with sodium chloride 0.9 % 500 ml intravenous infusion , hydroxyprogesterone inj 250mg , hydroxyprogesterone inj 500mg , hyoscine butylbromide inj 20 mg / ml , insulin 30%:70% inj ( 10ml ) biphasic , insulin n inj ( 10ml ) isophane 40 iu / ml , insulin r inj ( 10ml ) soluble 40 iu / ml , insuline glargine inj 100 iu / ml 3 ml cartridge , insuline glargine inj100 iu / ml 10 ml vial , iron sucrose inj 5ml , isoflurane inj 100 ml , isolyte p inj 500ml ( electrolyte p ) , isoxsuprine inj 2 ml , ketamine inj 10ml , labetalol inj 4 ml , levetiracetam inj 500 mg / 5ml , levofloxacine 100 ml , lignocaine & adrenaline inj 30 ml , lignocaine 2% inj 30ml , linezolid inj200mg / 100ml [ 517 ] , linezolid inj 200mg / 100ml , lorazepam inj 2ml , l ornithine l aspartate 10 ml , magnesium sulphat inj 500mg / ml 2ml , mannittol 20% inj 350ml , mannittol 20% w / v inj 100ml , mecobalamin 500 mcg / ml inj 1 ml , mephentermine 30mg / ml 10 ml vial , meropenem inj 1 gm , meropenem inj 500 mg , methyl ergometrine inj 1ml , methyl prednisolone sod. succinate inj 500 mg , methylprednisolon acetate injection 40mg , metoclopramide inj 2 ml , metronidazole inj 100ml , morphine sulphate inj 10 mg / ml , moxifloxacin 400 mg / 100ml , multivitamine 10 ml , mvi inj 10 ml , naloxone inj 0.4mg / ml 1 ml , nandrolone decanoate 50 mg inj , natural progesteron inj 200mg / 2ml , neostigmine inj 0.5 mg / ml 10 ml , neostigmine inj 2.5mg / 5ml , nicorandil 48 mg , nitroglycerin inj 5 mg / ml , noradrenaline inj 2 ml , normal human intravenous immunoglobulin 5g / 100ml [ 633 ] , normal saline 500 ml glass bottle , normal saline inj 500ml ( sodium chloride ) , ofloxacin 100ml infusion , ondansetron 8 mg , ondansetron inj 2ml , orinidazole inj 100ml , oxytocin inj 1ml , paracetamol infusion 100 ml , paractamol inj 2 ml , pentazocine inj 1 ml , pentoprazole inj 40 mg vial , pheniramine mealate inj 2ml , phenobarbitone inj 1ml , phenytoin sodium inj 2ml , pilocarpin inj 1ml , pilocarpine 0.5 %w / v , piperacillin + tazobactum inj 4gm+500mg , piracetam 200 mg , potasium chloride inj 10ml , pralidoxime chloride inj 25 mg / ml / 500 mg , prochlor perazine mesylate inj 5ml , promethazine inj 2 ml , promethazine inj 2ml , propofol inj 20 ml vial , quinine dihydrochloride inj 2ml , rabies vaccine human ( cell culture ) inj 2.5 iu dose ( 1 ml vial with 1 ml diluent ) , ranitidine hcl inj 2ml , remdesivir 100 mg inj. , rh erythropoetininj 10000 iu [ 176 ] , rh erythropoetininj 4000 iu [ 179 ] , ringer acetate infusion 500 ml , ringer lactate inj 1000ml , ringer lactate inj 500ml ( compound lactate ) , ringer lactate inj 500ml ( glass bottel ) , sodium biocarbonate inj 10ml , sodium chloride inj 100 ml ( normal saline ) , sodium valproate inj 100 mg / ml , streptokinase inj 15 lac units , succinyl choline inj 10ml , tetanus vaccine ( adsorbed ) 0.5ml , tetanus vaccine ( adsorbed ) inj 5 ml vial , thiopentone inj 0.5 gm , torsemide inj 10mg / ml , tramadol 50mg / ml inj 2 ml , traxenamie acid inj 5ml , urokinase inj 5 lac unit ( lyophilized ) , valethamate bromide 8mg / ml inj 1ml , vancomycin for intravenous infusion 250 mg , vancomycin for intravenous infusion 500 mg , vecuronium bromide inj 4 mg ( freeze dried ) , vitamin b complex inj 10 ml , vitamin d ( 600000 iu ) 15 mg , vitamin k inj 1ml ( menadione ) , vitamin k 1 inj ( phytomenadione ) 1 mg / 0.5ml , tablets / capsules list , acebrophylline 100 mg tab , aceclo 50 mg +para 325 mg+sera 10 mg tab , aceclofenac 100mg + paracetamol 325mg tab , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , act kit ( containing3 tab of artesunate 200mg, 2 tab of sulphadoxine 750 mg & pyrimethamine 37.5mg ) , act kit ( containing3 tab of artesunate 50mg, 1 tab of sulphadoxine 500 mg & pyrimethamine 25mg ) , act kit ( containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , acyclovir 200mg tab , acyclovir 800mg tab , albendazole 400mg tab , allopurinol 100 mg tab , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , alprazolam 0.25mg tab , alprazolam 0.5 mg tab , amitriptyline tab ip 25mg film coated , amlodipine2.5 mg tab , amlodipine 5 mg & enalapril 5 mg tab , amlodipine 5mg+ atenonol 50mg tab , amlodipine 5mg +lisinopril 5mg tab , amlodipine tablets ip 5 mg , amoxycillin 250mg & cloxacillin 250 mg cap , amoxycillin 250mg + calvulanic acid 125mg ( 1x375mg ) , amoxycillin 250mg cap , amoxycillin 500mg + calvulanic acid 125mg ( 1x625mg ) , amoxycillin 500mg cap , amoxycillin dispersible tab 125 mg , ampicilline 500mg cap , antacid tab ( aluminium hydroxide+magnesium trisilicate+peppermint oil ) , anticold tab ( cetirizine 5 mg, phenylephrine 1x325 mg ) , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , artemether 40 mg and leumefantrine 240 mg tablet , artemether 80 mg and leumefantrine 480 mg tablet , ascorbic acid 500mg tab , aspirin 150mg ( gastro resistant ) tab , aspirin 75mg tab delayed release , atenolol 25mg tab , atenolol 50mg tab , atorvastatin 10 mg tab , atorvastatin tablets40 mg , atorvastin 20 mg tab , azithromycin 100mg tab , azithromycin 250mg tab , azithromycin 500mg tab , b. complex tab ( prophylactic ) , baclofen 10 mg tab , betahistine 8 mg tab , betemethasone 0.5 mg tab , bisacodyl 5mg tab , cabergoline 0.5 mg tab , calcitriol capules 0.25mcg , calcium 500mg with vitamin d3 250 iu tab , carbamazepine 100 mg tab , carbamazepine 200mg tab , carbimazole tabs ip 5 mg ( film coated ) , carvedilol 3.125 mg tab , cefadroxil 250 mg tab , cefadroxil 500 mg tab , cefixime 100mg tab , cefixime 200mg tab , cefpodoxime 100mg tab , cefpodoxime dispersible tab 50 mg , cefuroxime axetil tab ip 250 mg , cephalexin 125mg dt tab , cephalexin 250 mg cap , cephalexin cap500 mg , cetrizine 10mg tab , chlordiazepoxide tablets ip 10mg , chloroquine phosphate 250mg tab , chlorpheniramine maleate 4mg tab , chymotrysin , cinnarizine 25mg tab , cinnarizine 75mg tab , ciprofloxacin 250mg tab , ciprofloxacin 500mg tab , ciprofloxacin+tinidazole tab , clarithromycin 500mg , clindamycine 150mg cap , clobazam 10 mg tab , clobazam 5 mg tab , clomifene 25 mg tab , clomifene 50 mg tab , clonazepam 0.5mg tab , clonidine hydrochloride tablet ip 0.1 mg , clopidogrel 75 mg and aspirin 75 mg tab , clopidogrel 75mg tab , clotrimazole ( vaginal ) 500 mg tab , clotrimazole powder 1x30 gm , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen , combikit of ( tab fluconazole150mg and azithromycin 1gm and secnidazole1gm ) each kit contain 1tab fluconazole150mg and 1 tab.azithromycin 1gm and 2 tab.secnidazole1gm . , dapagliflozin 10 mg tab. , deflazacort 6 mg , deflozacort 0.6mg tab , dexamethasone 0.5mg tab , diazepam 5mg tab , diclofenac 50 mg +paracetamol 325 mg +chloroxozone 250mg tab , diclofenac gastro resistant50 mg tab , diclofenac sodium + serrtiapeptidase + paracetamol 325mg tab , diclofenac sodium 100 mg sr tab , diclofenac sodium 50 mg + paracetamol 325mg tab , dicyclomin+mephenic acid tab , dicyclomine hcl 20mg + paracetamol 325mg tab , dicyclomine tab ip 10 mg , digoxin 0.25mg tab , diltiazem tabs ip 30 mg film coated , divalproex extended release 250 mg tab , domperidone tab ip 10 mg , doxycyclin 100mg cap , doxylamine succinate 20mg & pyridoxine hcl 20 mg tab , drotaverine 40mg tab , drotaverine 80mg +mephenic acid 250mg tab , duloxetine gastro resistant 20mg , duloxetine gastro resistant 30mg , dutasteride 0.5 mg tab , efavirenz 600 each film coated tablet contain efavirenz 600 mg , enalapril maleate 10 mg tab , enalapril maleate 2.5 mg tab , enalapril maleate 5mg tab , escitalopram tab ip 10 mg , esomeprazole 40 mg , esomeprazole 40 mg tab. , ethamsylate 500mg tab , etophylline 23mg +theophyllin 77mg tab , etoricoxib120mg tab , etoricoxib 90mg tab , ferrous sulphate 100 mg with folic acid 0.5mg tab ( iron folic acid tab ) , finasteride tablets ip 5 mg , flavoxate tablets ip / bp 200 mg ( coated tablet ) , fluconazole 150mg tab , flunarizine 5mg tab , fluoxetine 20 mg cap , folic acid 5mg tab , formalin tablet , frusemide tab ip 40 mg , gabapentine 300mg tab , glibenclamide 5mg tab , glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride tab ( sustained release ) 500 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , gliperimide 1mg+metformin 500mg sr tab , gliperimide 2mg+metformin 500mg sr tab , glipizide 5mg + metformin 500 mg tab , glipizide 5mg tab , glucosamine and hydrochloride and methylsulfonylmethane capsule ] , glucosamine hcl + diacerein 50 mg tab , glyceryl trinitrate 2.6mg controlled release tab , griseofulvin 125mg tab , haloperidol 1.5mg tab , haloperidol 5mg tab , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , hydrochlorthiazide 12.5 mg tab , hydrochlorthiazide 25 mg tab , hydroxychloroquine sulphate 200 mg tab , hydroxychloroquine sulphate 400 mg tab , hydroxyzine 25 mg tab , hyoscine butyl bromide 10mg tab , ibuprofen400 mg tab , ibuprofen 400mg + paracetamol 325mg tab , imipramine 25 mg tab , imipramine 75 mg tab , indomethacin 25 mg cap , isosorbide dinitrate 5mg tab , isosorbide mononitrate 20mg tab , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , itraconazole cap 200 mg , ivermectin 12mg tab. , ivermectin 6mg tab. , ketorolac 10 mg tab , labetalol 100 mg tab , lactic acid bacillus tab 60 million spores , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] , levetiracetam 500 mg tab , levocetrizine 5mg tab , levodopa 1x10mg tab , levodopa 250mg and carbidopa 25mg tab , levofloxacin 500 mg tab , levofloxacin tablets ip 250 mg , levosulpiride 25mg tab , levothyroxine sodium tablet 25 mcg , lincomycin 500mg tab , linezolid tablets ip 600 mg , linezolid tablets ip 600 mg [ 516 ] , lisinopril 10mg tab , lisinopril 2.5 mg tab , lisinopril tab ip 5 mg , lithium carbonate 300 mg tab , loperamide tab ip 2 mg , lorazepam 2mg tab , losartan 25 mg tab , losartan 50mg + amlodipine 5mg tab , losartan pot. 50mg & hydrochlorothiazide 12.5 mg tab , losartan tab ip 50 mg , mefenamic acid 250mg and dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg and dicyclomine hydrochloride10mg , mefenamic acid 500mg tab , mesalamine 1.2 gm enteric coated tab , metformin500mg film coated tab , metformin hcl sr 1000mg tab , methotrexate 10 mg , methyl cobalamine 500 mcg tab , methylcobalamine 1500mcg tab , methyldopa 250mg tab ( film coated ) , methylergometrin0.125mg tab , methylpredinisolone 16 mg , methylpredinisolone 8 mg , methylprednisolone 4mg tab. , metoclopramide 10mg tab , metoprolol 25mg tab , metoprolol succinate 50 mg tab , metronidazole 200mg tab , metronidazole 400mg tab , mifepristone 200 mg tab , misoprostol 200 mcg tab , montelucast 10mg + levocetrizine 5mg tab , moxifloxacin400 mg , multivitamin + f.a.+ minerals tab , naproxen 250 mg tab , naproxen 500 mg tab , natural micronised progesteron soft gelatin cap 200 mg , neomycin, bacitracin and sulphacetamide powder 10 gm , neostigmine 15 mg tab , neproxen 500 mg tab , nicoumalone 1 mg , nicoumalone 4 mg , nifedipine 5 mg cap ( nicardia ) , nifedipine sr 10 mg tab ( nicardia ) , nitrazepam 10 mg , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin 400mg ( film coated ) tab , ofloxacin 200mg + ornidizole 500mg tab , ofloxacin 200mg tab , olanzapine tab ip 5 mg , omeprazole 20mg cap , omperazole 20mg + domeradom cap , ondensetron orally disintegrating 4mg tab , ors powder ( who formula ) 20.5 gm , oseltamivir capsule ip 30 mg , oseltamivir capsule ip 45 mg capsule , oseltamivir capsule ip 75 mg capsule , oxcarbazepine 150mg tab , pantoperazole 40mg tab , pantoprazole 40mg and domperidone 30mg sr cap , paracetamol 500mg tab , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , phenazopyridine 5 mg tab , pheneramine mealate 25mg tab , phenobarbitone 30mg tab , phenytoin 100mg tab , pioglitazone tab ip 15 mg , piracetam 200mg tab , piracetam 800mg tab , prazosin 2.5 mg tab , prednisolone 10mg tab , prednisolone 20mg tab , prednisolone 5 mg tab , pregabaline 75 mg cap , primaquine 2.5mg tab , primaquine 7.5mg tab , probiotic sachets 1 gm size , prochlorperazine 5mg tab , promethazine 25 mg tab , propranolol 40mg tab , propylthiouracial 100 mg , pyridoxine 10mg tab , pyridoxine 40mg tab , quinnine sulphate ( enteric coated ) 300mg tab , racecadotril 100mg , rampril 2.5mg tab , rantidine 150mg film coated tab , rantidine 300mg film coated tab , rebeprazole 20mg +levosulpiride 75 mg , rifaximin 500mg , risperidone 1 mg tab , risperidone 2 mg tab , rosuvastatin 10mg and fenofibrate 160mg tab. , rosuvastatin tablet 10 mg [ 757 ] , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rotacap budesonide powder for inhalation 40 mcg ( budecort ) , rotacap formoterol fumerate & budesonide powder for inhalation 6 mcg +200 mcg ( foracort ) , salbutamol 2mg tab , salbutamol 4mg tab , serratiopeptidase 10mg , serratiopeptidase 10mg tab , sertaline 50mg tab , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sodium bicarbonate 1 gm tab , sodium valproate gastro resistant 200 mg tab , sodium valproate gastro resistant 500 mg tab , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , sulphasalazine 500 mg , tamsulosin hcl tablets 0.4 mg , telmisartan 40mg tab , telmisartan40mg and hydroclorothiazide12.5 mg, i.p. each tablet contain telmisartan40mg and hydroclorithiazide12.5 mg , telmisartan80mg and hydroclorothiazide25 mg, i.p. each tablet contain telmisartan80mg and hydroclorithiazide 25 mg, , tenaligliptin tab 20mg , terbinafine hcl 250 mg , terbutaline 2.5 mg tab , theophyllin 400mg prolonged release tab , thiamine 100mg tab , thiocolchicosite 4 mg , thyroxine 100 mcg tab , thyroxine 50 mcg tab , tinidazol 300mg tab , tinidazol 500mg tab , tizanidine hcl 2 mg tab , torsemide 10 mg tab , tramadol 50mg cap , traxenamic 500 mg + ethamsylate 250 mgtab , traxenamic acid 500 mg + mephenic acid 250 mg tab , traxenamic acid 500mg tab , trifluperazine 5 mg coated tab , trihexyphenidyl hcl tab ip 2 mg , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , trypsin & chemotrypsin tab , ursodeoxycholic acid tablets 300 mg , verapamil 40mg tab ( film coated ) , vildagliptine 50mg , vitamin a 25000 iu cap , vitamin c 500mg + zinc 20mg tab , vitamin d 1 gm sachets ( cholecaciferol granules ) , vitamin e 200mg tab , voglibose 0.2 mg tab tab. i.p. , voglibose 0.3 mg tab tab. i.p. , zinc 20mg tab , zinc 50mg , zinc sulphate 10mg tab , zolpidem 5mg tab , syrup / ointment list , acyclovir cream 5% , acyclovir oral susp. 400mg / 5ml , albendazole oral suspension ip 400 mg / 10ml , alkaline nasal douches ( sodium bicarbonate and sodium biborate and sodium chloride ) , amoxycillin & pot. clavunate oral susp. ( 30ml ) , amoxycillin 125mg / 5ml susp. ( 30ml ) , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mg gel , antacid liquid 60 ml , each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , anticold drop ( each ml contains paracetamol 125mg, chlorpheniramine maleate 1mg and phenylepherine hydrochloride 2.5 mg ) 15 ml , anticold syrup 30 ml ( each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg ) , azithromycine 100 mg / 5 ml oral susp. , azithromycine 200 mg / 5 ml oral susp. , beclomethasone + neomycin + clotrimazole cream 10gm , beclomethasone dipropionate 0.064% and salycylic acid 3% lotion , beclomethasone inhalation ip 200 mcg / dose ( 200 metered dose container ) , betamethasone and neomycin cream ( 0.10% and0.5% ) , betamethasone dipropionate cream 0.05% 15 gm , betamethasone lotion ip 0.05 o / o 50ml , betamethasone+ salisilic acid cream 5gm , budesonide inhaler 200 mcg , budesonide nebulizer susp. 0.25mg / ml 2 ml , calamine lotion 100 ml , calcium30 ml , calcium + vtamin d3 susp. ( 100ml ) , calcium phosphate syp 200 ml , carbamazepine oral susp. 100 ml , cefadroxil syp ( 30ml ) , cefixime oral susp. ( paed drops ) 10 ml , cefpodoxim syp ( 30ml ) , cefpodoxime 100 mg susp. , cephalexin susp. ( 30ml ) , cetirizine syrup ip 5mg / 5 ml 30 ml , cetrimide cream 15 gm , chlorhexidine mouthwash 0.2% 50 ml , chloroquine phosphate susp. ( 60ml ) , clindamycin phosphate gel usp 1o / o 20gm , clobetasol propionate cream 0.05% 20gm , clotrimazole 1 o / o w / v mouth paint 15 ml , clotrimazole cream ip 2% w / w 15gm , compound benzoic acid ointment 15 gm , co trimoxazole oral susp. 50 ml , cough syrup ( each 5 ml contains chloropheniramine maleate 3mg, ammonium chloride 130mg, sodium citrate 65mg, methol 0.5 mg ) 50ml , cough / expetotrant ( ambroxol hydrochloride ip 15mg+tebutaline sulphate ip 1.5mg+guaiphenesin ip 50mg+menthol ip 1mg ) 50ml , cream luliconazole 1% w / w , crotamiton 10% and hydrocortisone 0.25% cream , cyproheptidine 200 ml syp , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , dextromethorphen + bromhexine + cpm + menthol syp 60 ml , diastasepepsin with simethicone 15 ml drops , diclofenac gel 20 gm ( dicofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3% menthol 5% ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml 30ml , dicylomine hcl + activated dimethicon 10ml drop , digestive enzyme 15 ml drops , disodicum hydrogem citrate 100ml alkylizer syp , domperidon oral drops 10ml , domperidon susp. ( 30ml ) , drop caffeine citrus , drotavarine 60 ml susp. , formaldehyde solution 450ml , framycetin sulphate cream 1% 30 gm , fusidic acid cream 2% , gamabenzine hexachloride lotion 100ml 1% ( lindane lotion ) , gluteraldehyde solution 2% 5 ltrs can , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 10ml , hand sanitizer 500 ml ( alcoholic rub in hand ) , hydrogen peroxide solution 6% 400ml , hydroxyzine 15 ml drops , ipratropium bromide nebulizer solution 250 mcg / ml , iron and folic acid suspension 100ml , ketoconazole 1% shampo 50ml , ketoconazole cream 2% 15 gm , lactulose solution 100ml , levetiracetam oralsusp. 100 ml , levofloxacine 60 ml syp , lignocain mouth paint 10 ml , lignocine jelly 2% 30gm , lincomycin syp 60ml , liquid formalin 5 ltr. , liquid paraffin 100ml , liquide glycerine 100ml , mefenamice acid 100mg / 5ml syp , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60ml , miconazole nitrate cream ip 2% 15gm , montelucast+levocetrizine 60 ml syp , multi vitamin drops 15ml , multi vitamin syrup 200 ml , mupirocin ointment 2% 5gm , oflaxacin + ornidazole syp ( 30ml ) , oflaxacin + tinidazole syp 30 ml , oflaxacin oral susp. 30ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , ondansetron 30 ml susp. , oseltamivir phosphate for oral suspension ip 12 mg / ml 75 ml , paracetamol drops paediatric 15 ml , paracetamol syp 125 mg / 5ml 60 ml , permethrin lotion 5% 30ml , phenobarbitone 20mg / 5ml, 100 ml syp , phenyl ( black disinfectant fluid ) 5 ltrs can , phenytoin oral susp. 100 ml , potascium chloride oral solution 200ml , povidone iodine ointment 250 gm jar , povidone iodine ointment 5% 15gm , povidone iodine scrub solution 7.5% 500ml , povidone iodine solution 5% 500ml , povidone iodine solution 5%100ml , prednisolone 10 ml drops , promethazine 60 ml syp , salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup2mg / 5ml 100 ml , silver sulphadiazine 1% cream ( 500gm jar ) , silver sulphadiazine 1% cream 250gm , silver sulphadiazine cream 10gm , silver sulphadiazine1% cream 50gm , sodium hypochloride solution 5 lt can 10% , sodium hypochloride solution 5 lt can 6% , sodium phosphates enema 100 ml , sodium valprorate oral solution 200 mg / 5ml 100 ml , surgical spirit ip / bp ( 100 ml ) , surgical spirit ip / bp ( 500 ml ) , terbinafine cream 1% w / w 10 gm , terbutalin 15 ml drops , tooth gel 50 gm ( sodium monoflurophosphate 0.7% and potassium nitrate 5% , tretenoin cream 0.025% 20gm , triamcinolone oromucosal paste bp 0.1% w / w , vitamin d3 400 iu 15 ml drops , vitamin d3 800 iu 15 ml drops , vitamine a paediatric oral solution 100ml , vitamine d3 oral solution 60000 iu 5ml , zinc 20 mg, 100 ml syp. , eye / ear / nasal drops , aciclovir eye ointment 3% 5gm , amikacin eye drop 5 ml , atropin sulphate 1% e / d 10ml , atropine eye ointment 1% 3 gm tube , b.p. blade no. 11 , b.p. blade no. 15 , betaxolol eye drops 0.5 o / o5 ml , black gogals , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , buds sticks , carbolic acid 400gm , carboxymethyl celluslose 0.5%e / d 10ml , carboxymethyl celluslose 5ml e / d , carboxymethylcellulose + glycerin 10 ml e / d , chloramphenicol +polymycine 5 gm eye oint. , chloramphenicol +polymyxin + dexamethason 5 gm eye oint. , chloramphenicol 1% w / w eye ointment 3 gm tube , chloramphenicol eye drops ip 0.5 0 / 0 5ml , ciprofloxacin &dexamethasone 5ml e / d , ciprofloxacin + dexamethasone 10ml e / d , ciprofloxacin eye drops 0.3 o / o w / v 5ml , ciprofloxacin ophthalmic ointment usp 0.3% 5gm tube , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , cresent blade 2.8mm ( 1 piece rate ) , cyclopentolate eye drop 5 ml , disposal eye pad ( 6cmx8cm ) 01 no , dorzolamide 2% 5 ml e / d , eyebuds ( 100 buds ) , fluconazole 0.3% e / d 5ml , flurbiprofen eye drop 10 ml , flurbiprofen sod. e / d0.03% 5ml , foldable intra ocular lence with injector ( size 18 to 24 no. ) ( sterile hydrophilic acrylic ) , fumigation with silver hydrogen peroxide, grade standard , gatifloxacin and prednisolone 10 ml e / d , gentamycin +dexamethasone 10ml eye / ear , gentamycin 10ml e / d , gentamycin 10ml e / d , homatropine 2% e / d , hydrocortisone 1%w / v and acetic acid 2%w / v ear drops , hydroxy propyl methyl cellulose solution ( 2ml glass syringe with cannula ) , hypersol s e / d 10 ml , inj. viscomet ( 3ml ) , iol single piece lence ( size 18 to 24 no. ) standard pama intraocular lenses , keratome blade 3.5mm , ketorolac tromethamine + moxyfloxacine eye drop 5 ml , lidocaine hcl topical solution 4% 30 ml , metal frame with glasses ( spects ) , moxifloxacilline+ dyliprednate 5 ml e / d , moxifloxacilline+ prednisolone 5 ml e / d , moxifloxacin + dexamethasone 10ml eye / ear , moxifloxacin + dexamethasone 5ml eye / ear , moxifloxacin 0.5% e / d 5ml , moxifloxacin and prednisolone 5 ml e / d , moxifloxocin + prednisolone e / d 5 ml , moxigram e / d 5ml , nasal drops haemcoagulase topical solution each ml contain aqueous solution of haemocoagluase 0.2 cu , nasal spray 100mg ( azelistin + nometozone ) 15 ml , nasal spray 100mg ( flutosone ) , natamycin 5%5 ml e / d , neomycin, polymixin b and hydrocortisone ear drops 10 ml , nephazoline & pheniramine eye drop 10 ml , oflaxacin + prednisolon e / d 10 ml , oflaxacin eye / ear 10ml , ofloxacin + betamethasone + acetcic acid e / d 10 ml , ofloxacin + dexamethasone eye / ear ( 10ml ) , olaptadine & ketrolac 5 ml e / d , oxymetazolin nasal drop 10ml , phenylephrine hcl 5% e / d 5 ml , pilocarine 2% e / d 5ml , polymyxin b 10000iu / gm + neomycin 3400iu / gm 5 ml , potassium permanganate ( kmno4 ) crystal 20gm , povidone iodine eye drop 10 ml , predinislone e / d 10ml , predinislone e / d 5ml , saline nasal drops 10 ml , sodium chloride 5%5 ml e / d , suture 10 0 , timolol + pilocarpin e / d 5 ml , timolol 0.5 % e / d 5ml , tobra d eye ointment 3.5 gm , tobramycin + dexamethasone e / d10ml , tobramycin + dexamethasone e / d5ml , tobramycin e / d 0.3% 5ml , tobramycin ophthalmic ointment usp 0.3% 5gm , travoprost 0.004% 3 ml e / d , tropicacil e / d ( tropicamide ) 5 ml , tropicacil plus 10ml e / d , tropicacil plus 5ml e / d , tropicamide + phenlyephrine 5 ml e / d , trypen blue dye 1ml , wax dissolving ear / drops ( ceruminolytic drops ) 10ml , xylometazoline nasal drops 0.1% 5 ml...
37832647 medicine items purchase for rate contract medicine items purchase for rate contract in pddu hospital , acarbose 25 mg tab , acarbose 50 mg tab , acebrophylline sr 200 mg tab. , acebrophylline tablet / capsule 100 mg , aceclofenac 100 mg + paracetamol 325 mg + chlorzoxazone 250 mg tab , aceclofenac 100 mg tab , aceclofenac 100mg and thiocolchicoside 4mg tab. , aceclofenac and paracetamol and serratiopeptidase ( 100 and 325 and 15 mg ) tab. , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , aceclofenac sr 200 mg tab. , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , acetic acid otic solution 2% ear drop , acetylcystine solution usp ( injection ) 200 mg / ml , acitretin 10 mg cap. ip , acitretin 25 mg cap. ip , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir 400 tab , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adaplene ( 0.1% w / w ) gel , adenosine injection ip 6 mg / 2ml , adrenaline bitartrate injection ip 1mg / ml im / iv use , alamine 200 ml inj , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , albumin 5% infusion , alendronate sodium 70 mg tab. i.p. , alendronate sodium tablets usp / bp 35 mg , alfacalcidol soft gelatin 0.25mcg caps , alfuzosin 10 mg tab. i.p. , alkaline nasal douches ( sodium bicarbonate and sodium biborate and sodium chloride ) , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , allopurinol tablets ip 100 mg , aloe vera moisturizing cream , alpha and lipoic acid and leycopen and multivitamin and miltiminerals capsule , alpha beta arteether 2 ml injection , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , alprostodil 500 mcg / ml inj , amantidine 100mg tablet / capsule , ambroxol + terbuatline + guaphenasin 100 ml syp , ambroxol 15 mg / 2ml syp , ambroxol 75 mg + levocetrizine 5 mg tab , ambroxol drop 7.5mg / ml 15ml , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , aminocaproic acid 20ml injection , aminophylline inj ip 25 mg / ml , amiodarone hydrochloride inj 50 mg / ml , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amisulprade 100 mg tab , amisulprade 200 mg tab , amisulpride tablets i.p 50mg , amitriptyline 10 mg tab , amitriptyline tab ip 25mg film coated , amlodipine 10 mg tab , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine oral solution 1 mg / ml syrup b.p. , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , amophous hydrogel with colloid silver wound dressing cream , amorolfine 0.25% cream , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amoxicilline 875 mg + potassium clavulanate 125 mg tab , amoxycillin & clavulanic acid 300 mg injection , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , amphotericin b inj ip 50 mg , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mg gel , ampicillin and salbactum 1.5g injection , ampicillin cap ip 500mg , ampicillin injection ip 500 mg , anastrozole 1 mg tab , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , anti hbsag 100 iu inj , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) cap. , anti acne gel adapalene bp…0.1 % w / w, clindamycin phosphate usp equivalent to clindamycin…1% w / w, methyl paraben ip…0.1 % w / w, phenoxyethanol bp…0.25 % w / w , anticold drop ( each ml contains paracetamol 125mg, chlorpheniramine maleate 1mg and phenylepherine hydrochloride 2.5 mg ) 15 ml , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu and clostridium oedematiens anti toxin 10000 iu and clostridium septicum anti toxin 5000 iu ) , antihemophillic factor ix inj , antihemophillic factor viii inj , apixaban 2.5 mg tab. , apixaban 5mg tab. , appetite enhancer ( peptone, minerals, vitamins ) syrup 100 ml , arteether 150mg inj , artemether 40mg and lumefantrine 240 mg 30ml syrup , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , artesunate injection 120 mg each combo pack contains artesunate inj 120mg vial, sodium bicarbonate inj ip 5% ( 2ml amp ) , sodium chloride inj ip 0.9% ( 10ml amp ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artificial saliva solution , asceptic ( chlorhexadine gluconate 7.5% and =15%cetrimide solu and isopropyl 17% lotion , ascorbic acid tab ip 500 mg , aspirin75 mg + clopidogril 150 mg tab , aspirin 25 mg + dipyridamole 200 mg cap , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin dispresible tablet 325mg , aspirin ip 300 mg tab. i.p. , aspirin tablet ip ( gastro resistant ) 150 mg , astymine c ( vitamin c and essential amino acid ) drop , atenolol 25 mg + amlodipine 5 mg tab , atenolol 50 mg + hydrochlorothiazide 12.5 mg tab , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atomoxetin 10 mg tab. , atomoxetin 18 mg tab. , atomoxetin 25 mg tab. , atorvastatin 10 mg + aspirin 75 mg cap , atorvastatin 10 mg + clopidogril 75 mg cap , atorvastatin 10 mg + ezetimibe 10 mg tab , atorvastatin 10 mg + fenofibrates 160 mg tab , atorvastatin 20 mg tab , atorvastatin tab ip 10mg , atorvastatin tablets ip 40 mg , atracurium besilate 25mg / 2.5ml inj , atracurium inj 10 mg / ml , atropine eye ointment ip 1% , atropine sulphate injection 0.6mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tab ip 50 mg , azelaic acid 20% cream , azithromycin 1% eye ointment , azithromycin 10 ml vial equaivelent to 500 mg inj. , azithromycin 100mg / 5ml oral syrup / suspension , azithromycin 200mg / 5ml oral syrup / suspension , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , azithromycin tablets ip 250mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , b. complex syrup , bacillus clausii spores suspension 2 billion / 5ml , baclofen oral solution 5 mg / ml syrup , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin inj. , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed system polyolefin 500 ml bag , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag solution , beclomethasone dipropionate 0.064% and salycylic acid 3% lotion , beclomethasone inhalation ip 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , benzoyl peroxide gel 2.5 % ip , betadin 5% eye drop , betahistine 24 mg tab , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone and neomycin cream ( 0.10% and0.5% ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone sod phos inj ip 4mg / ml , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , biclutamide 50 mg tab , bilastin 20 mg tab. , bio d3 max cap , biotin 5 mg tab. usp , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , bisoprolol 2.5 mg tab , bisoprolol 5 mg tab , black disinfectant fluid ( phenyl ) as per schedule o grade iii , bleomycin 15 mg inj , bosentan 62.5 mg tab. i.p. , botrapase inj. 1 ml , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , brinozolamide 1% w / v and brimonidine tartrate 0.2% w / v ophthalmic suspension , brivaracetam 50mg tab. , bromfenac sodium eye drop 0.09% , bromhexine + dexrometharphan + ammonium chloride + menthol syp 100 ml , bromhexine + terbutalin + guiphenesin 100 ml syp , bromhexine 100 ml solu , budesonide 0.5mg / ml respiratory solution , budesonide 400 mcg dpi ip , budesonide capsule 9mg , budesonide inhalation 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , buprinorphine tablet 2mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , caffiene citrate oral solution oral drop , calamine lotion ip 100ml , calcitriol capsules ip 0.25 mcg , calcium acetate 667 tab. usp , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium carbonate 500mg + calcitriol 0.25mcg + zinc 7.5mg tab , calcium chloride 5ml vial injection , calcium dobesilate 500mg cap. , calcium folinate tablet 15mg , calcium gluconate + vitamin d3 + cyanacobalamin 15 ml syp , calcium gluconate inj ip 10% ( iv use ) , calcium phosphate 200 ml syrup ( each 10ml contain elemental calcium 300mg elemental phosphorus 150mg elemental magnesium 75mg elemental zinc 4mg vitamin d3 200 300iu. ) , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , capecitabine 500 mg tab , carbamazepine oral suspension usp 100 mg / 5ml , carbamazepine tab ip 100 mg , carbamazepine tab ip 200 mg , carbetocin 1ml / 100micro. injection , carbimazole 10 mg tab. i.p. , carbimazole tabs ip 5 mg ( film coated ) , carbolic acid solution 100% in 500 ml solution , carbolic acid solution 50% in 500 ml solution , carboplatin injection ip 450 mg , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , carboxymethylcellulose and glycerin eye drop , carboxymethylcellulose eye drops ip 0.5% , carvedilol 25 mg tab , carvedilol tab 12.5 mg , carvedilol tab 6.25 mg , carvedilol tablet 3.125 mg , caspofungin 50 mg inj. , caspofungin 70 mg inj. , cefaclor each 5 ml contain cefaclor 125 mg syp. i.p. , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , cefepime 1 gm inj , cefepime hydrochloride 1 gm + tezobactum 250 mg inj , cefepime hydrochloride 1000 mg+ salbactum 500 mginj , cefepime hydrochloride 2 gm + tezobactum 250 mg inj , cefepime injection ip 500 mg , cefipime 1000mg and tazobactum 125mg inj. , cefixime 200 mg + ofloxacin 200 mg tab , cefixime 50 mg+ clavulanate 31.25 mg syp , cefixime and potassium clavulanate 200 and 125mg tab. , cefixime oral suspension / dry syrup 100mg each 5 ml contain cefixime oral suspension / dry syrup100mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime oral suspension / dry syrup 50mg each 5 ml contain cefixime oral suspension / dry syrup 50mg , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone 1gm and tazobactum 125mg inj. , cefoperazone 500 mg + sulbactum 500 mg inj , cefoperazone 500mg inj. ip , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefoperazone injection 1gm , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , cefpodoxime 200mg tab. i.p. , cefpodoxime cv 325 tab , cefpodoxime dispersible tab 50 mg , cefpodoxime oral suspension 20mg / ml drop , cefpodoxime proxetil oral suspension 100mg syrup i.p. each 5 ml contain cefpodoxime proxetil oral suspension 100mg syrup i.p. , cefpodoxime proxetil oral suspension 50mg syrup i.p. each 5 ml contain cefpodoxime proxetil oral suspension 50mg syrup i.p. , cefpodoxime proxetil tablet 100mg / cefpodoxime proxetil dispersibletablet 100mg , cefpodxime 200 mg + clavulanic acid 125 mg tab , ceftazidime 1gm and sulbactam500 mg inj. , ceftazidime and avibactum 2gm and 500mg inj. , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftizoxime 1 gm inj. ip , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone 1000mg and salbactum 500mg and disodium edetate 37mg inj , ceftriaxone 250mg + sulbactam 125 mg inj. , ceftriaxone 500mg + sulbactam 250 mg inj. , ceftriaxone and sulbactam 1.5g injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftriaxone ip 125 mg inj. ip , ceftriaxone1000mg and tazobactom125mg inj. , ceftrioxone 250 gm + tazobactum 31.25 mg inj , cefuroxime 750 mg inj , cefuroxime 1500 mg inj , cefuroxime 1gm injection , cefuroxime 500mg + clavulanic acid 125mg ( as pot. clavulanate ) tab , cefuroxime axetil 500 mg. tab. i.p. , cefuroxime axetil oral suspension 125mg / 5ml syrup b.p. , cefuroxime axetil tab ip 250 mg , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetrimide cream ip 0.50 o / o , cetrizine 10 mg tab , cetrorelix acetate 0.25 mg inj. , chloramphenicol 0.5% eye ointment , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol 1%, polymyxin b sulphate ( 10000 units ) and dexamethasone 0.1% sodium phosphate eye ointment , chloramphenicol 1000 inj , chloramphenicol 1gm / vial injection , chloramphenicol and polymyxin b sulphate eye ointment , chloramphenicol eye drops ip 0.5 0 / 0 , chlordiazepoxide 10 mg + amitriptayline 10 mg tab , chlordiazepoxide 25 mg tab. i.p. , chlordiazepoxide 5 mg and clidinium bromide 2.5 mg tab , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% 250 ml , chlorhexidine mouthwash ip 0.2 o / o , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , chlorprocaine inj 2% , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorthalidone 6.25 mg tab. i.p. , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholchicine 0.5mg tab. i.p. , cholecalciferol cap 60, 000 iu ( vit. d3 ) , cholecalciferol granules 60, 000 iu / gm , cilnidipine 10mg+ metoprolol 50mg tab , cilnidipine 10mg+ telmisartan 40mg tab , cilnidipine 20 mg tab. i.p. , cilnidipine 5 mg tab. i.p. , cilnidipine10 mg tab. i.p. , cilostazol 100mg tab. i.p. , cilostazol 50mg tab. i.p. , cinnarizine 20 mg + domperidone15 mg tab , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops , ciprofloxacin 500mg + tinidazole 600 mg tabs , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin ophthalmic ointment usp 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , cisplatin 10 mg inj , cisplatin 50 mg inj , citicoline sodium 250 mg 2 ml inj , citicoline sodium 250 mg 4 ml inj , citicoline tablets 500mg inj. , clarithromycin 250 mg tab. i.p. , clarithromycin 500mg inj. bp , clarithromycin 500mg tab. i.p. , clarithromycin for oral suspension / dry syrup 125mg / 5ml , clindamycin 600mg / 4ml inj. ip in 4 ml vial , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin phosphate injection ip 300 mg , clobazam tablet ip / capsule 5 mg , clobazam tablet / capsule 10 mg , clobetasol and salicylic acid 0.5% and 6% ointment , clobetasol propionate bp…0.05 % w / w, neomycin sulphate ip…0.50 % w / w., miconazole nitrate ip…2.00 % w / w, chlorocresol ip ( as preservative ) 0.10 % w / w cream / ointment , clobetasol propionate cream ip 0.05 o / o , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clomipramine ip 25 mg capsule / tablet ip , clonazepam 0.25 tab. i.p. , clonazepam 1mg tab. i.p. , clonazepam tablet 0.5 mg , clonidine 150mcg / ml inj. ip in 1 ml ampoule , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , clotrimazole 1% and beclomethasone 0.025% lotion , clotrimazole 10mg lozenses , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , clotrimazole vaginal gel 30 gm , clotrimazole vaginal tab ip 500mg , cloxacillin sodium inj ip 500mg , clozapine 100 mg tab. i.p. , clozapine 25 mg tab. i.p. , clozapine 50 mg tab. i.p. , co trimoxazole tablet ip 480mg ( trimethoprim 80mg and sulphamethoxazole 400mg ) , coal tar 6% & salicylic acid 3% ointment , codiene phosphate and tripolidine syrup ( each 5ml contains codiene phosphate 10mg and tripolidine 1.25mg ) , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen , colistimethate injection ip 1m iu powder for solution , coloplast 60 gm paste , combikit of ( tab fluconazole150mg and azithromycin 1gm and secnidazole1gm ) each kit contain 1tab fluconazole150mg and 1 tab.azithromycin 1gm and 2 tab.secnidazole1gm . , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , compound benzoin tincture ip , compound sodium lactate ( ringer lactate ) in glass bottle 500ml injection , compound sodium lactate inj. ( ringer lactate ) 500ml injection , conc haemodialysis fluid b.p acetate concentrate 10 litre can , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , conjugated estrogen tabs usp 0.625 mg. , continuous ambulatory peritonedialysis fluid 2 ltr , contrast for ct scan / ivp / special investigations , contrast for special investigations ( barium sulphate paste ) , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , coq tablet / capsule 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , cough syp / expectorant terbutaline sulphate 1.25 mg, bromhexine 4 mg, guaiphenesin 50 mg, menthol 2.5 mg per 5 ml syp 100 ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , cpm and cmc and nephazoline eye drop , crotamiton 10% and hydrocortisone 0.25% cream , crystilline penicillin 2 lakh injection , cyclopentolate 1% eye drop ip , cyclosporine oral solution 100mg / ml syrup i.p. , cyproheptadine 4mg tab. i.p. , cyproheptadine hcl 2mg / 5ml syrup i.p. , cyproheptadine hcl 2mg + tricholine citrate 275 mg syrup , cyproterone acetate 2 mg and ethynil estradiol. 035mg tab bp , dabigatran 110 mg tab. , dabigatran 150 mg tab. , dacalatasvir 30 mg tab. / cap , dacalatasvir 60 mg tab. / cap , daflazacort 30 mg tab , danazol 100mg cap. ip , danazol cap ip 50 mg , dapagliflozin 10 mg + metformin 500 mg tab , dapagliflozin 10 mg tab. , dapagliflozin 20 mg + metformin 500 mg tab , dapoxetine 30 mg tab. i.p. , dapsone 100 mg tab. i.p. , deflazacort 12 mg tab. , deflazacort 6mg tab. , degludec insulin 100iu / ml injection 3ml , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , desflurane, 100ml , desflurane, usp, 100o / o desflurane. liquid for inhalation , desogestrel 0.075mg tablet , desonide 0.05% cream , desvenlafaxine 50mg cr / pr / sr / er tablet , detemir insuline 100iu / ml injection 3ml , dexamethasone inj ip 8mg / 2ml , dexamethasone syp 0.5 mg / 5 ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dexmedetomidine 100mcg / ml inj , dextran 40 injection , dextromethorphan hbr and chlorpheniramine syrup ( each 5ml contains dextromethorphan hbr 10mg and chlorpheniramine 2mg ) , dextromethorphan hbr syrup ip 13.5mg / 5ml , dextrose 30 % , dextrose 5% 500 ml glass bottle injection , dextrose 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dextrose 50 % , dextrose 50 % inj , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% , dextrose with sod.chloride polypack 5% 500ml injection , diastase, pepsin with simethicone 15ml drop each ml contains diastase ( 1:1200 ) 33.33mg, pepsin ( 1:3000 ) 5mg and simethicone emulsion 40mg , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , diazoxide 300 mg / 20ml injection , diclofenac 50 mg and thiocolchicoside 4 mg tablet , diclofenac each transdermal patch contain 200 mg diclofenac patch , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium 50 mg + serratiopeptidase 10 mg tab , diclofenac sodium 50mg and paracetamol 325mg and serratiopeptidase 10mg tablet , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofence prolonged release tablet ip 100 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine hydrochloride oral solution ip 10mg / 5ml , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , dienogest tablet 2mg , diethylcarbamazine tab ip 100 mg , digoxin 0.25% elixir , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem 2% p / r gel , diltiazem 25 mg injection , diltiazem cr / prolonged released tablet 90mg , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , diphenhydramine + ammonium chl. + sodium cit. 100 ml cough syrup , diphtheria antitoxin 10000 iu , distil water 5 ltr , distil water 500 ml , disulfiram 250mg tab. i.p. , disulfiram tablet 500mg , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , dns 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , docosahexaenoic 30ml drop , domperidone + esomeprazole ( 30 / 40mg ) capsule , domperidone oral drops ip 10mg / ml ( 10ml ) , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , donepezil 5 mg tab. i.p. , dopamine hydrochloride inj ip 40 mg / ml , dorzolamide 2% eye drop ip , doxofylline 400 mg + montelukast 10 mg tabs , doxofylline 400 mg tab , doxorubicin 10 mg inj , doxorubicin 50 mg inj , doxycycline cap ip 100 mg , doxycycline for injection 100 mg inj. usp , doxylamine 20 mg. +pyridoxine 20 mg + folic acid 5mg. tab , doxylamine succinate + pyridoxine + folic acid ( 10 mg + 10 mg + 2.5 mg ) tabs , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , drotavarine hcl 20mg / 5ml syrup / suspension , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , duloxetine 40mg tabs , duloxetine 60mg tabs , duloxetine gastro resistant 20 mg tab. i.p. , duloxitine gastro resistant 30 mg tab. i.p. , dusting powder ( povidone iodine 5% ) , dutasteride tablet 0.5 mg , dydrogesterone 10mg tab. i.p. , each 15 ml contains: milk of magnesia 11.25 ml and liquid paraffin 3.75 ml 170 ml syrup , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , ear drops each ml contain chloramphenicol 4mg and dexamethasone 1mg and polymyxin b ( 5000iu ) , ear drops hydrocortisone 1%w / v and acetic acid 2%w / v , eeg 400gm paste , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , eltrombopag 25mg tablet / capsule , eltrombopag 50mg tablet / capsule , empagliflazone 10mg tab. , empagliflazone 25mg tab. , enalapril maleate 10 mg + hydrochlorothiazide 25 mg tab , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , enalapril maleate tablets ip 10 mg , enalaprilat injection 1.25mg / ml in 1ml ampoule , enoxaparin sodium inj ip 60 mg , enoxaparin sodium injection ( low molecular wt. heparin ) 40mg / 0.4ml 0.4ml injection in prefilled syringe , entecavir 1mg tab. / cap film coated , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , enyme syrup mix fruit flavour pepsin 7.5 mg + fungal diastase 12.5 mg / 5 ml , enzyme drops pepsin ( 1:3000 ) 5 mg + fungal diastase ( 1:1200 ) 33.33 mg / ml , enzyme syrup ( each 5ml contains diastase 50mg and pepsin 10mg ) 100ml , ephedrine 30 mg / ml inj. bp in 1ml ampoule , ephedrine 5 mg / ml inj , epo 2000 iu inj , ertapenem sodium 1.046 gm equivalent to ertapenem 1gm inj. , erythromycin 250 mg tabs , erythromycin 500 mg tabs , escitalopram 10 mg + clonazepam 0.5 mg tab , escitalopram 20 mg tab , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , esmoprazole 10mg granules , esomeprazole 20 mg caps , esomeprazole 40 mg tab. i.p. , esomperazole syrup 100 ml , estradiol valerate 2 mg tab. , estradiol valerate cream 15 gm , etanercept 25mg / 0.5ml injection , ethambutol 800mg tab , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , ethinyloestradiol tabs ip 50 mcg , ethynil estradiol 0.02mg and desogestral 0.15mg tablets , etizolam 0.5 mg tab. i.p. , etomidate 20 mg injection , etomidate mct / lct 10ml vial injection , etophylline 231 mg + theophylline 69 mg srtabs , etoposide 100 mg / 5 ml inj , etoricoxib 60 mg + thiocolchicoside 4 mg tab , etoricoxib and thiocolchicoside ( 60 and 8 mg ) tab. , etoricoxib tab ip 120mg , etoricoxib tablet ip 90 mg , evening primosa capsule 1000mg , exemestane tablet 25mg , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , febuxostat 40 mg tab , febuxostat 80 mg tab , fenofibrate capsules / tab ip 200 mg , fentanyl 25iu patch , fentanyl 50iu patch , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , fenticonazole 2% cream , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , ferrous ammonium citrate 160mg + cyano cobalamine 7.5mcg+folic acid 0.5mg / 15ml syrup , ferrous ascorbate and folic acid drops 15ml ( each ml contains ferrous ascorbate 10mg and folic acid 100mcg ) , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , fexofenadine 120 mg tab. i.p. , fexofenadine 180 mg tab. i.p. , fexofenadine 60mlsyp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , finasteride tablets ip 5 mg , fingolimod tablet 0.5mg , finofibrate 160 mg tab , flavoxate tablets ip 200 mg ( coated tablet ) , fluconazole 200 mg inj. , fluconazole eye drops 0.3% , fluconazole oral suspension syrup 20 gm / 60 ml , fluconazole tablets ip 150mg , fludrocortisone tablet 100mcg , flunarizine 10mg tab. , flunarizine tab 5 mg , fluoxetine cap ip 20 mg , flupentixol inj. 20 mg / ml , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , fluromethalone 0.1% eye drop , fluticasone ointment 0.05% , fluticasone propionate nasal spray ip 50 mcg , fluvoxamine 100 mg tab. i.p. , fluvoxamine 50 mg tab. i.p. , folic acid and methylcobalamine 10 ml pack injection , folic acid tab ip 5 mg , fondaparinux 2.5mg inj. usp , formaldehyde solution ( 34.5 per. 38 per. ) , formalin 10% 5 ltr , formaline tablet , formeterol 20mcg and budesonide 0.5mg respitory solution / suspension , formeterol 6mcg. and fluticasone 250 mcg. inhalation mdi , formetrol 12mcg and budesonide 400 mcg. powder for inhalation , formoterol 6 mcg. and budesonide 200 mcg. mdi ip , formoterol 6 mcg. and budesonide 400 mcg. mdi ip , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , fosfomycin trometamol powder 3gm , fosphenytoin sodium 150mg / ml injection , framycetin sulphate cream 1 o / o 100 gm pack , framycetin sulphate cream 1 o / o 30gm pack , frusemide tab ip 40 mg , fsh 150 iu inj. , fsh 75 iu inj. , furosemide 20mg and spironolactone 50mg tab. , furosemide injection ip 10mg / ml ( im and iv use ) , furosemide oral solution 10mg / 30ml syrup , fusidic acid + beclomethasone dipropionatecream , fusidic acid cream ip 2% , gabapentin 100 mg + methylcobalmin 1500 mg tab , gabapentin 400 mg tabs , gabapentin 600 mg tabs , gabapentin 800 mg tabs , gabapentin 400 mg +nortriptyline 10 mg tablets , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , gadodiamide inj. 0.5mml / ml vial , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , ganciclovir 0.15% eye ointment , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , gatifloxacin 0.3% eye drop , gatifloxacin 0.30% and prednisolone acetate 1% ophthalmic suspension , gefetinib 250 mg tab , gelofusion infusion 500 ml , gemcitabine 1000 mg inj , gemcitabine 200 mg inj , genevac b 10mg ( 10 ml vial ) inj. , gentamycin ear drop 10 ml , gentamycin injection ip 80mg / 2ml ( im / iv use ) , gentian violet topical solution usp 1o / o , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , glimepride 1 mg + metformin 1000 mg tab , glimepride 2 mg + metformin 1000 mg tab , glimipride 3mg tab , glimipride 4mg tab , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glipizide tab ip 5mg , glucagon for injection usp 1 mg , glucosamine hydrochloride 750 mg and methylsulfonylmethane 250 mg capsule , glucosamine hydrocloride 750 mg tablet and diacerin 50 tablet mg , gluteraldehyde solution 2% , glycerin 2 gm / ml suppsitory , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablets 2.6 mg controlled release tablets , glycine irrigation solution 1.5% 3ltr solution ip , glycolic acid 6% cream , glycopyrrolate inj ip 0.2 mg / ml , glycopyrrolate tab. 1 mg , glycopyrronium 25 and formoterol 6 mcg dpi , glycopyrronium 50 dpi , glycopyrronium inhalation solution 25mcg 2 ml , griseofulvin tab ip 125 mg , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , haemaccel 500 ml inj. , haemocoagulase 1 ml injection , haloperidol ( long acting ) 50mg / ml ampoule inj. ip 1ml vial / ampoule , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , halothane bp 250 ml , heparin 50 iu benzyl nicotinate 2 mg ointment , heparin sodium 1000 iu / ml inj , heparin sodium inj ip 25000 iu , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis b immunologlobin injection ip 100 i.u , hepatitis b immunologlobin injection ip 200 i.u , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , hmf for pretem sachet 1 gm , homatropine eye drops ip 2% , hormonal intrauterine device releasing levonorgestrel 20mcg / 24 hours. contains levonorgestrel 52mg each iud contains levonorgestrel ip 52mg releasing levonorgestrel 20mcg / 24 hours. , horse atg ( anti thymocyte globulin ) 250 mg inj. , hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu inj. ip , hp hmg ( highly human menopausal parodied gonadotropin ) 75 iu inj. ip , hp kit ( pantoprazole 40 mg and metronidazole 400 mg and clarithromycin tablet 500 mg , hpmc 0.3% eye drop , human albumin 20% in 50 ml vial inj. , human albumin solution ip 20% 100 ml , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection 300mcg ( im use ) , human chorionic gonadotropin 2000 iu inj , human chorionic gonadotropin injection ip 5000 i.u. , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , human rabies immunoglobulin inj 150 iu / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydralazine 20mg / ml inj. ip 1ml vial / ampoule , hydrochlorthiazide tab ip 12.5 mg , hydrochlorthiazide tab ip 25mg , hydrocortisone 1% cream ip , hydrocortisone oromucosal tablet 10mg , hydrocortisone oromucosal tablet 20mg , hydrocortisone oromucosal tablet 5mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen 11% and silver nitrate .01% solution , hydrogen peroxide 1.5% mouthwash , hydrogen peroxide 100 ml liquid , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , hydroquinone 2% cream usp , hydroquinone 2.0% w / w + tretinoin 0.025% w / w + mometasone furoate 0.1% w / w in a cream base q.s cream , hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag inj. , hydroxychloroquine 400 mg tab , hydroxychloroquine sulphate tablets 200mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hydroxyprogestrone 500 mg inj , hydroxypropylmethyl cellulose solution 20 mg / ml , hydroxyzine hcl 10 mg tab , hydroxyzine hydrochloride oral solution / drop 6mg / ml , hydroxyzine tab ip 25 mg , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide 10 mg + paracetamol 500 mg tab , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen 600 mg tab , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , imatinib mesylate 100 mg tab , imatinib mesylate 400 mg tab , imipenem 250 mg + cilastatin 250 mg inj , imipenem 500 mg + cilastatin 500 mg inj , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , indacaterol and glycopyronium inhalation powder 110 / 50 mcg cap. , indomethacin 75 mg sr tablet / capsule , indomethacin cap ip 25 mg , indomethacin lyophilized powder 1mg injection , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , inj.caffeine cirate 20mg / ml , inositol and myoinositol tablet 1000mg , insulin aspart 100iu / ml injection 3 ml , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 300 iu per ml inj. ip 1 prefilled pen of 1.5ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin glulisine ( monocomponent insulin glulisine ) 100 iu / ml injection 3 ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , insulin lispro injection , insuline 50 / 50 injection , intravenous fat emulsion 20% w / v 250ml , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml inj. usp , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , iopamidol ct contrast solution for injection , iopromide ct contrast usfda / ce approved , iotrolon ct contrast usfda / ce approved , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium powder for inhalation ip 40 mcg , iron & zinc tab ( carbonyl iron 50 mg+ zinc sulphate monohydrate usp 61.8 mg equivalent to elemental zinc 22.5 mg + folic acid ip 0.5mg ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , iron as ferric saccharate and phospholipid chewable tab.each chewable tab. contains ferric saccharate encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine100 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isabgol husk powder , isoflurane usp 100 ml , isolyte g injection , isolyte p 10% 500 ml inj , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , isotretinoin 10mg cap. ip , isotretinoin 20 mg cap. ip , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itopride 50mg tab , itraconazole200 mg cap , itraconazole 1% eye drop , itraconazole 1% eye ointment , itraconazole cap 100 mg , ivabradine 5mg tab. , ivermectin 12mg tab. i.p. , ivermectin 6 mg and albendazole 400 mg tab. , ivermectin 6mg tab. i.p. , kabilyte 500 ml bottle ( balance fluid replenishment ) , ketaconazole 2% lotion , ketamine 2 ml amp preservative free for spinal use inj , ketamine inj ip 50 mg / ml , ketoconazole 200 mg tab. i.p. , ketoconazole cream bp 2% , ketoconazole shampoo 2% , ketoconazole soap , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , kojic acid 2%, arbutin, niacinamide cream , l arginine 3gm and proanthocynadine 75mg granules , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lacosamide 50 mg tab. b.p. , lacosamide infusion 200mg , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , lactic acid bacillus tab 60 million spores , lactodex milk powder preterm , lactodex milk powder term , lactulose enema 20% , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lamotrigine 25 mg dt tab , lamotrigine dispersible 100mg tab. i.p. , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , l carnosine 100mg / 5ml in 200ml syrup , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip 20mg ( film coated ) , lenalidomide capsules 10mg , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , levetiracetam injection 500mg / 5ml , levetiracetam ip 250 mg tab. i.p. , levetiracetam oral solution / suspension 100mg / ml , levetiracetam tablet ip 500 mg , levo carnitine 500mg / 5ml in 30 ml syrup usp , levobupivacaine 0.5% ( 20mg / 4ml ) ampule injection , levoceitrizine tablet 5mg , levodopa and carbidopa and entacapone 100mg / 25mg / 200mg tab. , levodopa and carbidopa tab 250 mg+ 25 mg , levodopa and carbidopa tablet 125 , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levofloxacin 750 mg tab. i.p. , levofloxacin oral solution / syrup 125mg / 5ml , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levofloxacine 500mg / 100 ml inj. ip 100ml infusion , levosalbutamol 1.25mg and ipratropium 500mcg respiratory solution 2.5ml , levosalbutamol 100mcg and ipratropium bromide 40mcg dpi , levosalbutamol 100ml syp , levosalbutamol 50mcg. and ipratropium 40mcg. mdi , levosalbutamol inhalation solution 50mcg , levosulpiride 75mg + pantoprazole 40mg caps , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , levosulpride 12.5 mg / ml injection 2ml , levosulpride tablet 75mg , levothyroxine sodium 25 mcg tab. i.p. , levothyroxine sodium 75 mcg tab. i.p. , lidocaine 25mg and prilocaine 25mg cream , lidocaine hcl topical solution usp 4% , lidocaine1% intra cameral injection , lignocaine ( preservative free ) 2% injection , lignocaine 1% mouth paint , lignocaine 10% spray injection , lignocaine 4% 30ml , lignocaine and adrenaline ( 1:10000, 2:10000 ) injection , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine hydrochloride 2% 50ml vial inj. ip , lignocaine inj ip 2 o / o , lignocaine ointment 5 o / o , lignocaine viscous , linaglipitin 5mg tab. , linaglipitin tablet 2.5mg , lincomycin 2 ml inj , linezolid 100mg / 5ml in 30ml syrup , linezolid infusion 200 mg / 300 ml , linezolid infusion 600 mg / 300 ml , linezolid inj 200mg / 100ml , linezolid tablets ip 600 mg , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , lisinopril tab ip 2.5 mg , lisinopril tab ip 5 mg , lisinopril tablets ip 10 mg , lithium carbonate tab ip 300 mg , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) injection , l lysine + multivitamin syrup , loperamide tab ip 2 mg , loratadine 10 mg tab. i.p. , lorazepam 1.0 mg injection , lorazepam 5 mg injection , lorazepam inj ip 2 mg / ml , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , l orinithine l aspartate 10 ml injection , l ornithine l aspartate ( 150mg ) and pancreatin ( 100mg ) capsule / tablet , losartan 50 mg + hydrochlorthizide 12.5 mg tab , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , loteprednol 0.25% eye drop , lotion savlon 100 ml , loxicard 2% iv 500 ml inj , luliconazole 1% cream ip , lycopene antioxidant + multi vitamin cap , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , magnesium sulphate, sulphacetamide, urea 75 gm ointment , mannitol 350 ml ffs inj , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , measles, mumps, and rubella ( mmr ) vaccine inj , mecobalamin 1500 mg + lipoic acid 100 mg + folic acid 1.5 mg + pyridoxine 3 mg tab / cap , mecobalamin 750 mg + pregabalin 150 mg cap , mecobalamin inj 500 mcg / ml , medium chain triglyceride oil , medroxyprogesterone acetate tablets ip 10 mg , mefenamic acid 250mg and dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg and dicyclomine hydrochloride10mg , mefenamic acid tablets bp 500 mg , mefenamice acid 100mg / 5ml syrup , mefenemic acid 50 mg and paracetamol 250 mg / 60 ml syrup , mefloquine tablets ip 250 mg , melatonin 3 mg tab. , melatonin 60 ml syrup , memantine tab. 10 mg , mephentermine 30mg / ml injection 10ml vial , mercunium chloride paint , meropenam 125 mg inj , meropenem 2gm inj. ip , meropenem inj ip 500 mg , meropenem inj. ip 1gm , meropenem injection ip 250 mg , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg , methimazole 10mg tab. usp , methimazole tablet 5mg , methotrexate 1000 mg inj. ip , methotrexate 250 mg inj. ip , methotrexate 500mg inj , methotrexate gel 1% , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablet 15mg , methotrexate tablet 7.5mg , methotrexate tablets ip 10 mg , methoxsalen 1% lotion. each ml contain methoxsalen 1% , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , methyl prednisolone sodium succinate 1000 mg inj , methyl prednisolone sodium succinate for injection usp 500 mg , methylcobalamin 200 ml bottle syp , methyldopa tab ip 250mg film coated , methylene blue injection usp 1.0% , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , methylphenidate tablet 10mg , methylprednisolon acetate 125mg injection , methylprednisolon acetate 40mg inj. ip , methylprednisolone 1 gm inj , methylprednisolone 16mg tab. i.p. , methylprednisolone 4mg tab. i.p. , methylprednisolone 8mg tab. i.p. , metoclopramide hydrochloride syrup ip 5 mg / 5ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metolazone tablet 5mg , metoprolol 1mg / ml inj. , metoprolol 50mg + amlodipine 5mg tab , metoprolol succinate extended release tablets ip 50 mg , metoprolol tablets ip 25 mg , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole inj ip 500 mg / 100ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , meverberine tablet 135mg and chlordiazepoxide tablet 10mg , miconazole + flucinolone 15gm cream , miconazole nitrate cream ip 2% , midazolam 0.5mg / 5ml nasal spray , midazolam 5mg / ml injection 10 ml vial , midazolam inj ip 1 mg / ml , midodrine 5mg tab. , mifepristone tab ip 200mg , mifepristone tablet 25mg , milk low birth formula powder , milrinone 10 mg injection , minocycline 50mg cap , minoxidil 10 % lotion , minoxidil 2% lotion , minoxidil 5% lotion , mirabegeron tablet 25mg , mirabegeron tablet 50mg , mirabegron er 50 mg. tablets , mirtazapine 15mg tab. i.p. , mirtazapine 30mg tab , mirtazapine 7.5mg tab. i.p. , misoprostol tab ip 200 mcg , mometasone 0.1 % cream ip , montelucast 10 mg + fexofenadine 120 mg tab , montelucast and levocetrizine syrup / suspension each 5ml contains montelucast 4mg and levocetrizine 2.5 mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , montelukast 10 mg tab. i.p. , montelukast 4 mg tab. i.p. , montelukast 5 mg tab. i.p. , morphine 10mg tab. i.p. , morphine 30mg tab. i.p. , morphine sulphate inj ip 10mg / ml , mouth ulcer gel ( choline salicylate sodium 9% w / v, benzalkonium chloride 0.01% w / w ) , moxifloxacin 0.5% and dexamethasone 0.1% eye drops , moxifloxacin 0.5% and difluoprednate 0.05% eye drop , moxifloxacin 0.5% and ketorolac tromethamine 0.5% eye drop , moxifloxacin 0.5% and prednisolone 1% ophthalmic solution , moxifloxacin 0.5% eye ointment , moxifloxacin 400 mg tab. b.p. , moxifloxacin hcl+ dexamethasone + benzalkonium chloride solution 0.02% v / v sterile opthelmic sol , moxifloxacin intra cameral 0.5% injection , moxifloxin 400mg / 100ml inj. , moxonidine 0.2 mg tab. b.p. , moxonidine 0.3 mg tab. b.p. , multi vitamin syrup 100 ml , multiple electrolytes & dextrose inj. 10% 500ml i.v. bottle ( e.g.: isolyte p rorte 10% ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , multistix test strip , multivitamin 10 ml injection , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , n acetyl cysteine nebulizer , n acetylecystine effervescent form, orange flavour, 600 mg tab. , nalbuphine inj. 10 mg / ml , naloxone inj ip 0.4mg / ml , naltrexone 50 mg tab. i.p. , nandrolone decanoate 100mg inj. ip , nandrolone decanoate 50 mg inj. ip , naproxen tablet ip 250mg , naproxen tablet ip 500mg , nasal drops haemcoagulase topical solution each ml contain aqueous solution of haemocoagluase 0.2 cu , natalizumab 300 mg inj. , natamycin opthalmic suspension 5% eye drop ip , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , nebivolol 10mg tab. i.p. , nebivolol 2.5 mg tab , nebivolol 5mg tab. i.p. , neomycin + polymyxin + becitracin zinc 15 gm ointment , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neomycin sulphate 0.5% cream , neomycin sulphate and bacitracin zinc ointment usp 5 mg and 500 iu / gm ointment usp , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip ointment , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , neostigmine and glycopyrrolate 2.5 mg / 0.5 mg injection , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , nepafenac 0.1% eye drop , netilmicin 25 mg inj , netilmicin 50 mg inj , netilmycin 300mg / 3ml inj. ip 3ml vial / ampoule , nicardipin 10mg injection , nicardipine tab. 10 mg , nicorandil 10mg tab , nicorandil 48 mg injection , nicorandil 5mg tab. i.p. , nicoumalone 1 mg tab. i.p. , nicoumalone 3 mg tab. i.p. , nicoumalone 4 mg tab. i.p. , nifedipine 0.3% and lidocaine 1.5% p / r gel 30 gm , nifedipine cap ip 5mg , nifedipine prolonged release 20mg tab , nifedipine sublingual tab , nifedipine tablets ip 10 mg ( sustained release ) , nifidipine 20mg sr tab. i.p. , nifidipine capsule 10mg , nimesulide 100 mg tab , nimeusulide 100 mg + paracetamol 325 mg tab , nimodipine infusion 10mg / 50 ml inj. bp 50ml , nintedanib 150mg tab. / cap. , nitazoxanide 500mg tab. , nitrazepam 10 mg tab. i.p. , nitrazepam 5mg tab. i.p. , nitrofurantoin oral suspension 25mg / 5ml in 100 syrup b.p. , nitrofurantoin tab ip 100mg , nitroglycerin 2.6 mg tab , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg , norfloxacin 400mg + tinidazole 600 mg tabs , norfloxacin tab ip 400mg film coated , normal human intravenous immunoglobulin 5g / 100ml , normal saline 0.9% 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 1000 ml glass bottle injection , normal saline 500 ml glass bottle injection , nortriptyline tablet 25mg tablet , octreotide 100mg inj. , octreotide injection 50 mcg / ml , octreotide lar ( long acting release ) 20 mg inj. , octreotide lar ( long acting release ) 30 mg inj. , ofloxacin 100 mg tab , ofloxacin 400 mg tab , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin oral suspension ip 50mg / 5ml , ofloxacin tab ip 200 mg , ointment ( modified lanolin ) cream , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oitment mupirocin ip 2% , olanzapine 3 mg and fluoxetine 25 mg cap , olanzapine inj. 10 mg , olanzapine tab ip 5 mg , olapatadine 0.1% and ketorolac 0.4% ophthalmic solution , olmesartan40 mg tab , olmesartan 20mg + amlodipine 5mg tab , olmesartan medoxomil 20 mg tab. i.p. , olmesartan medoxomil 20 mg+hydrochlorothiazide 12.5 mg tab , olmesartan medoxomil 40mg + hydroclorthiazide 12.5mg tab , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , omega 3fatty acid 50ml , omeprazole 20 mg + domperidone 30 mg sr cap , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron oral suspension / solution / syrup 2mg / 5ml , ondansetron orally disintegrating tablets ip 4mg , ondansetrone 8 mg tab , oral contrast for ct ( diatrozoate sodium and diatrozoate meglumine ) , oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) , orciprenaline tablet 10mg , orlistat 120 mg cap , orlistat 60 mg cap , ornidazole 500mg inj. ip , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin 100 mg inj , oxaliplatin injections 50mg , oxazepam 15mg tab. i.p. , oxcarbazepine 300mg tab. i.p. , oxcarbazepine 450mg tab. i.p. , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , oxybutynin oral suspension5 ml syrup , oxytocin inj ip 5 iu / ml , paclitaxel 100 mg inj , paclitaxel 30 mg vial inj , paclitaxel inj ip 260 mg , pancreatin gastroresistant tablet 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg tab. i.p. , pantoprazole 40 mg tab , pantoprazole 40mg + itopride 150mg s.r. tab , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , papaverine inj. 60 mg / 2 ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory , paracetamol and ibuprofen syrup ( each 5ml contains paracetamol 162.5mg and ibuprofen 100 mg ) 60ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag inj. , paracetamol infusion 1000 mg with both temper evident caps spray 10% injection , paracetamol infusion 500 mg with both temper evident caps spray 10% injection , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetomol 650 mg tab. i.p. , paroxetine 12.5 mg control release / prolonged release tablet , paroxetine 25 mg control release / prolonged release tablet , paroxetine 37.5 mg tab , peg ( alprastadil ) 500 mcg inj. , penicillin v tablet 400mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , pentoxifylline extended release / sr 400mg tab. ip , perampanel 2 mg tab. , perampanel 4mg tab. , peritonial dialysis solution ip , permethrin cream 5% , permethrin lotion 5% , pheniramine 25 mg tab. i.p. , pheniramine inj ip 22.75mg / ml , phenobarbitone 20mg / 5ml in 100ml syrup , phenobarbitone inj ip 200mg / ml , phenobarbitone tab ip 30 mg , phenozopyridine tablet 200mg , phenylephrine hydrochloride 10 mg / ml inj. bp / ip 1ml vial , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , pilocarpine 0.5% w / v injection , pilocarpine eye drop 2% , pioglitazone 15 mg tabs + metformin 500mg tab , pioglitazone 30 mg tab , pioglitazone tab ip 15 mg , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin 1 gm and tazobactum 125 mg inj. ip , piperacillin injection 2 gm + tazobactom 250mg ip , piracetam 200mg inj. , piracetam 400 mg tab , piracetam 500mg / 5ml suspension / syrup , piracetam 800mg tab , pirfenidone 200 mg tab. i.p. , pirfenidone 400 mg tab. i.p. , piroxicam 40 mg with bezyl alcohol injection , piroxicam dt 20mg tab. i.p. , placental extract 2ml injection , podophyliin toxin lotion 10 ml , polyethyene glycol and sodium chloride and sodium bi carbonate and potassium chloride sachet 14 gm , polyethyene glycol with elctrolyte approx 130 gm solution , polymixin sulphate b injection usp 5 lac i.u. , polymyxin b 10000iu / gm and neomycin 3400iu / gm eye drop , polymyxin b for injection 1 million injection , pomalidomide 2 mg tab. , pomalidomide 4 mg tab. , posaconazole 100mg tab. , posaconazole 40mg / ml syp. , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , potassium magnesium citrate syrup / solution each 5ml contians potassium citrate 1100mg and magnesium citrate 375 mg , potassium oxalate , povidone iodine + metronidazole 15 gm tube , povidone iodine 2 ltr 5% solution , povidone iodine gargle 0.5% w / v , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , povidone iodine pessary , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , povidone iodine solution ip 10 % , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection ip 25 mg / ml / 500 mg , pramipexole tab. 0.25 mg , pramipexole tab. 0.5 mg , pramipexole tab. 1 mg , prasugrel 10mg tab. , prazosin 5mg tab. er / pr / cr , prazosin tablets ( extended release ) 2.5 mg , prednisolone acetate opthalmic suspension 10 ml eye drop , prednisolone ip 40mg tab. i.p. , prednisolone sodium phosphate 1% eye / ear drop bp , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , prednisolone tablet ip 50mg , pregabalin 150 mg cap , pregabalin 75 mg + methylcobalamin 750 mcg tab , pregabalin 75 mg + methylcobalamine 750 mg + alphalipoic acid 100 mg + folic acid 1.5 mg + pyridoxine 1.5 mg cap , pregabalin cap ip 75 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , primidone tablet 250mg , primidone tablet 50mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , procaine penicillin fortified 2 lack injection , prochlorperazine 5 mg tab , prochlorperazine 5mg tab. i.p. , progesterone inj ip 200 mg / 2ml , progesterone injection 50 mg inj. bp , promethazine inj ip 25mg / ml , promethazine syrup ip 5 mg / 5ml , promethazine tab ip 25 mg , proparacaine 0.5% w / v eye drop usp , proparacaine eye drop 0.5% , propofol 1% 20 mlinj , propofol inj ip 10 mg / ml , propofol mct / lct with oleic acid iv inj. , propranolol 10mg tablet / capsule , propranolol 40 mg sr tablet / capsule , propranolol tab ip 40 mg , propylthiouracil tablet 100mg , prostaglandin 500mcg / ml inj. 1 ml vial , protamine sulphate 5ml injection , protien powder 500 gm , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , pyridoxine tablet 100mg , pyridoxine tablet ip 40mg , quetiapine fumarate tablets i.p 200mg , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , rabeprazole 20 mg + domperidone 30 mg sr tab , rabeprazole 20 mg and levosulpiride75 mg capsule , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , racecadotril 10 mg sachet , racecadotril 100 mg cap. ip , ramipril 10 mg tab , ramipril 5 mg + hydroclorthiazide 12.5mg tab , ramipril ip 5 mg capsule / tablet ip , ramipril tablets ip 2.5 mg , ranitidine 150 mg + domperidone 10 mg tab , ranitidine 75 mg / 5ml oral suspension / solution / syrup i.p. , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranolazine 500mg tab. er / pr / cr , rattle snake antivenin polyvalent inj , recombinant fsh 150 iu inj. , recombinant fsh 300iu inj. , recombinant hcg 250 iu injection , recombinant human growth hormone 4iu vial with syringe injection , recombinant lh 75iu inj. , repaglinamide 1mg tab. , repaglinamide tablet 0.5mg , reteplase 18 mg inj. , revolizer / rotahaler device , rh erythropoetin inj 4000 iu , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , ribavirin 200 mg tab. / cap film coated , rifampicin 150 mg tab. i.p. , rifampicin 450 mg tab. i.p. , rifampicin 600 mg tab. i.p. , rifaximin 200 tab. b.p. , rifaximin 550mg tab. b.p. , rifaximin syrup 100 mg / 5 ml , ringer acetate infusion 500 ml , ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , risperidone 3mg tab , risperidone prolonged released depot / suspension 25 mg injection , risperidone prolonged released depot / suspension 50 mg injection , risperidone tab 1 mg , risperidone tab 2mg , rituximab inj 500 mg / 50 ml , rivaroxaban 10mg tab. b.p. , rivaroxaban 15mg tab. b.p. , rivaroxaban 20mg tab. b.p. , rizatriptan 10mg tab. i.p. , rocuronium 100mg / 10ml inj. in 10 ml vial , rocuronium 50 mg inj , romiplostim 125 mcg injection , romiplostim 250 mcg inj. , romiplostim 500 mcg inj. , root canal sealer ( calcium carbonate ) , ropivacaine 0.75% 20ml vial inj. ip , ropivacaine 0.75% 3 ml ampule ( heavy ) injection , rosuvastatin 10mg + asprin 75mg tab , rosuvastatin 10mg and fenofibrate 160mg tab. i.p. , rosuvastatin 40mg tab , rosuvastatin tablet 10 mg , rosuvastatin tablet i.p 5mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , roxithromycin ( 50 mg / 5ml ) susp. , roxithromycin 150 mg tabs , roxithromycin 50 mg tab , sacubitril 24 mg and valsartan 26 mg tablet , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup ip 2mg / 5ml , salbutamol tab ip 2 mg , salbutamol tablet ip 4 mg , salicylic acid 16.7% and lactic acid 16.7% paint , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , salmetrol 50mcg and fluticasone 500 mcg dpi ip , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , secukinumab 150 mg inj. , selegiline 5 mg tab , serratiopeptidase 10mg tab. i.p. , serratiopeptidase 20 mg tab. i.p. , sertraline 100 mg tab , sertraline tab ip 50 mg , sevelamer carbonate 800 mg tab. , sevoflurane 250 ml , sildenafil 20 mg tab. i.p. , sildenafil citrarte inj. 10mg / 12.5 ml for iv use , sildenafil injection 0.8mg , sildosin 8 mg and dutasteride 0.5 mg tablet / capsule , silodosin 4 mg tablet / capsule , silodosin 8 mg tablet / capsule , silver sulphadiazine cream ip 1% 500 gm jar , silver sulphadiazine cream ip 1% 50gm tube , silymarin tablet 70mg. , simethicone 40 mg + dill oil 0.005 ml + fennel oil 0.0007 ml 30 ml drop , simvastatin 10 mg tabs , simvastatin 20 mg tabs , sitagliptine and metformin ( 50 / 500 ) tab , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , sodium bicarbonate 7.5% injection , sodium bicarbonate inj ip 7.5% w / v , sodium bicarbonate oral suspension syrup 200 ml , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride 0.9% 3000ml ( n.s ) injection , sodium chloride 0.9% biodegradable bag non dehp 500ml injection , sodium chloride 3 % respules , sodium chloride 3% 100ml inj. ip , sodium chloride 5 % eye drop bp , sodium chloride 6% eye ointment usp , sodium chloride and dextrose 0.45% infusion 500ml injection , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium fluroresceine dye 20% injection , sodium hyaluronate 1.4mg inj. , sodium nitroprusside injection 25mg / ml 2ml size , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium picosulphate oral suspension / solution / syrup 5mg / 5ml , sodium valproate 134 mg + valporic acid 58mg cap , sodium valproate 200mg+ valporic acid 87mg cap , sodium valproate gastro resistant tablets ip 200 mg , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , sodium valproate tablets 300mg , sodium valprolate 100 mg / 5 ml vial inj , sofosbuvir 400 mg and velpatasvir 100 mg tab. , sofosbuvir 400 mg tab. / cap , solifenacin succinate 10 mg tab. i.p. , solution silver nitrate 10% , solution silver nitrate 2% , solution silver nitrate 5% , sorbitol and tricholine citrate syrup / solution each 10ml contains sorbitol ( 70% ) 7.15gm and tricholine citrate ( 66% ) 0.55gm , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , spironolactone 100 mg tab , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , sterlium hand wash 100 ml , streptokinase injection 15 lac units ip , streptomycin 1gm injection , streptomycin 500mg injection , succinylcholine inj. ip 50 mg / ml ( iv use ) , sucralphate syrup / suspension each 5ml contains sucralphate 500mg , sugmadex injection 100 mg / ml , sulfacetamide 20% eye drop , sulfasalazine gastroresistant tablets ip 500 mg ip , sulphur and calamine lotion 100 ml , sultamicin tablet 375mg , sumag ointment 75 gm , sumatriptan 85 mg and naproxen sodium 500 mg tab , sumatriptan succinate 50 mg tab , sumatriptan succinate25mg tab , sunscreen lotion spf 30 ( octinoxate 7.5%, avobenzone 2%, oxybenzone 3%, octocrylene 3% and zinc oxide 2% ) 50ml , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 3ml inj , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml inj , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 5ml inj , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , syrup diatrizoic acid salts and meglumine 66o / o and sodium 10o / o and iodine content 370 mg / ml 30 ml solution , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , tacrolimus 0 .03% ointment , tacrolimus 0 .1% ointment , tacrolimus 1mg tablet / capsule , tadalafil 10 mg tab , tadalafil citrate 20 mg tab , tamoxifen tab ip 10 mg , tamsulosin 0.4 mg and dutasteride 0.5 mg tablet / capsule , tamsulosin hcl tablets / capsule 0.4 mg , tamsulosin hydrochloride 0.4mg + finasteride 5 mg tab , tapentadol 50mg tab. , teicoplanin 200 mg inj. ip , teicoplanin 400 mg inj. ip , telmisartan 20 mg tab , telmisartan 40 mg + amlodipine 5 mg tab , telmisartan 40mg + chlorthalidone 12.5mg tab , telmisartan tablets ip 40 mg , telmisartan40mg and hydroclorothiazide12.5 mg, i.p. each tablet contain telmisartan40mg and hydroclorithiazide12.5 mg, , telmisartan80mg and hydroclorothiazide25 mg, i.p. each tablet contain telmisartan80mg and hydroclorithiazide 25 mg, , tenaligliptin tablet ip 20mg , tenecteplase 20mg inj. , tenecteplase 40 mg inj. , tenofovir alafenamide fumerate ( taf ) 25 mg tab. / cap , terazosin 1 mg cap , terbinafine cream 1%w / w ( 10 gm tube ) , terbinafine hydrochloride tablet 250 mg , terbutaline tablets ip 2.5 mg , testosteron propionate 250mg injection , testosteron propionate 50mg injection , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml inj. , tetracycline 250 mg cap , tetracycline 500 mg cap , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ip ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , thiamine 100ml injection , thiamine tablets ip 100 mg , thiocolchicoside 4 mg + aceclofenac 100 mg + pcm 325 mgtab , thiocolchicoside 4 mg tab , thiocolchicoside 8 mg tab , thiopentone inj ip 0.5 g , thyroxine 12.5mcg tab , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , ticagrelor 90mg tablet / capsule , ticarcillin and clavulanic acid injection 3.1 gm , tigecycline for injection 100mg injection , tigecycline for injection 50mg inj. usp , timolol eye drops ip 0.5 o / o w / v , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tiotropium and glycopyrolate 25mg inhaler , tiotropium bromide powder for inhalation 18mcg , tiotropium inhalation 9mcg , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , tobaramycin 80mg inj. ip , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , tofacitinib 5 mg tab. , tolvapatan 15mg tab. , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , topical heparin solution 1000iu / ml , topiramate 50mg tab. i.p. , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , topotecan 1 mg injection , topotecan 2.5 mg inj. ip , topotecan 4 mg inj. ip , torsemide 10 mg / ml inj , torsemide 20mg tab. i.p. , torsemide tab 10 ip mg , tramadol 100 mg inj. , tramadol 37.5mg and paracetamol 325mg tab. , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , tranexamic acid 500 mg + mefenamic acid 250 mg tab , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , travapost 0.004% and timolol 0.5% eye drops ip , travoprost eye drops ip 0.004 o / o , tretenoin cream usp 0.025% , triamcinolone acetonide 10 mg per ml injection , triamcinolone acetonide 40 mg per ml injection , triamcinolone oromucosal paste bp 0.1% w / w , trichloroacetic acid ( tca ) 50% w / v lotion , triclofos oral suspension500 mg / 5ml in 30ml syrup i.p. , trifluperazine tab ip 5 mg coated , trihexyphenidyl hcl tab ip 2 mg , trimetazidine hcl modified release tablet 35mg , trimetazidine hydrochloride modified release ( cr / sr / pr ) 60 mg capsule / tablet , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , tropicamide 0.8% w / v and phenylphrine hcl 5% w / v eye drop , tropicamide eye drop ip 1o / o , trop t kit , troylase ( haemocougalase ) 1ml ( like botrapase ) inj. , trypan blue 0.06% w / v injection , trypsin 48mg and rutoside 100mg and bromelain 90 mg tablet , trypsin chymotripsin tablet ( each enteric coated tablet contains 1 lacks unit of enzymetic activity ) , typan blue dye , ulipristal 5mg tab. , ultrasound contrast agent ( sulphur hexafluoride ) sonovue , urokinase injection 5 lac unit ( lyophilized ) , ursodeoxycholic acid 150 mg tab , ursodeoxycholic acid 450 mg tab , ursodeoxycholic acid tablets ip 300 mg , ursodeoxycholic oral suspension 125mg / 5ml in 100ml syrup , vaccinehepatitis a inj , vaccinehepatitis b ( recombinant ) 1 ml inj , vaccine chicken pox inj , vaccine hepatitis b ( recombinant ) 0.5 ml inj , vaccine influenza virusinj , vaccine mmr inj , vaccine oral rota virus , vaccine rabies 2.5 iu inj ( intramuscular ) , vaccine typhoid , valacyclovir 500 mg tab , valethamate bromide inj 8mg / ml , valganciclovir tablet 450 mg , valproate sodium 333 mg + valproic acid 145 mg cap , valsartan + hydrochlorothiazide tab , valsartan tab ip 80mg tab , vancomycin 250 mg inj , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , vasopressin 3ml injection , vdrl antigen ( with + ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4mg ( freeze dried ) , venlafaxime tab. 37.5 mg , verapamil 2.5 mg / ml injection , verapamil hydrochloride tablet sustained release 120mg , verapamil hydrochloride tablet sustained release 40mg , verapamil tab ip 40 mg film coated , vidagliptin 100 mg + metformin 500 mg tab , vidagliptin 50 mg + metformin 500 mg tab , vildagliptin 50mg tab. i.p. , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , vitamin a 25000 iu cap. ip , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin b complex nfi syrup , vitamin d3 ( 600000 iu ) inj. ip , vitamin d3 400iu / ml drop , vitamin d3 800iu / ml drop , vitamin d3 oral solution 60000 iu , vitamin e 200 mg + levocarnitine 150 mg cap , vitamin e 50mg / ml drops 15ml , vitamin e capsule 400 mg , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , vitamins a, c, d, e and b complex and minerals syrup , vitneurin b1 b6 b12 3ml amp. inj. , voglibose 0.2 mg tab tab. i.p. , voglibose 0.2mg, metformin 500mg tablets , voglibose 0.3 mg tab tab. i.p. , voglibose 0.3 mg, metformin 500mg tablets , voriconazole 1 % w / v ( lyophilized ) 30mg eye drop , voriconazole 200 mg tab. i.p. , voriconazole injection 200mg / vial , warfarin 1mg tab. i.p. , warfarin 2mg tab. i.p. , warfarin 3mg tab. i.p. , warfarin sodium. tab ip 5mg , water for inj ip 10 ml , xylometazoline nasal drops ip 0.1% , zinc 50mg tab. , zinc oral syrup / solution / suspension 20 mg / 5ml , zinc oxide and alo vera and semethicone ointment , zinc sulphate dispersible tablets ip elemental zinc 10 mg , zoledronic acid injection ip 4mg vial , zolpidem 10mg tab. i.p. , zolpidem tablet 5 mg , zonisamide 100 mg tab. , zonisamide 50mg tab....
37796759 purchase for generic medicines , acebrophylline 100 , acebrophylline 200 , acebrophylline 200 + montelukast 10mg , aceclo 100 mg + pcm 500 mg tab. , aceclofenac +serratiopeptidase tab. , aceclofenac + pcm + serratio tab. , aceclofenac 100 mg tab. , aceclofenac inj. , aceclofenac sustained release tab. , acetylcyteine 600 mg tab , acyclovir 200 mg tab. , acyclovir 400 mg tab. , acyclovir 800 mg tab. , acyclovir cream , adriniline inj. , albendazole 10 ml sus. , albendazole 400 mg tab. , alendronic acid 35 cap , alendronic acid 70 cap , alfacalcidol calcium + zinc cap. , alfuzocin 10 , alfuzocin d , alpha beta arteether 2 ml inj. , alpha lio acid + mv + antioxi + chrom. cap. , alprazolam 0.25 mg + propanolol 20 mg tab. , alprazolam 0.25 mg tab. , alprazolam 0.5 mg tab. , ambroxol + terbutaline + guiphen. 100ml syp. , amikacin 100 mg inj. , amikacin 250 mginj. , amikacin 500 mg inj. , aminophylline 10 ml inj. , amiodarone hydrochloride 100 mg , amiodarone hydrochloride 200 mg , amisulpride 100 tab , amisulpride 50 tab , amlodipine + olmesartan tab. , amlodipine besilate 10 mg tab. , amlodipine besilate 2.5 mg tab. , amlodipine besilate 5 mg + ateno 50 mg tab. , amlodipine besilate 5 mg + lisino 5 mg tab. , amlodipine besilate 5 mg tab. , amoxy. + cloxa. cap. , amoxycillin 1.2 g + pot. clavu. 200 mg inj. , amoxycillin 125 mg + dicloxa 125 mg tab. , amoxycillin 200 mg + pot. clavu. 28.5 mg syp. , amoxycillin 250 mg + dicloxa 250 mg cap , amoxycillin 250 mg + pot. clavu. 125 mg tab , amoxycillin 250 mg dt , amoxycillin 500 mg + pot. clavu. 125 mg tab. , amoxycillin 500 mg cap. , amoxycillin dry syp. , ampicillin 250 mg + cloxacillin 250 mg cap. , antacid170ml syp. , antacidwith oxetacaine syp. , antioxidant softgels , atenolol 25 mg tab. , atenolol 50 mg tab. , atorvastatin 10 mg + ezetimibe 10 mg tab. , atorvastatin 10 mg + finofibrate 160mg tab , atorvastatin 10 mg tab. , atorvastatin 20 mg tab. , azathioprine 50 mg tab. , azelastine nasl spray , azilsartan kamedoxomil + chlorthalidone tab , azilsartan medoxomil 40 tab. , azithromycin 100mg sus. , azithromycin 200mg sus. , azithromycin 250 mg tab. , azithromycin 500 mg tab. , b.c. + l lysine 200 ml syp. , b.c. + mv+ mineral + zinc cap. , b.c. 200ml syp. , baclofen 10 tab , benidipine 4mg tab , benidipine 8 tab , betahistine 16 mg tab. , betahistine 8 mg tab. , betamethasone 0.5 tab. , bethanechol 25 mg tab , biscodyl 5 mg tab , bisoprolol 10 tab , bisoprolol 2.5 tab , bisoprolol 5 tab , bisoprolol2.5 + hydrochlorothiazide 6.25 tab , calamine 3% diphen 1% lot 100 ml , calamine lotion 100ml , calcium + vit. d3 tab. , calcium calcitriol + alfacalcidol cap , camylofin25mg+paracetamol300mg tab , canagliflozin + metformin 500 tab , canagliflozin 100mg tab , candesartan 4mg tab , candesartan 8mg tab , carbamezapine 100 mg tab. , carbamezapine 200 mg tab. , carbonyl iron + folic acid + zinc cap. , carvedilol 12.5 mg tab , carvedilol 6.25mg tab , cavedilol 3.125 mg tab , cefadroxil 250 mg dt tab. , cefadroxil 500 mg tab. , cefixime + azithromycin tab. , cefixime + clavu.200 mg tab. , cefixime + dicloxacillin tab. , cefixime + ofloxacin tab. , cefixime 100 mg dt tab. , cefixime 200 mg tab. , cefixime 50 mg dt tab. , cefpodoxime proxetil + clavuna. tab. , cefpodoxime proxetil 100 mg dt tab. , cefpodoxime proxetil 200 mg tab. , cefuroxime 250 mg + potassium clavulanate 125 tab. , cefuroxime 250 mg tab. , cefuroxime 500 mg + potassium clavulanate 125 tab. , cefuroxime 500 mg tab. , cephalexin 250 mg dt tab. , cephalexin 500 mg cap. , cetri. + nimu + pcm + phenyl + caffin tab. , cetrimide lotion , cetrizine 10 mg tab. , cetrizine5 mg+ambroxol 60 mg tab , chlordiazepoxide + clidinium bromide tab , chlordiazepoxide tab , chlorhexidine mouth wash , chloroquin 250 mg tab. , chloroquin 500 mg tab. , chlorthalidone 12.50 mg tab , chlorthalidone 6.25mg tab , cilnidipine 10 mg , cilnidipine 20 mg , cilnidipine10 mg+chlorthalidone12.5mg , cilnidipine 10mg+telmisartan40 mg , cinnarizine + domperidone tab. , cinnarizine 25 mg tab. , cinnarizine 75 mg tab. , ciprofaloxacin + tinidazole tab. , ciprofaloxacin 250 mg tab. , ciprofaloxacin 500 mg tab. , citicolin 500 mg tab , clarithromycin 250 mg tab , clindamycine 300 cap , clobetasol pro. + salicylic acid lotion , clobetasol pro. + salicylic acid oint. , clomifene citrate 50 mg , clonazepam 0.5 mg tab. , clonazepam 1 mg tab. , clonezapam 2 mg tab. , clopidogrel 75 mg + asprin 150 mg tab. , clopidogrel 75 mg + asprin 75 mg tab. , clopidogrel 75 mg tab. , clotrimazole + betame cream 15 gm , clotrimazole power , clotrimazole vag. tab. , cod liver oil 300 mg , coenzyme q1 with anti oxidant cap , collagen peptides + glucosamine sachet , coral calcium tab , coral calcium+vitamin k2 7 , cream beclometha. + genta. + miconaz. , cream beclomethasone + neomycin , cream beclomethasone + salisalic acid , cream beclomethasone 0.025 % + genta 0.2 % , cream beclomethasone dipropionate 0.025% , cream betamethasone + gentamycin , cream betamethasone + neomycin , cream chloramphenicol + hydrocortisone , cream clobetasole , cream clobetasone + genta , cream clotrimazole skin cream , cream clotrimazole vag. cream , cream fluocinolone +genta + clotri. , cream fusidic acid , cream fusidic acid+ beclomethasone , cream heparin + benzyl nicotinate , cream hydroquinone , cream luliconazole + beclometasone , cream luliconazole 10gm , cream luliconazole 20gm , cream luliconazole 30gm , cream miconazole , cream miconazole + fluocinolone , cream mometasone + fusidic acid , cream mometasone + salicylic acid , cream mometasone + terbinafine , cream mometasone furoate 1 mg , cream mupirocin 2% , cream nadifloxacin + mometasone + miconazole , cream nadifloxacine + clobetasol , cream nadifloxacine 10mg , cream neomycin + bacitracin eye oint. , cream neomycin + bacitracin skin oint , cream premethrine 5% , cream terbinafen , cyclobenzaprine ( 15mg ) + aceclofenac ( 200mg ) , cyproheptadine 4 mg tab. , dapagliflozin + metformin 500 tab , dapagliflozin 5mg , dapoxetine 30 tab , dapoxetine 60 tab , deflazacort 12 mg tab. , deflazacort 18 mg tab. , deflazacort 30 mg tab. , deflazacort 6 mg tab. , dexamethasone sod. phos. 0.5 mg tab. , diazepam 10 mg tab. , diazepam 5 mg tab. , dicerine 50 mg cap. , diclofenac + serratiopeptidase + pcm 500tab. , diclofenac + serratiopeptidase tab. , diclofenac 100 mg sr tab. , diclofenac 50 + paracetamol 325 tab. , diclofenac 50 mg tab. , dicyclo 10 mg + mefenimic acid 250 mg tab. , dicyclomin 10 mg + pcm 500 tab. , dicyclomin tab. , dicyclomine drop , digoxin 0.25 mg tab. , diltiazem 30 mg tab. , diltiazem 60 mg tab , diltiazem 90 mg sr tab. , disodium hydrogen citrate syp. , disulfiram 250 mg tab. , disulfiram 500 mg tab. , divalproex sodium 250 tab , divalproex sodium 500 tab , divalproex sodium 750 tab , domperi 10 mg + paracetamol 500 mg tab. , domperidone 10 mg tab , domperidone 5 mg tab. , domperidone sus. , dothipine 25 mg tab. , dothipine 75 mg tab. , doxofylline 400mg + montelukast 10mg , doxofylline 400mg tab , doxycillin 100 mg + lactic acid ba. tab. , doxylaminesuccinate + vit b6 tab. , drop cefpodoxime proxetil dry , drop hydroxyzine oral drop , drop multivitamin , drop paracetamol , drotavarin + mefenimic acid tab. , drotaverine 40 mg tab. , drotaverine 80+ paracetamol 325 tab. , ear drop benzo.+ paracu. + terpentin oil , ear drop chloram + beclo. + clotri + dipro. + ligno. , empagliflozin 25mg tab , enalapril 10 mg tab. , enalapril 2.5 mg tab. , enalapril 5 mg tab. , enzyme tab. , ergotamine+ caffine 100 mg + pcm 250 mg , erythromycin 250 mg , erythromycin 500mg tab , escitalopram + clonazepam tab. , escitalopram 10 mg + etizolam 0.5 tab. , escitalopram 10 mg tab. , escitalopram 5 mg tab. , esomeprazole 40mg , esomeprazole 40mg + levosulperide , esomeprazole 40mg +domperidone , ethamsylate 250 mg tab. , ethamsylate 500 mg tab. , etophyllin + theophyllin tab. , etophyllin r 150 tab. , etophyllin r 300 tab. , etoricoxib 120 mg tab. , etoricoxib 60 + paracetamol 325 tab , etoricoxib 60 + thiocolchicoside 4mg , etoricoxib 60 mg tab. , etoricoxib 90 mg tab. , evening primrose oil 1000 , evening primrose oil 500 mg , eye drop atropine , eye drop brimonidine , eye drop brimonidine + timolol , eye drop brinzolamide , eye drop bromfenac , eye drop carboxy methyl cellulose 0.5% , eye drop carboxy methyl cellulose 1% , eye drop chloram + dexamethasone , eye drop chloram + poly + dexame , eye drop chloram + sulphacetamide , eye drop ciprofloxacin , eye drop ciprofloxacin+ dexamethasone , eye drop cromolyn sodium , eye drop dorzolamide , eye drop dorzolamide + timolol , eye drop flurbiprofen , eye drop gatifloxacin 0.3% , eye drop gatifloxacin 0.3% + prednisolone , eye drop hydro carboxy cellu + sulpha , eye drop hydro carboxy methyl cellulose , eye drop ketorolac 0.4% , eye drop ketorolac 0.5% , eye drop levofloxacin 1.5 , eye drop moxifloxacin 0.5 , eye drop moxifloxacin 0.5 + dexamethasone , eye drop moxifloxacin 0.5 + ketorolac , eye drop naphazoline + camphor + cpm , eye drop neomycin + bacitracin , eye drop ofloxacin , eye drop ofloxacin , eye drop ofloxacin + betamethasone , eye drop ofloxacin + dexamethasone , eye drop ofloxacin + ketorolac , eye drop ofloxacin + prednisolone , eye drop olopatdine , eye drop olopatdine + ketorolac , eye drop pilocarpine + timolol , eye drop pilocarpine 2% , eye drop polyvinyl alcohol + povidone , eye drop pot iod + sod chlo + cal chlo , eye drop prednisolone , eye drop timolol 0.5% , eye drop tobramycin , eye drop tobramycin + dexamethasone , eye drop tobramycin + flurometholone , eye drop tropicamide + phenylephrine , eye drop xylometazoline , eye drop zinc sulphate + boric acid + cpm , eye gel carboxy methyl cellulose 0.5% , eye gel carboxy methyl cellulose 1% , eye oint moxifloxacin oint. , eye oint. atropine , eye oint. ciprofloxacin , eye oint. ofloxacin , eye oint. tobramycin , eye oint. tobramycin + dexamethasone oint. , face mask 3 layer , faropenam 200 tab , febuxostat 40 tab , febuxostat 80 tab , fexofenadine 120 mg tab. , fexofenadine 180 mg tab. , fluconazole 150 mg tab. , fluconazole 200 mg tab. , flunarizine 10 mg tab. , flunarizine 5 mg tab. , fluoxetine 10 mg cap. , fluoxetine 20 mg cap. , flupentixo + melitracen tab. , fluticasone + azelastine nasal spray , fluticasone cream , folic acid tab. , frusemide + spirolactone tab. , frusemide 40 mg tab. , gabapentin + mecobolamine cap. , gabapentin 100 mg cap. , gabapentin 300 mg cap. , gabapentin 400 mg cap. , gabapentin400mg + nortriptyline10mg , gatifloxacin 400 mg tab , gbhc + chlorhexi. + cetrimide lotion , gbhc lotion 100ml , gel aceclofenac + lins oil + methyl sali. , gel clindamycine , gel clindamycine + isotretinoin , gel clindamycine +nicotinamide , gel diclofenac + oleum etc. gel 30gm , gel diclofenac 30gm , gel erythromycin , gel lignocaine gel , gel metronidazole , gel mouth ulser gel , gel piroxicam 30 gm , gel povidone iodin + metronidazole oit. , gel povidone iodin 10% oit. , gel povidone iodin 5% oit. , gel pro sali+ benzyl ko chloride oral gel , ginseng with multivitamin cap , gliclazide 40 mg tab. , gliclazide 80 mg + metformine 500 mg tab. , gliclazide 80 mg tab. , glime 1 mg+ metfo 500mg+ piog 15mg tab. , glime 2mg+ metf 500mg+ pioglati 15mg tab. , glimepride 1 mg + metformine 1000 mg tab. , glimepride 1 mg + metformine 500 mg tab. , glimepride 1 mg tab. , glimepride 2 mg + metformine 1000 mg tab. , glimepride 2 mg + metformine 500 mg tab. , glimepride 2 mg tab. , glucosamine + dicerine + mms tab. , glucosamine + dicerine cap. , glucosamine + mms tab. , glucosamine cap. , glycerin liquid 100 ml , glyceryl trinitrate 2.6 mg tab. , glyceryl trinitrate 6.4 mg tab. , haematinic with vitamin cap. , hcg pregnancy test card , herbal liver tonic 100 ml , herbal liver tonic 200 ml , hydro + tretoin + memetasone cream , hydroxychloroquine 400mg tab , hydroxychloroqune 200mg tab , hydroxyzine 10 mg tab. , hydroxyzine 25 mg tab. , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibuprofen + paracetamol sus. 60ml , ibuprofen + paracetamol tab. , ibuprofen 400 mg tab. , indomethacin 25 mg cap. , indomethacin 75 mg sr cap. , inj.erythropoietin inj 4000 , inj. amoxycillin 125 mg + dicloxa 125 mg , inj. amoxycillin 250 mg + dicloxa 250 mg , inj. ampicillin + cloxacillin 1gm , inj. ampicillin + cloxacillin 500 mg , inj. ampicillin 500 mg , inj. anti snake venum ( liquid ) , inj. anti snake venum ( powder ) , inj. anti tetanus immunog human 250 , inj. anti tetanus immunog human 500 , inj. anti d immunoglobulin ( human ) , inj. arte mether 2 ml , inj. artesunate 50 mg , inj. arv , inj. atracurium 2.5 ml , inj. atropine 0.6 mg , inj. benzothine benzyl penicillin 12 la , inj. bupivacaine 0.5 % 30 ml , inj. bupivacaine heavy 0.5 mg ( 4 ml ) , inj. butarphenol 1 mg , inj. butarphenol 2 mg , inj. cafotaxime + salbutamol 1.5 gm , inj. calcium gluconate 10 ml , inj. cefaperazone + salbactum 1 gm , inj. cefaperazone + salbactum 1.5 gm , inj. cefazidime 1 gm , inj. cefazidime 1.5 gm , inj. cefazidime 2 gm , inj. cefotaxime 1 gm , inj. cefotaxime 250 mg , inj. cefotaxime 500 mg , inj. ceftriaxone+ salbactum 1.5 gm , inj. ceftriaxone+ salbactum 750 mg , inj. ceftriaxone + tazobactum 375 mg , inj. ceftriaxone 1000 mg , inj. ceftriaxone 1000 mg + tazoba125 mg , inj. ceftriaxone 250 mg , inj. ceftriaxone 500 mg , inj. cefuroxime 1.5 gm , inj. cefuroxime 250 mg , inj. cefuroxime 500 mg , inj. cefuroxime 750 mg , inj. ciprofloxacin 100 ml iv , inj. d10 1000 ml , inj. d10 500 ml , inj. d5 1000 ml , inj. d5 500 ml , inj. dexamethasone sod. phos. 2 ml , inj. dextran 40 , inj. dextran 70 , inj. dextrose 25% , inj. diazepam 2 ml , inj. diclofenac , inj. dicyclomin , inj. digoxin 0.5 mg / 2 ml , inj. dihydroergotamine 1 ml , inj. diltiazem 5 mg / ml , inj. distild water for inj ( d.w. ) 5ml , inj. distilled water 10 ml , inj. dns 1000 ml , inj. dns 500 ml , inj. dobutamine , inj. dopamine 5 ml , inj. drotaverine 2 ml , inj. drotaverine 80 mg , inj. enoxpirin 0.4% , inj. enoxpirin 0.6% , inj. ergometrine , inj. ethamsylate 2 ml , inj. etophyllin + theophyllin , inj. fenobarbitone , inj. frusemide , inj. gentamycin 80 mg , inj. glyceryl trinitrate , inj. glycopyrolate 0.2 mg , inj. haemaccoeal 500 ml , inj. halothane 20 ml , inj. halothane 30 ml , inj. heparin , inj. hyalunoridase 1500 , inj. hydrocortisone 100 mg , inj. hydroxyprogestron 250 mg , inj. hydroxyprogestron 500 mg , inj. insuline 30 / 70 , inj. insuline lente , inj. insuline nph , inj. iron dextran , inj. isolyte e 500 ml , inj. isolyte g 500 ml , inj. isolyte m 500 ml , inj. isolyte p 500 ml , inj. isoxsuprine hcl , inj. ketamine 2 ml , inj. levofloxacin 100ml , inj. lorazepam , inj. mannitol 100 ml , inj. mannitol 350 ml , inj. mecobalamin 500mcg 2ml , inj. megsulf , inj. menadione sodium 1 ml , inj. methyl cellulose pre filled syringe , inj. methyl ergometrine maleate , inj. metoclopromide 2ml , inj. metronidazole 100 ml , inj. midazolam 5 ml , inj. multivitamine 10 ml , inj. nandrolone decanote 25 mg , inj. nandrolone decanote 50 mg , inj. neostig 2.5 mg + glycopyrolate 0.5 mg , inj. neostigmine 5 ml , inj. normal saline 1000 ml , inj. normal saline 500 ml , inj. ofloxacin 100 ml iv , inj. omeprazole , inj. ondansetron , inj. ondansetron + ranitidin , inj. ornidazole iv , inj. oxytocin , inj. pantoprazole , inj. pantozocine 30 mg / ml , inj. paracetamol 2ml , inj. phenaramine maleate , inj. phenobarbitone , inj. pilocarpine , inj. piperacilline + tazobactum 2.5 gm , inj. piperacilline + tazobactum 4.5 gm , inj. piroxicam , inj. potassium chloride , inj. progestirone 100 mg , inj. progestirone 200 mg , inj. promethazine hcl 50 mg , inj. propofol 10 ml , inj. ranitidine , inj. rl 1000 ml , inj. rl 500 ml , inj. soda bi carb 10 ml , inj. streptokinase 15 lac iu , inj. succinyl choline 10 ml , inj. t.t. , inj. theopentone sodium , inj. tinidazole 400 ml , inj. tramadol hydrochoride , inj. tranexamic , inj. urokinase 5 lac i.u. , inj. valethamate 8 mg. , inj. vecuronium 4 mg , inj. xylocain 2% with adrenaline 3 ml , inj. xylocain 4% 30 ml , inj. xylocaine heavy 5% ( lox ) ( 2ml ) , inj.benzothine benzyl penicillin 24 la , iron cap. , iron iii tab. , isosorbide mononitrate 10 mg tab. , isosorbide mononitrate 20 mg tab. , isosorbide mononitrate 30 mg tab. , itraconazole 100 mg , itraconazole 200 mg , itraconazole 400 mg , ivermectin 12 mg + albenad 400 mg tab. , ivermectin 12 mg tab. , ivermectin 3 mg tab. , ivermectin 6 mg + albenadazole 400 mg tab. , ivermectin 6 mg tab. , ketaconazole + coaltar lotion , ketaconazole + zpto lotion , ketoconazole 200 mg tab. , ketoconazole lotion , ketorolac 10 mg tab , lactobacillus sporgenes 120 million tab. , letrozole 2.5mg tab , levetiracetam 250 mg , levetiracetam 500mg , levetiracetam 750 mg , levocetrizine + phenylpro + pcm tab. , levocetrizine 5 mg tab. , levofloxacin 250 mg tab. , levofloxacin 500 mg tab. , levofloxacin 750 mg tab. , levonorgestrol 0.75 mg tab. , lignocain hydroclorid 2% inj , linagliptin + metformin tab , linagliptin tab , lincomycin 2ml inj , lincomycin cap , linezolid syp , linezolide 600mg tab , liquide paraffine+ milk of magnesia + sodium picosulphate syp , lisinopril 5 mg tab. , lithium carbonate 300 mg tab. , lithium carbonate 450 mg tab. , loperamide tab. , loratadine 10 mg tab. , lorazepam 1 mg tab. , lorazepam 2 mg tab. , losartan + amlodipine tab. , losartan + atenolol tab. , losartan + hydrochlor. tab. , losartan 25 mg tab. , losartan 50 mg tab. , lycopen+vitamin cap , mebeverine 200 tab , mecobalamine + liopic acid + f. acid cap. , mecobalamine 1500 mcg tab. , metformin 1gm sustained release tab , metformin 500 mg sustained release tab , metformin 500 mg tab. , metformin 850mg tab , methotrexate 10 mg , methotrexate 2.5 mg , methotrexate 5 mg , methotrexate 7.5 mg , methyl ergometrine maleate 0.2 mg tab. , methyl prednisolone 16 mg tab. , methyl prednisolone 24 mg tab. , methyl prednisolone 4 mg tab. , methyl prednisolone 8 mg tab. , metoclopramide tab. , metoprolol 25mg , metoprolol 25mg + amlodipine 5 tab , metoprolol 25mg xl tab , metoprolol 50mg , metoprolol 50mg + amlodipine 5 tab , metoprolol 50mg xl tab , metronidazole + clorhexidin gel , metronidazole 200 mg tab. , metronidazole 400 mg tab. , mirtazapine 15 mg tab , monmtelukast 10 mg+fexofenadine 120 mg , montelukast 10 mg + levoce 5 mg tab. , montelukast 10 mg+fexofenadine hcl 120 mg+acebrophylline , mosapride 5mg tab , moxifloxacin + dexamethasone eye drop , multivitamin sogtgel cap. , mv + minerals cap. , myo inositol 1g+lmethyl folate 100mcg+vitamind3 cap , n 95 mask , naproxen + paracetamol tab. , naproxen 250 mg tab. , naproxen 250mg , naproxen 500 mg tab. , naproxen 500 mg+domperidone 10 tab , naproxen 750 mg tab. , natural progestirone 100 mg cap. , natural progestirone 200 mg cap. , nebivolol 5 mg + amlodipine 5 tab , nebivolol 5 mg tab , nicorandil 10mg tab , nicorandil 5mg tab , nifedipine 10 mg cap. , nifedipine 5 mg cap. , nifedipine extended release 10 mg tab , nifedipine extended release 20 mg tab. , nimesulide 100 mg + pcm500 mg tab. , nimesulide 100 mg + serratio 10 mg tab. , nimesulide 100 mg + tizanidine 2 mg tab. , nimesulide 100 mg tab. , nimesulide 200 mg tab. , nimesulide mouth disolving tab. , nitrofurantoin 100 mg , norethisterone 5 mg tab. , norfloxacin 400 mg + tinidazole 600 mg tab. , norfloxacin 400 mg tab. , ofloxacin + ornidazole tab. , ofloxacin 200 mg tab. , ofloxacin 400 mg tab. , olanzapine 10 mg tab. , olanzapine 15 mg tab. , olanzapine 5 mg tab. , olmesartan + hydrochlorthiazide tab , olmesartan 20 tab , olmesartan 20 tab chlorthalidone 12.5 , olmesartan 40 tab , omeprazole + domperidone cap. , omeprazole 20 mg cap. , ondansetron + ranitidin tab. , ondansetron 4 mg tab. , ondansetron 8 mg tab. , oral rehydration salts ( o.r.s. ) , ornidazole 500 mg tab. , oxcarbazepine 150mg , oxcarbazepine 300mg , oxymetazolin nasal solution ( a ) , oxymetazolin nasal solution ( p ) , pancreatin tab , pantoprazole + domperidone cap. ( dsr ) , pantoprazole + itopride cap. , pantoprazole + levosulpride tab. , pantoprazole 40 mg tab. , pantozocine tab. , paracetamol + camylofin tab , paracetamol 500 mg tab. , paracetamol 650 mg tab. , phenobarbitone 30 mg tab. , phenobarbitone 60 mg tab. , phenytoin 100 tab , phenytoin 300 er tab , phenytoin syp , pioglatazone 15 mg tab. , pioglatazone 30 mg tab. , piracetam + citicoline tab , piracetam 800mg tab , piroxicam 20 mg dt tab. , povidone iodin + metronidazole lotion , povidone iodin gergle 100ml , povidone iodin lotion 100ml , prazocin 1 mg tab. , prazocin 2 mg tab. , prazocin xl 2.5 tab , prazocin xl 5 mg , pre pro biotic cap , pre probiotic sachet 1x1 , prednisolone 10 mg tab. , prednisolone 20 mg tab. , prednisolone 40 mg tab. , prednisolone 5 mg tab. , pregabalin 75 mg + meco 750 mcg cap. , pregabalin 75 mg cap. , pregabalin 75 mg+nortriptyline 10mg , pregabaline 75 mg+nortriptyline 10 mg+methylcobalamine 1500 mc , pregnancy test card , premethrine 5% lotion , premethrine soap , primaquin 15mg tab. , primaquin 7.5mg tab. , prochlorperazine tab , promethazine 10 mg tab. , promethazine 5 mg tab. , propranolol 10 mg tab. , propranolol 20 mg tab. , propranolol 40 mg sr tab. , propranolol 40 mg tab. , protein powder , quetiapine 100 mg , quetiapine 50 mg , rabeprazole + domperidone dsr cap. , rabeprazole + itopride cap. , rabeprazole + itopride cap. , rabeprazole + levosulpride cap. , rabeprazole 20 mg tab. , racecadotril 100 mg , racecadotril sachet , ramipril 10 mg tab. , ramipril 2.5 mg tab. , ramipril 5 mg tab. , ranitidine + domperidone tab. , ranitidine 150 mg tab. , ranolazine 500mg , resperidone 2 mg tab. , resperidone 3 mg tab. , resperidone 4 mg tab. , riboflavin10mg, folic acid, niacinamide 100mg , rosehip powder cap , rosuvastatin 10 + finofibrate tab , rosuvastatin 10 tab , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 20 tab , roxythromycin 150 mg tab. , roxythromycin 50 mg tab. , sachet antacid , salbutamol 2 mg tab. , salbutamol 4 mg tab. , scanidazole 1 gm tab. , serratiopeptidase 10 mg tab. , serratiopeptidase 5 mg tab. , sertaline 25 mg tab. , sertaline 50 mg tab. , sidenafil 100 mg tab. , sidenafil 50 mg tab. , silodosin 4 mg , silodosin 4 mg + dutasteride 0.5 mg , silodosin 8 mg , silodosin 8 mg + dutasteride 0.5 mg , silver nitrate + chlorhexidine cream , silver sulphadiazine + chlorhexidine oint. , silver sulphadiazine oit. , sitagliptin 100 tab , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 tab , soap anti acne , sodium chloride nasal spray , sodium picosulphate syp , sodium picosulphate tab. , sodium valproate 200 mg tab. , sodium valproate 300 mg tab. , sodium valproate 500 mg tab. , spironolactone + aldectone tab. , spironolactone 100 mg tab. , spironolactone 25 mg tab. , spironolactone 50 mg tab. , sun screen lotion , sur. abdominal binder , sur. adapter 3 way , sur. adhesive plaster ( cloth ) , sur. arm pouch sling , sur. asepto syringe , sur. b.k. skin traction kit , sur. b.k. sponge traction kit , sur. b.p. blade 10 , sur. b.p. blade 11 , sur. b.p. blade 15 , sur. b.p. blade 22 , sur. b.p. blade 23 , sur. b.p. blade 24 , sur. b.t. set , sur. bactigras , sur. band aid , sur. bandage 2 , sur. bandage 4 , sur. bandage 6 , sur. barbers thread60 , sur. barbers thread80 , sur. barbers thread 40 , sur. bed pan , sur. cap , sur. cervical collar , sur. chest belt , sur. clavicular brace , sur. cord clamp , sur. cotton 100 , sur. cotton 200 , sur. cotton 500 , sur. crd ( corrugated rubber drain ) , sur. crepe bandage 10 cm , sur. crepe bandage 15 cm , sur. crepe bandage 7.5 cm , sur. dispovan 1 ml , sur. dispovan 10 ml , sur. dispovan 2 ml , sur. dispovan 20 ml , sur. dispovan 5 ml , sur. dispovan 50 ml , sur. dynaplast , sur. flatus tube , sur. foleys catheter12 no. , sur. foleys catheter20 no. , sur. foleys catheter8 no. , sur. foleys catheter 10 no. , sur. foleys catheter 14 no. , sur. foleys catheter 16 no. , sur. foleys catheter 18 no. , sur. gastric levage tube , sur. gauze , sur. gel foam , sur. gloves 6 , sur. gloves 6½ , sur. gloves 7 , sur. gloves 7½ , sur. gloves 8 , sur. hernia mesh , sur. hydrogen peroxide 100 ml , sur. i.v. cannula 18 ( one way ) , sur. i.v. cannula 18 ( threeway ) , sur. i.v. cannula 20 ( one way ) , sur. i.v. cannula 20 ( threeway ) , sur. i.v. cannula 22 ( one way ) , sur. i.v. cannula 22 ( threeway ) , sur. i.v. cannula 24 ( one way ) , sur. i.v. cannula 24 ( threeway ) , sur. i.v. microdrip set , sur. i.v. set , sur. infant feeding tube 10 , sur. infant feeding tube 12 , sur. infant feeding tube 6 , sur. infant feeding tube 8 , sur. iol 20, 21, 22 no , sur. k 90 , sur. k 91 , sur. l.s. brace , sur. lap pad , sur. malleycots catheter 10 , sur. malleycots catheter 12 , sur. malleycots catheter 14 , sur. malleycots catheter 16 , sur. malleycots catheter 18 , sur. malleycots catheter 20 , sur. malleycots catheter 22 , sur. malleycots catheter 24 , sur. malleycots catheter 26 , sur. malleycots catheter 28 , sur. malleycots catheter 30 , sur. malleycots catheter 32 , sur. malleycots catheter 8 , sur. mask , sur. medicated soap ( savlon, dettol ) , sur. micropore 1 , sur. micropore 2 , sur. micropore 3 , sur. micropore 4 , sur. micropore 6 , sur. monocryl 1 , sur. monocryl 1.0 , sur. monocryl 2.0 , sur. monocryl 3.0 , sur. monocryl 4.0 , sur. mucous extractor , sur. nasal catheter , sur. neck arm pouch , sur. ng tube , sur. nitrofix , sur. paedia set , sur. pan rose drain , sur. patient dress female , sur. patient dress male , sur. pds 1 , sur. pds 1 0 , sur. pds 2 0 , sur. pds 3 0 , sur. pds 4 0 , sur. pds 5 0 , sur. plain rubber catheter ( all size ) , sur. plaster of paris 4 , sur. plaster of paris 6 , sur. polypropylene mesh , sur. profofol 10 ml , sur. profofol 20 ml , sur. prolene 1 pregabine , sur. prolene 1.0 , sur. prolene 2.0 , sur. prolene 3.0 , sur. prolene 4.0 , sur. prolene 5.0 , sur. romo suction drain 14 , sur. romo suction drain 16 , sur. romo suction drain 18 , sur. romo under water seal , sur. ryles tabe 10 , sur. ryles tabe 12 , sur. ryles tabe 14 , sur. ryles tabe 16 , sur. ryles tabe 18 , sur. ryles tabe 8 , sur. sanitary napkin , sur. scalp vein set 18 , sur. scalp vein set 20 , sur. scalp vein set 22 , sur. scalp vein set 24 , sur. silk 1 , sur. silk 1.0 , sur. silk 2.0 , sur. silk 3.0 , sur. silk 4.0 , sur. silk 5.0 , sur. skin grafting blade , sur. sofra tullae , sur. spinal needle no. 23 , sur. spinal needle no. 25 , sur. spinal needle no. 27 , sur. spirit 100ml , sur. sponge , sur. sponge tractian kit , sur. stapler , sur. stapples removal forcep , sur. stockinets , sur. suction catheter , sur. suction tube , sur. suction tubing set , sur. supra cath , sur. surgi gel , sur. surgical shirt , sur. surgical trouser , sur. t tube , sur. thermometer , sur. thermometer digital , sur. urinal , sur. urobag , sur. vickryl 1 , sur. vickryl 1.0 , sur. vickryl 2.0 , sur. vickryl 3.0 , sur. vickryl 4.0 , sur. vicryl rapide 1 , sur. vicryl rapide 1 o , sur. vicryl rapide 2 o , sur. vicryl rapide 3 o , syp. cefdinir 125 , syp. cefixime dry , syp. cefpodoxime proxetil dry , syp. cephalexin dry , syp. cet. + pph. + ammo. chloride + menthol 100ml , syp. codein + cpm 100ml , syp. codein + triprolidine 100ml , syp. colistin sulphate , syp. cyprohep. + tricholine citrate 200ml , syp. cyproheptadine , syp. cyproheptadine + sorbi. + tricho. 200ml , syp. dextro + brom + amm. c. + menth. 100ml , syp. dextro. + cpm + phenylpro. 100ml , syp. dextrome + guiph. + bromh. 100ml , syp. dextromethorphan cough syp sugar free , syp. enzyme ayurvedic , syp. fungal diastage + pepsin 200ml , syp. hydroxyzine , syp. iron , syp. iron iii , syp. lactulose 100 ml sus. , syp. lactulose 200 ml sus. , syp. levocetrizine 60 ml , syp. liver tonic 200 ml , syp. metoclopramide , syp. norfloxacin + metronidazole sus. , syp. ofloxacin , syp. ofloxacin + ornidazole sus. , syp. ondansetron , syp. paracetamol , syp. pcm + cpm + sod. citrate + pph , syp. pcm + promethazine , syp. piracetam 100 ml , syp. potassium chloride liquid , syp. potassium citrate + sodium citrate , syp. sodium picosulphate sus. , syp. terbutaline + brom + guiphen.100ml , syp. zinc acetate , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin 0.4 , tamsulosin 0.4 + dutasteride , tamsulosin 0.4 + finasteride 5 , tapentadol 100 , telmisartan 20 tab , telmisartan 20+amlodipine 5 +hydroch 12.5tab , telmisartan 40 + amlodipine tab , telmisartan 40 + chlorthalidone 12.5 tab , telmisartan 40 + chlorthalidone 6.25 tab , telmisartan 40 + clinidipine 10 + chlorthadone 12.5mg , telmisartan 40 + hydrochlorthiazide tab , telmisartan 40 tab , telmisartan 40+amlodipine 5 +hydroch 12.5 tab , telmisartan 80 + hydrochlorthiazide 12.5tab , telmisartan 80 tab , teneligliptin 20 mg tab , teneligliptin 20mg + metformin 500 mg , teneligliptin 20mg + metformine 1000mg , terbinafen 250 mg tab. , terbinafen 500 mg tab. , tetracycline cap. , thiocochicoside 4mg , thiocochicoside 4mg + etoricoxib , thiocochicoside 8mg , thiocochicoside 8mg + etoricoxib , thiolchicoside 4 + aceclofenec 100 tab , thiolchicoside 8 + aceclofenec 100 tab , thyroxine 100 mcg , thyroxine 25 mcg , thyroxine 50 mcg , thyroxine 75 mcg , ticagrelor 90mg tab , tinidazole 500 mg tab. , tolperisone 150 mg , topiramate 25 mg , topiramate 50 mg , torsemide 10 mg tab , torsemide 5mg tab , tramadol + paracetamol tab. , tramadol + pcm + diclofenac tab. , tramadol tab. , tranexamic acid + ethamsylate tab. , tranexamic acid + mefenamic acid tab. , tranexamic acid tab. , trifuoperazine + chlordiazepoxide tab. , trihexyphenidyl 2mg tab. , trypsin chymotrypsin tab. , trypsin chymotrypsin+paracetamol+aceclofenac tab , ursodeoxycholic acid 150 tab , ursodeoxycholic acid 300 tab , veldagliptin 50mg tab , veldagliptin+metformin 500 tab , veldagliptin+metformin1000 tab , vitamin b complex cap , vitamin c + zinc tab. , vitamin c tab. , vitamin e 400 mg cap , voglibose 0.2mg tab , voglibose 0.3mg tab , xylometazolin nasal solution ( a ) , xylometazolin nasal solution ( p ) , zoledronic acidinj 4 mg , zolpidem 10 mg tab. , zolpidem 5 mg tab....
37310905 supply of ( 1 ) lincomycin 30mg. / ml injection 2ml amp. ( 2 ) tigecycline inj. 50mg. 5ml vial ( 3 ) moxifloxacin 4mg. / ml. inj. for i.v.use 100ml. bottle, lincomycin 30mg. / ml injection 2ml amp. , moxifloxacin 4mg. / ml. inj. for i.v.use 100ml. bottle , tigecycline inj. 50mg. 5ml vial => limited...
35317300 supply of various types of medicinesvarious types of medicines, diosmin 500mg. tab. / cap. [ warranty period: 30 months after the date of delivery ] , biotine 10mg tab / cap [ warranty period: 30 months after the date of delivery ] , lincomycin 500mg. cap. / tab. [ warranty period: 30 months after the date of delivery ] , diltiazem hydrochloride 2% ointment min. 20gms. tube [ warranty period: 30 months after the date of delivery ] , gabapentin 6% + lignocaine 5% gel 30gm [ warranty period: 30 months after the date of delivery ] , ursodeoxycholic acid 450mg sr / er. tab. / cap. [ warranty period: 30 months after the date of delivery ] page 1 of 5 run date / time: 16 / 12 / 2022 17:06:58central hosp jp medical / north western rly tender document , collagen peptide sachet 10.5gms. [ warranty period: 30 months after the date of delivery ] , single dose dry powder inhalation device for rotacaps [ warranty period: 30 months after the date of delivery ] , mefenamic acid 100mg with paracetamol dispersible tablet [ warranty period: 30 months after the date of delivery ] => limited...
34809893 supply of drug and medicine , essentail drug list of rmsc medicines , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , aceclofenac and paracetamol tablet 100 mg + 325 mg , acenocoumarol tablet 2 mg , acetazolamide tablet 250 mg , act kit containing 3 tablet of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg , act kit containing 3 tablet of artesunate ( 50mg each ) and 1tablet of sulphadoxine pyremethamine ( 500+25 ) mg , act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyremethamine ( 500+25 ) mg each , act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and 1 tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir injection250 mg , acyclovir injection500 mg , acyclovir suspension400 mg / 5ml , acyclovir tablet200 mg , acyclovir tablet 800 mg , adenosine injection6 mg / 2ml , adrenaline injection 1 mg / ml , albendazole oral suspension 400 mg / 10 ml , albendazole tablet ip 400 mg , alendronate sodium tablets usp / bp 35 mg , allopurinol tablet 100 mg , alpha interferon injection 3 million unit , alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , amikacininjection100 mg , amikacininjection 500 mg , amikacin injection250 mg , aminophylline injection25 mg / ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg / ml , amitriptyline tablets ip 25 mg , amlodipine and atenolol tablet 5 mg +50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin oral suspension ( dry syrup ) 125 mg / 5ml , amoxycillin trihydrate dispersible tablet 125 mg , amphotericin b injection 50 mg , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , antacidliquid , antacid tablet , anti a blood grouping serum ( anti a monoclonal serum ip ) , anti b blood grouping serum , anti drh blood grouping serum , anti inhibitor coagulation complex [ human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu ] , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg / 5ml , artemether + leumefantrine tablet ( 40 mg and 240 mg ) , artemether + leumefantrine tablet ( 80 mg and 480 mg ) , artisunate injection 60 mg ( combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) , ascorbic acid tablet 500 mg , aspirintablet ip ( gastro resistant ) 150 mg , aspirin delayed release tablet ( enteric coated ) 75 mg , atenolol tablet 25 mg , atenolol tablet 50 mg , atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , atracurium injection 10 mg / ml , atropine eye ointment 1% , atropine sulphate injection0.6 mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tablet ip 50 mg , azithromycin tablet ( dt ) 100 mg , azithromycin tablet 500 mg , azithromycin tablet ip 250 mg , aztreonam 1gm injection , aztreonam injection 500 mg , beclomethasone inhalation 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , benzathine benzylpenicillin injection 6 lac units , benzathine benzylpenicillin injection ip12 lac units , betahistine tabletip 8 mg , betahistine tablet ip 16 mg , betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , betamethasone sodiumphosphate injection 4 mg / ml , betamethasone tablet 0.5 mg , betaxolol eye drops 0.50% , biphasic isophane insulin injection30 / 70 ( 30% soluble insulin &70% isophane insulin ) 40 iu / ml , bisacodyl tablet 5 mg , black disinfectant fluid ( phenyl ) ( as per schedule o grade iii , bleomycin injection15 units , brimonidine tartrate and timolol eye drops0.15% + 0.5% , bromocriptine mesylate tablet2.5 mg , budesonide nebulizer suspension0.25 mg / ml , budesonide rotacap 200 mcg , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , calamine lotion ip , calcitriol capsule0.25 mcg , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu ) , calcium gluconate injection 10% , cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , cap. vitamin e 400 mg , capsuleprocarbazine hydrochloride usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , capsule lomustine ip 40 mg ( each capsule contains lomustine ip 40 mg ) , capsule mycophenolate mofetil usp 250 mg ( each capsule conatin mycophenolate mofetil usp 250 mg ) , capsule tacrolimus ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg / 5 ml , carbimazole tablet 5 mg , carboplatin injection 150mg , carboplatin injection 450mg , carboprosttromethamine injection0.25 mg / ml , carboxymethylcellulose sodium lubricant eyedrops 0.50% , cefepime injection500 mg , cefixime oral susp ( drops ) 25 mg / ml , cefixime tablet 100 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection 250 mg , ceftriaxone injection ip 1 g / vial , ceftriaxone injection ip 500 mg / vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5ml , cephalexin tablet ( dt ) 125 mg , cetirizine syrup 5 mg / ml , cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetrimide cream ip 0.50% , chlorambucil tablet 5 mg , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops 0.05% , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash bp 0.20% , chloridazepoxide tablets ip 10 mg , chloroquine phosphate injection 40 mg / ml , chloroquine phosphate suspension 50 mg / 5ml , chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) , chlorpheniramine maleate tablet 4 mg , chlorpromazineinjection ip 25 mg / ml , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip50 mg , chlorpromazinetablets ip 25 mg , chlorzoxazone, diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , cholecalciferol granules 60, 000 iu / 1gm , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , ciprofloxacin eye drops0.30% , ciprofloxacin injection 200 mg / 100 ml , ciprofloxacin ophthalmic ointment 0.30% , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , cisplatin injection 10 mg / 10 ml , cisplatin injection 50 mg / 50 ml , clindamycincapsule 150 mg , clindamycin capsule 300 mg , clindamycin phosphate gel usp 1% , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol cream 0.05% , clomiphene tablet 50 mg , clomiphene tablet ip 25 mg , clonazepam tablet 0.5 mg , clopidogrel and aspirin tablet 75 mg +75 mg , clopidogrel tablet ip 75 mg , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1% w / v ) 1% , clotrimazole vaginal tablet 500 mg , cloxacillin sodium injection 500 mg , coal tar 6% & salicylic acid 3% onitment , compoundbenzoin tinctureip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , compound sodium lactate injection , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , conjugated estrogen tablet 0.625 mg , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet160 mg + 800 mg , co trimoxazole tablet40 mg + 200 mg , cough syrup [ each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg ] , cough syrup / expectorant ( ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , cream mupirocin usp 2% ( each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base ) 15 gm size , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg / 5 ml , dacarbazine injection 500 mg , danazol capsule ip 50 mg , daunorubicininjection 20 mg , deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) 500 mg , dexamethasoneinjection 8 mg / 2ml , dexamethasone tablet 0.5 mg , dextromethorphan hydrobromide syrup 13.5 mg / 5ml , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic stip for sugar, ketone , diagnostic stip for sugar, protein , diatrizoate meglumine and diatrizoate sodium inj usp60% ( iodine conc.292 mg / ml ) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w / v ( iodine conc.370 mg / ml ) 76% , diazepam injection10 mg / 2ml , diazepam tablet 5 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg / ml , diclofenac sodium tablet 50 mg , diclofenac tablet ( sr ) 100 mg , dicyclomineinjection 10 mg / ml , dicyclominetablet 10 mg , dicyclomine and paracetamol tablet 20mg + 325mg , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine hydrochloride oral solution ip10 mg / 5ml , diethylcarbamazine tablets ip 100 mg , digoxin injection 0.25 mg / ml , digoxin tablet 0.25 mg , diltiazem tablet 30 mg , dinoprostone cream0.5 mg , diphtheria antitoxin 10, 000 iu , dobutamineinjection 50 mg / ml , domperidone oral drops 10 mg / ml , domperidone suspension 5 mg / 5ml , domperidone tablet 10 mg , dopamine hydrochloride injection40 mg / ml , doxorubicin injection50 mg / 25 ml , doxycycline capsule 100 mg , dried factor viii fraction ( iv use ) 1000 iu , dried factor viii fraction ( iv use ) 250 iu , dried factor viii fraction ( iv use ) 500 iu , drotaverine & mefenamic acidtablet 80 mg + 250 mg , drotaverine hydrochloride injection 40 mg / 2ml , drotaverine tablet 40 mg , enalapril maleate tablet 10 mg , enalapril maleate tablet 2.5 mg , enalapril maleate tablet 5 mg , enoxaparin sodium injection 60 mg , escitalopram tablets ip10 mg , ethamsylate injection 250 mg / 2ml , ethinyloestradiol tablet ip 50 mcg , etoposide injection 100 mg / 5 ml , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , eye drop moxifloxacin0.5% w / v ophthalmic solutionip 5ml size , factor – ix concentrate 600 iu , fenofibrate capsule 200 mg , fentanyl citrate injection50 mcg / ml , fentanyl citrate injection50 mcg / ml , feracrylum 1% w / w sterile solution 100 ml , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab. ( paediatric ) 20 mg + 0.1 mg , filgrastim injection 300mcg / ml , finasteride tablet 5 mg , flavoxate tablet 200 mg , fluconazole eye drops0.3% , fluconazole tablet 150 mg , flunarizine tablet 5 mg , fluorouracil injection 250 mg / 5 ml , fluoxetine capsule ip 20 mg , flurbiprofen sodium ophthalmic solution 0.03% , folic acidtablet ip 5 mg , formaldehyde solution ( 34.5% 38% ) , formoterol & budesoniderotacap 6 mcg+ 200 mcg , framycetin sulphate cream 1% , framycetin sulphate cream 1% , furosemide injection 10 mg / ml , furosemide tablet 40 mg , fusidic acid cream2% , gabapentine tablet / capsule 100 mg , gabapentine tablet / capsule 300 mg , gadodiamide injection0.5 mmol / ml , gamma benzene hexachloride lotion ( lindane lotion usp ) 1% , gemcitabine injection 1gm , gemcitabine injection 200 mg , gentamycin injection 80 mg / 2ml , gentian violet topical solution usp 1% , glibenclamide and metformin hydrochloride ( sr ) tablet 5 mg + 500 mg , glibenclamide tablet 5 mg , gliclazideand metformin tablet 80 mg + 500 mg , gliclazide tablets ip 40 mg , glimepiride tablet 1 mg , glimepiride tablet 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sr ) tablet2mg + 15mg + 500mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glipizide tablet ip 5 mg , glucagon injection usp 1 mg / ml , glutaraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablet 2.6 mg , glycopyrrolate injection 0.2 mg / ml , griseofulvin tablets 125 mg , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , haloperidol injection 5 mg / ml , haloperidol tablet5 mg , haloperidol tablet 1.5 mg , halothane , hameodialysis bicarbonate solution , heparin sodium injection 5000 iu / ml , homatropine eye drops 2% , humanalbumin solution 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection ( im use ) 300 mcg , human rabies immunoglobulin injection 150 iu / ml , hyaluronidase injection 1500 iu , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , hydrocortisone sodium succinate injection 100 mg base / vial , hydrogen peroxide solution 6% , hydroxychloroquine sulphatetablet 200 mg , hydroxyethyl starch ( 130 / 4 ) 6% w / vwith sodium chloride 0.9% w / v intravenous infusion , hydroxyprogesterone injection 250 mg / ml , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg / ml , hydroxyzine tablet 25 mg , hyoscine butylbromide injection ip 20 mg / ml , hyoscine butylbromide tablet 10 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen oral suspension 100 mg / 5ml , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ifosfamide injection 1gm , imatinib tablet 400 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , indomethacin capsule 25 mg , injbendamustine 100 mg , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg / 500mg ip powder for solution , inj colistimethate ip 1m iu powder for solution , inj diclofenac sodium aqueous 75mg / ml1ml size, iv & im use , inj human chorionic gonadotropin ip 5000 i.u. , inj meropenem ip 250 mg , inj piperacillin 2 gm + tazobactom 250mg usp , inj poractant alpha 80 mg / ml in pack of 1.5 ml , inj prochlorperazine mesylate 12.5mg / ml 5ml size , inj tranexamic acid ip 100mg / ml 5ml size , inj zoledronic acid ip 4mg / 100ml 100ml size , inj. amino acid 10% 100ml size , inj. bevacizumab 100 mg , inj. bevacizumab 400 mg , inj. bortezomib 2mg , inj. butorphanol tartrate usp 1mg / ml 1ml size , inj. caffeine citrate usp 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , inj. ceftriaxone 1 gm + tazobactum 1.25 gm , inj. cis atracurium besylate 2 mg / ml in 5 ml vial , inj. esmolol hydrochloride 10mg / ml 10ml size , inj. ferric carboxymaltose 50 mg / ml 10 ml size , inj. ganciclovir sodium 500mg ( lyophilized powder for reconstitution ) , inj. hepatitis b immunologlobin ip 100 i.u , inj. liposomol amphotericine b 10 mg , inj. n butyl alcohol 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , inj. polymixin sulphate b usp 5 lac i.u. , inj. sodium nitroprusside25mg / ml2ml size , inj. voriconazole200mg / vial , insulin glargine100 iu / mlwith 30 insulin syringes with needle , insulin glargine 100 iu / ml with 15 insulin syringes and needles / cartridge 100 iu / ml with 15 needles and 1 pen per 20 cartridges , intravenous fat emulsion 20% w / v ( pl / tg ratio 0.06 ) 250ml , iohexol ( non ionic contrastmedium in sterile aqueous solution ) 300 mg iodine / ml. , iohexol usp ( solution for injection ) non ionic contrastmedium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium rotacap40 mcg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg / ml usp / bp 20 mg / ml ( for iv use ) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , isoflurane , isophane insulin injection40 iu / ml , isoprenaline injection 2mg / ml , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , isoxsuprine injection 5 mg / ml , isoxsuprine tablet 20 mg , itraconazole capsule 100 mg , ketamine injection 50 mg / ml , ketoconazole cream 2% , labetalol hydrochloride injection 20 mg / 4ml , labetalol tablet 100 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm / 15ml , l asparaginase injection 10000 iu , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , leucovorin calcium injection 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500 mg / 5ml , levetiracetam oral solution suspension 100 mg / ml , levetiracetam tablet 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , levofloxacin tablet250 mg , lidocaine hydrochloride topical solution usp 4% , lignocaineointment 5% , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , lignocaine gelip 2% , lignocaine injection 2% , linezolid injection 200 mg / 100 ml , linezolid tablet ip 600 mg , liquid paraffin ip , liquid paraffin ip , lisinopril tablet 10 mg , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lithium carbonate tablet 300 mg , loperamide tablet ip 2 mg , lorazepam injection2 mg / ml , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , losartan tablet 25 mg , losartan tablet 50 mg , lysol ( cresol with soap solution ) ( cresol 50% + soap 50% ) , magnesium sulphate injection ( 50% ) 500 mg / ml , mannitolwith glycerin injection 10% + 10% , mannitol injection 20% , mecobalamin injection 500 mcg / ml , medroxyprogesterone acetate tablet ip 10 mg , mefenamic acid tablet 500 mg , mefloquine tablet250 mg , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , meropenem injection 1 g , meropenem injection 500 mg , metformin hydrochloride ( sr ) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride ( sustained release ) and glimepiride tablet500 mg + 2 mg , metformin hydrochloride sr tablet 1000 mg , metformin tablet 500 mg , methotrexate injection 50 mg / 2 ml , methotrexate tablet 2.5 mg , methotrexate tablet ip 10 mg , methyl prednisolone sodium succinate for injection 500 mg , methylcobalmin tablet 1500 mcg , methylcobalmin tablet 500 mcg , methyldopa tablet 250 mg , methylergometrine injection 0.2 mg / ml , methylergometrine tablet ip 0.125 mg , metoclopramide injection 10 mg / 2ml , metoclopramide syrup 5 mg / 5ml , metoclopramide tablet 10 mg , metoprolol suscinate tablet ( extended release ) usp 50 mg , metoprolol tablet ip 25 mg , metronidazoleinjection 500 mg / 100 ml , metronidazole and chlorhexidine gel 1%+ 0.25% , metronidazole benzoate oral suspension 100 mg / 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , miconazole nitrate cream2% , midazolam injection ip 1 mg / ml , mifepristone tablet200 mg , misoprostol tablet 200 mcg , mitomycin c injection 10 mg , montelukast 10 mg + levocetrizine 5mg tablet , morphine sulphate injection ip 10 mg / ml , multi vitamin syrup , multiple electrolytes & dextrose injection type iip ( electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip ( electrolyte m injection ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , n acetylcystine injection 200 mg / ml , naloxone injection ip 0.4 mg / ml , naproxen tablet ip 250 mg , naproxen tablet ip 500 mg , natural micronisedprogesteron soft gelatin capsule 200 mg ( each soft gelatin capsule containsprogesteron ip 200 mg ) , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , neomycin, polymixin b & hydrocortisone ear drops / otic solution usp ( neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml ) , neostigmine injection 2.5 mg / 5ml , neostigmine injection ip 0.5 mg / ml , neostigmine tablets ip 15 mg , nifedipine capsule 5 mg , nifedipine tablet ( sustained release ) 10 mg , nitrofurantoin tablet 100 mg , nitroglycerininjection 5 mg / ml , noradrenaline injection 2 mg / ml , norethisterone tablet 5 mg , norfloxacintablet 400 mg , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin injection 200mg / 100 ml , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin suspension 50 mg / 5 ml , ofloxacin tablet 200 mg , oint. terbinafine 1%w / w ( 10 gm tube ) , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , olanzapine tablet5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v usp ( e / d ) 5ml size , omeprazole capsule 20 mg , ondansetron injection 2 mg / ml , ondansetron orally disintegrating md tablet4 mg , ors powder , oseltamivir 30 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate oral suspension ip 12 mg / ml ( each ml contains : 12 mg oseltamivir after reconstitution , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg / ml. ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection 50 mg , oxytocin injection 5 iu / ml , paclitaxel injection 100 mg , paclitaxel injection 260 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , pantoprazole injection 40 mg , paracetamoldrops 150 mg / ml , paracetamolsyrup ip 125 mg / 5ml , paracetamoltablet 500 mg , paracetamol infusion ip 1% w / v 100ml size , paracetamol injection 150 mg / ml , pentazocine injection 30 mg / ml , peritonial dialysis solution ip , permethrinlotion 5% , permethrin cream 5% , pheniramine injection 22.75 mg / ml , phenobarbitone injection ip 200 mg / ml , phenobarbitone tablet 30 mg , phenylephrine hydrochloride ophthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection 50 mg / ml , phenytoin oral suspension 25 mg / ml , phenytoin tablet 100 mg , pioglitazone tablet ip 15 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride injection0.15 gm / ml , potassium chloride oral solution usp500 mg / 5ml , povidone iodine ointment 5% , povidone iodine ointment 5% , povidone iodine scrub solution / cleansing solution 7.5%w / v povidone iodine 7.5% , povidone iodine solution10% , povidone iodine solution5% , povidone iodine solution5% , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection 25 mg / ml , prazosin tablet ( extended release ) 2.5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , prednisolone tablet 5 mg , pregabalin capsule ip 75 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesteroneinjection 200 mg / 2ml , promethazinesyrup ip 5 mg / 5ml , promethazine injection 25 mg / ml , promethazine tablet 25 mg , propofol injection 10 mg / ml , propranolol tablet 40 mg , pyridoxine tablet40 mg , pyridoxine tablet 10 mg , quetiapine tablet ip 25 mg , quetiapine tablet ip 50 mg , quinine dihydrochlorideinjection 300 mg / ml , quinine sulphate tablet 300 mg , rabies antiserum ip ( equine ) ( i.m. / sc use ) 300 units / ml , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose , ramipril tablet / capsule 2.5 mg , ranitidine hcl injection 50 mg / 2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , ringer acetate infusion 500 ml , risperidone tablet2 mg , risperidone tablet 1 mg , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution 5 mg / ml , salbutamol syrup ip 2 mg / 5ml , salbutamol tablet 2 mg , saline nasal solution ( drops ) 0.65% , sertraline tablet 50 mg , sevoflurane , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , snake venom anti serum ( polyvalent anti snake venom ) lyophillized , sodium bicarbonate injection ip 7.5% , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , sodium phosphates enema bp , sodium valproatetablet 200 mg , sodium valproate ipinjection 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate ( gastro resistant ) ip tablet 500 mg , soluble insulin injection 40 iu / ml , spironolactone tablet 25 mg , spironolactone tablet 50 mg , streptokinase injection 15 lac units , succinylcholine injection 50 mg / ml , sulfasalazine delayed release tablet 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical spirit bp , surgical spirit bp , syp. alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , tab abiraterone acetate ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , tab baclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tab cabergoline ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , tab cyclophosphamide ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , tab dexamethasone ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg ) , tab ethamsylate bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , tab gefitinib ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , tab lacosamide 100 mg ( each film coated tablet contains lacosamide 100 mg ) , tab lamotrigine ip50 mg ( eachsustained releasetablet contains lamotrigineip 50 mg ) , tab letrozole usp2.5 mg ( each film coated tablet containsletrozole usp2.5 mg ) , tab levamisol hydrochloride ip 50 mg ( each uncoated tablet conatinlevamisol hydrochloride ip 50 mg ) , tab oxcarbazepine ip150 mg ( each film coated tablet contains oxcarbazepine ip150 mg ) , tab pyridostigmine usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) , tab rosuvastatin 10 mg , tab rosuvastatin ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , tab savelamer carbonate 400 mg ( each film coated tablet containssavelamer carbonate 400 mg ) , tab sodium bicarbonate usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , tab tizanidine hydrochloride ip 2 mg ( each uncoated tablet containstizanidine hydrochloride ip 2 mg ) , tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , tab. acebrophylline 100 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) , tab. carvedilol 3.125 mg , tab. clonidine hydrochloride usp 0.1 mg ( each tablet contains clonidine hydrochloride usp 0.1 mg ) , tab. dutasteride 0.5 mg , tab. entecavir ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , tab. faropenem sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , tab. ketorolac 10 mg , tab. levofloxacin ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , tab. levosulpiride 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , tab. lorazepam ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , tab. mesalamine usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , tab. mycophenolate sodium 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , tab. sacubitril 24 mg and valsartan 26 mg , tab. sotalol hydrochloride usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , tab. terbinafine hydrochloride 250 mg , tab. valganciclovir 450 mg , tab. zolpidem 5 mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , tab.phenazopyridine 5 mg , tamoxifen tablet 10 mg , tamsulosinhcltablet 0.4 mg , telmisartan tablet ip 40 mg , tenaligliptin tablet 20 mg , terbutaline sulphate tablet ip 2.5 mg , tetanus immunoglobulin 250iu , tetanus vaccine ( adsorbed ) ip , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet ( sr ) 400 mg , thiamine tablet 100 mg , thiopentone injection 0.5 g , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , timolol eye drops 0.50% , tinidazole tablet ip 300 mg ( film coated ) , tinidazole tablet ip 500 mg ( film coated ) , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , torsemide injection10 mg / ml , torsemide tablet 10 mg , tramadol capsule 50 mg , tramadol injection 50 mg / ml , tranexamic acid tablet 500 mg , travoprost ophthalmic solution 0.004% , tretenoin cream 0.03% , trifluperazine tablets ip5 mg , trihexyphenidyl hydrochloride tablet 2 mg , tropicamide eye drops 1% , urokinase injection 5 lac unit , ursodeoxycholic acid tablet 300 mg , valethamate bromide injection 8 mg / ml , vancomycin for intravenous infusion ip 1 gm , vancomycin injection 500 mg , vdrl antigen ( with +ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4 mg ( freeze dried ) , verapamil tablets ip 40 mg , vinblastineinjection 10 mg / 10 ml , vincristineinjection 1 mg / ml , vitamin a solution 1 lac iu / ml , vitamin b complex injectionnfi , vitamin b complex tablet nfi ( prophylactic ) , vitamin d3 oral solution 60000 iu , vitamin k injection10 mg / ml , vitamin k 1 ( phytomenadione ) 1 mg / 0.5ml injection , warfarin sod. tablet 5 mg , water for injection ip , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , xylometazolinenasal drops 0.1% , zinc sulphate dispersible ip elemental tablet 10 mg , essentail drug list of rmsc medicines , 6 mercaptopurine tablet 20mg , acebrophylline sr tablet 200mg , aceclofenac and paracetamol and serratiopeptidase tablet ( 100 and 325 and 15 mg ) , acetic acid otic solution 2% ear drop , acitretin cap ip 10 mg , adalimumab 40 mg injection , adaplene ( 0.1% w / w ) gel , amantidine tablet 100mg , ambroxol drop , ampicillin and salbactum 1.5g injection , apixaban tablet 2.5mg , apixaban tablet 5mg , artemether 40mg and lumefantrine 240 mg 30ml syrup , aspirin dispresible tablet 325mg , aspirin tablet ip 300mg , astymine c ( vitamin c and essential amino acid ) drop , azithromycin oral suspension 200mg / 5ml syrup , b. complex syrup , baclofen oral solution 5 mg / ml syrup , bortezomib 2.5 injection , bosentan tablet 62.5mg , botulinum toxin type a for injection / botulinum toxin type b for injection 100 iu injection , brinozolamide and brimonidine eye drop , brivaracetam tablet 50mg , budesonide 0.5mg / ml respules , budesonide 1ml respules , budesonide 200 mcg. mdi , budesonide capsule 9mg , caffeine cirate 20mg / ml injection , caffiene citrate oral solution oral drop , calcium acetate tablet 667 , calcium gluconate / folinate injection , carbimazole tablet 10mg , carboxymethylcellulose and glycerin eye drop , cefipime 1000mg and tazobactum 125mg injection , cefixime oral suspension 100mg syrup , cefixime oral suspension 50mg syrup , cefpodoxime oral suspension 20mg / ml drop , cefpodoxime proxetil oral suspension 50mg syrup , cefpodoxime proxetil tablet 100mg , cefpodoxime tablet cv 375 , ceftazidime 1gm and sulbactam500 mg injection , cefuroxime axetil oral suspension 125mg / 5ml syrup , cefuroxime axetil tablet 500mg. , ceritinib capsule 100mg , ceritinib capsule 200mg , chloramphenicol 0.5% eye ointment , chloramphenicol and polymycin eye ointment , chlordiazepoxide tablet 25mg , chlordiazsepoxide tablet 10 mg and clidinium 25 mg , chlorthalidone tablet 6.25mg , cholchicine tablet 0.5mg , cilnidipine tablet 20mg , cilnidipine tablet 5mg , clarithromycin for oral suspension 125mg / 5ml syrup , clarithromycin tablet 500mg , clindamycin 600mg / 4ml injection , clobetasol and salicylic acid 0.5% and 6% ointment , clomipramine capsule ip 25mg , clonazepam tablet 0.25 , clonidine 150mcg / ml injection , clotrimazole 1% and beclomethasone 0.25% lotion , clotrimazole 10mg lozenses , clozapine tablet 25mg , coloplast 60 gm paste , cyclosporine capsule 100mg , d penicillamine 250mg capsule , dabigatran tablet 110mg , dabigatran tablet 150mg , dacarbazine 200mg injection , deflazacort tablet 12mg , degarelix 120 mg injection , desonide 0.05% cream , dextromethorphan hcl and chlorpheniramine syrup , diastase pepsin with simethicone 15 ml drop , digoxin 0.25% elixir , digoxin 2mg injection , diltiazem 2% p / r gel , diltiazem prolonged released tablet 90mg , dimethyl fumarate tablet 120mg , dimethyl fumarate tablet 240mg , distilled water 10ml injection , docetaxel 120 mg injection , docetaxel 80 mg injection , dorzolamide 2% eye drop , drotavarine syrup , duloxitine gastro resistant tablet 30mg , eeg 400gm paste , erlotinib tablet 150mg , etizolam tablet 0.5mg , etoricoxib and thiocolchicoside tablet ( 60mg and 8mg ) , febuxostat tablet 80mg , fexofenadine tablet 120mg , fluconazole 100mg injection , flunarizine tablet 10mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography injection , fluromethalone 0.1% eye drop , folic acid and methylcobalamine 10 ml pack injection , formoterol 6 mcg. and budesonide 200 mcg. mdi , fosphenytoin sodium 150mg / ml injection , furosemide 10mg / ml drop , furosemide tablet 20mg and spironolactone tablet 50mg , gatifloxacin and prednisolone eye drop , glycerin 2 gm / ml suppsitory , hmf for pretem sachet , human albumin 20% injection 50 ml vial , hydrocortisone 1% cream , indomethacin lyophilized powder 1mg injection , indomethacin tablet 75mg , insulin glargine 300 iu per ml / prefilled pen injection , intralipds injection , isotretinoin capsule 10mg , isotretinoin capsule 20mg , ivermectin tablet 12mg , kojic acid 2%, arbutin, niacinamide cream , lacosamide tablet 50mg , lamotrigine dispersible tablet 100mg , l carnitine 500mg / 5ml in 30 ml syrup , levetiracetam tablet ip 250mg , levodopa and carbidopa and entacapone tablet 100mg / 25mg / 200mg , levodopa and carbidopa tablet 125 , levofloxacin oral solution syrup , levosalbutamol 2.5 mg and ipratropium 500 mcg 2.5 ml respules , levosulpride tablet 75mg , linaglipitin tablet 5mg , lorazepam 5 mg injection , mefenamice acid 100mg / 5ml syrup , mefenemic acid 50 mg and paracetamol 250 mg / 60 ml syrup , megestrol acetate tablet 160mg , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) injection , methotrexate tablet 15mg , methotrexate tablet 7.5mg , methylene blue injection , methylprednisolone tablet 4mg , methylprednisolone tablet 8mg , metolazone tablet 5mg , midazolam 0.5mg / 5ml nasal spray , midazolam 5mg / ml 1 ml injection , midodrine tablet 5mg , milrinone 10 mg injection , montelukast tablet 4mg , morphine tablet 30mg , moxifloxacin and dexamethasone eye drop , moxifloxacin and difluoprednate eye drop , mycophenolate mofetil capsule 500mg , n acetylcysteine ( nac ) 200mg / ml respule , natamycin opthalmic suspension 5% eye drop , nebivolol tablet 5mg , neomycin sulphate and bacitracin zinc ointment usp 5 mg and 500 iu / gm ointment , nicoumalone tablet 1mg , nicoumalone tablet 3mg , nicoumalone tablet 4mg , nifedipine and lidocaine p / r gel , nifidipine tablet 20mg , normal saline 500 ml glass bottle injection , octreotide 100mg injection , olaptadine & ketorolac eye drop , olmesartan medoxomil tablet 20mg , oloptadine opthalmic solution 0.1% eye drop , ondansetron oral solution 30 ml drop , orciprenaline tablet 10mg , oxcarbazepine tablet 300mg , oxcarbazepine tablet 450mg , pantoprazole tablet 20mg , paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory , paracetamol infusion 500 mg with both temper evident caps spray 10% injection , pemetrexed 100mg injection , pemetrexed 500 mg injection , perampanel tablet 2mg , permethrin 1% rinse cream , pheniramine tablet 25mg , phenobarbitone 20mg / 5ml in 100ml syrup , piperacillin 1 gm and tazobactum 125 mg injection , podophyliin toxin lotion , polyethyene glycol and sodium chloride and sodium bi carbonate and potassium chloride sachet , polyethyene glycol with elctrolyte approx 130gm solution , potassium chloride for injection injection , potassium magnesium citrate syrup , prednisolone acetate opthalmic suspension 10 ml eye drop , prednisolone tablet ip 50mg , prednisolone tablet ip40mg , primidone tablet 250mg , primidone tablet 50mg , prochlorperazine tablet 5mg , propranolol tablet 10mg , propranolol tablet 40mg sr , propylthiouracil tablet 100mg , prostaglandin 500mcg / ml injection , rabeprazole and levosulpiride capsule , racecadotril sachet 30 mg sachet , ranitidine oral suspension syrup , rasagiline1mg tablet , repaglinamide tablet 1mg , rifaximin syrup , rivaroxaban tablet 10mg , ropinirole tablet 0.25mg , rosuvastatin tablet 10mg and fenofibrate tablet 160mg , salmetrol 50mcg and fluticasone 500 mcg dpi , sildenafil 0.8mg injection , silymarin tablet 70mg. , sodium bicarbonate injection , sodium chloride 3% 100ml injection , sodium chloride and dextrose 0.45% infusion 500ml injection , sodium fluroresceine dye 20% injection , sodium hyaluronate 1.4mg injection , sofosbuvir tablet 400mg and velpatasvir tablet 100mg , tacrolimus tablet 1mg , tacrolimus tablet / capsule 0.25 , tamsulosin and dutasteride tablet , tenecteplase 40 mg injection , tetanus vaccine ( adsorbed ) injection ip in 0.5 ml , thiamine 100ml injection , tigecycline for injection 50mg injection , tofacitinib tablet 5mg , topiramate tablet 50mg , torsemide tablet 20mg , tramadol tablet 37.5mg and paracetamol tablet 325mg , tranexamic acid 500mg / 5ml injection , trastuzumab 150mg injection , trastuzumab 440 mg injection , triamcinolone acetonide 10 mg per ml injection , triclofos oral suspension500 mg / 5ml in 30ml syrup , tropicamide and phenylepherine eye drop , trypan blue 0.6% injection , ursodeoxycholic oral suspension 125mg / 5ml in 100ml syrup , vitamin a capsule 25000iu , vitamin d3 800iu / ml drop , zinc oral suspension 20 mg / 100 ml syrup , zinc tablet 50mg , zolpidem tablet 10mg , zonisamide tablet 100mg , zonisamide tablet 50mg ss , other essentail drug list dm2022 23 , aceclofenac 200 mg sr tab. , aceclofenec 100mg.+thiocolchicoside 4mg.tab. , advanced liquid cleaner for instruments, endoscopes , alfuzosin 10 mg. + dutasteride 0.5 mg tab , alfuzosin tab. 10 mg. , amino acid infusion inj. 7%w / v , amisulpride 50 mg. tab. , amlodipine tabs 10mg. , amoxicillin + clavulanic acid 150 mg.inj. , amoxicillin + clavulanic acid 300 mg.inj. , ampicillin 250 mg. inj. , ampicillin 250mg+cloxacillin 250mg inj. , anastrozole 1 mg.tab. , antiseptic for mucous membranes , wounds, skin & pre & post opreative scrub solution of 10% , antiseptic for mucous membranes , wounds, skin & pre & post opreative scrub solution of 5% , aripiprazole tab 10 mg , artemether+lumefantrine syp. , artesunate 120mg inj , artesunate tab 50 mg , atenolol tabs ip 100mg. , atracurium inj 10mg / ml , azithromycin 100mg / 5ml syp. , azithromycin 500 mg.inj. , balanced salt solution ( opth. ) inj. , benzathine benzylpenicillin inj. ip 24 lacs units , bethanechol chloride 25 mg tab , bimetoprost eye drops 0.03% , biotin 5 mg tab , bupropiontab.150 mg. , caffeine citrate tablet , calcitonin nasal spray , calcitrol 1mcg inj , calcium acetate tab 667mg , calcium chloride inj. , calcium gluconate +calcium lactobionate inj. , carvedilol 6.25 mg tab. , cefepime250 mg.inj , cefepime +sulbactum inj. 1.125gm. , cefepime 1 gm.inj. , cefepime 125 mg.inj. , cefixim 200mg+clavulanic acid 125 mg. tab , cefpodoxime 100mg. / 5ml. syp. , cefpodoxime 200 mg.tab , cefpodoxime proxetile 200 mg + ofloxacine 200 mg tab , ceftriaxone + sulbactum 1.5 gm inj. , cefuroxime1.5 gm inj. , cefuroxime750 mg inj. , cefuroxime oral susp.syp. , chlorpromazine oral solution bp 25mg / 5ml. , chlorthalidone tabs ip 25mg. , cilnidipine 10 mg tab , cilostazole 50mg tab , ciproflox 500 mg. tinidazole 600 mg.tab. , citicoline 500 mg inj , citicoline tab. 500 mg , clarithromycin 250 mg cap / tab , clarithromycin inj 500 mg , clarithromycin suspension 250 mg , clonazepam tab.1 mg. , clozapine tab. 100 mg. , clozapine tab. 50 mg. , colistimethate sod inj. 1 million , colistimethate sod inj. 2 million , crystalline penicillin 10 lacs iu inj , cyproheptadine syp. , deflazacort tab. 6 mg. , dextrose 5% 1000 ml , dextrose inj 5% glass bottle , dextrose inj 50% glass bottle , diacerin+glucosamin 50 mg. , diclofenac50mg.+ serrotiopeptidese 10 mg.tab. , diethylcarbamazine tabs ip 50mg , diloxanide furoate tabs ip 500mg , diltiazem inj. 5mg. / ml. , diltiazem tabs ip 60mg. , distilled water , dorzolamide eye drops 2% , dry powder inhaler device ( revlizer ) , duloxetine tab. 20 mg. tab. , ecg jelly 250 ml , emollient+aloevera+vit.e cream , enoxaparin sodium inj ip 40mg / 0.4ml , enzyme syp. , epirubicin 10 mg.inj. , epirubicin 50 mg. inj. , erlotinib 150 mg.tab. , ethamsylate 250 mg.tab. , ethionamide 250 mg. , febuxostat 40 mg.tab. , ferrous ascorbate 30mg + folic acid 550 mcg suspension , fibrain sealant 1 ml.inj. , filgrasim 6 mg. ( peg. ) inj. , fluconazole 200mg tab , fluconazole 50mg tab , fluconazole inj. 2mg / ml , flurometholone 1% eye drops , fluticasone furoate +azilastin nasal spray , fluticasone furoate inhaler , fluticasone nasal spray , fluticasone propionate 0.05% cream , fluticasone propionate 0.05% cream , fluvoxamine tab ip 100mg , fluvoxamine tab ip 50mg , formalin vaporiser tab. , formeterol+fluticasone ( 6ug+250ug ) , formeterol+fluticasone6ug / 100 ug , formeterol+tiotropium ( 12ug+18 ug ) , frusimide+spironolactone tab. , gentamycin inj. ip 10mg / ml , glutathion 600 mg. inj. , glycine irrigation solu. 1.5% , halothane liq for inhalation , handrub solution ( chlorhexidine gluconate +ethanol ) , hydralazine hydrochloride 20mg inj , hydroxyprogesterone caproate 500mg inj. , hydroxyurea 500 mg. tab. , hydroxyzinesyp , hydroxyzine drop , ibandronic acid 150 mg.tab. , indomethacin 75 mg. cap , influenza vaccine inj. , iron dextran inj. ip 50mg iron / ml , isotretinoin20 mg. , ketaconazole 2% lotion , levetiracetam 250 mg.tab , levofloxacin 500 mg inj. , levofloxacin750 mg tab. , levomisole tab 150 mg , levosalbutamol syp. , levosulpiride 25 mg. tab. , l glutamine powder , lincomycin 300mg / ml inj , linezolid 100 mg.tab. , linezolid 100mg syp. , l ornithine, l aspartateinj , mephentamine 30 mg. / ml.inj. , meropenem & salbactum1.5 gm.inj. , mesalarine 1.2 gm.tab. , methyleprednisolon 16 mg tab , methyleprednisolon 250mg inj. , methyleprednisolon 40mg inj. , methyleprednisolon acetate 125mg inj. , midazolam 10 mg inj. , milk formula lbw powder , milk formula low lactose powder , milk formula zero lactose powder , minoxidil5% , minoxidil 2% , mirtazapin 15mg tab , mirtazapine 7.5 , mometasone furoate 0.1% w / w cream , mometasone furoate 0.1% w / w cream , montelucast + levocetrizine syp , moxifloxacine 400mg inj , multivitamin iv use inj , n acetyl cystine 600mg tab , neostimine 2.5+ glycopyrolate 0.4 inj , netilmicin 10 mg inj. , netilmicin 25 mg inj. , nicomalone 4mg tab , nicorandil 5mg tab , nitrazepam tab. 10 mg , norfloxacin 100mg tab , norfloxacin 200mg tab , ofloxacin 200 mg+tinidazole 600mg tab , ofloxacin 400 mg tab. , ofloxacin 50mg+ornidazole125mg syp. , oxybutynin tab. 2.5 mg. , oxybutynin tab. 5 mg. , pancreatic enzyme cap 10000 iu , paracetamol 650mg tab , phenobarbitone syp. , piracetam 200 mg / ml inj 20% , piracetam 800 mg. tab. , piracetam syp 500 mg , piroxicam 20mg inj , povidone iodine gargles , pramipexol 1.5mg tab , pramipexol 1mg tab , prednisolone acetate 1% eye dro;ps , primaquine phosphate 15mg tab , pyridoxine 100mg tab , racecadotril100 mg. , ramipril 5mg , ringer lacted sodium 1000 ml , rituximab 100 mg.inj. , rituximab 500 mg.inj. , rocuromium 10mg / ml , salmetrol 50 mcg.+fluticasone 250 mcg. , serrotiopeptidase 10mg tab , sevelamer carbonate 800 mg.tab , sildenafil citrate 25 mg ( oral ) tab. , sodium chloride1.6% ( ns ) glass bottle , sodium chloride 0.45% ( ns ) glass bottle , sodium chloride irrigation solu. ( ns ) , sofosbuvir 400 mg. tab. , solifenacin succinate tab. 10 mg. , solifenacin succinatetab. 5 mg. , spironolactone tabs ip 100mg. , succinyl choline inj. , sucralfate gel 1 gm / 5ml , sulbactum 1 gm inj , sulfadoxine+pyrimethamine tab 500 mg +25 mg , sulphadoxine+pyrimethamine syp. , sultamicillin 375 mg tab , sumatriptan 50mg tab , sunscreen gel spf 15 , sunscreen lotion spf 30 , tadalafil 20 mg tab , teicoplanin 400 mg.inj. , tenofovir tab.300 mg. tab. , terbinafine 1.0% w / w cream / oint , terlipressin inj 1mg , thyroxine sodium 25mcg tab , thyroxine sodium 75mcg tab , tiotropium 18mcg dry powder cap , tirofiban 5mg inj. , tissue plasminogen activator 20 mg inj , tobramycin sulphate inj 80mg / 2ml , torsemide 20 mg.tab , triamacinolon eacetonide inj.40 mg. / ml. , tropicamide0.8%+phenyl ephrine 5% eye drop , trypsin chymotrypsin tab , usg jelly 250 ml , vasopressin inj 20 units , vitamin bcomplex + vitamin b12 inj , voglibose0.2mg tab , voglibose0.3mg tab , white soft parrafin oint / cream , zinc sulphate syp. , everolimus 0.75 mg tab , tacrolimus 2mg tab , cefpriome + sulbactum ( 1.5 gm ) , eye drop atropine 0.01% , injection moxifloxacin 0.5% intracameral , injection ranibizumab intravitreal 0.5 mg dose single use ( vial 1 2 ml ) & disposable 30g & 1 / 2 inch long hypo dermic needle & 1 ml syringe , pilocarpine inj. 1ml , inj.flucloxaillin 1000mg , cap flucloxacilline 500mg , inj.cotrimoxazole 10ml , inj.anidulafungin100 mg , inj anti t lymphocyte globulin 20mg / dl , inj.basiliximab 20 mg , inj anti thymocyte globulin ( rabbit atg ) 25 mg...
33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...
33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...
33634321 rate contract for antisera and antibiotic discs at microbiology department rate contract for antisera and antibiotic discs at microbiology department , electrical items : , shigella dysenteriae , shigella flexneri , shigella boydii , shigella soneii , salmonella polyvalent h antisera , salmonella polyvalent o antisera , salmonella typhi o 9 antisera , salmonella typhi h a antisera , salmonella typhi h b antisera , salmonella typhi h d antisera , vibrio cholerapolyvalentantisera , vibrio cholera inabaantisera , vibrio cholera ogawaantisera , salmonella sero quick id kit , amphotericin b , clotrimazole , fluconzole ( fluconazoleflc25 mcg ) , griesofulvin , itraconazole , ketoconazole , miconazole , nystatin , terbinafine , voriconazole , amikacin 30 ug , amoxycillin 30 ug , amoxyclav 20 / 10 ug , ampicillin 10 ug , azithromycin 15 ug , cefepime 30 ug , cefixime 5 ug , cefoperazone 75 ug , cefotaxime 30 ug , cefpodoxime 10 ug , ceftazidime 30 ug , ceftriaxone 30 ug , cefuroxime 30 ug , cephalexin 30 ug , chloramphenicol 30 ug , ciprofloxacin 5 ug , clindamycin 2 ug , doxycycline 30 ug , erythromycin 10 ug , furazolidone 50ug , gentamycin ( 10mcg ) , linezolid 30 ug , meropenem 10 ug , netilmycin 30 ug , nitrofurantoin 300 ug , doripenem 10ug , optochin , piperacillin 100 ug , piperacillin + tazobactum ( 100 / 10 ) , tetracycline 30 ug , tiecoplanin 30 ug , tobramycin 10ug , vancomycin 30ug , ofloxacin 5 ug , imipenem 10ug , cefoxitin 30 ug , ceftazidime + clavulanic acid 30+10 , aztreonam 30 ug , penicillin g 10ug , ticarcillin + clavulanic acid ( 75 / 10 mcg ) , cefaclor 30 ug , nitrate reagent disc , dalfopristin 15 ug , carbenicillin100ug , cefdinir 5 ug , clarithromycin 15ug , co trimoxazole 25 ug , fosfomycin 200 ug , fusidic acid 10 ug , levofloxacin 5ug , lincomycin , hi gentamicin 120 ug , moxalactam030 ug , pristinomycin 15 ug , hi streptomycin 180ug , ticarcillin 75ug , spectinomycin 100ug , tigecycline 15 ug , cefotatan 30ug , colistin 10ug , minocycline 30ug , cefoperazone + sulbactum 75 ug / 10ug , novobiocin disc 30 ug , moxifloxacin 5 ug , ertapenem 10ug , polymyxin b ( 300 units ) , rifampicin 5ug , rifampicin 5ug , esbl identification kot ( a ) cefotaxime 30ug & cefotaxime + clavulanic acid 30 + 10mcq ( b ) ceftazidime & ceftazidme + clavulanic ancid 30+10 mcq , e test for cefotaxime , e test for vancomycin , e test for penicillin , e test for tiecoplanin , e test for colistin , mc farland equivalence turbidity standard 0.5 , x factor disc , v factor disc , x+v factor disc , bacitracin ( 0.04 unit ) , bile esculin disc , fluconzole ( 0.016 to 256 mcg / ml ) e strip mic , griesofulvin ( 0.002 to 32 mcg / ml ) e strip mic , itraconazole ( 0.002 to 32 mcg / ml ) e strip mic , terbinafine ( 0.002 to 32 mcg / ml ) e strip mic...
33465082 regents and consumables items for microbiology lab regents and consumables items for department microbiology lab , electrical items : , alberts stain , alkaline peptone water , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbeab elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , antiinuelear antibody ( ani ) elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , corn meal agar , cover slips 22 x 22 mm , crp test kit , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable polythene gloves , dubos medium , ecoshield , edta powder , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , mr vp medium ( glucose phosphate broth ) , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile transport medium ( stuart medium ) with test tube and swab individually packed , sulphanilamide , tcbs , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , hcv igmrapid card , occult blood stool , rpr test kit...
33067937 supply of lincomycin 500mg. cap./tab.lincomycin 500mg. cap./tab.,lincomycin 500mg. cap./tab. => limited...
32049429 supply of generic medicines supply of generic medicines , abiraterone 250mg tab , acarbose 50 mg tab , aceclofenacsr 200 mg tab , aceclofenacsr 100 mg tab , aceclofenac 100 mg tab , aceclofenaic + para tab , aciclovir 800 mg tab 1x10 , acyclovir 200 mg inj , acyclovir 200 mg tab , acyclovir 400 mg inj , acyclovir cream , adrenaline inj , albendazole drop 10ml , albendazole syp , albumin 100ml inj , alkaliser 100ml syp , all hydr + mag hydro+ dim. + sorb syp 200ml , alphal ipoic acid +mv +antioxi +ch , alprazolam 0.25 mg tab 1x10 , alprazolam 0.25 mg tab 1x15 , alprazolam 0.5 1x15 , alprazolam 0.5 tab , amikacin 500 mg inj , amlodipin 10mg tab , amlodipin+ atenolol tab , amlodipine + atenolol tab , amlodipine 2.5 mg tab , amlodipine besilate 5mg tab , amoxicillin 500 mg cap , amoxycillin + claul 625 tab , amoxycillin 1.2 mg inj , amoxycillin 125 dry sup , amoxycillin 125 mg 30 ml syp , amoxycillin 250 mg 30 ml syp , amoxycillin 250 mg cap , amoxycillin+clav 625 mg tab , anacid 170ml syp , anstrazole 1mg tab , antacid chew tab , antacid tab 1x9 , antacids syp 200 ml , antacids tab , anti oxi+ lyco+ miner cap , anti oxidant cap , anticold tab , arsinix trioxide inj , artesunatge 50 mg tab , atenol 50 mg tab 1x14 , atenolol 100 mg tab , atenolol 100 mg tab 1x14 , atenolol 25mg tab , atenolol 50 mg + amlodipine 5 mg ta , atenolol 50 mg tab , atenolol 50 mg tab 1x14 , atorvastain 10 mg + ezetimibe 10 mg tab , atorvastatin 10 mg tab , atorvastatin 10mg +aspirin 75mg , atorvastatin 10mg +aspirin 75mg , atorvastatin 20 mg tab , atorvastatin 40 mg tab , azaciticline inj , azithromycin +cefixime tab 1x6 , azithromycin 250 mg tab 1x10 , azithromycin 250 mg tab 1x6 , azithromycin 500 mg tab 1x10 , azithromycin 500 mg tab 1x3 , azithromycin 500 mg tab 1x6 , azithromycin syp , azthromycin susp 100 mg 10 ml , azthromycin susp 200 mg 10ml , bandage 15 mtr , bandage 2x2.5 , bandage 5mtr , bandaid , b com+mv+mine+zinc forte cap , b com6mv+mine+zinc forte cap , b complex 200 ml syp , b complex cap 1x15 , b complex forte+ vit , b complex tab1x10 , beclo+clotri+neomy 10 gm oint , beclo+clotri+neomy 5 gm , beclomethason dipro , bendamustin 100 mg inj , benzyl benzoate lotion 100 ml , betahistine 16 mg tab , betahistine 8mg tab , betahistine tab , betamethasone lotion , betnameta sone tab , bevacizumnabinj 100 mg , bisacodyl 5mg tab , bleomycininj15 mg , boric acid 20gm , bortezumib 2 mg inj , bortezumib 3.5mg inj , bromaxin dia cpm syp , bromhexine syp , buprenorphine 0.3 mg 2ml inj , c.p. 5 lac inj , cal carbonate + vitd3 syp , calamine 100 ml lotion , calamine 3% diphen 1% lot 100 ml , calamine 50ml lotion , calcitrol seachet , calcium + vita c inj 10 ml , calcium + vitamin syp , calcium + vitd3 tab , calcium carbon + calcitriol + zinc , calcium carbon+ calcitriol + zinc , calcium citrate, calcitriol & vitamin k2 7tab , calcium citrate, calcitriol & vitamin k2 7tab , calcium gluconate inj. 10 ml , capecitabine500 mg tab , capecitbine tab , capecitbine tab500 mg , carboplatin 150 mg inj , carboplatin 450 mg inj , carvedilol 12.5 mg tab , carvedilol 6.25 mg tab , caspofun xgin 50 mginj , caspofunxgin 70 mg inj , cefadroxil 250 mg in , cefadroxil 250 mg tab , cefadroxil 500 mg inj , cefadroxil 500 mg tab , cefixime 100 mg tab , cefixime 200 mg tab , cefixime 50 dt tab , cefixime 50 mg tab , cefixime drops 10ml , ceforperazone 1gm inj , ceforperazone 500mg + sulbactum , cefotaxime 1gm inj , cefotaxime 500 mg inj , cefpodoxime proxetil 200 mg tab , cefpodoxime proxetil 50mg syp , cefpodoxime proxetil disp. 100 m , ceftazidime 1gm inj , ceftriaxone 1g+ tazobacctum 12 , ceftriaxone 1gm +sulbact , ceftriaxone 1gm inj. , ceftriaxone 1gm+ sulbactm 500mg , ceftriaxone 250inj , ceftriaxone 250 mg + sulbactm 250 , ceftriaxone 250 mg + sulbactm 500 , ceftriaxone 250 mg inj , ceftriaxone 250mg + sulbactm 125 , ceftriaxone 500 inj , ceftriaxone 500 mg inj , cefuroxim 250 mg tab , cefuroxime 125 mg oral susp , cefuroxime axetil 250 mg , cefuroxime axetil 250 mg tab , cefuroxime axetil 500 mg , cefuroxime axetil 500mg tab , cefuroxime axetil 500mg tab 1* , cephalexin 125 mg dt tab , cephalexin 250 mg dt tab , cephalexin 250 mg tab , cephalexin 500 mg tab , cephalexin drop 10ml , cephalexin dry syp , cepodoxim 100mg tab , cepodoxim 200mg tab , cepodoxim syp , cetrizine + ambroxol tab , cetrizine + phenyl prop+ dextro s , cetrizine + pph+ ammo chlo + menth , cetrizine + pph+ammo chlo+menth , cetrizine 10 mg tab , cetrizine 30ml syp , cetrizine hyd +pseudeph hyd +pcm , child tonic iron / calcium / vit , chiloramphenicol 1 mg inj , chiloramphenicol 1gm inj , chiloramphenicol 500mg cap , chiloramphenicol syp , chilrpheniramine 4mg + codeine 1 , chloramphenicol 125 mg 60ml syp , chloramphenicol 250 mg cap , chlorhexidine3% mouth wash 10 , chloroquine phosphate 250 mg ta , chlorpheniramine + codein phos , chlorpheniramine + dextra + pcm +p , chlorpheniramine + pcm + phenylep , chlorquine 250 mg tab , chlorquine 500 mg tab , chlorquine ds tab , chlorquine syp , cholecalciferol tab 1x4 , cilnidipine 10 mg +telmisartan 40mg , cilnidipine 10mg , cilnidipine 10mg , cilnidipine 20 mg , cilnidipine 20 mg , cilnidipine 5mg , cinnarizine + domperidon tab , cinnarizine 25mg tab , cinnarzine 10mg tab , cipro +dexa eye drop , cipro +flucinolane + clorti cream , cipro 250 mg tab , ciprofloxacin250mg , ciprofloxacin + fluocin + clotri , ciprofloxacin 500 + tinidanzole500mg tab , ciprofloxacin eye / ear drop , ciprofloxacin iv inj , ciprofloxin 500 mg , cisplatin 10 mg , cisplatin 10 mg inj , cisplatin 50 mg inj , citicolin 500 mg tab , citicoline 500mg +piracetam 400mg , citicoline 500mg +piracetam 800mg , clarithromycin 250 mg tab , clavulanate pot + amoxycillin , clindamycim 1% gel , clobetasol 0.5 + miconazol 2 , clobetasol 0 05%+gentamicin 0 , clobetasol pro 0.5% + miconazole , clonazepam 0.5 mg tab , clonazepam 1mg tab , clopidogrel 75mg + aspirin 75 ta , clotriamazole tab , clotrimazol veg , clotrimazole + beclometh + neo , clotrimazole + beclomethasone , clotrimazole + beclomethasone + n , clotrimazole + fluclinolone + neom , clotrimazole 50 ml syp , clotrimazole oint , clotrimazole power , co trimaxazole syp , codin + cpm + menthol , cotrimaxazole d.s. tab , cotton 500 gm , cotton woll 20gm , cpm 2.5 + ammonium chloride 125 +sod syp , cpm 2.5 ml + ammo+ chloride 1.25 + sod syp , cyprohepatidine + sorbi+ tricho , cyprohepatidine + tricholine ci syp , cyproheptadine 200ml syp , cyproheptadine 4mg tab , cytrabine 100 mg inj , cytrabine 1000mginj , cytrabine 500 mg inj , d 1.0% 500ml , d 5% 1000ml inj , d 5% 500ml inj , d 25% 500ml inj , dacarbizine 200 mg inj , dacarbizine 500 mg inj , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 5mg , dapagliflozin 5mg , darbepoetin 25mginj , darbepoetin 40mg inj , darbepoetin 60mg inj , daxotelinj 120 mg , daxotelinj 120 mg , ddripemem 500mginj , deca anabolin 50mg inj , deflazcort 6mg tab , dexamethason inj , dexamethasone + chloramphenicol , dexamethasone + ciprofloxacin 1 , dexamethasone + neomycin 10ml , dexamethasone + ofloxacin 10ml , dexamethasone 0.5 mg tab , dexamethasone 5mg + phenyleph 5 , dexamethasone phos inj , dextro 5ml + pheny 12.5 +cpm 2mg , dextromethopen + hydro+ bromhx +am , dextromethorphan 10+ cpm+phenyl , dextromethorphan 10+ guai 100 +br , dextromethorphan 5mg + pph+diphe , dextroproposyphen & hydroclo , dextroproposyphen + acetominophe , dextroproposyphene 65ml + para+ , dextropropoxiphen 65mg +pcm 325 , diazepam 10mg tab , diazepam 2ml inj , diclo+ para+ chlorzox tab , diclofenac + diethyla+ met salt + oint 30gm , diclofenac + para+ tab , diclofenac + serra tab , diclofenac 50mg + serratiopeptidase 10mg tab , diclofenac 50mg tab , diclofenac eye drop , diclofenac inj , diclofenac oint 30gm , diclofenac poto 100 + pcm 500+ ser , diclofenic + para+ serra tab , diclofenic 100mg sr tab , dicyclomine + para , dicyclomine 10+ mefenamic 250mg , dicyclomine 10mg 2 ml inj , dicyclomine drop , diltiazem 30mg , diltiazem 60mg tab , diphenhydramine 14.08 + amni 38 syp , diphenhydramine 14.08+ amni 38+ x , diphenhydramine 25mg cap , disodium hydrogencitrate syp , dns 1000 ml , dns 500 ml , dobutamine 250 mg 5ml inj , docetaxel 20 mg inj , docetaxel 80mg , docetaxel 80mg inj , domeperidone 10mg tab , domeperidone dt 10mg tab , domeperidone syp , domperidone 10+ pcm 500 mg tab , domperidone tab , doxarubacininj10 mg , doxarubacininj 10 mg , doxarubacin inj 50 mg , doxarubacininj50 mg , doxycycline 100 mg tab 1x8 , doxycycline caps , doxylamine + pyridoxine + folic ac , drotaverine & mefenamic tab , dycerin 50 mg+ glucosamin 750 mgtab , ecitabinecap500 mg , electrolyte m 500 ml , enalapril 10mg tab , enalapril 2.5mg tab , enalapril 5mg tab , enapil 5 mg + amlodipine 5 mg tab , enoxaparin sodium 60mg inj , enzymes cap , enzymes cap1x15 , enzymes syp200ml , epirubicin 10 mg inj , epirubicin 10 mg tab , epirubicin 100 mg inj , epribucin 50 mginj , epribucin 50 mg inj , erlotinib 100mg tab , erlotinib 150 mg tab , erythro protine inj , erythromycin +aloevera cream , erythromycin 250 mg , erythromycin 500mg tab , erythropoietin inj 4000 , erythropoietin 10000 inj , erythropoietin 40000 inj , escitalopram 10mg + clonazepam0.5 ml , escitalopram 10mg tab , escitalopram 20mg tab , esomeprazole 40mg , esomeprazole 40mg , esomeprazole 40mg +domperidone , esomeprazole 40mg +domperidone , etaner cept 250mg inj , etaner cept 50 mg inj , ethambutol 800mg tab , ethamsylate 250 tab , ethamsylate 2ml inj , ethamsylate 500 tab , etophylin + theeophylin 2ml inj , etophylin + theophyl in 300mg tab , etophylin + theophylin 150mg tab , etophyll ine 84.7mg + theoph 25.3 , etophyllin + theophyllin tab , etoricoxib 120mg tab , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60mg tab , etoricoxib 90mg tab , face mask , febuxostat 40mg tab , febuxostat 80mg tab , ferric + folicacid + cyanoco + sorbi syp , ferric+ folicacid tab , ferrous salt + folic acid syp 200 , ferrous salt + folic acid tab , fexofenadine 120mg , fexofenadine 180mg tab , filgrastim pfsinj300mg , filgrastim pfsinj 6mg , filgrastim pfsinj 300mg , fluconazole 150 + azithromycin 1 , fluconazole 150 tab , fluconazole 50mg tab , fludocyte 50 mginj , fluoxetine + alprozolam tab , fluxoetin cap , folic acid 5mg tab , folic acid 5mg tab , folic acid 5mg tab1x30 , fosapre ptant 150mg inj , frusemide 40mg tab , fungal diastase 50 pcpsin 10 , furazol idone 100 metronidazole , furazol idone tab , fusidic acid + beciomfth+ dipro c , fusidic acid cream , gabapentin 300 mg + mecobalamine 500mg , gabapentin 300mg cap , gabapentin 400 mg cap , gamabanzyl lot , gamma benzene hexachloride 1% , gatifloxacin 200mg + ornidazole , gatifloxacin 400 mg tab , gatifloxacin eye drop , gauze , geftinmib tab 250 mg , gemcitabine inj 1 gm , gemcitabine inj 1 gm , gemcitabine inj 20 mg , gemcitabineinj 200 mg , gemcitabine 1.4 mg inj , gentamicin 0.2% dexamethasone , gentamicin 80mg inj 2 ml , gentamicin inj 2 ml , gentamycin eye drop , ginsang + multi vit , ginsang + multi vit cap , glibenclamide 5mg + metformin 500 tab , glibenclamide smg tab , gliclazide 40mg tab , gliclazide 80mg + metformin 500 , gliclazide 80mg tab , glime 1mg + metfor 500 mg+ piogl 15mg tab , glime 2 mg + metfor 500+ piogl 15 mgtab , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 500 t , glimepride 1 mg tab , glimepride 2 mg + metformin 1000t , glimepride 2 mg + metformin 1000t , glimepride 2mg +metformin 500 tab , glimepride 2mg tab , glipizide 5mg + metformin 500 , glucos c 100 + 200 gm , glucosamine 500mg tab , glucosamine 750mg+ diacerein 50 mg+msm tab , griseofulvin 250 mg tab , hacmatinic with vitamins 200ml , haematinic + vitamin+ folic acid cap , haematinic + zing cap 1x15 , haematinic with vitamins cap , haematinic with vitamins syp , heparin sodium 50 iu gel , heparin sodium 50 i u +bengyl n , human erythropoetin alfainj2000 iv , human erythropoetin alfa inj4000 iv , human erythropoetin alfa inj 4000 iv , human erythropoetin alfainj 2000 iv , hydrocortisone 100 inj , hydrogen peroxide 100ml , hydroxyprogesterone 250 inj , hydroxyprogesterone 500 inj , hyoscine butylbromide 10mg , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibandronate tab , ibuprofen 100pcm 125 mg 60ml sy , ibuprofen 100pcm 125 mg tab , ibuprofen 100 pcm 125 syp , ibuprofen 100 pcm 500 mg tab , ibuprofen 100 pcm 500 tab 1x15 , ibuprofen 400 +para 325 mg tab , imatinibtab 100mg , imatinib tab 400 mg , imatinibtab400 mg , imatinibtab 100mg , imatinib tab100mg inj , indomethacin 75mg sr cap , indomethacin cap , intazyme cap 1x15 , irenotacan 100mg inj , irenotacan 40 mg inj , iron ( 111 ) hydr. poly cap , iron + folic acid cap , iron + folic acid cap ( g ) 1x15 , iron 200ml syp , iron 60ml syp , iron polymaltose comphfolic ac , isabgol 100 gm , iso sorbide monoitrate tab , isolyte p500mg , isosorbide dinitrate 10mg tab , isosorbide mononitare 40mg ta , isosorbide mononitrare 20mg tab , isosrbide dinitrate 5mg tab , isosrbide mononitrare 10mg tab , ketoconazole 1% lot , ketoconazole 2% lot , lacobactllus tab , lacto bacillus tab 1x15 , lactobacillus 60mill tab , lactolus tab 1x15 , lactoluse 100ml syp , lactoluse syp 20, ml , lansprazole 30mg cap , lefotaxime 1gm inj , lefotaxime 250mg inj , lenalidmide 10mgtab , lenalidmide 5mg tab , letrazol 2.5 mg tab , levamisole 150mg tab , levetiracetam 250mg , levetiracetam 500 mg , levetiracetam 500 mg , levetiracetam 750 mg , levocetrizine + montelukast syp , levocetrizine syp , levocetrizine tab , levofloxacin 150mg 1x5 , levofloxacin 250 mg , levofloxacin 500mg , levofloxacin 500mg tab 1x5 , levofloxacin 500mg tab 1x5 , levofloxacin 750mg tab , levofloxacin iv inj 100ml , levonorgestrol 0.75 mg pills , levprolideinj 3.75mg , lignocaile 30ml + adrenal in inj , lignocain hydroclorid 2% inj , lignocaine hydro 2% adrenaline , lin oil + diclo sod+ methyl+ ment , lincomycin 2ml inj , lincomycin cap , liq. paraffin + milk or magnesia , lisinopril 10mg tab , lisinopril 5mg tab , lisinopril 5mg+amlodipin 5mg , lithium carbonate 300mg tab , liver tonic 100 syp , liver tonic 200 syp , loeramide 2mg tab , loperamide 2mg tab , loratadine + ambroxol hci tab , loratadine 10mg tab , loratadine 5mg +pseudoephedrine , lorazepam 1mg tab , lorazepam 2mg tab , los pot 50mg tab , losartan 50+ amlodipine 5 tab , losartan 50mg tab , losartan 50mg+ hydroch 12.5 mgtab , losartan pota 50+ amlodipine 5mg tab , losatan 50 + hydro 12.5 , luprolide depot 11.25inj , luprolide depot 22.5 inj , lycopen cap , lycopen+vitamin tab 1x15 , lyophillzed doxetaxel inj 20 mg , lyophillzed doxetaxel inj 80 mg , magaldrate540 + simeth 50mg syp , mandrolone dacanote 50 inj , mcp inj , mcp tab , mecobalamin + thiamine +pyridoxi , mecobalamin 1500mg tab , mecobalamin 500mg inj 2ml inj , mecobalamin 500mg tab , mecobalaminia lipo +facid +pyri , mefenamic acid 500mg + diclo hyd , melphalantab 2 mg , menadione sod 1 ml inj , meropenem 1gm inj , metformin 500mg tab , metformin 500mg tab 1x20 , metformin 850mg tab , metformin sr 1gm tab , metformin sr 500mg tab , metformin+gl imepride tab , metformine 500mh+gliclazide 80 mhtab , metformin sr 1000mg tab , metformin sr 500mg tab , methycobalamine 2ml 1500mg inj , methyl + prednisolan tab , methyl cobalami tab , methylcobalami + mincrals cap , methylcobalami od tab , methylcobalamin alpha lip.+ro , methylcobalamin ivit , methylergometrine inj , methylergometrine inj 1x1 , methylergometrine tab , methylpredsolone 16 mg tab , methylpredsolone 4mg tab , methylpredsolone 8 mg tab , metoclopramide inj , metoprolol 25mg tab , metoprolol 50mg tab , metoprolol xl 50mg tab 1x10 , metoprolol xl 25mg tab , metro 100 ml , metronidazole + norfloxacin susp , metronidazole 200mg tab , metronidazole 400mg tab , metronidazole inj 100ml , miconazole nitrate + flucinole , miconazole oint 10gm , mifepristone 200mg tab , mimesulide 100mg tab , minesulide + serrapep tab , minesulide gel , mirtazapine 15mg tab , misoprostol 200mg tab , misoprostol 200mtab , momemtasone creasm , montelukast 10mg + levo.d hcl 5 , mosapride 5mg tab , mosapridecitrate 5mg tab , multivitamin +min+zinc cap , multivitamin 10ml inj , multivitamin 2ml inj , multivitamin and minerals cap , multivitamin drop , multivitamin soft gel cap , multivitamin syp 200ml , mvi inj ( g ) , mycophenolate 500mg tab , nab paclitaxel 100 inj , nandrolone dacanote 25 inj , nano paclitaxel 100mg inj , nebivolol hydrochloride 2.5mg tab , nebivolol hydrochloride 5mg tab , nicorandil 5mg tab , nifeditine rt 20mg , nimesu+praa+serra tab , nimesulide + para tab , nimesulide 1% +methysalicylate oint , nimesulide 100mg + para 500 +ser tab , nimesulide 100mg +dicyclomine 2 , nimesulide 100mg mouth diss tab , nimesulide 100mg+tizanidine 2mg tab , nimesulide 200mg tab , nimesulide 50+paracetamol 125m , nimesulide 50mg+para 125 ( neula , nimesulide dt 50mg tab , nitroglycerin 2.6 tab 1x30 , norfloxacin 400 tab , norfloxacin+tinidazole +betacyc , ns 500 ml , ofloxacin +metronidazole syp , ofloxacin +ornidazole syp , ofloxacin +tinidazole tab , ofloxacin 200mg tab , ofloxacin eye / ear drop , ofloxacin inj , ofloxacin oral drop , ofloxacin syp , ofloxacin+dexamethasone drop , ofloxacin+ornidazol tab , olanzapine 5mg tab , olemesartan 40mg tab 1x10 , oleu 3% diclof 1.16% methyl 10 , olmesartan 20mg& hydroch 12.5tab , olmesartan 20mg tab , omeprazole 20 cap 1x15 , omeprazole 20mgcap , omeprazole 20mg +dom 10 mg cap , omeprazole 40mg tab 1x15 , omeprazole+domp cap 1x15 , ondansetron 2ml inj , ondansetron 8mg tab , ondansetron md 4mg tab , ondensetron 4mg inj , ondensetron 4mg tab , ondensetron 8mg tab , ondensetron drop , ornidazole 500mg tab , ornidazole iv inj 100ml , ors 21.8 gm , ors 4 gm , ors powder 21gm , oxaplatin 100mg inj , oxaplatin 50 mg inj , oxaplatin 50 mg tab , oxymethazole ine hydro nasla ors , oxytocin inj , paclitaxel inj 260mg , paclitaxelinj 260mg , paclitaxel 100mg inj , paclitaxel 200 mg inj , paclitaxel 30 mg inj , paclitaxel 300 mg inj , pain kill oil , pantoprazole 40mg , pantoprazole 40mg+domp 30 mg sr cap , pantoprazole 40mg + domperidone 30mg sr , pantoprazole inj , pantoprazole+domp tab , pantoproazole 40mg , paracetamol650mg tab , paracetamol 100mg drop , paracetamol 125mg syp , paracetamol 250mg syp , paracetamol 2ml inj , paracetamol 500mg tab , paracetamol 650mg tab , paracetamol d / s syp , paracetamol tab 1x15 , paracetamol+domperi ab , parafin 100ml , paralfin & milkof magnesia , pcm 125 mg +chlophe+sod cit+phe syp , pcm 450+brom 8mg +gui 100mg +cpm tab , pcm 500+serratio +aceclofenac tab , pcm 500mg tab , pegylated interferon alfainj1180mg , pemetrexed inj100mg , pemetrexed inj 100mg , pemetrexedinj500mg , penicillin g potassium 200000 , penicillin g potassium 400000 , penicillin g potassium 4000000 , penicillin g potassium 800000 , pheniramine maleate 22.7 mg inj , pheniramine maleate 25mg inj , phenobarbitone 30mg tab , phenobarbitone 60mg tab , piogilitazone 15mg tab , piogilitazone 30mg tab , piracetam 400mg tab , piracetam 800mg tab , piroxicam 40mg 2ml inj , piroxicam disp 20mg tab , piroxicam dt tab , polymer degarded gelatin 500m , porpanolol 10mg tab , potassium permegnate 20gm , povidone 100ml liq , povidone 15gm oint , povidone 20gm oint , povidone 250gm oint , povidone 500ml liq , povidone oint 5gm , povidone powder , prazocin xl 2, 5mg tab 1x15 , prazocin xl 5mg tab 1x15 , prazosin 1mg tab , prazosin 2.5mg tab , prazosin 5mg tab , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , pre & probiotic sachet 1x1 , prednisolone 10mg tab , pregabalin 75mg & methycobalmin750 mg cap , pregnancy test card , pregnency test card / kit , primaquine phosphate 15mg tab , primaquine phosphate 7.5 mg tab , promethazine 25mg 2mlinj , promethazine 25mg tab , propanolol 40mg tab , propranolol40mg & alprazolam 0.25mg tab , protine powder20gm , pyra 1500 +rifa450+isonia , pyramethamine 25ml +sulpha 500 , pyrazinamide 500mg , pyrazinamide 750 mg , quinine dthydrochloride inj , quinine sulpate 300mg tab , rabeprazole 20mg + dom 10mg tab , rabeprazole 20mg + dom 30mg cap , rabeprazole 20mg tab , ramipril 2.5mg tab , ramipril 5mg tab , ranitidine 150+domperidone 10m , ranitidine 150mg tab , ranitidne 2ml inj , ranolazine 500mg , ranolazine 500mg , rifamicin 450 tab , rijoximabinj500 mg , rijoximabinj 100 mg , risperidone 2mg tabroxithromyc , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg tab , rosuvastatin 20mg tab , roxithromycin syp , roxituromycin 50mg tab , salbutamol 2mg +ambroxol 30mgsyp , salbutamol 4mg tab , salbutamol tab , secnidazole 1gm tab , serratiopeptidase tab10mg , sertaline 100mg tab , sertaline 50mg tab , sildenafil citrate 100mg tab , silodosin 8 mg cap. , silodosin 8 mg cap. , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg tab , simvastatin 10mg tab , simvastatin 20mg tab , sitagliptin 100mg , sitagliptin 100mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50mg , sitagliptin 50mg , soda bi carb 25ml inj , sodium valaporate 200mg tab , sodium valproate cr 500mg tab , sodiumbicarbonate inj 10ml , sorafenib 200mgtab , sparfloxacin 200mg tab , sparfloxin 100mg tab , sponge rolder , sterile gloves , streptomycin 1gm inj , streptomycin 2.75 inj , sucralfate 100ml susp , tacrolimus cap 1mg , tacrolimuscap 0.5mg , tacrolimus cap 0.5mg , tacrolimus 0.01% w / w ointment , tacrolimus 0.03% w / w ointment , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin .4mg +dutasteride .5mg , tamsulosin .4mg +dutasteride .5mg , tamsulosin 0.4mg tab , tamsulosin 0.4mg tab 1x15 , tamzolamid tab250 mg , tamzolamidtab 100mg , tamzolamid tab100mg , tamzolamid tab 250 mg , telmisartan 20+amlodipine +hydroch tab , telmisartan 40 mg + amlodipin 5mg tab , telmisartan 40+amlodipine +hydroch tab , telmisartan 40mg+ hydroch 12.5 mgtab , telmisartan 40mg tab , telmisartan 80 mg tab , telmisartan 80+hydrochlorothiazide tab , telmisartan 80+hydrochlorothiazide tab , temozolomidecap20mg , temozolomidecap 100mg , temozolomidecap 100mg , temozolomidecap 20mg , teneligliptin 20mg , teneligliptin 20mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin 500mg , teneligliptin 20mg + metformin 500mg , terbipression inj , terbutalinesfsyp , terbutaline + guai+brom +menthol syp 100ml , teripratide 750mg / ml inj , testosterone 250mg 1ml inj , tetanus toxoid inj , tetra cycline 250 mg cap , tetracycline 250mg tab , thyroxine 100mg tab 1x1 , thyroxine 25mg tab 1x1 , ticagrelor 60 mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , tigercyclin inj , tinidazole 500mg tab , tobramycin & dexamethasone e / d , tobramycin 40mg inj , tobramycing 3% eye drop , tramadol 50mg+ paracetamol 375 mg tab , tramadol hydrochloride inj , tramadol hydrochloride tab , tramadol inj 2ml , trastozumab 440 inj , uniron inj , urokinase 5lakh tu inj , ursodeoxycholic acid 300 mg tab , ursodeoxycholic acid 300 mg tab , vildagliptina 50mg , vildagliptina 50mg , vildagliptina 50mg+ metformin 500mg , vildagliptina 50mg + metformin 1000mg , vildagliptina 50mg + metformin 500mg , vitamin b complex cap 1x15 , vitamin c 500mg tab , vitamin e tab 400ng , vitamine b complex cap ( conci , vitamine e 200mg tab , vitamine e 400 mg tab , voglibose 0.2mg tab , voglibose 0.3mg tab , voriconazole 200ml tab , zinc sulphate 60ml syp , zoledronic acidinj 4 mg , zoledronic acidinj 4 mg , zoledronic acid 5mg inj , zolpidem 5mg tab...
32024476 supply of medicine in govt bdm hospital kotputli supply of medicine in govt bdm hospital kotputli , injection list , adrenaline 1 ml , adenosine inj. 3mg / ml , aipha beta artemether inj 2ml , alpha beta artemether inj 1ml , amikacin 100mg inj 2ml , amikacin 250mg inj 2ml , amikacin 500mg inj 2ml , aminophyllin inj 10ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj 1.2gm , amoxicillin and potassium clavulanic inj 600mg , ampicillininj 1gm , ampicillininj 500mg , ampicillin + cloxacillin inj 1gm , anti d human immunoglobulin inj 300 mcg , anti tetanus serum inj ( tetanus immunoglobulin ) 250 iu / vial , ars inj ( rabies antiserum ) 5 ml vial , artesunate inj 60mg vial , artisunate inj 120mg , asv inj ( snake venum antiserum ) lyophilized , atracurium inj 10 mg / ml , atropine sulphate inj 1 ml , benzathine benzylpenicilline inj 12 lac units , benzathine benzylpenicilline inj 6 lac units , betamethasone sod phos inj 1 ml , botropase inj 1ml , bupivacaine 0.5% inj 20ml , bupivacaine in dextrose inj ( heavy ) 4ml , butorphanol tartrate inj 1 ml , caffeine citrate inj 3 ml , calcium gluconate 10% inj 10ml , carboprost tromethamine inj 1ml , cefoperazone 1 gm & sulbactum 0.5 gm inj , cefotaxime + salbactam inj 375mg , cefotaxime inj 125mg , cefotaxime inj 1gm , cefotaxime inj 250mg , cefotaxime inj 500mg , ceftazidime inj 1 gm , ceftazidime inj 250 mg , ceftazidime inj 500 mg , ceftriaxone inj 125mg , ceftriaxone inj 1gm , ceftriaxone inj 250mg , ceftriaxone inj 500mg , chloroprozmine inj 25 mg / ml , chloroquine phosphate inj 5ml , ciprofloxacin inj 100ml , clindamycin phosphate inj 300mg , cloxacillin sodium inj 500 mg , dexamethasone inj 2ml , dextrose 10% inj 500ml , dextrose 25% inj 100ml , dextrose 5% inj 1000ml , dextrose 5% inj 500ml , diazepam inj 2ml , diclofenac sodium inj 1 ml , diclofenac sodium inj 3ml , dicyclomine inj 2ml , digoxin inj 2ml , diltiazem inj 5ml , distal water 10ml ( water for inj. ) , dns inj 1000ml , dns inj 500ml ( sodium chloride 0.9% & dextrose 5% ) , dobutamine inj 250 mg / 5ml , dopamine hcl inj 5ml , dried factor viii fraction 1000 iu / vial ( iv use ) , dried factor viii fraction 500 iu / vial ( iv use ) , dried human anti haemophlic fraction inj ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine hydrochloride inj 2ml , electrolyte m inj500 ml , enaxoparine sodium 60mg inj , ethamsylate inj 2ml , etophylline + theophylline 2ml inj , fentanyl citrate inj 2 ml , ferric carboxymaltose inj 10 ml , fructodox 10% inj 500ml , frusemide inj 2ml , gentamycin 80mg inj 2ml , gentamycin inj 20mg , glycopyrrolate inj 0.2 mg / ml , haemaceel inj ( polygeline+ nacl+ kcl+cacl2 ) 500ml , haloperidol inj 1ml , halothane inj 250 ml , heparin sodium 5000 iu / ml inj 5 ml , hepatitis b immunoglobulin inj 100 iu , human albumin solution 20% 100 ml , human chorionic gonadotropin inj 5000 iu , hyaluronidase inj ( hylase ) 1500 iu , hydrocortisone inj 100mg , hydrocortisone inj200mg , hydroxyethyl starch 6% with sodium chloride 0.9 % 500 ml intravenous infusion , hydroxyprogesterone inj 250mg , hydroxyprogesterone inj 500mg , hyoscine butylbromide inj 20 mg / ml , insulin 30%:70% inj ( 10ml ) biphasic , insulin n inj ( 10ml ) isophane 40 iu / ml , insulin r inj ( 10ml ) soluble 40 iu / ml , insuline glargine inj 100 iu / ml 3 ml cartridge , insuline glargine inj100 iu / ml 10 ml vial , iron sucrose inj 5ml , isoflurane inj 100 ml , isolyte p inj 500ml ( electrolyte p ) , isoxsuprine inj 2 ml , ketamine inj 10ml , labetalol inj 4 ml , levetiracetam inj 500 mg / 5ml , lignocaine & adrenaline inj 30 ml , lignocaine 2% inj 30ml , linezolid inj 200mg / 100ml , lorazepam inj 2ml , magnesium sulphat inj 500mg / ml 2ml , mannittol 20% inj 350ml , mannittol 20% w / v inj 100ml , mecobalamin 500 mcg / ml inj 1 ml , meropenem inj 1 gm , meropenem inj 500 mg , methyl ergometrine inj 1ml , methyl prednisolone sod. succinate inj 500 mg , metoclopramide inj 2 ml , metronidazole inj 100ml , morphine sulphate inj 10 mg / ml , mvi inj 10 ml , naloxone inj 0.4mg / ml 1 ml , natural progesteron inj 200mg / 2ml , neostigmine inj 0.5 mg / ml 10 ml , neostigmine inj 2.5mg / 5ml , nitroglycerin inj 5 mg / ml , noradrenaline inj 2 ml , normal saline inj 500ml ( sodium chloride ) , ofloxacin 100ml infusion , ondansetron inj 2ml , orinidazole inj 100ml , oxytocin inj 1ml , paracetamol infusion 100 ml , paractamol inj 2 ml , pentazocine inj 1 ml , pentoprazole inj 40 mg vial , pheniramine mealate inj 2ml , phenobarbitone inj 1ml , phenytoin sodium inj 2ml , pilocarpin inj 1ml , piperacillin + tazobactum inj 4gm+500mg , potasium chloride inj 10ml , pralidoxime chloride inj 25 mg / ml / 500 mg , prochlor perazine mesylate inj 5ml , promethazine inj 2 ml , promethazine inj 2ml , propofol inj 20 ml vial , quinine dihydrochloride inj 2ml , rabies vaccine human ( cell culture ) inj 2.5 iu dose ( 1 ml vial with 1 ml diluent ) , ranitidine hcl inj 2ml , remdesivir 100 mg inj. , ringer acetate infusion 500 ml , ringer lactate inj 1000ml , ringer lactate inj 500ml ( compound lactate ) , ringer lactate inj 500ml ( glass bottel ) , sodium biocarbonate inj 10ml , sodium chloride inj 100 ml ( normal saline ) , sodium valproate inj 100 mg / ml , streptokinase inj 15 lac units , succinyl choline inj 10ml , t.t. inj 0.5ml , tetanus vaccine ( adsorbed ) inj 5 ml vial , thiopentone inj 0.5 gm , torsemide inj 10mg / ml , tramadol 50mg / ml inj 2 ml , traxenamie acid inj 5ml , urokinase inj 5 lac unit ( lyophilized ) , valethamate bromide 8mg / ml inj 1ml , vancomycin for intravenous infusion 250 mg , vancomycin for intravenous infusion 500 mg , vecuronium bromide inj 4 mg ( freeze dried ) , vitamin b complex inj 10 ml , vitamin k inj 1ml ( menadione ) , vitamin k 1 inj ( phytomenadione ) 1 mg / 0.5ml , alpha beta arteether [ lp.26 ] [ m ] , multivitamine 10 ml , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , doxcyline100 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , vitamin d ( 600000 iu ) 15 mg , cefepime injection ip 500 mg [ 510 ] , ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] , esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] , linezolid inj200mg / 100ml [ 517 ] , normal human intravenous immunoglobulin 5g / 100ml [ 633 ] , rh erythropoetininj 10000 iu [ 176 ] , rh erythropoetininj 4000 iu [ 179 ] , tablets / capsules list , acebrophylline 100 mg tab , aceclo 50 mg +para 325 mg+sera 10 mg tab , aceclofenac 100mg + paracetamol 325mg tab , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , act kit ( containing3 tab of artesunate 1x37.5mg ) , act kit ( containing3 tab of artesunate 200mg, 2 tab of sulphadoxine 750 mg & pyrimethamine 37.5mg ) , act kit ( containing3 tab of artesunate 50mg, 1 tab of sulphadoxine 500 mg & pyrimethamine 25mg ) , acyclovir 200mg tab , acyclovir 800mg tab , albendazole 400mg tab , allopurinol 100 mg tab , alprazolam 0.25mg tab , alprazolam 0.5 mg tab , amitriptyline tab ip 25mg film coated , amlodipine2.5 mg tab , amlodipine 5 mg & enalapril 5 mg tab , amlodipine 5mg+ atenonol 50mg tab , amlodipine 5mg +lisinopril 5mg tab , amlodipine tablets ip 5 mg , amoxycillin 250mg & cloxacillin 250 mg cap , amoxycillin 250mg + calvulanic acid 1x375mg , amoxycillin 250mg cap , amoxycillin 500mg + calvulanic acid 1x625mg , amoxycillin 500mg cap , amoxycillin dispersible tab 125 mg , ampicilline 500mg cap , antacid tab ( aluminium hydroxide+magnesium trisilicate+peppermint oil ) , anticold tab ( cetirizine 5 mg, phenylephrine 1x325 mg ) , artemether 40 mg and leumefantrine 240 mg tablet , artemether 80 mg and leumefantrine 480 mg tablet , ascorbre acid 500mg tab , aspirin 150mg ( gastro resistant ) tab , aspirin 75mg tab delayed release , atenolol 25mg tab , atenolol 50mg tab , atorvastatin tablets ip 40 mg , atorvastin 10mg tab , atorvastin 20mg tab , azithromycin 100mg tab , azithromycin 250mg tab , azithromycin 500mg tab , b. complex tab ( prophylactic ) , baclofen 10 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg tab , betemethasone 0.5 mg tab , bisacodyl 5mg tab , cabergoline 0.5 mg tab , calcitriol capules 0.25mcg , calcium 500mg with vitamin d3 250 iu tab , cap vitamin a , carbamazepine 100 mg tab , carbamazepine 200mg tab , carbimazole tabs ip 5 mg ( film coated ) , carvedilol 3.125 mg tab , cefadroxil 250 mg tab , cefadroxil 500 mg tab , cefixime 100mg tab , cefixime 200mg tab , cefpodoxime 100mg tab , cefpodoxime dispersible tab 50 mg , cefuroxime axetil tab ip 250 mg , cephalexin 125mg dt tab , cephalexin 250 mg cap , cephalexin cap500 mg , cetrizine 10mg tab , chlordiazepoxide tablets ip 10mg , chloroquine phosphate 250mg tab , chlorpheniramine maleate 4mg tab , cinnarizine 25mg tab , cinnarizine 75mg tab , ciprofloxacin 250mg tab , ciprofloxacin 500mg tab , ciprofloxacin+tinidazole tab , clindamycine 150mg cap , clobazam 10 mg tab , clobazam 5 mg tab , clomifene 25 mg tab , clomifene 50 mg tab , clonazepam 0.5mg tab , clopidogrel 75 mg and aspirin 75 mg tab , clopidogrel 75mg tab , clotrimazole ( vaginal ) 500 mg tab , clotrimazole powder 1x30 gm , deflozacort 0.6mg tab , dexamethasone 0.5mg tab , diazepam 5mg tab , diclofenac 50 mg +paracetamol 325 mg +chloroxozone 250mg tab , diclofenac gastro resistant50 mg tab , diclofenac sodium + serrtiapeptidase + paracetamol 325mg tab , diclofenac sodium 100 mg sr tab , diclofenac sodium 50 mg + paracetamol 325mg tab , dicyclomin+mephenic acid tab , dicyclomine hcl 20mg + paracetamol 325mg tab , dicyclomine tab ip 10 mg , digoxin 0.25mg tab , diltiazem tabs ip 30 mg film coated , divalproex extended release 250 mg tab , domperidone tab ip 10 mg , doxycyclin 100mg cap , doxylamine succinate 20mg & pyridoxine hcl 20 mg tab , drotaverine 40mg tab , drotaverine 80mg +mephenic acid 250mg tab , dutasteride 0.5 mg tab , enalapril maleate 10 mg tab , enalapril maleate 2.5 mg tab , enalapril maleate 5mg tab , escitalopram tab ip 10 mg , ethamsylate 500mg tab , etophylline 23mg +theophyllin 77mg tab , etoricoxib120mg tab , etoricoxib 90mg tab , ferrous sulphate 100 mg with folic acid 0.5mg tab ( iron folic acid tab ) , flavoxate tablets ip / bp 200 mg ( coated tablet ) , fluconazole 150mg tab , flunarizine 5mg tab , fluoxetine 20 mg cap , folic acid 5mg tab , formalin tablet , frusemide tab ip 40 mg , gabapentine 300mg tab , glibenclamide 5mg tab , glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride tab ( sustained release ) 500 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , gliperimide 1mg+metformin 500mg sr tab , gliperimide 2mg+metformin 500mg sr tab , glipizide 5mg + metformin 500 mg tab , glipizide 5mg tab , glyceryl trinitrate 2.6mg controlled release tab , griseofulvin 125mg tab , haloperidol 1.5mg tab , haloperidol 5mg tab , hydrochlorthiazide 12.5 mg tab , hydrochlorthiazide 25 mg tab , hydroxychloroquine sulphate 200 mg tab , hydroxychloroquine sulphate 400 mg tab , hydroxyzine 25 mg tab , hyoscine butyl bromide 10mg tab , ibuprofen400 mg tab , ibuprofen 400mg + paracetamol 325mg tab , imipramine 25 mg tab , imipramine 75 mg tab , indomethacin 25 mg cap , isosorbide dinitrate 5mg tab , isosorbide mononitrate 20mg tab , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , itraconazole cap 200 mg , ketorolac 10 mg tab , labetalol 100 mg tab , lactic acid bacillus tab 60 million spores , levetiracetam 500 mg tab , levocetrizine 5mg tab , levodopa 1x10mg tab , levodopa 250mg and carbidopa 25mg tab , levofloxacin 500 mg tab , levofloxacin tablets ip 250 mg , levosulpiride 25mg tab , lincomycin 500mg tab , linezolid tablets ip 600 mg , lisinopril 10mg tab , lisinopril 2.5 mg tab , lisinopril tab ip 5 mg , lithium carbonate 300 mg tab , loperamide tab ip 2 mg , lorazepam 2mg tab , losartan 25 mg tab , losartan 50mg + amlodipine 5mg tab , losartan pot. 50mg & hydrochlorothiazide 12.5 mg tab , losartan tab ip 50 mg , mefenamic acid 500mg tab , mesalamine 1.2 gm enteric coated tab , metformin500mg film coated tab , metformin hcl sr 1000mg tab , methotrexate 10 mg , methyl cobalamine 500 mcg tab , methylcobamin 1500mcg tab , methyldopa 250mg tab ( film coated ) , methylergometrin0.125mg tab , metoclopramide 10mg tab , metoprolol 25mg tab , metoprolol succinate 50 mg tab , metronidazole 200mg tab , metronidazole 400mg tab , mifepristone 200 mg tab , misoprostol 200 mcg tab , montelucast 10mg + levocetrizine 5mg tab , multivitamin + f.a.+ minerals tab , naproxen 250 mg tab , naproxen 500 mg tab , natural micronised progesteron soft gelatin cap 200 mg , neomycin, bacitracin and sulphacetamide powder 10 gm , neostigmine 15 mg tab , neproxen 500 mg tab , nifedipine 5 mg cap ( nicardia ) , nifedipine sr 10 mg tab ( nicardia ) , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin 400mg ( film coated ) tab , ofloxacin 200mg + ornidizole 500mg tab , ofloxacin 200mg tab , olanzapine tab ip 5 mg , omeprazole 20mg cap , omperazole 20mg + domeradom cap , ondensetron orally disintegrating 4mg tab , ors powder ( who formula ) 20.5 gm , oseltamivir capsule ip 30 mg , oseltamivir capsule ip 45 mg capsule , oseltamivir capsule ip 75 mg capsule , oxcarbazepine 150mg tab , pantoperazole 40mg tab , pantoprazole 40mg and domperidone 30mg sr cap , paracetamol 500mg tab , phenazopyridine 5 mg tab , pheneramine mealate 25mg tab , phenobarbitone 30mg tab , phenytoin 100mg tab , pioglitazone tab ip 15 mg , piracetam 200mg tab , piracetam 800mg tab , prazosin 2.5 mg tab , prednisolone 10mg tab , prednisolone 20mg tab , prednisolone 5 mg tab , pregabaline 75 mg cap , primaquine 2.5mg tab , primaquine 7.5mg tab , probiotic sachets 1 gm size , prochlorperazine 5mg tab , promethazine 25 mg tab , propranolol 40mg tab , pyridoxine 10mg tab , pyridoxine 40mg tab , quinnine sulphate ( enteric coated ) 300mg tab , rampril 2.5mg tab , rantidine 150mg film coated tab , rantidine 300mg film coated tab , risperidone 1 mg tab , risperidone 2 mg tab , rotacap budesonide powder for inhalation 40 mcg ( budecort ) , rotacap formoterol fumerate & budesonide powder for inhalation 6 mcg +200 mcg ( foracort ) , salbutamol 2mg tab , salbutamol 4mg tab , serraptionpeptidase 10mg tab , sertaline 50mg tab , sodium bicarbonate 1 gm tab , sodium valproate gastro resistant 200 mg tab , sodium valproate gastro resistant 500 mg tab , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , tamsulosin hcl tablets 0.4 mg , telmisartan 40mg tab , tenaligliptin tab 20mg , terbinafine hcl 250 mg , terbutaline 2.5 mg tab , theophyllin 400mg prolonged release tab , thiamine 100mg tab , thyroxine 100 mcg tab , thyroxine 50 mcg tab , tinidazol 300mg tab , tinidazol 500mg tab , tizanidine hcl 2 mg tab , torsemide 10 mg tab , tramadol 50mg cap , traxenamic 500 mg + ethamsylate 250 mgtab , traxenamic acid 500 mg + mephenic acid 250 mg tab , traxenamic acid 500mg tab , trifluperazine 5 mg coated tab , trihexyphenidyl hcl tab ip 2 mg , trypsin & chemotrypsin tab , ursodeoxycholic acid tablets 300 mg , verapamil 40mg tab ( film coated ) , vitamin c 500mg + zinc 20mg tab , vitamin d 1 gm sachets ( cholecaciferol granules ) , vitamin e 200mg tab , zinc 20mg tab , zinc sulphate 10mg tab , zolpidem 5mg tab , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , clarithromycin 500mg , deflazacort 6 mg , esomeprazole 40 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , rifaximin 500mg , rosuvastatin 160mg + finofib 10mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , clonidine hydrochloride tablet ip 0.1 mg , finasteride tablets ip 5 mg , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] , rosuvastatin tablet 10 mg [ 757 ] , linezolid tablets ip 600 mg [ 516 ] , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , zinc 50mg , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole 20mg +levosulpiride 75 mg , syrup / ointment list , acyclovir cream 5% , acyclovir oral susp. 400mg / 5ml , albendazole oral suspension ip 400 mg / 10ml , amoxycillin & pot. clavunate oral susp. ( 30ml ) , amoxycillin 125mg / 5ml susp. ( 30ml ) , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , anticold syrup 30 ml ( each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg ) , azithromycine syp 15ml ( 100mg / 5ml ) , beclomethasone + neomycin + clotrimazole cream 10gm , beclomethasone inhalation ip 200 mcg / dose ( 200 metered dose container ) , betamethasone dipropionate cream 0.05% 15 gm , betamethasone lotion ip 0.05 o / o 50ml , betamethasone+ salisilic acid cream 5gm , budesonide inhaler 200 mcg , budesonide nebulizer susp. 0.25mg / ml 2 ml , calamine lotion 100 ml , calcium + vtamin d3 susp. ( 100ml ) , calcium phosphate syp 200 ml , carbamazepine oral susp. 100 ml , cefadroxil syp ( 30ml ) , cefixime oral susp. ( paed drops ) 10 ml , cefpodoxim syp ( 30ml ) , cephalexin susp. ( 30ml ) , cetirizine syrup ip 5mg / 5 ml 30 ml , cetrimide cream 15 gm , chlorhexidine mouthwash 0.2% 50 ml , chloroquine phosphate susp. ( 60ml ) , clindamycin phosphate gel usp 1o / o 20gm , clobetasol propionate cream 0.05% 20gm , clotrimazole 1 o / o w / v mouth paint 15 ml , clotrimazole cream ip 2% w / w 15gm , compound benzoic acid ointment 15 gm , co trimoxazole oral susp. 50 ml , cough syrup ( each 5 ml contains chloropheniramine maleate 3mg, ammonium chloride 130mg, sodium citrate 65mg, methol 0.5 mg ) 50ml , cough / expetotrant ( ambroxol hydrochloride ip 15mg+tebutaline sulphate ip 1.5mg+guaiphenesin ip 50mg+menthol ip 1mg ) 50ml , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , dextromethorphen + bromhexine + cpm + menthol syp 60 ml , diclofenac gel 20 gm ( dicofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3% menthol 5% ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml 30ml , dicylomine hcl + activated dimethicon 10ml drop , disodicum hydrogem citrate 100ml alkylizer syp , domperidon oral drops 10ml , domperidon susp. ( 30ml ) , drop caffeine citrus , formaldehyde solution 450ml , framycetin sulphate cream 1% 30 gm , fusidic acid cream 2% , gamabenzine hexachloride lotion 100ml 1% ( lindane lotion ) , gluteraldehyde solution 2% 5 ltrs can , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 10ml , hand sanitizer 500 ml ( alcoholic rub in hand ) , hydrogen peroxide solution 6% 400ml , ipratropium bromide nebulizer solution 250 mcg / ml , iron and folic acid suspension 100ml , ketoconazole 1% shampo 50ml , ketoconazole cream 2% 15 gm , lactulose solution 100ml , levetiracetam oralsusp. 100 ml , lignocine jelly 2% 30gm , lincomycin syp 60ml , liquid formalin 5ltr. , liquid paraffin 100ml , liquide glycerine 100ml , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60ml , miconazole nitrate cream ip 2% 15gm , multi vitamin drops 15ml , multi vitamin syrup 200 ml , mupirocin ointment 2% 5gm , oflaxacin + ornidazole syp ( 30ml ) , oflaxacin + tinidazole syp 30 ml , oflaxacin oral susp. 30ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oseltamivir phosphate for oral suspension ip 12 mg / ml 75 ml , paracetamol drops paediatric 15 ml , paracetamol syp 125 mg / 5ml 60 ml , permethrin lotion 5% 30ml , phenyl ( black disinfectant fluid ) 5 ltrs can , phenytoin oral susp. 100 ml , potascium chloride oral solution 200ml , povidone iodine ointment 250 gm jar , povidone iodine ointment 5% 15gm , povidone iodine scrub solution 7.5% 500ml , povidone iodine solution 5% 500ml , povidone iodine solution 5%100ml , promethazine 60 ml syp , salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup2mg / 5ml 100 ml , silver sulphadiazine 1% cream ( 500gm jar ) , silver sulphadiazine 1% cream 250gm , silver sulphadiazine cream 10gm , silver sulphadiazine1% cream 50gm , sodium hypochloride solution 5 lt can 10% , sodium hypochloride solution 5 lt can 6% , sodium phosphates enema 100 ml , sodium valprorate oral solution 200 mg / 5ml 100 ml , surgical spirit ip / bp ( 100 ml ) , surgical spirit ip / bp ( 500 ml ) , terbinafine cream 1% w / w 10 gm , tooth gel 50 gm ( sodium monoflurophosphate 0.7% and potassium nitrate 5% , tretenoin cream 0.025% 20gm , vitamine a paediatric oral solution 100ml , vitamine d3 oral solution 60000 iu 5ml , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine 200 ml , drotavarine 60 ml , mefenamice acid 100mg / 5ml , montelucast+levocetrizine 60 ml , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine 60 ml , ondansetron 30 ml , zink 20 mg, 100 ml , lignocain mouth paint 10 ml , cream luliconazole 1% w / w , eye / ear / nasal drops , aciclovir eye ointment 3% 5gm , acyclovireye ointment 5 mg , amikacin eye drop 5 ml , atropin sulphate 1% e / d 10ml , atropine eye ointment 1% 3 gm tube , b.p. blade no. 11 , b.p. blade no. 15 , black gogals , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , buds sticks , carbolic acid 400gm , carboxymethyl celluslose 0.5%e / d 10ml , carboxymethyl celluslose 5ml e / d , chloramphenicol 1% w / w eye ointment 3 gm tube , chloramphenicol eye drops ip 0.5 0 / 0 5ml , cipro + dexa 10ml e / d , ciprofloxacin &dexamethasone 5ml e / d , ciprofloxacin eye drops 0.3 o / o w / v 5ml , ciprofloxacin ophthalmic ointment usp 0.3% 5gm tube , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , cresent blade 2.8mm ( 1 piece rate ) , cyclopentolate eye drop 5 ml , disposal eye pad ( 6cmx8cm ) 01 no , eyebuds ( 100 buds ) , fluconazole 0.3% e / d 5ml , flurbiprofen eye drop 10 ml , flurbiprofen sod. e / d0.03% 5ml , foldable intra ocular lence with injector ( size 18 to 24 no. ) ( sterile hydrophilic acrylic ) , fumigation with silver hydrogen peroxide, grade standard , genta+dexa 10ml eye / ear , gentamycin 10ml e / d , gentamycin 10ml e / d , homatropine 2% e / d , hydroxy propyl methyl cellulose solution ( 2mlglass syringe with cannula ) , hypersol s e / d 10 ml , inj. viscomet ( 3ml ) , iol single piece lence ( size 18 to 24 no. ) standard pama intraocular lenses , keratome blade 3.5mm , ketorolac tromethamine + moxyfloxacine eye drop 5 ml , lidocaine hcl topical solution 4% 30 ml , metal frame with glasses ( spects ) , moxifloxacin + dexamethasone 10ml eye / ear , moxifloxacin + dexamethasone 5ml eye / ear , moxifloxacin 0.5% e / d 5ml , moxifloxocin + prednisolone e / d 5 ml , moxigram e / d 5ml , nasal spray 100mg ( azelistin + nometozone ) 15 ml , nasal spray 100mg ( flutosone ) , neomycin, polymixin b and hydrocortisone ear drops 10 ml , nephazoline & pheniramine eye drop 10 ml , oflax+prednesolon e / d 10 ml , oflaxacin eye / ear 10ml , ofloxa + betamethasone + acetcic acid e / d 10 ml , ofloxa+dexamethasone eye / ear ( 10ml ) , oxymetazolin nasal drop 10ml , phenylephrine hcl 5% e / d 5 ml , pilocarine 2% e / d 5ml , potassium permanganate ( kmno4 ) crystal 20gm , povidone iodine eye drop 10 ml , predinislone e / d 10ml , predinislone e / d 5ml , saline nasal drops 10 ml , suture 10 0 , timolol + pilocarpin e / d 5 ml , timolol 0.5 % e / d 5ml , tobra d eye ointment 3.5 gm , tobramycin e / d 0.3% 5ml , tobramycin ophthalmic ointment usp 0.3% 5gm , tobriamycin + dexamethasone e / d5ml , tobrimycin + dexa e / d10ml , travoprost 0.004% 3 ml , tropicacil e / d ( tropicamide ) 5 ml , tropicacil plus 10ml e / d , tropicacil plus 5ml e / d , trypen blue dye 1ml , wax dissolving ear / drops ( ceruminolytic drops ) 10ml , xylometazoline nasal drops 0.1% 5 ml , chloramphenicol +polymycine 5 gm , chloramphenicol +polymycine + dexamethason 5 gm , carboxymethylcellulose + glycerin 10 ml , gatifloxacin and prednisolone 10 ml , moxifloxacilline+ dyliprednate 5 ml , moxifloxacilline+ prednisone 5 ml , natamycin 5%5 ml , sodium chloride 5%5 ml , tropicamide + phenlyephrine 5 ml , dorzolamide 5 ml , moxifloxacin and prednisolone 5 ml , olaptadine & ketrolac 5 ml , polymyxin b 10000iu / gm + neomycin 3400iu / gm 5 ml , betaxolol eye drops 0.5 o / o5 ml , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin 15 ml , vitamind3 400 iu 15 ml , vitamind3 800 iu 15 ml...
31778068 supply of medicine and surgical items in rmrs chittorgarh tablet injection syrup etc abdominal drain kit all size , aldehydes solution for fogger machine ` , b p instrument non mercury , b.p. bulb , b.p. cuff ( rubber & cloth ) , b.t. set , baby dipper , black googles for catractract operation , blood doner set , blue dye , bp instrument ( mercury ) diamond / pagoda , bp instrument digital ( omron, bpl, infy ) , cannula fixator , cap.aerocort rotacap , cap. indomethacin 25 mg , cap. indomethacin 75 mg sr , cap. multivitamin + minerals + zinc , cap. pantoprazole 40 mg + domperidone 30 mg dsr , cap. progeston 200 mg , cap. progeston 300 mg , cap.rabeprazole 20mg+dom. 10mg , cap.vitamin e 400 mg , cervical color , clotrimazole 1 % talcum , cord clamp , corrugated drain sheet , cotton roll , cream. acyclovir , cream. beclomethasone0.025% + clotrimazole 1% + , cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% , cream. erythromycin + alov vera , cream. fusidic acid + beclometh. dipro. , cream. mometasone furoate , crepe bendage 10 inch , crepe bendage 6 inch , crepe bendage 8 inch , delivary kit , dispo needle24, 26 no. , dispo syringe 10 ml , dispo syringe 2 ml , dispo syringe 20 ml , dispo syringe 3 ml , dispo syringe 5 ml , dispo syringe 50 ml , dispo. e.t tube size 2.5 / 3.0 / 3.5 , disposable ot gown , drop dizestive+ enzyme 30ml , drop hydroxyzime 15ml , drop. lactac enzyme 15 ml , drop. vitamin d 3 30ml , drop.chlolcicolchpherol30ml , drop.fungal distare+ papsine15 ml , drops. chloprheniramine + pcm + phenyleph , drops. dexamethasone + chloramphenicol , drops. dexamethasone + gentamycin , drops. dexamethasone + ofloxacin , drops. gentamicin eye / ear , drops. paracetamol 100 mg , drops. phenylephrine hyd + cpm. maleate , drops. salbutamol+ ambroxol , drops. sulphacetamide eye , drops. tobramycin 0.3 % eye , drops. xylometazoline 0.01% nasal , drops. xylometazoline 0.05% nasal , e.c.g. electrode ( chest lid. ) , eye drop prednisolo 10 ml , f.b.n.c. kit ( strelise iso certifyed ) , fast absorable poliglactin 910 , fetal doppler , flatus tube , foleys cathater no. 12 , foleys cathater no. 14 , foleys cathater no. 16 , foleys cathater no. 18 , gallent blade , gel. cervi prime , gel. clindamycim 1% , gel. diclofenac , gel. lignocaine hydrochloride , gel. piroxicam , gloves all size6.5, 7, 7.5 , h.i.v. kit ( strelise iso certifyed ) , homotropine 2% , hypersol eye drop 10 ml , i.v. canula18 , 20 , 22 , i.v. canula 24, 26 ( romson, medicath, neocath, neocan ) , i.v. set , infant feeding tube all size , ing. amoxiclav 150mg ( amoxiclove ) , ing. ampoxin / megapain 1 gm , ing. ampoxin / megapain 500 mg , ing. ascorbicacid 500 ml , ing. buscogast 2ml , ing. calcium sandoz 10ml , ing. cefrin plus 375 mg , ing. cefrine plus 750 mg , ing. ceftzoxon+tezbactm 281.25mg , ing. ceftzoxon+tezbactm562.50 mg , ing. diclofanic 1ml ( aqua ) , ing. drotavarin 2ml , ing. hucog 5000 iu ( human cronic gonadotrotine 5000 iu , ing. liycomicen 2 ml , ing. mefentermin 10 ml , ing. netilmican 10mg , ing. netilmican 25mg , ing. netilmican 50mg , ing. superspas / nobalspas 2ml , ing. velthamate 2ml , ing. vit .bcomplex2 ml , ing.ampoxin / megapain 250 mg , ing.c amoxiclav 300mg ( amoxiclove ) , ing.cefepime500mg , ing.dilzem 1 ml , ing.liycomicen 1 ml , ing.meropenam 1 gram , ing.montaz250mg , ing.natuzampragestoen 100mg ( 2ml ) , ing.oxytocin 1 mg , inj. acuclav / agclav / mega cv 150 mg , inj. acuclav / agclav / mega cv 300 mg , inj. adrenaline , inj. alamin sn , inj. alpha beta arteether 2 ml , inj. amiadarone , inj. amikacin 100 mg , inj. amikacin 250 mg , inj. amikacin 500 mg , inj. amoxycillin + clavulanate pot. 1.2gm , inj. anti snake venum , inj. anti d , inj. artesunate 60 mgwith soda. bicarb 5 ml combo pack , inj. ascorbic acid 150 mg. , inj. atropine , inj. azithro mycin 500 ml , inj. betamethasone 4 mg , inj. botropase , inj. butrum , inj. butrum , inj. cefoparazone + sulbactum 1.5 gm , inj. ceftazidine 1 gm. , inj. ceftriaxone 1gm , inj. ceftriaxone 1gm. + sulbactum 500 mg , inj. ceftriaxone 1gm. + tazobactum 125 mg , inj. ceftriaxone 2 gm , inj. ceftriaxone 250mg , inj. ceftriaxone 250mg. + sulbactum 125 gm , inj. ceftriaxone 500mg , inj. ceftriaxone 500mg. + sulbactum 500 mg , inj. citicoline 4 ml , inj. clindmicin 2ml , inj. ct contrast , inj. ct contrast , inj. d 10% ( f.f.s. ) , inj. d 5% ( f.f.s. ) , inj. d.n.s. ( f.f.s. ) , inj. daizepam 10mg / 2ml , inj. dexamethasone , inj. diclofenac , inj. diclofenac+dicyclomine , inj. dobutamine , inj. dobutamine 250mg / 5 ml , inj. dopamine 40mg / ml , inj. dopanine , inj. enoxaparin sodium 60mg , inj. envas , inj. erythroptrin 4000 iu , inj. etophylline 84.7mg + theophylline 25.3mg / 2ml , inj. frusemide 10mg / 1ml , inj. gentamicin 80 mg40 mg / 1 ml , inj. glargine , inj. h.insulin , inj. heparin vial , inj. human mixtard30 / 70 , inj. hyalase1500 iu , inj. hydrocoritison 200mg , inj. hydrocortisone 100mg , inj. hydroxyprogesterone 500 mg , inj. isolate p ( f.f.s. ) , inj. l orthinh l asprite , inj. levi taretam , inj. levo sulphride , inj. lignocaine 4% , inj. lignocaine hydrochloride 2% vial , inj. lincomycin 1ml , inj. lincomycin 2 ml , inj. linezolid , inj. livofloxacne , inj. mannitol 20% ( f.f.s. ) , inj. mecobalamin 500 mcg , inj. meg. sulf. ( 50% ) , inj. menadione sodium 1 ml , inj. meropannum 125 mg , inj. metoclopromide , inj. metronidazoleiv ( f.f.s. ) , inj. midazolan , inj. multivitamin 10 ml. vial , inj. multivitamin 2 ml. amp. , inj. n.s. ( f.f.s. ) , inj. naloxone hcl , inj. nandrolone decanoate 25mg , inj. nandrolone decanoate 50mg , inj. nitroglycerine , inj. nor adrenaline , inj. oflaxacin ( f.f.s. ) , inj. ondansetron2 mg / 1ml , inj. ondansetron2 mg / 1ml , inj. ornidazole ( f.f.s. ) , inj. ornidazole iv , inj. oxytocin 5 i.u. / 1 ml , inj. pantoprazole 40 mg , inj. paracetamol 150 mg / 1 ml , inj. pentazocine 30 mg / 1 ml amp. , inj. pheniramine maleate22.7 mg , inj. phenytion , inj. pilocarpinole , inj. piperacillin 4 gm + tazobactum 500 mg , inj. piperacillin / tazobactam 1.125 mg , inj. piracetam , inj. piroxicam 40 mg , inj. promethazine 25 mg / mlamp. , inj. propofol , inj. pyridoxime , inj. pyridoxime , inj. quinine dihydrochloride , inj. rabeprazole 20 mg , inj. rabies vaccine ( human ) ( anti ) , inj. ranitidine , inj. rl. ( f.f.s. ) , inj. soda. bi carb 25 ml , inj. stemetil 1ml / 2ml , inj. streptokinase 15 lakh iu , inj. terliprincine , inj. termin 10ml , inj. tetanus toxoid 250 iu , inj. tirofiban 5mg / 100ml , inj. tramadol hydrochloride , inj. tranexamic acid 500 mg , inj. triamcinolone 40 mg , inj. urokinase 5 lakh iu , inj. vitamin b complex , inj.carbaprost 250 mg. , inj.methargin 2ml , k 90, k 91 cathetor , knife blade 23, 24 no. , liquid o.r.s.packet , lotion. calamine , lotion. gamma benzene hexachloride 1 % , lotion. ketoconazole1 % , lotion. povidone iodine , lotion. povidone iodine , malecot cathetor no. 28, 30, 32 , malt protin +multi vitamin 250 gram , micro i v set , micropore1 inch ( 3 mtr length ) , micropore1 inch ( 3 mtr length ) , micropore2 inch ( 3 mtr length ) , micropore3 inch ( 3 mtr length ) , mop ped , mt fog solution for fogger , mucas extractor , n 95 mask , n.s. 100 ml , n.s. 500 ml ( glass bottle ) , nasal prongs for cpap size 0 & 1 , neb. mask sizeaudlt , nebuliser mask child , nebuliser mask machine , needle cutter ( 1000 ml capacity ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r55 ] , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r56 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) [ r20 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) [ r45 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) [ r46 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) [ r34 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm [ r50 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm [ r40 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm [ r51 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) [ r36 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) [ r48 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) [ r35 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm [ r29 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) [ r32 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) [ r23 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) [ r25 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) [ r53 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) [ r54 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 [ r30 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm [ r39 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm [ r49 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) [ r41 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) [ r31 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) [ r47 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) [ r26 ] , o.t. sheet , o2 nasal canulla , neonatal , paed, adult , oil vitamin ad 60ml , oint. clobetasol 0.05 % + gentamicin 0.1 % , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. heparin / thrombotas , oint. miconazole , oint. povidoneiodine10 gm , oint. silver sulphadiazine , oint. silver sulphadiazine + chlorhexidin , orthopaedic cotton roll 10 cm x 300 cm , oxygen delivery tube with mask , ped. blood doner set , pedia set , pilocarpinole eye drop 10 ml , plaster of paris , powderdexolac 500 gram , powder arginine 5 gram , ppe kit iso certified , proctoclys enema , prolin no. 1 length 70 cms , protein powder , prulin 2 / 0 ( suture ) , pv rubbergloves all size , r.l. 500 ml ( glass bottle ) , res.budecort ( budesunide ) , res.duolin ( levosalbutamol + ipratropium ) , resp. duolin , resp. levosalbutamol , romadrain under water seal bag , round band aid , ryles tube n0. 12, 14, 16, 18 , sachatvitamin d3 , sachet agysee d , sachet powder prebioatic+ lactic acid 1 gram , sanitary pad , sanitizer 100 ml70 % , sanitizer 500 ml70 % , sanitizer alcohal base 70 % , shampoo. ketoconazole 2 % , spinal needle 23 no. ( pricon ) , suction canula size 6 / 8 / 10 / 12 , suction tube for suction machine , sup. azithromycin200mg / 5ml , sup. m.v.+minerals 100ml , sup. potasium cloride 100ml , swine flue vaccine .5 ml , swine flue vaccine 5 ml , syp.pre probiotic 60ml , syp.sod.picosulphate 100 ml , syp. albendazole + ivermectin , syp. amoxycillin + clavulanate , syp. antacid ( mag.hy. + allum.hy. ) , syp. arthmether+lumither 30 ml , syp. bpricilne 100ml , syp. cepodoxim+clavonate 30 ml , syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml , syp. cotrimoxazole , syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg , syp. cyprohepatidine + tricholin citrate , syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg , syp. dextromethorphan 10 mg + phenyl hcl2 mg , syp. disodium hydrogen citrate , syp. ferrous salt + folic acid , syp. haematinic with vitamins , syp. hydroxyzime 100 ml , syp. ibuprofen 100mg + pcm 125 mg + / 5ml , syp. lactulose 10gm / 15 ml , syp. levocetrizine , syp. levocetrizine + montelokast 60ml , syp. liq.paraffin + milk of magnesia , syp. livertonice 200ml , syp. longifene 200ml / buclizine 200ml , syp. lycopin 200ml , syp. magaldrate 480 mg + simeth. 20 mg , syp. mefanic acid 60 ml , syp. mefanic+ peracitamol 60ml , syp. moxclav / mega cv 30 ml , syp. moxclav / mega cv 60 ml , syp. multivitamin+ multiminaral + amino acid200ml , syp. multivitamin+ multiminaral + lycopin 200ml , syp. multvitamin+antioxidant 200ml , syp. ofloxacin + ornidazole , syp. ofloxacin oral , syp. paracetamol 125 mg , syp. paracetamol 250 mg , syp. pcm + cpm + sod. cit. + pph , syp. pcm + promehazine , syp. polybion 100ml , syp. racecortodil+ofloxacin 60ml , syp. roxithromycin 50 mg / 5 ml , syp. salbutamol 2 mg + ambroxol 30 mg , syp. solvin cold / reconite / sinerest 60 ml , syp. sucralfate 1 g / 10 ml , syp. terbutaline sul. + bromh. + guaip. , syp. zinc 60ml , syp.cefuroxime 60ml , syp.digsestiv enzyme 200ml , tab.alprazolam0.25mg , tab.arither and lumethar ( 400mg ) , tab.cabergoline , tab.citicolin 500 mg , tab.l orthinh l asprite , tab.linezolid 600 , tab.linezolid 600mg , tab.n.t.g. sr 2.6 mg , tab.nicoran 5 mg , tab.phenytoin 100 mg , tab.sodium valporal 500 mg , tab.temsulofin0.4mg , tab.thyroxine 100 mg , tab.ursodil 300 mg , tab. aceclo + pcm + serra , tab. acelofenac 100mg , tab. acelofenac 100mg + serratiopeptidase 10mg , tab. acelofenac 100mg + thiocolchicoside 250 mg , tab. acyclovir 400 mg , tab. albendazole 400mg , tab. alprazolam0.25mg + propranolol 20mg , tab. alprazolam0.5mg , tab. amlodipine 2.5mg , tab. amlodipine 5mg + atenolol 50mg , tab. amlodipine besilate5mg , tab. amoxy 250mg + clav. acid 125mg , tab. amoxy 500mg + clavulanate 125 mg , tab. amoxyciline +lactiacid 625mg , tab. atenolol 25mg , tab. atenolol 50mg , tab. atorvastatin80 mg , tab. atorvastatin 10mg , tab. atorvastatin 40mg , tab. azithromycin 100mg dt , tab. azithromycin 250mg , tab. azithromycin 500mg , tab. betahistadin 16 mg , tab. calcium 500mg + vit. d3 , tab. carbamazepine 100mg , tab. carbamazepine 200mg , tab. cefixime 100mg disp. , tab. cefixime 200mg disp. , tab. cefixime 200mg+ clavalunicacid , tab. cefpodoxime proxetil 200 mg , tab. cefuroxime axetil 250mg , tab. cefuroxime axetil 500mg , tab. cetrizine 10 mg ( oval ) , tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg , tab. cinnarizine 20 mg + domperidone 15 mg , tab. cinnarizine 25 mg , tab. clotrimazole vaginal 500mg , tab. diclo + pcm +serra , tab. diclofenic+chymotripcin , tab. dicyclomine 10mg + mefenomic acid 250mg , tab. dicyclomine hci 10mg + pcm 500mg , tab. dothiepin 75 mg. , tab. ethamsylate 500mg , tab. ethamsylate inj. 2ml , tab. etophylline + theophylline , tab. ferobact 200 mg , tab. ferobact 300 mg , tab. ferrous sult + folic acid , tab. fexofenadine 120 mg , tab. fluconazole 150 mg , tab. fluconazole 50 mg , tab. fluoxetine 20 mg , tab. folic acid 5 mg , tab. frusemide 40 mg , tab. glimepiride 1 mg , tab. glimepiride 1 mg + metformin 500 mg , tab. glimepiride 2 mg , tab. glimepiride 2 mg + metformin 500 mg , tab. ibuprofen 100mg + pcm 125 mg , tab. ibuprofen 400mg + pcm 500mg , tab. isosorbide mononitrate 20 mg , tab. itraconzole 100 , tab. itraconzole 200 , tab. levocetrizine 5mg , tab. levofloxacin500mg , tab. lisinopril 5 mg , tab. lithium carbonate 300 mg , tab. loperamide 2 mg , tab. lorazepam 2 mg , tab. losartan 25 mg , tab. losartan patassium 50 mg , tab. losartan pota. 50 mg + amlodipine 5mg , tab. losartan potassium. 50 mg + hydroch.12.5mg , tab. lycopin+multivitamin , tab. mecobalamin 1500 mcg , tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg , tab. mefloc 100mg , tab. metformin 500 mg , tab. metoclopromide 10 mg , tab. napra d ( napraxone + domperidone ) , tab. nimesulide 100 mg , tab. nimesulide 100mg + serratiopeptidase 10mg , tab. normaxin 10 mg , tab. nynes , tab. ofloxacin + ornidazole 500 mg , tab. ofloxacin 200mg , tab. olanzapine 5 mg , tab. ondansetron 4mg , tab. ondansetron 8mg , tab. ornidazole 500mg , tab. pantoprazole 20 mg , tab. pantoprazole 40 mg , tab. pantoprazole 40 mg + domperidone 10 mg , tab. paracetamol 500 mg , tab. pheniramine maleate 25 mg , tab. phenobarbitone 30 mg , tab. phenobarbitone 60 mg , tab. pioglitazone 15 mg , tab. pioglitazone 30 mg , tab. piracetam 800 mg , tab. piroxicam disp. 20 mg , tab. prazosin 1 mg , tab. prazosin 2.5 mg , tab. prazosin 5 mg , tab. prednisolone 10 mg , tab. primaquine phosphate 15 mg , tab. primaquine phosphate 7.5 mg , tab. prochlorperazine 5 mg , tab. promethazine 25 mg , tab. quinine sulphate 300 mg , tab. rabeprazole 20 mg , tab. rabeprazole 20 mg + domperidone 10 mg , tab. rabiprazole + itopride , tab. ramipril 10 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. ranitidine 150 mg + domperidone 10 mg , tab. risperidone 2 mg , tab. sertaline 25 mg , tab. sertaline 50 mg , tab. sildenafil 50 mg , tab. spiromicyn500mg , tab. superspas / nobalspas , tab. tramadol hyd. 20 mg + pcm. 500 mg , tab. tranexamic+etamcylate , tab. tranexamic+mefanic acid , tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg , tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg , tab. trypsin chymotrypsin , tab. ursodeoxycholic 150 mg , tab. ursodeoxycholic 300 mg , tab. vitamin c 500 +zinc 50 mg , tab. vitamin c 500 mg ( ascorbic acid ) , tab. zinc 20 mg , tab. zinc 50 mg , tab. zolpidem 10 mg , tab. / cap. multivitamin+ multiminaral + lycopin , tab.cefpodoxime 200mg+ clavalunicacid , tab.clarithromycin 250 mg , tab.clonazepam 0.5mg , tab.clopidogrel 75 mg , tab.clopidogrel 75 mg+ aspirin 75mg , tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) , tab.diazepam 5 mg , tab.diclo + trypsin +chymotrypsin , tab.diclofenac 50mg + serratiopeptidase 10mg , tab.etori coxib 120mg+ gabapentin300mg , tab.etori coxib 90mg+ gabapentin100mg , tab.iver mactin 12 mg , tab.iver mactin 6 mg , tab.pregabaline75 mg +methylcobaline 1500mg , tab.rabiprazole+domperidon d , tab.zinc 10mg , triple layer mask with nose pin , tropicayl plus eye drop 10 ml , urine collection beg , venoline set200 cm , vicryl 1 no.1 / 2 cir rb 30 / 40mm needle 70 cm, , vypro mesh , weight machine ( digital ) , weight machine ( manual ) , weight machine for paediatric / neonatal ( digital ) ...
31760543 srno01 supply of medicine and surjical items in govt hospital chittorgarh , supply of medicine and surjiclail tems , abdominal drain kit all size , aldehydes solution for fogger machine ` , b p instrument non mercury , b.p. bulb , b.p. cuff ( rubber & cloth ) , b.t. set , baby dipper , black googles for catractract operation , blood doner set , blue dye , bp instrument ( mercury ) diamond / pagoda , bp instrument digital ( omron, bpl, infy ) , cannula fixator , cap.aerocort rotacap , cap. indomethacin 25 mg , cap. indomethacin 75 mg sr , cap. multivitamin + minerals + zinc , cap. pantoprazole 40 mg + domperidone 30 mg dsr , cap. progeston 200 mg , cap. progeston 300 mg , cap.rabeprazole 20mg+dom. 10mg , cap.vitamin e 400 mg , cervical color , clotrimazole 1 % talcum , cord clamp , corrugated drain sheet , cotton roll , cream. acyclovir , cream. beclomethasone0.025% + clotrimazole 1% + , cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% , cream. erythromycin + alov vera , cream. fusidic acid + beclometh. dipro. , cream. mometasone furoate , crepe bendage 10 inch , crepe bendage 6 inch , crepe bendage 8 inch , delivary kit , dispo needle24, 26 no. , dispo syringe 10 ml , dispo syringe 2 ml , dispo syringe 20 ml , dispo syringe 3 ml , dispo syringe 5 ml , dispo syringe 50 ml , dispo. e.t tube size 2.5 / 3.0 / 3.5 , disposable ot gown , drop dizestive+ enzyme 30ml , drop hydroxyzime 15ml , drop. lactac enzyme 15 ml , drop. vitamin d 3 30ml , drop.chlolcicolchpherol30ml , drop.fungal distare+ papsine15 ml , drops. chloprheniramine + pcm + phenyleph , drops. dexamethasone + chloramphenicol , drops. dexamethasone + gentamycin , drops. dexamethasone + ofloxacin , drops. gentamicin eye / ear , drops. paracetamol 100 mg , drops. phenylephrine hyd + cpm. maleate , drops. salbutamol+ ambroxol , drops. sulphacetamide eye , drops. tobramycin 0.3 % eye , drops. xylometazoline 0.01% nasal , drops. xylometazoline 0.05% nasal , e.c.g. electrode ( chest lid. ) , eye drop prednisolo 10 ml , f.b.n.c. kit ( strelise iso certifyed ) , fast absorable poliglactin 910 , fetal doppler , flatus tube , foleys cathater no. 12 , foleys cathater no. 14 , foleys cathater no. 16 , foleys cathater no. 18 , gallent blade , gel. cervi prime , gel. clindamycim 1% , gel. diclofenac , gel. lignocaine hydrochloride , gel. piroxicam , gloves all size6.5, 7, 7.5 , h.i.v. kit ( strelise iso certifyed ) , homotropine 2% , hypersol eye drop 10 ml , i.v. canula18 , 20 , 22 , i.v. canula 24, 26 ( romson, medicath, neocath, neocan ) , i.v. set , infant feeding tube all size , ing. amoxiclav 150mg ( amoxiclove ) , ing. ampoxin / megapain 1 gm , ing. ampoxin / megapain 500 mg , ing. ascorbicacid 500 ml , ing. buscogast 2ml , ing. calcium sandoz 10ml , ing. cefrin plus 375 mg , ing. cefrine plus 750 mg , ing. ceftzoxon+tezbactm 281.25mg , ing. ceftzoxon+tezbactm562.50 mg , ing. diclofanic 1ml ( aqua ) , ing. drotavarin 2ml , ing. hucog 5000 iu ( human cronic gonadotrotine 5000 iu , ing. liycomicen 2 ml , ing. mefentermin 10 ml , ing. netilmican 10mg , ing. netilmican 25mg , ing. netilmican 50mg , ing. superspas / nobalspas 2ml , ing. velthamate 2ml , ing. vit .bcomplex2 ml , ing.ampoxin / megapain 250 mg , ing.c amoxiclav 300mg ( amoxiclove ) , ing.cefepime500mg , ing.dilzem 1 ml , ing.liycomicen 1 ml , ing.meropenam 1 gram , ing.montaz250mg , ing.natuzampragestoen 100mg ( 2ml ) , ing.oxytocin 1 mg , inj. acuclav / agclav / mega cv 150 mg , inj. acuclav / agclav / mega cv 300 mg , inj. adrenaline , inj. alamin sn , inj. alpha beta arteether 2 ml , inj. amiadarone , inj. amikacin 100 mg , inj. amikacin 250 mg , inj. amikacin 500 mg , inj. amoxycillin + clavulanate pot. 1.2gm , inj. anti snake venum , inj. anti d , inj. artesunate 60 mgwith soda. bicarb 5 ml combo pack , inj. ascorbic acid 150 mg. , inj. atropine , inj. azithro mycin 500 ml , inj. betamethasone 4 mg , inj. botropase , inj. butrum , inj. butrum , inj. cefoparazone + sulbactum 1.5 gm , inj. ceftazidine 1 gm. , inj. ceftriaxone 1gm , inj. ceftriaxone 1gm. + sulbactum 500 mg , inj. ceftriaxone 1gm. + tazobactum 125 mg , inj. ceftriaxone 2 gm , inj. ceftriaxone 250mg , inj. ceftriaxone 250mg. + sulbactum 125 gm , inj. ceftriaxone 500mg , inj. ceftriaxone 500mg. + sulbactum 500 mg , inj. citicoline 4 ml , inj. clindmicin 2ml , inj. ct contrast , inj. ct contrast , inj. d 10% ( f.f.s. ) , inj. d 5% ( f.f.s. ) , inj. d.n.s. ( f.f.s. ) , inj. daizepam 10mg / 2ml , inj. dexamethasone , inj. diclofenac , inj. diclofenac+dicyclomine , inj. dobutamine , inj. dobutamine 250mg / 5 ml , inj. dopamine 40mg / ml , inj. dopanine , inj. enoxaparin sodium 60mg , inj. envas , inj. erythroptrin 4000 iu , inj. etophylline 84.7mg + theophylline 25.3mg / 2ml , inj. frusemide 10mg / 1ml , inj. gentamicin 80 mg40 mg / 1 ml , inj. glargine , inj. h.insulin , inj. heparin vial , inj. human mixtard30 / 70 , inj. hyalase1500 iu , inj. hydrocoritison 200mg , inj. hydrocortisone 100mg , inj. hydroxyprogesterone 500 mg , inj. isolate p ( f.f.s. ) , inj. l orthinh l asprite , inj. levi taretam , inj. levo sulphride , inj. lignocaine 4% , inj. lignocaine hydrochloride 2% vial , inj. lincomycin 1ml , inj. lincomycin 2 ml , inj. linezolid , inj. livofloxacne , inj. mannitol 20% ( f.f.s. ) , inj. mecobalamin 500 mcg , inj. meg. sulf. ( 50% ) , inj. menadione sodium 1 ml , inj. meropannum 125 mg , inj. metoclopromide , inj. metronidazoleiv ( f.f.s. ) , inj. midazolan , inj. multivitamin 10 ml. vial , inj. multivitamin 2 ml. amp. , inj. n.s. ( f.f.s. ) , inj. naloxone hcl , inj. nandrolone decanoate 25mg , inj. nandrolone decanoate 50mg , inj. nitroglycerine , inj. nor adrenaline , inj. oflaxacin ( f.f.s. ) , inj. ondansetron2 mg / 1ml , inj. ondansetron2 mg / 1ml , inj. ornidazole ( f.f.s. ) , inj. ornidazole iv , inj. oxytocin 5 i.u. / 1 ml , inj. pantoprazole 40 mg , inj. paracetamol 150 mg / 1 ml , inj. pentazocine 30 mg / 1 ml amp. , inj. pheniramine maleate22.7 mg , inj. phenytion , inj. pilocarpinole , inj. piperacillin 4 gm + tazobactum 500 mg , inj. piperacillin / tazobactam 1.125 mg , inj. piracetam , inj. piroxicam 40 mg , inj. promethazine 25 mg / mlamp. , inj. propofol , inj. pyridoxime , inj. pyridoxime , inj. quinine dihydrochloride , inj. rabeprazole 20 mg , inj. rabies vaccine ( human ) ( anti ) , inj. ranitidine , inj. rl. ( f.f.s. ) , inj. soda. bi carb 25 ml , inj. stemetil 1ml / 2ml , inj. streptokinase 15 lakh iu , inj. terliprincine , inj. termin 10ml , inj. tetanus toxoid 250 iu , inj. tirofiban 5mg / 100ml , inj. tramadol hydrochloride , inj. tranexamic acid 500 mg , inj. triamcinolone 40 mg , inj. urokinase 5 lakh iu , inj. vitamin b complex , inj.carbaprost 250 mg. , inj.methargin 2ml , k 90, k 91 cathetor , knife blade 23, 24 no. , liquid o.r.s.packet , lotion. calamine , lotion. gamma benzene hexachloride 1 % , lotion. ketoconazole1 % , lotion. povidone iodine , lotion. povidone iodine , malecot cathetor no. 28, 30, 32 , malt protin +multi vitamin 250 gram , micro i v set , micropore1 inch ( 3 mtr length ) , micropore1 inch ( 3 mtr length ) , micropore2 inch ( 3 mtr length ) , micropore3 inch ( 3 mtr length ) , mop ped , mt fog solution for fogger , mucas extractor , n 95 mask , n.s. 100 ml , n.s. 500 ml ( glass bottle ) , nasal prongs for cpap size 0 & 1 , neb. mask sizeaudlt , nebuliser mask child , nebuliser mask machine , needle cutter ( 1000 ml capacity ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r55 ] , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r56 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) [ r20 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) [ r45 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) [ r46 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) [ r34 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm [ r50 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm [ r40 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm [ r51 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) [ r36 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) [ r48 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) [ r35 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm [ r29 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) [ r32 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) [ r23 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) [ r25 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) [ r53 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) [ r54 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 [ r30 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm [ r39 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm [ r49 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) [ r41 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) [ r31 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) [ r47 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) [ r26 ] , o.t. sheet , o2 nasal canulla , neonatal , paed, adult , oil vitamin ad 60ml , oint. clobetasol 0.05 % + gentamicin 0.1 % , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. heparin / thrombotas , oint. miconazole , oint. povidoneiodine10 gm , oint. silver sulphadiazine , oint. silver sulphadiazine + chlorhexidin , orthopaedic cotton roll 10 cm x 300 cm , oxygen delivery tube with mask , ped. blood doner set , pedia set , pilocarpinole eye drop 10 ml , plaster of paris , powderdexolac 500 gram , powder arginine 5 gram , ppe kit iso certified , proctoclys enema , prolin no. 1 length 70 cms , protein powder , prulin 2 / 0 ( suture ) , pv rubbergloves all size , r.l. 500 ml ( glass bottle ) , res.budecort ( budesunide ) , res.duolin ( levosalbutamol + ipratropium ) , resp. duolin , resp. levosalbutamol , romadrain under water seal bag , round band aid , ryles tube n0. 12, 14, 16, 18 , sachatvitamin d3 , sachet agysee d , sachet powder prebioatic+ lactic acid 1 gram , sanitary pad , sanitizer 100 ml70 % , sanitizer 500 ml70 % , sanitizer alcohal base 70 % , shampoo. ketoconazole 2 % , spinal needle 23 no. ( pricon ) , suction canula size 6 / 8 / 10 / 12 , suction tube for suction machine , sup. azithromycin200mg / 5ml , sup. m.v.+minerals 100ml , sup. potasium cloride 100ml , swine flue vaccine .5 ml , swine flue vaccine 5 ml , syp.pre probiotic 60ml , syp.sod.picosulphate 100 ml , syp. albendazole + ivermectin , syp. amoxycillin + clavulanate , syp. antacid ( mag.hy. + allum.hy. ) , syp. arthmether+lumither 30 ml , syp. bpricilne 100ml , syp. cepodoxim+clavonate 30 ml , syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml , syp. cotrimoxazole , syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg , syp. cyprohepatidine + tricholin citrate , syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg , syp. dextromethorphan 10 mg + phenyl hcl2 mg , syp. disodium hydrogen citrate , syp. ferrous salt + folic acid , syp. haematinic with vitamins , syp. hydroxyzime 100 ml , syp. ibuprofen 100mg + pcm 125 mg + / 5ml , syp. lactulose 10gm / 15 ml , syp. levocetrizine , syp. levocetrizine + montelokast 60ml , syp. liq.paraffin + milk of magnesia , syp. livertonice 200ml , syp. longifene 200ml / buclizine 200ml , syp. lycopin 200ml , syp. magaldrate 480 mg + simeth. 20 mg , syp. mefanic acid 60 ml , syp. mefanic+ peracitamol 60ml , syp. moxclav / mega cv 30 ml , syp. moxclav / mega cv 60 ml , syp. multivitamin+ multiminaral + amino acid200ml , syp. multivitamin+ multiminaral + lycopin 200ml , syp. multvitamin+antioxidant 200ml , syp. ofloxacin + ornidazole , syp. ofloxacin oral , syp. paracetamol 125 mg , syp. paracetamol 250 mg , syp. pcm + cpm + sod. cit. + pph , syp. pcm + promehazine , syp. polybion 100ml , syp. racecortodil+ofloxacin 60ml , syp. roxithromycin 50 mg / 5 ml , syp. salbutamol 2 mg + ambroxol 30 mg , syp. solvin cold / reconite / sinerest 60 ml , syp. sucralfate 1 g / 10 ml , syp. terbutaline sul. + bromh. + guaip. , syp. zinc 60ml , syp.cefuroxime 60ml , syp.digsestiv enzyme 200ml , tab.alprazolam0.25mg , tab.arither and lumethar ( 400mg ) , tab.cabergoline , tab.citicolin 500 mg , tab.l orthinh l asprite , tab.linezolid 600 , tab.linezolid 600mg , tab.n.t.g. sr 2.6 mg , tab.nicoran 5 mg , tab.phenytoin 100 mg , tab.sodium valporal 500 mg , tab.temsulofin0.4mg , tab.thyroxine 100 mg , tab.ursodil 300 mg , tab. aceclo + pcm + serra , tab. acelofenac 100mg , tab. acelofenac 100mg + serratiopeptidase 10mg , tab. acelofenac 100mg + thiocolchicoside 250 mg , tab. acyclovir 400 mg , tab. albendazole 400mg , tab. alprazolam0.25mg + propranolol 20mg , tab. alprazolam0.5mg , tab. amlodipine 2.5mg , tab. amlodipine 5mg + atenolol 50mg , tab. amlodipine besilate5mg , tab. amoxy 250mg + clav. acid 125mg , tab. amoxy 500mg + clavulanate 125 mg , tab. amoxyciline +lactiacid 625mg , tab. atenolol 25mg , tab. atenolol 50mg , tab. atorvastatin80 mg , tab. atorvastatin 10mg , tab. atorvastatin 40mg , tab. azithromycin 100mg dt , tab. azithromycin 250mg , tab. azithromycin 500mg , tab. betahistadin 16 mg , tab. calcium 500mg + vit. d3 , tab. carbamazepine 100mg , tab. carbamazepine 200mg , tab. cefixime 100mg disp. , tab. cefixime 200mg disp. , tab. cefixime 200mg+ clavalunicacid , tab. cefpodoxime proxetil 200 mg , tab. cefuroxime axetil 250mg , tab. cefuroxime axetil 500mg , tab. cetrizine 10 mg ( oval ) , tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg , tab. cinnarizine 20 mg + domperidone 15 mg , tab. cinnarizine 25 mg , tab. clotrimazole vaginal 500mg , tab. diclo + pcm +serra , tab. diclofenic+chymotripcin , tab. dicyclomine 10mg + mefenomic acid 250mg , tab. dicyclomine hci 10mg + pcm 500mg , tab. dothiepin 75 mg. , tab. ethamsylate 500mg , tab. ethamsylate inj. 2ml , tab. etophylline + theophylline , tab. ferobact 200 mg , tab. ferobact 300 mg , tab. ferrous sult + folic acid , tab. fexofenadine 120 mg , tab. fluconazole 150 mg , tab. fluconazole 50 mg , tab. fluoxetine 20 mg , tab. folic acid 5 mg , tab. frusemide 40 mg , tab. glimepiride 1 mg , tab. glimepiride 1 mg + metformin 500 mg , tab. glimepiride 2 mg , tab. glimepiride 2 mg + metformin 500 mg , tab. ibuprofen 100mg + pcm 125 mg , tab. ibuprofen 400mg + pcm 500mg , tab. isosorbide mononitrate 20 mg , tab. itraconzole 100 , tab. itraconzole 200 , tab. levocetrizine 5mg , tab. levofloxacin500mg , tab. lisinopril 5 mg , tab. lithium carbonate 300 mg , tab. loperamide 2 mg , tab. lorazepam 2 mg , tab. losartan 25 mg , tab. losartan patassium 50 mg , tab. losartan pota. 50 mg + amlodipine 5mg , tab. losartan potassium. 50 mg + hydroch.12.5mg , tab. lycopin+multivitamin , tab. mecobalamin 1500 mcg , tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg , tab. mefloc 100mg , tab. metformin 500 mg , tab. metoclopromide 10 mg , tab. napra d ( napraxone + domperidone ) , tab. nimesulide 100 mg , tab. nimesulide 100mg + serratiopeptidase 10mg , tab. normaxin 10 mg , tab. nynes , tab. ofloxacin + ornidazole 500 mg , tab. ofloxacin 200mg , tab. olanzapine 5 mg , tab. ondansetron 4mg , tab. ondansetron 8mg , tab. ornidazole 500mg , tab. pantoprazole 20 mg , tab. pantoprazole 40 mg , tab. pantoprazole 40 mg + domperidone 10 mg , tab. paracetamol 500 mg , tab. pheniramine maleate 25 mg , tab. phenobarbitone 30 mg , tab. phenobarbitone 60 mg , tab. pioglitazone 15 mg , tab. pioglitazone 30 mg , tab. piracetam 800 mg , tab. piroxicam disp. 20 mg , tab. prazosin 1 mg , tab. prazosin 2.5 mg , tab. prazosin 5 mg , tab. prednisolone 10 mg , tab. primaquine phosphate 15 mg , tab. primaquine phosphate 7.5 mg , tab. prochlorperazine 5 mg , tab. promethazine 25 mg , tab. quinine sulphate 300 mg , tab. rabeprazole 20 mg , tab. rabeprazole 20 mg + domperidone 10 mg , tab. rabiprazole + itopride , tab. ramipril 10 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. ranitidine 150 mg + domperidone 10 mg , tab. risperidone 2 mg , tab. sertaline 25 mg , tab. sertaline 50 mg , tab. sildenafil 50 mg , tab. spiromicyn500mg , tab. superspas / nobalspas , tab. tramadol hyd. 20 mg + pcm. 500 mg , tab. tranexamic+etamcylate , tab. tranexamic+mefanic acid , tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg , tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg , tab. trypsin chymotrypsin , tab. ursodeoxycholic 150 mg , tab. ursodeoxycholic 300 mg , tab. vitamin c 500 +zinc 50 mg , tab. vitamin c 500 mg ( ascorbic acid ) , tab. zinc 20 mg , tab. zinc 50 mg , tab. zolpidem 10 mg , tab. / cap. multivitamin+ multiminaral + lycopin , tab.cefpodoxime 200mg+ clavalunicacid , tab.clarithromycin 250 mg , tab.clonazepam 0.5mg , tab.clopidogrel 75 mg , tab.clopidogrel 75 mg+ aspirin 75mg , tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) , tab.diazepam 5 mg , tab.diclo + trypsin +chymotrypsin , tab.diclofenac 50mg + serratiopeptidase 10mg , tab.etori coxib 120mg+ gabapentin300mg , tab.etori coxib 90mg+ gabapentin100mg , tab.iver mactin 12 mg , tab.iver mactin 6 mg , tab.pregabaline75 mg +methylcobaline 1500mg , tab.rabiprazole+domperidon d , tab.zinc 10mg , triple layer mask with nose pin , tropicayl plus eye drop 10 ml , urine collection beg , venoline set200 cm , vicryl 1 no.1 / 2 cir rb 30 / 40mm needle 70 cm, , vypro mesh , weight machine ( digital ) , weight machine ( manual ) , weight machine for paediatric / neonatal ( digital ) ...
31583020 chemicals reagents consumable items for department of microbiologywork list of annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology sl. no. item description 1 electrical items : 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 alberts stain 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbc (igm & igg) total test 13 anti hbe elisa test kit 14 hbeag elisa kit 15 anti hbs antibody elisa kit 16 hbs ag elisa kit 17 cytomegalovirus (cmv) igg elisa kit 18 cytomegalovirus (cmv) igm elisa kit 19 dengue ns1 antigen elisa kit 20 hav igm elisa kit 21 hcv igm elisa kit 22 hev igm elisa kit 23 ds dna elisa kit 24 ana elisa kit 25 herpes simplex virus (hsv 1 & 2) igg elisa kit 26 herpes simplex virus (hsv 1 & 2) igm elisa kit 27 rubella igg elisa kit 28 rubella igm elisa kit 29 toxoplasma igg elisa kit 30 scrb typhus igm ag elisa kit 31 toxoplasma igm elisa kit 32 biodegradable plasic bags (yellow, red, blue, black) 33 bleaching powder 34 blood agar base 35 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 36 brain heart infusion broth 37 cled media 38 conc. h2so4 39 corn meal agar 40 cover slips 22 x 22 mm 41 crp test kit 42 deionized water 43 dengue rapid test card along with ns1 antigen 44 deoxycholate citrate agar 45 di sodium hydrogen phosphate 46 discarding plastic buckets (yellow, red, blue, black) 20 litre 47 disposable individually packed centrifuge tube conical bottom capacity 50 ml 48 disposable polythene gloves 49 disposable sterile test tube with swab individually packed 50 dubos medium 51 ecoshield 52 edta powder 53 face mask 54 ferric chloride 55 filter paper box whartman no. 1, 12.5 cm circular 56 filter paper sheet whartman no. 1 57 fluid thioglycollate broth (anaerobic) with indicator 58 formalin pellets 59 glass marking pencils (red, white) 60 glass test tube 100 mm x 12 mm without rim 61 glass test tube 75 mm x 12 mm without rim 62 h2o2 (30%) 63 koh pellets 64 kovcks indole reagents 65 l arginine 66 l lysine mono dihydrochloride 67 lactophenol cotton blue solution 68 liquid paraffin 69 loeffler serum medium base bovine serum 70 lowenstein jensen medium 71 macconkey agar 72 macconkey broth 73 maltose 74 mannitol 75 mannitol salt agar 76 mccartney bottle 77 methyl red powder 78 microcentrifuge tube with cap capacity 2 ml 79 mr vp medium (glucose phosphate broth) 80 muller hinton agar 81 n acetyl l cysteine 82 n naphthyl ethylene diamine dihydrochloride 83 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 84 nigrosin 10% 85 nutrient agar 86 oxidase disc 87 peptone water 88 perforated bucket (red, blue) 15 litre double bin 89 petridish glass 90 mm 90 petridish glass 75 mm 91 ph indicator strips 6.5 to 9 ph measurement 92 phenol 93 pottasium dihydrogen phosphate 94 pregnancy test card 95 ra factor kit 96 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 97 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 98 robertson cooked meat medium readymade 99 vdrl rapid test card 100 sabraud’s dextrose agar 101 selenite f broth bacteriological 102 sim agar 103 simmons citrate agar 104 sodium chloride 105 sodium hydroxide pellets 106 sodium hypochlorite solution 107 sterile autoclavable skirted plate 96 wells x 0.3 ml 108 sterile readymade plates of blood agar (90 mm size) 109 sterile readymade plates of macconkey agar (90 mm size) 110 sterile readymade plates of nutrient agar (90 mm size) 111 sterile storage vial 2 ml capacity 112 sterile storage vial 5 ml capacity 113 sterile transport medium (stuart medium) with test tube and swab individually packed 114 stool container with spoon 115 sulphanilamide 116 tcbs 117 triple layer mask 118 trypticase soya broth 119 tsi agar 120 urea agar base 121 viral transport medium 122 widal slide test 123 wilson and blair medium 124 xylene 125 xylose 126 resazurin powder 127 sterile readymade plates of dca (90mm size) 128 sterile readymade plates of tcbs (90mm ) 129 vancomycin powder 130 vencomycin disc 131 amikacin 30 µg 132 amoxycillin 30 µg 133 amoxyclav 20/10 µg 134 amphotericin b 135 ampicillin + sulbactum 136 azithromycin 15 µg 137 aztreonam 30µg 138 bacitracin (0.04 unit) 139 bile esculin disc 140 cefepime 30 µg 141 cefixime 5 µg 142 cefoperazone + sulbactum 75/10 µg 143 cefoperazone 75 µg 144 cefotaxime 30 µg 145 cefotetan 146 cefoxitin 30 µg 147 cefpirome 148 cefpodoxime 10 µg 149 ceftazidime + clavulanic acid 30/10µg 150 ceftazidime 30 µg 151 ceftriaxone 30 µg 152 cefuroxime 30 µg 153 cephalexin 30 µg 154 chloramphenicol 30 µg 155 ciprofloxacin 5 µg 156 clarithromycin 15 µg 157 clindamycin 2 µg 158 clotrimazole 159 colistin 160 cotrimoxazole 25 µg 161 cyclopirox 50 µg 162 dalfopristine 163 daptomycin 164 doripenam 10µg 165 doxycycline 30 µg 166 e strip for esbl detection 167 e strip for mbl detection 168 e strip oxacillin 169 ertapenam 10µg 170 erythromycin 10 µg 171 faropenam 172 fluconazole 25 µg 173 fosfomycin 200 µg 174 furazolidone 50 µg 175 fusidic acid 176 gentamicin 120µg 177 gentamicin 30µg 178 gentamycin 10 µg 179 griseofulvin 10 µg 180 hippurate 181 imipenam 10 µg 182 itraconazole 8 µg 183 kanamycin 184 ketoconazole 15 µg 185 levofloxacin 5µg 186 lincomycin 10 µg 187 linezolid 30 µg 188 meropenam 10 µg 189 miconazole 10 µg 190 moxalactum 191 nalidixic acid 30µg 192 netilmycin 30 µg 193 nitrofurantoin 300 µg 194 norfloxacin 10 µg 195 novobiocin 196 nystatin 197 ofloxacin 5 µg 198 onpg 199 optochin 200 oxacillin 1 µg 201 piperacillin + tazobactum 100/10 µg 202 piperacillin 100 µg 203 polymyxin b 30 units 204 pristinomycin 15µg 205 quinopristin 206 teicoplanin 30 µg 207 terbinafine 1 µg 208 tetracycline 30 µg 209 ticarcillin+clavulanic acid 75/10 µg 210 ticarcillin75µg 211 tigecyclin 15µg 212 tobramycin 10 µg 213 v factor 214 vancomycin 30 µg 215 voriconazole 1 µg 216 x + v factor 217 x factor 218 immersion oil 219 (occuet blood in stool ) kit hemoccult sensa aninophezone test 220 grams stain kit 221 hcv igmrapid card 222 sterile urine container single pack 223 culture loop (nicrome)1mm 24 gauge wire loop 224 culture loop (nicrome) 2mm24 gauge wire loop 225 cotton roll 226 disposable petri disc 90 mm 227 sterile disposable swab sticks with test tube 228 sterile disposable cotton swab (individual pack) 229 hbsag rapid test card 230 aluminium foil (72 meter) 231 rpr test kit 232 vaccutainer vial 4.5ml (serum activator without gel) 233 disposable plain tube 5ml (without cap) plastic 234 disposable plain tube 8ml (without cap) plastic 235 test tube stand 96 hole plastic 236 urea solu 40% 237 glass test tube 10ml 238 glass test tube 20 ml 239 aslo test kit 240 phenyl alanin agar 241 sulphide indole motility test (sim motility medium) 242 test tube holder bighole for 20ml test tube 243 disposable test tube 20ml ...
30259092 chemicals reagents consumable items for department of microbiology chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , dengu igm elisa kit , chikungunya igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , lugols iodine solution , plastic scurbber , test tube washing brush , disposable test tube 20ml...
30106420 purchase of drug and medicine purchase of drug and medicine , drug and medicine purchase , acyclovir 250mg / 5ml injection ( 10ml ) , acyclovir 500mg / 10ml injection ( 10ml ) , adrenaline injection 1 mg / ml ( 1 ml amp ) , amikacin 100 mg injection 2ml vial , amikacin 250 mg inj 2ml vial , amikacin 500 mg injection 2ml vial , aminophylline 25 mg / ml injection 10 ml amp , amino caproic acid 5gm / 20ml , amiodarone 150mg / 3ml injection ( 3ml ) , amoxicillin and clavulanic acid 1.2gm injection with diluent , amoxicillin and clavulanic acid 150mg injection ( 5ml ) with diluent , amoxicillin and clavulanic acid 600mg injection with diluent , ampicillin 125mg with diluent ( 5ml ) , ampicillin 250mg with diluent ( 5ml ) , ampicillin 500 mg injection with diluent ( 5ml ) , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , arteether ( ? ? ) 150mg / 2ml injection ( 2ml ) , artisunate 60 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml , artisunate 120 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml , atracurium besilate 10 mg / ml injection ( 2.5ml ) , atracurium besilate 10 mg / ml injection ( 10ml ) , atropine sulphate 0.6 mg / ml injection ( 1 ml amp ) , atropine sulphate 100 ml injection ( 100ml ) , adenosine 3mg / ml 2ml injection , acetylcystine 200mg / ml injection 2ml , azetronam 500mg ( 10ml ) , azetronam 1000mg ( 20ml ) , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , betamethasone sodium phosphate 4 mg / ml injection ( 1 ml vial ) , biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin & 70% isophane insulin ) 40 iu / ml ( 10 ml vial ) , botrophage injection ( haemocagulase enzyme ) ( 1ml ) , bupivacaine hydrochloride in dextrose 5mg+80mg per ml ( 4 ml amp ) , bupivacaine injection 0.25% ( 20 ml vial ) , bupivacaine injection 0.5% ( 20ml vial ) , bleomycin 15mg injection , butrophanol tartrate 1mg / ml injection ( 1ml ) , butrophanol tartrate 2mg / ml injection ( 1ml ) , bupernorphine transdermal patch 5mcg / hr , bupernorphine injection , bendamustine injection 100 mg , bevacizumab injection 100 mg , bevacizumab injection 400 mg , bortezomib injection 2mg , calcium gluconate 10% injection ( 10 ml amp ) , carboplatin 450mg / 45ml injection , carboprost tromethamine 250 mcg / ml injection ( 1ml ) , cefepime 500 mg injection with diluent , cefoperazone and sulbactum 1 g + 0.5 g injection with diluent , cefotaxime 1 gm injection +dw ( 30ml ) , cefotaxime 250 mg injection with diluent , cefotaxime with sulbactum ( 250+125 ) mginjection with diluent , ceftazidime 1 gm injection with diluent , ceftazidime 250 mg injection with diluent , ceftazidime 500 mg injection with diluent , ceftriaxone 1 gm injection ( vial ) with dw , ceftriaxone 1 gm with tazobactum 125 mg injection with diluent , ceftriaxone 125 mg injection ( vial ) with dw , ceftriaxone 2 gm with tazobactum 250mg injection with diluent , ceftriaxone 250 mg injection ( vial ) with dw , ceftriaxone 500 mg injection ( vial ) with dw , ceftriaxone with sulbactam 1.5 gm injection with diluent , ceftriaxone with sulbactam 375 gm injection with diluent , cefuroxime250 mg with dw injection , cefuroxime 750 mg with dw injection , cefuroxime 1500 mg with dw injection , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , ciprofloxacin 200mg / 100ml injection ( 100 ml bottle ) , cloxacillin sodium 500 mg injection with diluent , compound sodium lactate 500 ml injection ( 500 ml glass bottle ) , compound sodium lactate injection ( pp bottle ) ( 500ml bottle ) , compound sodium lactate injection ( pp bottle ) 1000ml , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cisplatin 50mg / 50ml injection , cyclophosphamide 200mg injection , cyclophosphamide 500mg injection , cytarabine 500mg injection , caffein citrate 2ml injection , caffein citrate 1ml injection , clarithromycin infusion 500ml injection , chlorpromazine 25mg / ml injection , clindamycin phosphate 150mg / ml injection ( 4ml ) , camylofin hcl 25mg / ml injection ( 2ml ) , cholecalciferol 60000 iu / ml injection ( 1ml ) , citicoline 250mg / ml injection ( 2ml ) , colistimethate 2million iu / ml injection , colistimethate 1million iu / ml injection , dexamethasone 8 mg / 2ml injection ( 2 ml vial ) , dextrose 10% 1000 ml ( ppbottle ) injection , dextrose 10% 500 ml ( glassbottle ) injection , dextrose 10% 500 ml ( ppbottle ) injection , dextrose 5% ( ppbottle ) 1000 ml injection , dextrose 5% 500 ml ( ppbottle ) injection , dextrose 5% 500 ml ( glassbottle ) injection , dextrose injection 25% ( pp bottle ) ( 100 ml bottle ) , dextrose injection 25% ( glass bottle ) ( 100 ml bottle ) , dexmedetomidine hcl 100mcg / ml ( 1ml ) , dexmedetomidine hcl 100mcg / ml ( 2ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diclofenac sodium 25 mg / ml injection ( 3 ml amp ) , diclofenac aqua 75mg / mlinjection ( 1ml ) , dicyclomine 10 mg / ml injection ( 2 ml amp ) , diltiazem 5 mg / ml injection , dobutamine 50mg / ml ( 5ml injection ) , dopamine injection 40mg / ml ( 5ml ) , doxorubicin 50 mg / 25ml injection , daunorubicin 20 mg inj ip , drotaverine hydrochloride 40 mg / 2ml injection ( 2 ml amp ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , digoxin 0.25mg / ml injection , diptheria antitoxin 10000 iu injection , dinoprostone 0.5mg gel , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , ethamsylate 250 mg / 2ml injection ( 2 ml amp ) , etophylline 84.7mg +theophylline 25.3 mg / ml. ( 2ml. injection ) , etoposide 100mg injection , ephedrine 30mg / ml injection ( 1ml ) , esmolol hcl injection 10mg / 10ml , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , fosphenytion 2ml injection , fentanyl citrate 50mcg / ml injection 2ml , filgrastim 300 mcg / ml injection , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , furosemide 10 mg / ml injection ( 2 ml amp ) , factor ix concentrate 600 iu injection , ferric carboxymaltose 50mg / ml injection ( 10ml ) , fluconazole 100ml injection , gemcitabin 200mg injection , gemcitabin 1000mg injection , gentamicin 80 mg / 2ml injection ( 2 ml amp ) , glycopyrrolate 0.2 mg / ml injection ( 1 ml amp ) , glycopyrrolate 0.2 mg / ml injection ( 10 ml ) , granisetron injection 1mg. / ml. 3ml. amp. , glycine 3ltr injection , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , haloperidol 5 mg / mlinjection ( 2ml ) , hcg2000 i.u. injection , hcg5000 i.u. injection , heparin sodium 1000 i.u. / ml injection , heparin sodium 5000 i.u. / ml injection , human albumin solution 20% ( 100 ml bottle ) , human anti d immunoglobulin 150 mcg injection , human anti d immunoglobulin 300 mcg injection ( im use ) ( prefilled syringe / vial ) , human rabies immunoglobulin150 iu / ml injection , hyaluronidase 1500 iu injection , hydrocortisone sod. succinate 100 mginjection , hydrocortisone sod. succinate 200 mginjection , hydrocortisone sod. succinate 400 mginjection , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxyprogesterone 250 mg / ml injection ( 1 ml amp ) , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , halothane 50ml , halothane 100ml , hepatitis b immunologlobin injection ip 100 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , iron sucrose 20mg / ml injection ( 5ml ) , isoflurane liquid for inhalation ( 100ml ) , isoflurane liquid for inhalation ( 30ml ) , isoflurane liquid for inhalation ( 250ml ) , isolyte g ( each 100ml contains: sodium chloride usp 0.53 g; sodium gluconate usp 0.5 g sodium acetate trihydrate usp 0.37 g; potassium chloride usp 0.037 ) injection ( 500ml ) , isophane insulin 40 iu / ml injection ( 10ml vial ) , isoxsuprine 5 mg / ml injection ( 2ml amp ) , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) ( 10ml ) , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , intravenous fat emulsion 20% w / v 250ml , isoprenaline injection ip 2mg / ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , ketamine injection 50 mg / ml ( 10 ml vial ) , labetalol hydrochloride 20 mg / 4ml injection ( 4 ml amp ) , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg ( 30ml ) , lignocaine 2% injection ( 30 ml vial ) , lignocaine hcl 2% injection ( 50ml i.v. ) , lincomycin 600mg / 2ml injection , linezolid inj 200mg / 100ml ( 300ml ) , low mol. wt. heparin 60mg / 0.6mlinjection ( enoxaparin ) , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , levetiracetam injection 500mg / 5ml , lorazepam inj ip 2 mg / ml ( 2ml ) , levobupivacaine 5mg / ml ( 20ml ) , lignocaine hcl and dextrose injection ( 2ml ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , magnesium sulphate 500mg / ml injection ( 50% ) ( 2 ml amp ) , mannitol 20% injection ( 350 ml bottle ) , mannitol inj ip 20% w / v 100 ml , mannitol 10% w / v glycerin 10% w / v injection , mecobalamin 500 mcg / ml injection , mephentermine 30 mg / ml injection ( 10ml ) , meropenem 125 mg injection , meropenem 250 mg injection , meropenem 1gm injection , meropenem 500 mg injection , methylcobalamin 1500 mcg injection , methylcobalamin 1000 mcg vit.b 6 100mg nicotinamide 100mg injection ( 2ml ) , methylergometrine 0.2 mg / ml injection ( 1ml amp ) , methylprednisolone sodium succinate 500 mg ( vial ) , metoclopramide injection 10 mg / 2ml ( 2 ml amp ) , metronidazole injection 500 mg / 100ml ( 100ml bottle ) , midazolam 1 mg / ml injection ( 5 ml vial ) , midazolam 1 mg / ml injection ( 10 ml vial ) , morphine sulphate 10mg / ml injection , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) ( pp bottle ) ( 500ml bottle ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) glass bottle ( 500ml bottle ) , multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) ( pp bottle ) ( 500ml bottle ) , multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) glass bottle ( 500ml bottle ) , multivitamin 10 ml injection , methotrexate inj ip 50 mg / 2 ml , meropenem injection ip 250 mg , nandrolone decanoate25 mg injection , nandrolone decanoate 50 mg injection , neostigmine inj ip 0.5 mg / ml ( 1ml amp ) , neostigmine inj ip 0.5 mg / ml ( 5ml amp ) , nitroglycerin inj 5 mg / ml ( 1ml amp ) , nitroglycerin inj 5 mg / ml ( 5ml amp ) , noradrenaline injection ip 2 mg / ml ( 1mlamp ) , noradrenaline injection ip 2 mg / ml ( 5mlamp ) , normal saline ( sodium chloride ) 0.9% 100ml ( pp bottle ) , normal saline ( sodium chloride ) 0.9% 100ml glass bottle , naloxone inj ip 0.4mg / ml ( 1ml ) , normal saline ( sodium chloride ) 0.9% 3ltr , normal saline ( sodium chloride ) 3% 100ml glass bottle , normal saline ( sodium chloride ) 0.9% 10ml injection , netilmicin sulphate 300mg injection , netilmicin sulphate 50mg injection , normal human intravenous immunoglobulin 5g / 100ml , ofloxacin inj 200 mg / 100 ml , ondansetron 2 mg / ml injection ( 2 ml amp ) , oxytocin 5 iu / ml injection ( 1ml amp ) , octreotide injection 50 mcg / ml , paclitaxel 260mg injection , paclitaxel 100mg injection , pantoprazole 40 mg injection ( vial ) , paracetamol 150 mg / ml injection ( 2 ml amps ) , paracetamol infusion ip 1% w / v 100ml , pentazocine 30 mg / ml injection ( 1 ml amp ) , pheniramine 22.75 mg / ml injection ( 2ml amp ) , phenobarbitone 200 mg / ml injection ( 1ml ampoule / vial ) , phenytoin sodium 50 mg / ml injection ( 2ml amp ) , pilocarpine injection 0.5% mg / ml ( 1 ml injection ) , piperacillin and tazobactam 4 gm + 500 mg for injection ( vial ) with diluent , piperacillin with tazobactam 1gm + 125 mg injection with diluent , piperacillin injection 2 gm + tazobactom 250mg ip , potassium chloride injection 0.15 gm / ml ( 10ml amp ) , pralidoxime chloride 25mg / ml ( 20ml injection ) , pralidoxime iodide 25mg / ml ( 20 ml lnjection ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , progesterone 200 mg / 2ml injection ( 2 ml amp ) , promethazine 25 mg / ml injection ( 2 ml amp ) , propofol 10mg / ml injection ( 10ml ) , propofol 10mg / ml injection ( 20ml ) , phenylephrine hcl 10mg / ml injection ( 1ml ) , pottasium phosphate 15ml injection , prochlorperazine mesylate injection 12.5mg / ml 5ml , polygeline 3.5% solution with electrolytes for i.v. infusion , polymixin b 500000iu injection , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , protamine sulphate 50mg / 5ml injection , quinine dihydrochloride 300 mg / ml injection ( 2ml amp ) , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , ranitidine hcl 50 mg / 2ml injection ( 2 ml amp ) , rh erythropoitin injection 2000 iu , rh erythropoitin injection 4000 iu , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , ringer acetate infusion 500 ml , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , remdesivir 5mg / ml 20ml vial , rh erythropoetin inj ip 10000 iu , swine flu vaccine injection , snake venom antiserum ( polyvalent anti snake venum ) ( 10ml vial ) , sodium bicarbonate 7.5% injection ( 10 ml amp ) , sodium chloride 1000 ml ( pp bottle ) injection , sodium chloride 500 ml ( glass bottle ) injection , sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 500ml bottle ) , sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 1000ml bottle ) , sodium chloride and dextrose 0.9 % + 5 % injection ( glass bottle ) ( 500ml bottle ) , sodium chloride injection ( 500ml pp bottle ) , sodium valproate 100 mg / ml injection ( 5 ml vial ) , soluble insulin 40 iu / ml injection ( 10 ml vial ) , streptokinase15 lac units injection , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , succinylcholine 50 mg / ml injection ( 10 ml vial ) , sodium chloride 0.45% w / v polypack 500 ml , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium nitropruside 25mg / ml 2ml injection , thiopentone inj ip 0.5 gm , thiopentone inj ip 1 gm , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetanus vaccine 0.5 ml ( adsorbed ) ipamp , teicoplanin 200mg injection , teicoplanin 400mg injection , torsemide 10 mg / ml injection ( 2 ml amp ) , tramadol 50 mg / ml injection ( 2 ml amp ) , thiamine injection , triamcinolone 40mg / ml injection ( 1ml ) , tranexamic acid injection ip 100mg / ml 5ml , tirofiban hcl injection 5mg / 100ml , terlipressin acetate injection 1mg 10ml amp , tocilizumab 20 mg / ml 4ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , urokinase injection 5 lac unit ( lyophilized ) , valethamate bromide 8 mg / ml injection ( 1 ml amp ) , vancomycin 1 gm injection ( vial ) , vancomycin 500mg injection ( vial ) , vecuronium bromide 4 mg for injection ( freeze dried ) ( 2ml ) , vitamin b complex injection ( 10 ml vial ) , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , voriconazole injection 200mg / vial , water for injection ip ( 10 ml amp ) , water for injection ip ( 5 ml amp ) , zoledronic acid injection ip 4mg / 100ml 100ml , acyclovir cream 5 % ( 5 gm tube ) , beclomethasone, neomycin and clotrimazole cream 0.025%+0.5%+1% ( 10g tube ) , betamethasone dipropionate cream 0.05% ( 10gm ) , betamethasone with salicylic acid ( 15 gm ointment ) , betamethasone lotion 0.05% ( 50ml ) , calamine lotion ip ( 100ml bottle ) , cetrimide cream ip 15gm , cetrimide tincture 0.5% ( 200ml bottle ) , clindamycin phosphate gel 1% ( 20 gm ) , clobetasolpro pionate 0.05 % cream ( 15gm ) , clotrimazole 1% mouth paint ( 15ml ) , clotrimazole cream ip 2% w / w ( 15gm ) , coal tar 6% & salicylic acid 3% ointment ( 20gm ) , compound benzoic acid ointment ip 6%+ salicylic 3% ( 15gm tube , compound benzoin tincture ( 500ml bottle ) , chlorhexidine mouthwash 0.2% ( 50 ml ) , clotrimazole beclomethsone lotion 50ml , powder clotrimazole 1% w / w 100gm , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , dental gel: choline salicylate 8.75% + benzalkonium chloride 0.01% + lignocaine hcl 2% ( 10gm ) , desensitizing tooth gel with sodium mono fluoro phosphate 0.7% & pot. nitrate 5 % ( 50gm ) , diclofenac 1% gel ( 30 gm ) , diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil3% menthol 5% ( 15 gm ) , diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil 3%, menthol 5% ( 30 gm ) , dinoprostone 0.5 mg ( 3gm cream ) , framycetin sulphate 1% cream ( 30gm tube ) , fusidic acid cream bp 2% 10gm tube ( 10 gm tube ) , fusidic acid ointment 2% ( 10 gm. packing ) , gamma benzene hexachloride 2% lotion ( lindane lotion usp ) ( 100 ml bottle ) , gentian violet paint 1% ( 200 ml bottle ) , glycerin ( 100ml ) , glycerin ip ( 400 ml ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% ( 10ml ) , ketoconazole 2% cream ( 20gm ) , ketoconazole 2% zpto 1% shampoo 100ml , lignocaine 2% gel ( 30gm ) , lignocaine 5% ointment ( 10gm ) , liquid paraffin100 ml pack , liquid paraffin ip ( 400ml bottle ) , metronidazole 1% and chlorhexidine 0.25% gel ( 10gm ) , miconazole nitrate 2% cream ip ( 15g tube ) , mupirocin 2% ointment ( 5 gm ) , neomycin sulphate 5 mg and bacitracin 500 iu / gm ointment ( 10gm ) , ointment containing : lidocaine 3% , zinc oxide 5%, hydrocortisone 0.25% , allantoin 0.5% ( 15 g tube ) , permethrin cream 5% ( 30 gm pack ) , permethrin lotion 5% ( 50ml pack ) , permethrin soap 5% 75gm , povidone iodine ointment 5% ( 15 gm tube ) , povidone iodine ointment 5% ( 250 gm pack ) , povidone iodine ointment 5% ( 500 gm pack ) , silver sulfadiazine 1% cream ( 50 gm tube ) , silver sulfadiazine cream 1% 500 g pack ( each ) , tobramycin ophthalmic 0.3% ( 5gm ointment ) , tretenoin cream 0.025% ( 20 gm ) , terbinafine 1% w / w ( 10 gm ) cream , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , albendazole oral suspension 400 mg / 10ml ( 10 ml bottle ) , albendazole 200mg / 5ml, ivermectin 1.5mg / 5ml ( 10ml ) , alkalizer disodium hydrogen citrate 1.25 gm / 5ml ( 100 ml ) , amoxicillin 200 mg & clavulanic acid syrup 28.5 mg / 5 ml ( 30ml ) , amoxicillin oral suspension125 mg / 5ml ( dry syrup ) ( 30ml bottle ) , amoxicillin 100mg / ml drop ( 15ml ) , amoxy and clavulanic acid 80 mg+11.4 mg / ml ( 10 ml drop ) , antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, simethicone 20mg ) ( 170 ml ) , antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, polydimethylsiloxane ( 100 ml ) , anti cold syrup: phenylephrine hcl , cetirizine and paracetamol ( 60 ml bottle ) , anti cold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol2.5mg+1mg+125mg / 5ml ( 60 ml bottle ) , azithromycin syrup 100 mg / 5ml ( 15ml ) , azithromycin syrup 200 mg / 5ml ( 15ml ) , azithromycin syrup 200 mg / 5ml ( 30ml ) , calcium carbonate 250mg & vitamin d3 125iu suspension ( 100 ml bottle ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , carboxymethylcellulose sodium lubricant eye drops 0.5% , cefixime 25mg / ml drop ( 10ml ) with diluent , cefixime 50mg / 5ml suspension ( 30ml ) with diluent , cefixime 100mg / 5ml suspension ( 30ml ) with diluent , cefpodoxime 25mg / ml ( 10 ml drop ) with diluent , cefpodoxime syrup 100 mg / 5ml ( 30 ml ) with diluent , cefpodoxime syrup 50 mg / 5ml ( 30 ml ) with diluent , cephalexin 100mg / ml ( 15ml drop ) with diluent , cephalexin oral suspension 125 mg / 5ml ( 30 ml ) with diluent , cetirizine syrup 5mg / ml ( 30ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , chlorpheniramine oral solution 2.5 mg / 5ml ( 50 ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , cough syrup [ terbutaline 2.5mg bromhexine2mg ambroxol 15mg ] ( 100ml ) , cough syrup [ terbutaline 2.5mg guaiphensin 50mgambroxol 15mg ] ( 100ml ) , cough syrup [ levosalbutamol 1mg guaiphensin 50mgambroxol 15mg ] ( 100ml ) , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup ( 100ml ) , cough syrup each 5 ml contains chloropheniramine maleate ip 2 mg, phenylepherin hcl 5mg dextromethorphan hbr 10mg ( 100ml ) , dextromethorphan hydrobromide 13.5mg / 5ml syrup ( 100 ml ) , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml ( 10 ml bottle with dropper ) , domperidone oral drops 10mg / ml ( 10ml ) , dicyclomine oral solution 10mg / 5ml ( 30ml ) , domperidone suspension 5 mg / 5ml ( 30 ml bottle ) , drop anti cold ( paracetamol 125mg / ml, phenyephrine 2.5mg / ml & chlorpheniramine maleate 1mg / ml ( 15 ml drop ) , lactase enzyme ( 15 ml drop ) , fungal diastase with pepsin enzyme drop 15ml , enzyme drop each ml contains ( alpha emylase 20mg + papain 10mg + dill oil 2mg + anise oil 2mg + caraway oil 2mg ) ( 15ml ) , erythromycin estolate 125 mg / 5ml oral suspension ( 30ml bottle ) , ibuprofen 100 mg+paracetamol 162.5 mg syrup ( 60 ml bottle ) , ibuprofen 100 mg / 5ml oral suspension ( 60 ml bottle ) , ferrous fumerate 100mg and folic acid 500mcg syrup ( 100ml bottle ) , lactulose solution 10gm / 15ml ( 100ml ) , lidocaine hydrochloride topical solution 4% , syrup levocetirizine with montelukast 2.5mg+4mg / 5ml ( 60 ml ) , multivitamin drop ( vitamin a, thiamine 0.4mg, riboflavin 0.8mg, pyridoxine hydrochloride 0.8mg, nicotinamide 8mg, ascorbic acid 40mg ( 15ml ) , metronidazole 100 mg and norfloxacin 100 mg / 5ml suspension ( 30 ml bottle ) , metronidazole benzoate 100 mg / 5ml oral suspension ( 60 ml bottle ) , metochlopramide hcl 5mg / 5ml ( 30ml syrup ) , ondansetron 2mg / 5ml ( 30ml syrup ) , ondansetron 4mg / 5ml ( 30ml syrup ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , ofloxacin suspension 50 mg / 5ml ( 30 ml bottle ) , ofloxacin suspension 100 mg / 5ml ( 30 ml bottle ) , paracetamol 150 mg / ml drops ( 15ml bottle ) , peritoneal dialysis solution ip ( 1000ml pack ) , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , povidone iodine scrub solution 7.5% ( 500 ml bottle ) , povidone iodine solution 10 % ( 100 ml bottle ) , povidone iodine solution 5% ( 100 ml bottle ) , povidone iodine solution 5% ( 500 ml bottle ) , promethazine 5 mg / 5ml syrup ( 60 ml bottle ) , paracetamol 125 mg / 5mlsyrup ( 60ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , surgical spirit ( 70 % alcohol ) ( 450 ml bottle ) , surgical spirit ( 70% alcohol ) ( 100 ml bottle ) , salbutamol syrup 2 mg / 5ml ( 100 ml bottle ) , turpentine oil ( 100 ml ) , vitamin c and vitamin e drop , vitamin d3 oral solution 60000 i.u. , vitamin a solution 1 lac iu / ml ( 100ml bottle ) , zinc sulphate 60 ml syrup , beclomethasone inhalation 200 mcg / dose ( 200 metered doses container ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg rotocap ( 30 capsule ) , betamethasone with clotrimazole with lignocaine 5ml ear drop , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , betaxolol eye drops 0.5 o / o ( 5ml ) , budesonide nebulizer suspension 0.25 mg / ml ( 2ml amp ) , budesonide powder for inhalation 200 mcg ( rotocap 30 capsul ) , chloramphenicol 0.05%eyedrop , chlorhexidine gluconate solution 2% ( 250ml ) , chlorhexidine gluconate solution 2% ( 100ml ) , chlorhexidine gluconate 2%, cetrimide solution ( 100ml ) , cholecalciferol granules 60000 iu / 1gm ( 1 gm sachet ) , ciprofloxacin 0.3% and dexamethasone 0.1% ear drops 10ml , ciprofloxacin 0.3% and dexamethasone 0.1% eye drops 10ml , ciprofloxacin 0.3% eye drops ( 10ml ) , ciprofloxacin ophthalmic ointment usp 0.3% 5gm , chloramphenicol 1% w / w eye ointment ip, 3gm size , clotrimazole 1% with beclomethasone 0.02% drops ( 5 ml drop ) , clotrimazole 1% with lignocaine 1% ear drops ( 5 ml drop ) , concentrated haemodialysis fluid b.p acetate concentrate in 10 litre cans. each 1000ml after 1:34 dilutions should provide sodium chloride 135 to 140 meq ( 10 litres plastic can ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , black disinfectant fluid ( phenyl ) as per schedule o grade iii , fluconazole 0.3% eye drops ( 5 ml drop ) , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5ml , formaldehyde solution ( 34.5 per. 38 per. ) , glutaraldehyde 2% solution ( 5 ltrs can ) , homatropine eye drop ( 2% ) 5 ml , hydrogen peroxide solution 6% ( 400 ml bottle ) , hydrogen peroxide solution 6% ( 100 ml bottle ) , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , ketorolac tromethamine 0.5% w / v eye drop 5ml , liquid soap ( 1000 ml ) , liquid soap ( 500 ml ) , liquid soap ( 5000 ml ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 5 ltrs can ) , miconazole 1% eye drops , moxifloxacin ( 0.5% w / v ) eye drop , nasal spray azelastine 140 mcg with fluticasone 50 mcg , neomycin, hydrocortisone and polymyxin b ear drops , ors powder , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , polymixin b, chloramphenicol, dexamethasone ear drop 5ml , phenylephrine opthalmic drops 5% ( 5 ml drop ) , pilocarpine hydrochloride 2%5 ml vial , pilocarpine hydrochloride 4%5 ml vial , powder neomycin, bacitracin withsulfacetamide 5mg+250units+60mg ( 10 gm plastic bottle ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) , salbutamol nebuliser solution 5 mg / ml ( 10 ml vial ) , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) ( 10ml bottle with dropper / squeeze bottle ) , sodium chloride 5%w / v opthalmic soln. 10ml , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sodium phosphates enema bp ( 100 ml polypropylene pack ) , sulfacetamide 20% eye drops ( 10 ml drop ) , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , timolol eye drops ip 0.5 o / o w / v5 ml , tobramycin 0.3% eye drops 5ml , tobramycin and dexamethasone 0.3%+0.1% ophthalmic suspension ( 5ml ) , tropicamide eye drop 1% 5 ml , travoprost eye drops ip 0.004 o / o 5ml , wax dissolving ear drops: paradichlorobenzene 2%, benzocaine 2.7%, chlorobutanol 5%, turpentine oil 15% , xylometazoline nasal drops 0.1% ( 10 ml drop ) , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , alendronate sodium tablets usp / bp 35 mg , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acamprosate calcium 333 mg tablet , acarbose 25mg tablet , aceclofenac & thiocolchicoside 100 mg+4mg tablet , aceclofenac 100 mg and paracetamol 325 mg tab , aceclofenac 100 mg, paracetamol 325 mg, chlorzoxazone 250mg tab , aceclofenac 100 mg, paracetamol 325 mg, serratiopeptidase 10mg tab , acebrophylline tablet 100 mg , acebrophylline tablet 200 mg , acenocoumarol1 mg tablet , acenocoumarol 2 mg tablet , acetazolamide 250 mg tablets , acyclovir 200 mg tablets , acyclovir 400 mg tablets , acyclovir 800 mg tablets , acetyl cystein 600mg tablet , albendazole 400 mg tablets , albendazole 400 mg, ivermectin 6mg tablets , alprazolam 0.25 mgtablets , alprazolam 0.5 mg tablets , amitriptyline hcl 25 mg tablet , amitriptyline hydrochloride50 mg tablet , amlodipine & lisinopril 5mg+10mg tablet , amlodipine 2.5 mg tablets ip ( 10 tab blister ) , amlodipine 5 mg tablets ( 10 tab blister ) , amlodipine and atenolol 5 mg +50mg tablet , amlodipine and enalapril maleate 5 mg +5mg tablets , amoxycillin and potassium clavulanate 500mg + 125mg tablet , amoxycillin trihydrate 125 mg dispersible tablets , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , artemether & lumefantrine tab artemether 80mg + lumefantrine 480mg , artemether & lumefantrine tab artemether 40mg + lumefantrine 480mg , artemether and lumefantrine tab artemether 20mg+lumefantrine 120mg , ascorbic acid 500 mg tablets , aspirin 300 mg tablets , aspirin 150 mg tablets , amiodarone tab ip 100 mg , amisulpride 100 mg tablet , amisulpride 50 mg tablet , amiodarone tab ip 200 mg , allopurinol tablets ip 100 mg , allopurinol tablets ip 300 mg , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , aspirin delayed release tablets 75 mg ( enteric coated gr tablet ) , atenolol 25 mg tablets , atenolol 50 mg tablets , atorvastatin 10 mg tablets , atorvastatin 20 mg tablets , atorvastatin 40 mgtablets , azithromycin 100 mg dt tablets , azithromycin 250 mg tablets , azithromycin 500 mg tablets , azathiopurine 50mg tablet , biotin 10mg tablet , biotin 10mg, acetylcystine 50mg, calcium pantothenate 100mg, selenium 65mcg, copper 3mg, zinc oxide 22.5mg tablet , betahistine 8mg tablet , betahistine 16mg tablet , betahistine 24mg tablet , baclofen 10mg tablet , baclofen 20mg tablet , baclofen 30mg tablet , betamethasone 0.5 mg tablets , bicalutamide 50 mg tablet , bisacodyl 5 mg tablets , bisoprolol 5 mg tab , bisoprolol 10 mg tab , bromocriptine tablets ip 2.5 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) , carbamazepine 100 mg tablets , carbamazepine 200 mg tablets , carbamazepine 400 mg tablets , carbimazole 10 mg tablets , carbimazole 5 mg tablets , cholecalciferol 60000 iu tablet , cefixime 100 mg tablets , cefixime 200 mg tablets , cefpodoxime 200 mg tablets , cefpodoxime 50 mg dispersible tablets , cefpodoxime proxetil 100 mg tablet , cefuroxime500 mg tablet , cefuroxime 250 mg tablet , cephalexin 125 mg tablets ( dt ) , cetirizine 10 mg tablet , cetirizine 5mg, phenylephrine 10mg& paracetamol 325 mg tablet , chlordiazepoxide + trifluoperazine 5mg+1mg tablet , chlordiazepoxide 10 mg tablets , chlordizepoxide 25 mg tablet , chlorine 500 mg tablet , chloroquine phosphate tablets 250mg , chlorpheniramine maleate 4 mg tablets , chlorpromazine 100 mg tablets , chlorpromazine 25 mg tablets , chlorpromazine 50 mg tablets , chlorpromazine 10 mg tablets , chlorzoxazone 250mg, diclofenac sodium 50mg & paracetamol 325 mg tablet , chymotrypsin 20 mg + trypsin 20mg tablet , cinnarizine + domperidone20 mg + 15 mg tablet , cinnarizine tab 25 mg tablet , cinnarizine tab 75 mg tablet , ciprofloxacin 250 mg tablets , ciprofloxacin 500 mg tablets , clobazam10 mg tablet , clobazam5 mg tablet , clonazepam 0.25 mg tablets , clonazepam 0.5 mg tablets , clonazepam 1 mg tablets , clopidogrel 75 mg and aspirin 75 mg tablet , clopidogrel 75 mg tablets , clotrimazole vaginal 500 mg tablets ( single tablet ) , clozapine 50 mg tablet , clozapine 25 mg tablet , cloimpiramine 25mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , citicoline 500mg tablet , conjugated estrogen 0.625mg tablet , clomifene 25mg tablet , clomifene 50mg tablet , carvedilol 3.125mg tablet , cefadroxil 250mg tablet , cefadroxil 500mg tablet , cabergoline 0.5mg tablet , calcitriol 0.25mg tablet / capsule , cerebroprotein hydrolysate 90mg tablet , chlorambucil 5mg tablet , cyclosporin 50mg tablet / capsule , capecitabine 500mg tablet , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , dapsone 100mg tablet , deflazacort6 mg tablet , deflazacort12 mg tablet , deflazacort24 mg tablet , deflazacort 30 mgtablet , dexamethasone 0.5 mg tablet , dexamethasone 4 mg tablet , diazepam 5 mg tablet , diclofenac 100 mg ( sr ) tablets , diclofenac potassium 50mg + serratiopeptidase 15mg + paracetamol 325mg tablet , diclofenac sodium + paracetamol tab 50+325mg tablet , diclofenac sodium 50 mg tablets , dicyclomine 10 mg tablets , dicyclomine 20 mg + paracetamol 325 mg tablet , diethylcarbamazine 100 mg tablets , digoxin 0.25 mg tablet , diltiazem30 mg tablet , diltiazem 60 mg tablet , diltiazem 90 mg tablet , divalproex sodium500 mg tablet , divalproex sodium250 mg tablet , divalproex sodium750 mg tablet , disulfiram 500mg tablet , desloratadine 5mg tablet , doxofyline 400mg tablet , domperidone 10 mg tablets , doxylamine succinate 20mg + pyridoxine 20mg + folic acid 2.5 mg tablets , drotaverin 40mg tablet , drotaverine 80 mg & mefenamic acid 250 mg tab ( 10 tab strip ) , drotaverine 80 mg tablets , donepezil hcl 5mg tablet , donepezil hcl 10mg tablet , duloxetine 20mg tablet , duloxetine 30mg tablet , duloxetine 40mg tablet , dutasteride 0.5mg tablet , deferasirox tab 100 mg , deferasirox tab 500 mg , dasatinib tab 100 mg , enalapril maleate 10 mg tablets , enalapril maleate 2.5 mg tablets , enalapril maleate 5 mg tablets , erythromycin stearate 250 mg tablets , erythromycin stearate 500 mg tablets , escitalopram 5 mg tablet , escitalopram 10 mg tablet , escitalopram 20 mg tablet , ethamsylate 250 mg tablet , ethamsylate 500 mg tablet , etoricoxib 90mg tablet , etoricoxib 120mg tablet , etoricoxib 60mg tablet , ethinyloestradiol 50mcg tablet , etizolam 0.5mg tablet , etizolam 0.25mg tablet , favipiravir 200 mg tablets , favipiravir 400 mg tablets , famotidine 20 mg tablets , famotidine 40 mg tablets , flavoxate 200 mg tablet , fluconazole 150 mg tablets tablet , fluconazole 50 mg dt tablet , flunarazine 10 mg tablet , flunarazine 5 mg tablet , fluoxitine 20 mg tablet , fluoxitine 60 mg capsule , flupentixol 1 mg. tablet , flupentixol 0.5mg, melitracen 10mg tablet , folic acid tablets ip 5 mg tablet , formalin tablet , furosemide 40 mg tablet , fexofenadine 120mg tablet , feropenum 200mg tablet , fenofibrate 200mg tablet , fenofibrate 160mg tablet , finasteride 5mg tablet , gabapentin 100mg tablet , gabapentin 300mg tablet , griseofulvin 125mg tablet , glyceryltrinitrate 2.6mg tablet , glibenclamide 5 mg tablets , glibenclamide and metformin hydrochloride 5 mg + 500 mg ( sr ) tablets , gliclazide 40 mg tablets , gliclazide 80 and metformin 500 mg tablet , glimepiride 1 mg tablets , glimepiride 2 mg tablets , glimepiride, pioglitazone and metformin hydrochloride 2mg + 15mg + 500mg ( sr ) tablets , glipizide 5 mg tablets , glipizide and metformin hydrochloride 5 mg + 500 mg tablets , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , haloperidol 1.5 mg tablets , haloperidol 5 mg tablet , hydrochlorothiazide 12.5 mg tablets , hydrochlorothiazide 25 mg tablets , hydroxychloroquine sulphate 200 mg , hydroxychloroquine sulphate 300 mg , hydroxychloroquine sulphate 400 mg , hydroxyzine 25 mg tablets , hyoscine butylbromide 10 mg tablets , ibuprofen 200 mg tablets , ibuprofen 400 mg tablets , ibuprofen and paracetamol 400 mg + 325 mg tablets , imiatinib 100mg tablet , imiatinib 400mg tablet , imipramine 25mg tablet , imipramine 75mg tablet , iron ( ferrous sulphate 100mg ) folic acid 0.5 mg tablet , iron ( ferrous sulphate 20mg ) folic acid 0.1 mg tablet , isosorbide dinitrate 5 mg tabletssl tab. , isosorbide mononitrate 20 mg tablets , isoxsuprine 20 mg tablets , ivermectin 6 mg tab , ivermectin 12 mg tab , ketorolac 10mg tablet , labetalol 100 mg tablets , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , lactic acid bacillus tab 60 million spores , levetiracetam250 mg tablet , levetiracetam500 mg tablet , levocetirizine 5mg with montelukast 10mg tab , levocetirizine 2.5mg with montelukast 4mg tab , levocetrizine 5mg tablet , levofloxacin 250 mg tablet , levofloxacin 500 mg tablet , levofloxacin 750 mg tablet , linezolid 600 mg tablet , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , lithium carbonate 300 mg tablet , loperamide 2 mg tablets , lorazepam2 mg tablet , lorazepam1 mg tablet , losartan 25 mg tablets , losartan 50 mg tablets , losartan potassium & amlodipine 50 mg + 5mg tablets , losartan potassium & hydrochlorothiazide 50 mg + 12.5mg tablets , lamotrigine 25mg tablet , lamotrigine 50mg tablet , lamotrigine 100mg tablet , levodopa 100mg + carbidopa 10mg tablet , levodopa 250mg + carbidopa 25mg tablet , levosulpiride 25mg tablet , letrozole 2.5mg tablet , loratidine 10mg tablet , leflunomide 10mg tablet , leflunomide 20mg tablet , melphalan 5mg tablet , mercaptopurine 50mg tablet , mefenamic acid 500 mg tablet , mefenamic acid 125 mg tablet , mefenamic acid 250 mg tablet , mefloquine 250 mg tablet , mesalamine800 mg tablet , mesalamine 400 mg tablet , mesalamine1.2gm tablet , medroxyprogestrone acetate 10mg tablet , metformin 500 mg tablets , metformin hydrochloride ( sr ) and glimepiride 500 mg + 1 mg tablets , metformin hydrochloride ( sustained release ) and glimepiride 500 mg + 2 mg tablets , metformin hydrochloride 1000 mg sr tablets , methotrexate 7.5 mgtablet , methotrexate 2.5 mgtablet , methotrexate 10 mgtablet , methyldopa 250 mg tablets , methylergometrine0.125 mg tablets , methylprednisolone 4 mg tablets , methylprednisolone 8 mg tablets , methylprednisolone 16 mg tablets , metoclopramide 10 mg tablets , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , metronidazole 200 mg tablets , metronidazole 400 mg tablets , misoprostol 200 mcg tablets , mifepristone tab ip 200mg , molnupiravir tab ip , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mirabegron 50mg er tablet , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , naproxen tablet ip 250mg , naproxen tablet ip 500mg , neostigmine tab ip 15 mg , nimesulide and paracetamol 100 mg+325 mg tablet , nitrofurantoin 100 mg tablets , nitroglycerin controlled release 2.6mg tablets , norethisterone 5 mg tablets , nortryptyline 10mg tablet , norfloxacin 400 mg tablets , ofloxacin 200 mg and ornidazole 500 mg tablet , ofloxacin 200 mg tablets , ofloxacin 400 mg tablets , olanzapine 10 mg tablet , olanzapine 5 mg tablet , ondansetron 4 mg md tablet , oxcarbazepine 300 mg tablet , oxcarbazepine 150 mg tablet , pantoprazole 40mgtablet , paracetamol 500 mg tablets , paracetamol 650 mg tablets , paroxetine 12.5 mg tablet , phenobarbitone 30 mg tablets , phenobarbitone 60 mg tablets , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 100 mg tablets , pioglitazone 15 mg tablets , prazosin hcl 2.5 mg tablets , prednisolone 10 mg tablets , prednisolone 20 mg tablets , prednisolone 5 mg tablets , primaquine 2.5 mg tablets , primaquine 7.5 mg tablets , prochlorperazine 5 mg tablet , prochlorperazine 10 mg tablet , promethazine25 mg tablet , propranolol 40 mg tablets , propranolol 10 mg tablets , pyridoxine 10 mg tablet , pyridoxine 40mg tablet , pyrimethamine 37.5 mg and sulphadoxine 750 mg tablet , phenazopyridine tablet 5 mg , piracetam 400mg tablet , pyridestigmine 60mg tablet , phenolphathaline 0.19gm tablet , quinine sulphate 300 mg tablets , quitiapine100 mgtablet , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , ramipril 2.5 mg tablets , ramipril 5 mg tablets , ramigliflozin 100mg tablet , rifaximin 200mg tablet , rifaximin 400mg tablet , ranitidine 150 mg tablets , ranitidine 300 mg tablets , resperidone 2 mg tablet , resperidone 1 mg tablet , ritonavir tablet ip , roxithromycin 150 mg tablet , rosuvastatin 10mg tablet , rosuvastatin 20mg tablet , rosuvastatin 40mg tablet , silymarin 70mg tablet , silodosin 4mg tablet , salbutamol 2 mg tablets , salbutamol 4 mg tablets , sodium valporate500 mg gr tablet , sodium valproate 200 mg tablets , sodium valproate 300 mg tablets ( sodium valproate 200+ valproic 87 mg, both corresponds 300 mg ) , sodium valproate 500 mg tablets , spironolactone 25 mg tablets , spironolactone 50 mg tablet , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , sertaline 50mg tablet , sotalol hcl 40mg tablet , sodiumbicarbonate 1gm tablet , sacubitril 24 mg and valsartan 26 mg tablet , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , tamoxifen 10 mg tablet , tamoxifen 20 mg tablet , tamsulosin hcl 0.4 mgtablet , tamsulosin with dutasteride 0.4mg+0.5mg tablet , tamsulosin with finasteride 0.4mg+5mg tablet , telmisartan 40 mg tablet , telmisartan 80 mg tablet , tenaligliptin 20 mgtablet , terbutaline sulphate 2.5mg tablet , theophylline 400 mg tablets ( sr ) , theophylline and etofylline 23mg + 77mg tablet , thiamine 100mg tablet , thyroxine sodium 100 mcg tablets , thyroxine sodium 50 mcg tablets , tinidazole 300 mg tablets , tinidazole 500 mg tablets , topiramate 50 mg tablet , topiramate 25 mg tablet , topiramate 100 mg tablet , torsemide 10 mg tablets , torsemide 10 mg + spironolactone 50mg tablets , tranexamic acid 500 mg tablet , tranexamic acid 500 mg, mefanimic acid 250mg tablet , tranexamic acid 250 mg, ethamsylate 250mg tablet , trifluoperazine 5 mgtablet , trihexyphenidyl2 mg tablet , temozolomide 100mg tablet / capsule , thalidomide 100mg tablet / capsule , 6 thioguanine 40mg tablet , tizanidine 2mg tablet , terbinafine 250mg tablet / capsule , ursodeoxycholic acid 300 mg tablet , ursodeoxycholic acid 150 mg tablet , venlafaxine 37.5 mg tablet , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg , verapamil 40mg tablet , valganciclovir tablet 450 mg , vitamin c 500mg, zinc sulphate 50mg & vitamin d 400iu chewable tablet , warfarin sodium 5mg tablet , warfarin sodium 2mg tablet , zinc sulphate dispersible 10 mg tablets , zinc sulphate dispersible 20 mg tablets , zinc sulphate dispersible 50 mg tablets , zolpidem 5mg tablet , zolpidem 10mg tablet , amoxicillin 250 mg capsules , amoxicillin 500 mg capsules , amoxicillin and cloxacillin 250mg+250mg capsules , ampicillin 500 mg capsules , cephalexin 250 mg capsules , cephalexin 500 mg capsule , clindamycin 300 mg cap , clindamycin150mg cap , diacerin 50mg capsule , diacerin 50mg, glucosamine 500mg capsule / tablet , deferiprone 250mg capsule , deferiprone 500mg capsule , danazol 50 mg capsules , doxycycline 100 mg capsules , fluoxetine 20 mg capsules , fluoxetine 60 mg capsules , fenofibrate 150mg capsules , indomethacin 25 mg capsules , iron & zinc & folic acid capsule , itraconazole 100 mg capsule , itraconazole 200 mg capsule , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , multivitamin tablet / capsules , nifedipine 10 mg capsules , nifedipine 5 mg capsules , omeprazole 20 mg capsules , oseltamivir 30mg capsule , oseltamivir 45 mg capsule , oseltamivir 75 mg capsule , orlistat 120mg capsule , pantoprazole 40mg & domperidone 30mg sr capsule , pregabalin 75 mg + methylcobalamin 750 mcg capsule , pregabalin 75mg capsule , pregabalin 75mg, nortryptyline 10mg capsule / tablet , preprobiotic capsule each capsule contains ( streptococcus faccalis 30million, clostridium butyricum 2million, bacillus mesntericus 1million, lactic acid bacillus 50million ) , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , natural micronised progesterone 200 mg ( capsule ) , tramadol 50 mg capsules , thiocolchicoside 4mg tablet / capsule , thiocolchicoside 8mg tablet / capsule , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , vitaminb complex capsules , vitamin a 10000iu capsules , vitamin e 400 mg capsules...
29067463 purchase for generic medicines , acebrophylline 100 , acebrophylline 200 , acebrophylline 200 + montelukast 10mg , aceclo 100 mg + pcm 500 mg tab. , aceclofenac +serratiopeptidase tab. , aceclofenac + pcm + serratio tab. , aceclofenac 100 mg tab. , aceclofenac inj. , aceclofenac sustained release tab. , acetylcyteine 600 mg tab , acyclovir 200 mg tab. , acyclovir 400 mg tab. , acyclovir 800 mg tab. , acyclovir cream , adriniline inj. , albendazole 10 ml sus. , albendazole 400 mg tab. , alendronic acid 35 cap , alendronic acid 70 cap , alfacalcidol calcium + zinc cap. , alfuzocin 10 , alfuzocin d , alpha beta arteether 2 ml inj. , alpha lio acid + mv + antioxi + chrom. cap. , alprazolam 0.25 mg + propanolol 20 mg tab. , alprazolam 0.25 mg tab. , alprazolam 0.5 mg tab. , ambroxol + terbutaline + guiphen. 100ml syp. , amikacin 100 mg inj. , amikacin 250 mginj. , amikacin 500 mg inj. , aminophylline 10 ml inj. , amiodarone hydrochloride 100 mg , amiodarone hydrochloride 200 mg , amisulpride 100 tab , amisulpride 50 tab , amlodipine + olmesartan tab. , amlodipine besilate 10 mg tab. , amlodipine besilate 2.5 mg tab. , amlodipine besilate 5 mg + ateno 50 mg tab. , amlodipine besilate 5 mg + lisino 5 mg tab. , amlodipine besilate 5 mg tab. , amoxy. + cloxa. cap. , amoxycillin 1.2 g + pot. clavu. 200 mg inj. , amoxycillin 125 mg + dicloxa 125 mg tab. , amoxycillin 200 mg + pot. clavu. 28.5 mg syp. , amoxycillin 250 mg + dicloxa 250 mg cap , amoxycillin 250 mg + pot. clavu. 125 mg tab , amoxycillin 250 mg dt , amoxycillin 500 mg + pot. clavu. 125 mg tab. , amoxycillin 500 mg cap. , amoxycillin dry syp. , ampicillin 250 mg + cloxacillin 250 mg cap. , antacid170ml syp. , antacidwith oxetacaine syp. , antioxidant softgels , atenolol 25 mg tab. , atenolol 50 mg tab. , atorvastatin 10 mg + ezetimibe 10 mg tab. , atorvastatin 10 mg + finofibrate 160mg tab , atorvastatin 10 mg tab. , atorvastatin 20 mg tab. , azathioprine 50 mg tab. , azelastine nasl spray , azilsartan kamedoxomil + chlorthalidone tab , azilsartan medoxomil 40 tab. , azithromycin 100mg sus. , azithromycin 200mg sus. , azithromycin 250 mg tab. , azithromycin 500 mg tab. , b.c. + l lysine 200 ml syp. , b.c. + mv+ mineral + zinc cap. , b.c. 200ml syp. , baclofen 10 tab , benidipine 4mg tab , benidipine 8 tab , betahistine 16 mg tab. , betahistine 8 mg tab. , betamethasone 0.5 tab. , bethanechol 25 mg tab , biscodyl 5 mg tab , bisoprolol 10 tab , bisoprolol 2.5 tab , bisoprolol 5 tab , bisoprolol2.5 + hydrochlorothiazide 6.25 tab , calamine 3% diphen 1% lot 100 ml , calamine lotion 100ml , calcium + vit. d3 tab. , calcium calcitriol + alfacalcidol cap , camylofin25mg+paracetamol300mg tab , canagliflozin + metformin 500 tab , canagliflozin 100mg tab , candesartan 4mg tab , candesartan 8mg tab , carbamezapine 100 mg tab. , carbamezapine 200 mg tab. , carbonyl iron + folic acid + zinc cap. , carvedilol 12.5 mg tab , carvedilol 6.25mg tab , cavedilol 3.125 mg tab , cefadroxil 250 mg dt tab. , cefadroxil 500 mg tab. , cefixime + azithromycin tab. , cefixime + clavu.200 mg tab. , cefixime + dicloxacillin tab. , cefixime + ofloxacin tab. , cefixime 100 mg dt tab. , cefixime 200 mg tab. , cefixime 50 mg dt tab. , cefpodoxime proxetil + clavuna. tab. , cefpodoxime proxetil 100 mg dt tab. , cefpodoxime proxetil 200 mg tab. , cefuroxime 250 mg + potassium clavulanate 125 tab. , cefuroxime 250 mg tab. , cefuroxime 500 mg + potassium clavulanate 125 tab. , cefuroxime 500 mg tab. , cephalexin 250 mg dt tab. , cephalexin 500 mg cap. , cetri. + nimu + pcm + phenyl + caffin tab. , cetrimide lotion , cetrizine 10 mg tab. , cetrizine5 mg+ambroxol 60 mg tab , chlordiazepoxide + clidinium bromide tab , chlordiazepoxide tab , chlorhexidine mouth wash , chloroquin 250 mg tab. , chloroquin 500 mg tab. , chlorthalidone 12.50 mg tab , chlorthalidone 6.25mg tab , cilnidipine 10 mg , cilnidipine 20 mg , cilnidipine10 mg+chlorthalidone12.5mg , cilnidipine 10mg+telmisartan40 mg , cinnarizine + domperidone tab. , cinnarizine 25 mg tab. , cinnarizine 75 mg tab. , ciprofaloxacin + tinidazole tab. , ciprofaloxacin 250 mg tab. , ciprofaloxacin 500 mg tab. , citicolin 500 mg tab , clarithromycin 250 mg tab , clindamycine 300 cap , clobetasol pro. + salicylic acid lotion , clobetasol pro. + salicylic acid oint. , clomifene citrate 50 mg , clonazepam 0.5 mg tab. , clonazepam 1 mg tab. , clonezapam 2 mg tab. , clopidogrel 75 mg + asprin 150 mg tab. , clopidogrel 75 mg + asprin 75 mg tab. , clopidogrel 75 mg tab. , clotrimazole + betame cream 15 gm , clotrimazole power , clotrimazole vag. tab. , cod liver oil 300 mg , coenzyme q1 with anti oxidant cap , collagen peptides + glucosamine sachet , coral calcium tab , coral calcium+vitamin k2 7 , cream beclometha. + genta. + miconaz. , cream beclomethasone + neomycin , cream beclomethasone + salisalic acid , cream beclomethasone 0.025 % + genta 0.2 % , cream beclomethasone dipropionate 0.025% , cream betamethasone + gentamycin , cream betamethasone + neomycin , cream chloramphenicol + hydrocortisone , cream clobetasole , cream clobetasone + genta , cream clotrimazole skin cream , cream clotrimazole vag. cream , cream fluocinolone +genta + clotri. , cream fusidic acid , cream fusidic acid+ beclomethasone , cream heparin + benzyl nicotinate , cream hydroquinone , cream luliconazole + beclometasone , cream luliconazole 10gm , cream luliconazole 20gm , cream luliconazole 30gm , cream miconazole , cream miconazole + fluocinolone , cream mometasone + fusidic acid , cream mometasone + salicylic acid , cream mometasone + terbinafine , cream mometasone furoate 1 mg , cream mupirocin 2% , cream nadifloxacin + mometasone + miconazole , cream nadifloxacine + clobetasol , cream nadifloxacine 10mg , cream neomycin + bacitracin eye oint. , cream neomycin + bacitracin skin oint , cream premethrine 5% , cream terbinafen , cyclobenzaprine ( 15mg ) + aceclofenac ( 200mg ) , cyproheptadine 4 mg tab. , dapagliflozin + metformin 500 tab , dapagliflozin 5mg , dapoxetine 30 tab , dapoxetine 60 tab , deflazacort 12 mg tab. , deflazacort 18 mg tab. , deflazacort 30 mg tab. , deflazacort 6 mg tab. , dexamethasone sod. phos. 0.5 mg tab. , diazepam 10 mg tab. , diazepam 5 mg tab. , dicerine 50 mg cap. , diclofenac + serratiopeptidase + pcm 500tab. , diclofenac + serratiopeptidase tab. , diclofenac 100 mg sr tab. , diclofenac 50 + paracetamol 325 tab. , diclofenac 50 mg tab. , dicyclo 10 mg + mefenimic acid 250 mg tab. , dicyclomin 10 mg + pcm 500 tab. , dicyclomin tab. , dicyclomine drop , digoxin 0.25 mg tab. , diltiazem 30 mg tab. , diltiazem 60 mg tab , diltiazem 90 mg sr tab. , disodium hydrogen citrate syp. , disulfiram 250 mg tab. , disulfiram 500 mg tab. , divalproex sodium 250 tab , divalproex sodium 500 tab , divalproex sodium 750 tab , domperi 10 mg + paracetamol 500 mg tab. , domperidone 10 mg tab , domperidone 5 mg tab. , domperidone sus. , dothipine 25 mg tab. , dothipine 75 mg tab. , doxofylline 400mg + montelukast 10mg , doxofylline 400mg tab , doxycillin 100 mg + lactic acid ba. tab. , doxylaminesuccinate + vit b6 tab. , drop cefpodoxime proxetil dry , drop hydroxyzine oral drop , drop multivitamin , drop paracetamol , drotavarin + mefenimic acid tab. , drotaverine 40 mg tab. , drotaverine 80+ paracetamol 325 tab. , ear drop benzo.+ paracu. + terpentin oil , ear drop chloram + beclo. + clotri + dipro. + ligno. , empagliflozin 25mg tab , enalapril 10 mg tab. , enalapril 2.5 mg tab. , enalapril 5 mg tab. , enzyme tab. , ergotamine+ caffine 100 mg + pcm 250 mg , erythromycin 250 mg , erythromycin 500mg tab , escitalopram + clonazepam tab. , escitalopram 10 mg + etizolam 0.5 tab. , escitalopram 10 mg tab. , escitalopram 5 mg tab. , esomeprazole 40mg , esomeprazole 40mg + levosulperide , esomeprazole 40mg +domperidone , ethamsylate 250 mg tab. , ethamsylate 500 mg tab. , etophyllin + theophyllin tab. , etophyllin r 150 tab. , etophyllin r 300 tab. , etoricoxib 120 mg tab. , etoricoxib 60 + paracetamol 325 tab , etoricoxib 60 + thiocolchicoside 4mg , etoricoxib 60 mg tab. , etoricoxib 90 mg tab. , evening primrose oil 1000 , evening primrose oil 500 mg , eye drop atropine , eye drop brimonidine , eye drop brimonidine + timolol , eye drop brinzolamide , eye drop bromfenac , eye drop carboxy methyl cellulose 0.5% , eye drop carboxy methyl cellulose 1% , eye drop chloram + dexamethasone , eye drop chloram + poly + dexame , eye drop chloram + sulphacetamide , eye drop ciprofloxacin , eye drop ciprofloxacin+ dexamethasone , eye drop cromolyn sodium , eye drop dorzolamide , eye drop dorzolamide + timolol , eye drop flurbiprofen , eye drop gatifloxacin 0.3% , eye drop gatifloxacin 0.3% + prednisolone , eye drop hydro carboxy cellu + sulpha , eye drop hydro carboxy methyl cellulose , eye drop ketorolac 0.4% , eye drop ketorolac 0.5% , eye drop levofloxacin 1.5 , eye drop moxifloxacin 0.5 , eye drop moxifloxacin 0.5 + dexamethasone , eye drop moxifloxacin 0.5 + ketorolac , eye drop naphazoline + camphor + cpm , eye drop neomycin + bacitracin , eye drop ofloxacin , eye drop ofloxacin , eye drop ofloxacin + betamethasone , eye drop ofloxacin + dexamethasone , eye drop ofloxacin + ketorolac , eye drop ofloxacin + prednisolone , eye drop olopatdine , eye drop olopatdine + ketorolac , eye drop pilocarpine + timolol , eye drop pilocarpine 2% , eye drop polyvinyl alcohol + povidone , eye drop pot iod + sod chlo + cal chlo , eye drop prednisolone , eye drop timolol 0.5% , eye drop tobramycin , eye drop tobramycin + dexamethasone , eye drop tobramycin + flurometholone , eye drop tropicamide + phenylephrine , eye drop xylometazoline , eye drop zinc sulphate + boric acid + cpm , eye gel carboxy methyl cellulose 0.5% , eye gel carboxy methyl cellulose 1% , eye oint moxifloxacin oint. , eye oint. atropine , eye oint. ciprofloxacin , eye oint. ofloxacin , eye oint. tobramycin , eye oint. tobramycin + dexamethasone oint. , face mask 3 layer , faropenam 200 tab , febuxostat 40 tab , febuxostat 80 tab , fexofenadine 120 mg tab. , fexofenadine 180 mg tab. , fluconazole 150 mg tab. , fluconazole 200 mg tab. , flunarizine 10 mg tab. , flunarizine 5 mg tab. , fluoxetine 10 mg cap. , fluoxetine 20 mg cap. , flupentixo + melitracen tab. , fluticasone + azelastine nasal spray , fluticasone cream , folic acid tab. , frusemide + spirolactone tab. , frusemide 40 mg tab. , gabapentin + mecobolamine cap. , gabapentin 100 mg cap. , gabapentin 300 mg cap. , gabapentin 400 mg cap. , gabapentin400mg + nortriptyline10mg , gatifloxacin 400 mg tab , gbhc + chlorhexi. + cetrimide lotion , gbhc lotion 100ml , gel aceclofenac + lins oil + methyl sali. , gel clindamycine , gel clindamycine + isotretinoin , gel clindamycine +nicotinamide , gel diclofenac + oleum etc. gel 30gm , gel diclofenac 30gm , gel erythromycin , gel lignocaine gel , gel metronidazole , gel mouth ulser gel , gel piroxicam 30 gm , gel povidone iodin + metronidazole oit. , gel povidone iodin 10% oit. , gel povidone iodin 5% oit. , gel pro sali+ benzyl ko chloride oral gel , ginseng with multivitamin cap , gliclazide 40 mg tab. , gliclazide 80 mg + metformine 500 mg tab. , gliclazide 80 mg tab. , glime 1 mg+ metfo 500mg+ piog 15mg tab. , glime 2mg+ metf 500mg+ pioglati 15mg tab. , glimepride 1 mg + metformine 1000 mg tab. , glimepride 1 mg + metformine 500 mg tab. , glimepride 1 mg tab. , glimepride 2 mg + metformine 1000 mg tab. , glimepride 2 mg + metformine 500 mg tab. , glimepride 2 mg tab. , glucosamine + dicerine + mms tab. , glucosamine + dicerine cap. , glucosamine + mms tab. , glucosamine cap. , glycerin liquid 100 ml , glyceryl trinitrate 2.6 mg tab. , glyceryl trinitrate 6.4 mg tab. , haematinic with vitamin cap. , hcg pregnancy test card , herbal liver tonic 100 ml , herbal liver tonic 200 ml , hydro + tretoin + memetasone cream , hydroxychloroquine 400mg tab , hydroxychloroqune 200mg tab , hydroxyzine 10 mg tab. , hydroxyzine 25 mg tab. , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibuprofen + paracetamol sus. 60ml , ibuprofen + paracetamol tab. , ibuprofen 400 mg tab. , indomethacin 25 mg cap. , indomethacin 75 mg sr cap. , inj.erythropoietin inj 4000 , inj. amoxycillin 125 mg + dicloxa 125 mg , inj. amoxycillin 250 mg + dicloxa 250 mg , inj. ampicillin + cloxacillin 1gm , inj. ampicillin + cloxacillin 500 mg , inj. ampicillin 500 mg , inj. anti snake venum ( liquid ) , inj. anti snake venum ( powder ) , inj. anti tetanus immunog human 250 , inj. anti tetanus immunog human 500 , inj. anti d immunoglobulin ( human ) , inj. arte mether 2 ml , inj. artesunate 50 mg , inj. arv , inj. atracurium 2.5 ml , inj. atropine 0.6 mg , inj. benzothine benzyl penicillin 12 la , inj. bupivacaine 0.5 % 30 ml , inj. bupivacaine heavy 0.5 mg ( 4 ml ) , inj. butarphenol 1 mg , inj. butarphenol 2 mg , inj. cafotaxime + salbutamol 1.5 gm , inj. calcium gluconate 10 ml , inj. cefaperazone + salbactum 1 gm , inj. cefaperazone + salbactum 1.5 gm , inj. cefazidime 1 gm , inj. cefazidime 1.5 gm , inj. cefazidime 2 gm , inj. cefotaxime 1 gm , inj. cefotaxime 250 mg , inj. cefotaxime 500 mg , inj. ceftriaxone+ salbactum 1.5 gm , inj. ceftriaxone+ salbactum 750 mg , inj. ceftriaxone + tazobactum 375 mg , inj. ceftriaxone 1000 mg , inj. ceftriaxone 1000 mg + tazoba125 mg , inj. ceftriaxone 250 mg , inj. ceftriaxone 500 mg , inj. cefuroxime 1.5 gm , inj. cefuroxime 250 mg , inj. cefuroxime 500 mg , inj. cefuroxime 750 mg , inj. ciprofloxacin 100 ml iv , inj. d10 1000 ml , inj. d10 500 ml , inj. d5 1000 ml , inj. d5 500 ml , inj. dexamethasone sod. phos. 2 ml , inj. dextran 40 , inj. dextran 70 , inj. dextrose 25% , inj. diazepam 2 ml , inj. diclofenac , inj. dicyclomin , inj. digoxin 0.5 mg / 2 ml , inj. dihydroergotamine 1 ml , inj. diltiazem 5 mg / ml , inj. distild water for inj ( d.w. ) 5ml , inj. distilled water 10 ml , inj. dns 1000 ml , inj. dns 500 ml , inj. dobutamine , inj. dopamine 5 ml , inj. drotaverine 2 ml , inj. drotaverine 80 mg , inj. enoxpirin 0.4% , inj. enoxpirin 0.6% , inj. ergometrine , inj. ethamsylate 2 ml , inj. etophyllin + theophyllin , inj. fenobarbitone , inj. frusemide , inj. gentamycin 80 mg , inj. glyceryl trinitrate , inj. glycopyrolate 0.2 mg , inj. haemaccoeal 500 ml , inj. halothane 20 ml , inj. halothane 30 ml , inj. heparin , inj. hyalunoridase 1500 , inj. hydrocortisone 100 mg , inj. hydroxyprogestron 250 mg , inj. hydroxyprogestron 500 mg , inj. insuline 30 / 70 , inj. insuline lente , inj. insuline nph , inj. iron dextran , inj. isolyte e 500 ml , inj. isolyte g 500 ml , inj. isolyte m 500 ml , inj. isolyte p 500 ml , inj. isoxsuprine hcl , inj. ketamine 2 ml , inj. levofloxacin 100ml , inj. lorazepam , inj. mannitol 100 ml , inj. mannitol 350 ml , inj. mecobalamin 500mcg 2ml , inj. megsulf , inj. menadione sodium 1 ml , inj. methyl cellulose pre filled syringe , inj. methyl ergometrine maleate , inj. metoclopromide 2ml , inj. metronidazole 100 ml , inj. midazolam 5 ml , inj. multivitamine 10 ml , inj. nandrolone decanote 25 mg , inj. nandrolone decanote 50 mg , inj. neostig 2.5 mg + glycopyrolate 0.5 mg , inj. neostigmine 5 ml , inj. normal saline 1000 ml , inj. normal saline 500 ml , inj. ofloxacin 100 ml iv , inj. omeprazole , inj. ondansetron , inj. ondansetron + ranitidin , inj. ornidazole iv , inj. oxytocin , inj. pantoprazole , inj. pantozocine 30 mg / ml , inj. paracetamol 2ml , inj. phenaramine maleate , inj. phenobarbitone , inj. pilocarpine , inj. piperacilline + tazobactum 2.5 gm , inj. piperacilline + tazobactum 4.5 gm , inj. piroxicam , inj. potassium chloride , inj. progestirone 100 mg , inj. progestirone 200 mg , inj. promethazine hcl 50 mg , inj. propofol 10 ml , inj. ranitidine , inj. rl 1000 ml , inj. rl 500 ml , inj. soda bi carb 10 ml , inj. streptokinase 15 lac iu , inj. succinyl choline 10 ml , inj. t.t. , inj. theopentone sodium , inj. tinidazole 400 ml , inj. tramadol hydrochoride , inj. tranexamic , inj. urokinase 5 lac i.u. , inj. valethamate 8 mg. , inj. vecuronium 4 mg , inj. xylocain 2% with adrenaline 3 ml , inj. xylocain 4% 30 ml , inj. xylocaine heavy 5% ( lox ) ( 2ml ) , inj.benzothine benzyl penicillin 24 la , iron cap. , iron iii tab. , isosorbide mononitrate 10 mg tab. , isosorbide mononitrate 20 mg tab. , isosorbide mononitrate 30 mg tab. , itraconazole 100 mg , itraconazole 200 mg , itraconazole 400 mg , ivermectin 12 mg + albenad 400 mg tab. , ivermectin 12 mg tab. , ivermectin 3 mg tab. , ivermectin 6 mg + albenadazole 400 mg tab. , ivermectin 6 mg tab. , ketaconazole + coaltar lotion , ketaconazole + zpto lotion , ketoconazole 200 mg tab. , ketoconazole lotion , ketorolac 10 mg tab , lactobacillus sporgenes 120 million tab. , letrozole 2.5mg tab , levetiracetam 250 mg , levetiracetam 500mg , levetiracetam 750 mg , levocetrizine + phenylpro + pcm tab. , levocetrizine 5 mg tab. , levofloxacin 250 mg tab. , levofloxacin 500 mg tab. , levofloxacin 750 mg tab. , levonorgestrol 0.75 mg tab. , lignocain hydroclorid 2% inj , linagliptin + metformin tab , linagliptin tab , lincomycin 2ml inj , lincomycin cap , linezolid syp , linezolide 600mg tab , liquide paraffine+ milk of magnesia + sodium picosulphate syp , lisinopril 5 mg tab. , lithium carbonate 300 mg tab. , lithium carbonate 450 mg tab. , loperamide tab. , loratadine 10 mg tab. , lorazepam 1 mg tab. , lorazepam 2 mg tab. , losartan + amlodipine tab. , losartan + atenolol tab. , losartan + hydrochlor. tab. , losartan 25 mg tab. , losartan 50 mg tab. , lycopen+vitamin cap , mebeverine 200 tab , mecobalamine + liopic acid + f. acid cap. , mecobalamine 1500 mcg tab. , metformin 1gm sustained release tab , metformin 500 mg sustained release tab , metformin 500 mg tab. , metformin 850mg tab , methotrexate 10 mg , methotrexate 2.5 mg , methotrexate 5 mg , methotrexate 7.5 mg , methyl ergometrine maleate 0.2 mg tab. , methyl prednisolone 16 mg tab. , methyl prednisolone 24 mg tab. , methyl prednisolone 4 mg tab. , methyl prednisolone 8 mg tab. , metoclopramide tab. , metoprolol 25mg , metoprolol 25mg + amlodipine 5 tab , metoprolol 25mg xl tab , metoprolol 50mg , metoprolol 50mg + amlodipine 5 tab , metoprolol 50mg xl tab , metronidazole + clorhexidin gel , metronidazole 200 mg tab. , metronidazole 400 mg tab. , mirtazapine 15 mg tab , monmtelukast 10 mg+fexofenadine 120 mg , montelukast 10 mg + levoce 5 mg tab. , montelukast 10 mg+fexofenadine hcl 120 mg+acebrophylline , mosapride 5mg tab , moxifloxacin + dexamethasone eye drop , multivitamin sogtgel cap. , mv + minerals cap. , myo inositol 1g+lmethyl folate 100mcg+vitamind3 cap , n 95 mask , naproxen + paracetamol tab. , naproxen 250 mg tab. , naproxen 250mg , naproxen 500 mg tab. , naproxen 500 mg+domperidone 10 tab , naproxen 750 mg tab. , natural progestirone 100 mg cap. , natural progestirone 200 mg cap. , nebivolol 5 mg + amlodipine 5 tab , nebivolol 5 mg tab , nicorandil 10mg tab , nicorandil 5mg tab , nifedipine 10 mg cap. , nifedipine 5 mg cap. , nifedipine extended release 10 mg tab , nifedipine extended release 20 mg tab. , nimesulide 100 mg + pcm500 mg tab. , nimesulide 100 mg + serratio 10 mg tab. , nimesulide 100 mg + tizanidine 2 mg tab. , nimesulide 100 mg tab. , nimesulide 200 mg tab. , nimesulide mouth disolving tab. , nitrofurantoin 100 mg , norethisterone 5 mg tab. , norfloxacin 400 mg + tinidazole 600 mg tab. , norfloxacin 400 mg tab. , ofloxacin + ornidazole tab. , ofloxacin 200 mg tab. , ofloxacin 400 mg tab. , olanzapine 10 mg tab. , olanzapine 15 mg tab. , olanzapine 5 mg tab. , olmesartan + hydrochlorthiazide tab , olmesartan 20 tab , olmesartan 20 tab chlorthalidone 12.5 , olmesartan 40 tab , omeprazole + domperidone cap. , omeprazole 20 mg cap. , ondansetron + ranitidin tab. , ondansetron 4 mg tab. , ondansetron 8 mg tab. , oral rehydration salts ( o.r.s. ) , ornidazole 500 mg tab. , oxcarbazepine 150mg , oxcarbazepine 300mg , oxymetazolin nasal solution ( a ) , oxymetazolin nasal solution ( p ) , pancreatin tab , pantoprazole + domperidone cap. ( dsr ) , pantoprazole + itopride cap. , pantoprazole + levosulpride tab. , pantoprazole 40 mg tab. , pantozocine tab. , paracetamol + camylofin tab , paracetamol 500 mg tab. , paracetamol 650 mg tab. , phenobarbitone 30 mg tab. , phenobarbitone 60 mg tab. , phenytoin 100 tab , phenytoin 300 er tab , phenytoin syp , pioglatazone 15 mg tab. , pioglatazone 30 mg tab. , piracetam + citicoline tab , piracetam 800mg tab , piroxicam 20 mg dt tab. , povidone iodin + metronidazole lotion , povidone iodin gergle 100ml , povidone iodin lotion 100ml , prazocin 1 mg tab. , prazocin 2 mg tab. , prazocin xl 2.5 tab , prazocin xl 5 mg , pre pro biotic cap , pre probiotic sachet 1x1 , prednisolone 10 mg tab. , prednisolone 20 mg tab. , prednisolone 40 mg tab. , prednisolone 5 mg tab. , pregabalin 75 mg + meco 750 mcg cap. , pregabalin 75 mg cap. , pregabalin 75 mg+nortriptyline 10mg , pregabaline 75 mg+nortriptyline 10 mg+methylcobalamine 1500 mc , pregnancy test card , premethrine 5% lotion , premethrine soap , primaquin 15mg tab. , primaquin 7.5mg tab. , prochlorperazine tab , promethazine 10 mg tab. , promethazine 5 mg tab. , propranolol 10 mg tab. , propranolol 20 mg tab. , propranolol 40 mg sr tab. , propranolol 40 mg tab. , protein powder , quetiapine 100 mg , quetiapine 50 mg , rabeprazole + domperidone dsr cap. , rabeprazole + itopride cap. , rabeprazole + itopride cap. , rabeprazole + levosulpride cap. , rabeprazole 20 mg tab. , racecadotril 100 mg , racecadotril sachet , ramipril 10 mg tab. , ramipril 2.5 mg tab. , ramipril 5 mg tab. , ranitidine + domperidone tab. , ranitidine 150 mg tab. , ranolazine 500mg , resperidone 2 mg tab. , resperidone 3 mg tab. , resperidone 4 mg tab. , riboflavin10mg, folic acid, niacinamide 100mg , rosehip powder cap , rosuvastatin 10 + finofibrate tab , rosuvastatin 10 tab , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 20 tab , roxythromycin 150 mg tab. , roxythromycin 50 mg tab. , sachet antacid , salbutamol 2 mg tab. , salbutamol 4 mg tab. , scanidazole 1 gm tab. , serratiopeptidase 10 mg tab. , serratiopeptidase 5 mg tab. , sertaline 25 mg tab. , sertaline 50 mg tab. , sidenafil 100 mg tab. , sidenafil 50 mg tab. , silodosin 4 mg , silodosin 4 mg + dutasteride 0.5 mg , silodosin 8 mg , silodosin 8 mg + dutasteride 0.5 mg , silver nitrate + chlorhexidine cream , silver sulphadiazine + chlorhexidine oint. , silver sulphadiazine oit. , sitagliptin 100 tab , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 tab , soap anti acne , sodium chloride nasal spray , sodium picosulphate syp , sodium picosulphate tab. , sodium valproate 200 mg tab. , sodium valproate 300 mg tab. , sodium valproate 500 mg tab. , spironolactone + aldectone tab. , spironolactone 100 mg tab. , spironolactone 25 mg tab. , spironolactone 50 mg tab. , sun screen lotion , sur. abdominal binder , sur. adapter 3 way , sur. adhesive plaster ( cloth ) , sur. arm pouch sling , sur. asepto syringe , sur. b.k. skin traction kit , sur. b.k. sponge traction kit , sur. b.p. blade 10 , sur. b.p. blade 11 , sur. b.p. blade 15 , sur. b.p. blade 22 , sur. b.p. blade 23 , sur. b.p. blade 24 , sur. b.t. set , sur. bactigras , sur. band aid , sur. bandage 2 , sur. bandage 4 , sur. bandage 6 , sur. barbers thread60 , sur. barbers thread80 , sur. barbers thread 40 , sur. bed pan , sur. cap , sur. cervical collar , sur. chest belt , sur. clavicular brace , sur. cord clamp , sur. cotton 100 , sur. cotton 200 , sur. cotton 500 , sur. crd ( corrugated rubber drain ) , sur. crepe bandage 10 cm , sur. crepe bandage 15 cm , sur. crepe bandage 7.5 cm , sur. dispovan 1 ml , sur. dispovan 10 ml , sur. dispovan 2 ml , sur. dispovan 20 ml , sur. dispovan 5 ml , sur. dispovan 50 ml , sur. dynaplast , sur. flatus tube , sur. foleys catheter12 no. , sur. foleys catheter20 no. , sur. foleys catheter8 no. , sur. foleys catheter 10 no. , sur. foleys catheter 14 no. , sur. foleys catheter 16 no. , sur. foleys catheter 18 no. , sur. gastric levage tube , sur. gauze , sur. gel foam , sur. gloves 6 , sur. gloves 6½ , sur. gloves 7 , sur. gloves 7½ , sur. gloves 8 , sur. hernia mesh , sur. hydrogen peroxide 100 ml , sur. i.v. cannula 18 ( one way ) , sur. i.v. cannula 18 ( threeway ) , sur. i.v. cannula 20 ( one way ) , sur. i.v. cannula 20 ( threeway ) , sur. i.v. cannula 22 ( one way ) , sur. i.v. cannula 22 ( threeway ) , sur. i.v. cannula 24 ( one way ) , sur. i.v. cannula 24 ( threeway ) , sur. i.v. microdrip set , sur. i.v. set , sur. infant feeding tube 10 , sur. infant feeding tube 12 , sur. infant feeding tube 6 , sur. infant feeding tube 8 , sur. iol 20, 21, 22 no , sur. k 90 , sur. k 91 , sur. l.s. brace , sur. lap pad , sur. malleycots catheter 10 , sur. malleycots catheter 12 , sur. malleycots catheter 14 , sur. malleycots catheter 16 , sur. malleycots catheter 18 , sur. malleycots catheter 20 , sur. malleycots catheter 22 , sur. malleycots catheter 24 , sur. malleycots catheter 26 , sur. malleycots catheter 28 , sur. malleycots catheter 30 , sur. malleycots catheter 32 , sur. malleycots catheter 8 , sur. mask , sur. medicated soap ( savlon, dettol ) , sur. micropore 1 , sur. micropore 2 , sur. micropore 3 , sur. micropore 4 , sur. micropore 6 , sur. monocryl 1 , sur. monocryl 1.0 , sur. monocryl 2.0 , sur. monocryl 3.0 , sur. monocryl 4.0 , sur. mucous extractor , sur. nasal catheter , sur. neck arm pouch , sur. ng tube , sur. nitrofix , sur. paedia set , sur. pan rose drain , sur. patient dress female , sur. patient dress male , sur. pds 1 , sur. pds 1 0 , sur. pds 2 0 , sur. pds 3 0 , sur. pds 4 0 , sur. pds 5 0 , sur. plain rubber catheter ( all size ) , sur. plaster of paris 4 , sur. plaster of paris 6 , sur. polypropylene mesh , sur. profofol 10 ml , sur. profofol 20 ml , sur. prolene 1 pregabine , sur. prolene 1.0 , sur. prolene 2.0 , sur. prolene 3.0 , sur. prolene 4.0 , sur. prolene 5.0 , sur. romo suction drain 14 , sur. romo suction drain 16 , sur. romo suction drain 18 , sur. romo under water seal , sur. ryles tabe 10 , sur. ryles tabe 12 , sur. ryles tabe 14 , sur. ryles tabe 16 , sur. ryles tabe 18 , sur. ryles tabe 8 , sur. sanitary napkin , sur. scalp vein set 18 , sur. scalp vein set 20 , sur. scalp vein set 22 , sur. scalp vein set 24 , sur. silk 1 , sur. silk 1.0 , sur. silk 2.0 , sur. silk 3.0 , sur. silk 4.0 , sur. silk 5.0 , sur. skin grafting blade , sur. sofra tullae , sur. spinal needle no. 23 , sur. spinal needle no. 25 , sur. spinal needle no. 27 , sur. spirit 100ml , sur. sponge , sur. sponge tractian kit , sur. stapler , sur. stapples removal forcep , sur. stockinets , sur. suction catheter , sur. suction tube , sur. suction tubing set , sur. supra cath , sur. surgi gel , sur. surgical shirt , sur. surgical trouser , sur. t tube , sur. thermometer , sur. thermometer digital , sur. urinal , sur. urobag , sur. vickryl 1 , sur. vickryl 1.0 , sur. vickryl 2.0 , sur. vickryl 3.0 , sur. vickryl 4.0 , sur. vicryl rapide 1 , sur. vicryl rapide 1 o , sur. vicryl rapide 2 o , sur. vicryl rapide 3 o , syp. cefdinir 125 , syp. cefixime dry , syp. cefpodoxime proxetil dry , syp. cephalexin dry , syp. cet. + pph. + ammo. chloride + menthol 100ml , syp. codein + cpm 100ml , syp. codein + triprolidine 100ml , syp. colistin sulphate , syp. cyprohep. + tricholine citrate 200ml , syp. cyproheptadine , syp. cyproheptadine + sorbi. + tricho. 200ml , syp. dextro + brom + amm. c. + menth. 100ml , syp. dextro. + cpm + phenylpro. 100ml , syp. dextrome + guiph. + bromh. 100ml , syp. dextromethorphan cough syp sugar free , syp. enzyme ayurvedic , syp. fungal diastage + pepsin 200ml , syp. hydroxyzine , syp. iron , syp. iron iii , syp. lactulose 100 ml sus. , syp. lactulose 200 ml sus. , syp. levocetrizine 60 ml , syp. liver tonic 200 ml , syp. metoclopramide , syp. norfloxacin + metronidazole sus. , syp. ofloxacin , syp. ofloxacin + ornidazole sus. , syp. ondansetron , syp. paracetamol , syp. pcm + cpm + sod. citrate + pph , syp. pcm + promethazine , syp. piracetam 100 ml , syp. potassium chloride liquid , syp. potassium citrate + sodium citrate , syp. sodium picosulphate sus. , syp. terbutaline + brom + guiphen.100ml , syp. zinc acetate , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin 0.4 , tamsulosin 0.4 + dutasteride , tamsulosin 0.4 + finasteride 5 , tapentadol 100 , telmisartan 20 tab , telmisartan 20+amlodipine 5 +hydroch 12.5tab , telmisartan 40 + amlodipine tab , telmisartan 40 + chlorthalidone 12.5 tab , telmisartan 40 + chlorthalidone 6.25 tab , telmisartan 40 + clinidipine 10 + chlorthadone 12.5mg , telmisartan 40 + hydrochlorthiazide tab , telmisartan 40 tab , telmisartan 40+amlodipine 5 +hydroch 12.5 tab , telmisartan 80 + hydrochlorthiazide 12.5tab , telmisartan 80 tab , teneligliptin 20 mg tab , teneligliptin 20mg + metformin 500 mg , teneligliptin 20mg + metformine 1000mg , terbinafen 250 mg tab. , terbinafen 500 mg tab. , tetracycline cap. , thiocochicoside 4mg , thiocochicoside 4mg + etoricoxib , thiocochicoside 8mg , thiocochicoside 8mg + etoricoxib , thiolchicoside 4 + aceclofenec 100 tab , thiolchicoside 8 + aceclofenec 100 tab , thyroxine 100 mcg , thyroxine 25 mcg , thyroxine 50 mcg , thyroxine 75 mcg , ticagrelor 90mg tab , tinidazole 500 mg tab. , tolperisone 150 mg , topiramate 25 mg , topiramate 50 mg , torsemide 10 mg tab , torsemide 5mg tab , tramadol + paracetamol tab. , tramadol + pcm + diclofenac tab. , tramadol tab. , tranexamic acid + ethamsylate tab. , tranexamic acid + mefenamic acid tab. , tranexamic acid tab. , trifuoperazine + chlordiazepoxide tab. , trihexyphenidyl 2mg tab. , trypsin chymotrypsin tab. , trypsin chymotrypsin+paracetamol+aceclofenac tab , ursodeoxycholic acid 150 tab , ursodeoxycholic acid 300 tab , veldagliptin 50mg tab , veldagliptin+metformin 500 tab , veldagliptin+metformin1000 tab , vitamin b complex cap , vitamin c + zinc tab. , vitamin c tab. , vitamin e 400 mg cap , voglibose 0.2mg tab , voglibose 0.3mg tab , xylometazolin nasal solution ( a ) , xylometazolin nasal solution ( p ) , zoledronic acidinj 4 mg , zolpidem 10 mg tab. , zolpidem 5 mg tab....
28239104 rate contract of antibiotic disc for microbiology department penicilin g ( 10u ) , oxacilin ( 1mcg ) , ampicillin 10 ug , amoxycilin ( 20mcg ) , carbencillin ( 100 mcg ) , ticarcilin ( 15mcg ) , piperacilin ( 100mcg ) , amoxycilin + clavulanic acid ( 20/10 ) , ticarcilin + clavulanic acid ( 75/10mcg ) , piperacilin + tazobactum ( 100/10 ) , cefazolin / cephlothin ( 30/ ) , cefalexin ( 30 mcg ) , cefoxitin ( 30mcg ) , cefuroxime ( 30 mcg ) , cefoperazone ( 75 mcg ) , cefixime ( 5mcg ) , cefotaxime ( 30mcg ) , ceftriaxone ( 30 mcg ) , ceftazidime ( 30 mcg ) , ceftazidime + clavulanic acid ( 30/10 ) , cefoperazone + salbactum ( 75/10 ) , cefipime ( 30 mcg ) , imipenem ( 10 mcg ) , meropenem 10 ug , imipenem + edta , ertapenem ( 10mcg ) , aztreonam ( 30 mcg ) , vancomycin ( mic/vsa ) ( 30 mcg ) , tiecoplanin ( 30 mcg ) , polymyxin b ( 300 u ) , colistin ( mic ) ( 10mcg ) , amikacin ( 30 mcg ) , gentamycin ( 10 mcg ) , high gentamycin ( 120 mcg ) , netilmycin ( 320 mcg ) , tobramycin ( 10 mcg ) , streptomycin , high streptomycin , pristinomycin , tetracycline e ( 30 mcg ) , doxycycline ( 30 mcg ) , tigecycline ( 15 mcg ) , minocycline ( 30mcg ) , chloramphenicol ( 30 mcg ) , erythromycin ( 15 mcg ) , azithromycin ( 15 mcg ) , clarithromycin , linezolid ( 30 mcg ) , dalfopristin , norfloxacin ( 10 mcg0 , ciprofloxacin ( 5 mcg ) , ofloxacin ( 5 mcg ) , levofloxacin ( 5 mcg ) , clotrimoxazole ( 1 . 25/23 . 75 ) , nitrofurantoin ( 300 mcg ) , novobiocin , clindamycin ( 2mcg ) , lincomycin , fosfomycin ( 200u ) , furazolidone ( 50mcg ) , bacitracin ( 0 . 04 u ) , optochin ( 5 mcg ) , nalidixic acid ( 30 mcg ) , bile esculin disc , rifampicin , x factor disc , v factor disc , x + v factor disc , ceftarolin ( 30 mcg ) , ceftolozone tazobactum ( 30/10 mcg ) , ceftobiprol ( 30 mcg ) , daptomycin , levonadifloxacin , ceftazidim + avibactum ( 30/20 mcg ) , fluconazole ( 25mcg ) , voriconazole ( 1mcg ) , amphotericin b ( 100 units ) , itraconazole ( 10 mcg ) , ketoconazole ( 15 mcg ) , miconazole ( 10 mcg ) , nystantin ( 100 units ) , clotrimoxazole ( 10 mcg ) ...
28197675 supply drugs and medicines as per salt name and their combinations at drug stores run by confed , district wholesale coop bhandars and kvss in rajasthan 2 abiraterone 250mg tab 3 acarbose 50 mg tab 4 aceclofenaic + para tab 5 alprazolam 0.25 mg tab 1x10 6 alprazolam 0.25 mg tab 1x15 7 alprazolam 0.5 1x15 8 alprazolam 0.5 tab 9 amikacin 500 mg inj 10 amlodipin+ atenolol tab 11 amlodipine + atenolol tab 12 amlodipine 2.5 mg tab 13 amlodipine besilate 5mg tab 14 amoxycillin + claul 625 tab 15 amoxycillin+clav 625 mg tab 16 anacid 170ml syp 17 anstrazole 1mg tab 18 anstrazole 1mg tab 19 antacids syp 200 ml 20 anti oxi+ lyco+ miner cap 21 anti oxidant cap 22 anticold tab 23 atenol 50 mg tab 1x14 24 atenolol 50 mg tab 1x14 25 atorvastatin 10 mg tab 26 atorvastatin 10mg +aspirin 75mg 27 atorvastatin 10mg +aspirin 75mg 28 atorvastatin 20 mg tab 29 azithromycin 250 mg tab 1x10 30 azithromycin 250 mg tab 1x6 31 azithromycin 500 mg tab 1x10 32 azithromycin 500 mg tab 1x3 33 azithromycin 500 mg tab 1x6 34 b com+mv+mine+zinc forte cap 35 b com6mv+mine+zinc forte cap 36 b complex 200 ml syp 37 b complex cap 1x15 38 b complex forte+ vit 39 b complex tab 1x10 40 beclo+clotri+neomy 10 gm oint 41 beclo+clotri+neomy 5 gm 42 betahistine 16 mg tab 43 betahistine 8mg tab 44 bortezumib 2 mg inj 45 bortezumib 2 mg inj 46 cal carbonate + vitd3 syp 47 calcitrol seachet 48 calcium + vitd3 tab 49 calcium carbon + calcitriol + zinc 50 calcium carbon+ calcitriol + zinc 51 calcium citrate, calcitriol & vitamin k2 7tab 52 calcium citrate, calcitriol & vitamin k2 7tab 53 capecitabine 500 mg tab 54 capecitbine tab 55 capecitbine tab 500 mg 56 carvedilol 6.25 mg tab 57 cefixime 200 mg tab 58 cefuroxime axetil 250 mg tab 59 cefuroxime axetil 500mg tab 60 cefuroxime axetil 500mg tab 1* 61 cetrizine 10 mg tab 62 cholecalciferol tab 1x4 63 cilnidipine 10mg 64 cilnidipine 10mg 65 clonazepam 0.5 mg tab 66 clopidogrel 75mg + aspirin 75 ta 67 clotrimazole + beclomethasone 68 cyprohepatidine + sorbi+ tricho 69 dapagliflozin 10 mg 70 dapagliflozin 10 mg 71 dapagliflozin 10 mg 72 darbepoetin 40mg inj 73 deflazcort 6mg tab 74 diclo+ para+ chlorzox tab 75 diclofenac + diethyla+ met salt + oint 30gm 76 diclofenac + para+ tab 77 diclofenac + serra tab 78 diclofenac oint 30gm 79 diclofenic + para+ serra tab 80 dicyclomine 10+ mefenamic 250mg 81 domeperidone 10mg tab 82 dycerin 50 mg+ glucosamin 750 mgtab 83 enalapril 5mg tab 84 erythropoietin inj 4000 85 escitalopram 10mg + clonazepam0.5 ml 86 esomeprazole 40mg +domperidone 87 esomeprazole 40mg +domperidone 88 etoricoxib 120mg tab 89 etoricoxib 60 + thiocolchicoside 4 mg 90 etoricoxib 60 + thiocolchicoside 4 mg 91 etoricoxib 60mg tab 92 etoricoxib 90mg tab 93 febuxostat 40mg tab 94 fexofenadine 120mg 95 fexofenadine 180mg tab 96 fluconazole 150 tab 97 folic acid 5mg tab 98 folic acid 5mg tab 1x30 99 gabapentin 300 mg + mecobalamine 500mg 100 gabapentin 300mg cap 101 geftinmib tab 250 mg 102 gliclazide 80mg + metformin 500 103 glime 1mg + metfor 500 mg+ piogl 15mg tab 104 glime 2 mg + metfor 500+ piogl 15 mgtab 105 glimepride 1 mg + metformin 1000t 106 glimepride 1 mg + metformin 1000t 107 glimepride 1 mg + metformin 500 t 108 glimepride 1 mg tab 109 glimepride 2 mg + metformin 1000t 110 glimepride 2 mg + metformin 1000t 111 glimepride 2mg +metformin 500 tab 112 glimepride 2mg tab 113 glucosamine 750mg+ diacerein 50 mg+msm tab 114 human erythropoetin alfa inj 4000 iv 115 imatinib tab 400 mg 116 imatinib tab 400 mg 117 isosorbide mononitrare 20mg tab 118 lactoluse syp 20, ml 119 lenalidmide 10mg tab 120 levetiracetam 500 mg 121 levetiracetam 500 mg 122 levocetrizine tab 123 levofloxacin 500mg tab 1x5 124 lin oil + diclo sod+ methyl+ ment 125 losartan 50+ amlodipine 5 tab 126 losartan 50mg tab 127 losartan 50mg tab 128 losartan 50mg+ hydroch 12.5 mgtab 129 losartan pota 50+ amlodipine 5mg tab 130 lycopen cap 131 mandrolone dacanote 50 inj 132 mecobalamin + thiamine +pyridoxi 133 metformin 500mg tab 134 metformin 500mg tab 1x20 135 metformin sr 1gm tab 136 metformin sr 500mg tab 137 metoprolol 25mg tab 138 metoprolol 50mg tab 139 metoprolol xl 50mg tab 1x10 140 metoprolol xl 25mg tab 141 montelukast 10mg + levo.d hcl 5 142 multivitamin and minerals cap 143 nicorandil 5mg tab 144 nimesulide + para tab 145 ofloxacin 200mg tab 146 olemesartan 40mg tab 1x10 147 olmesartan 20mg & hydroch 12.5tab 148 olmesartan 20mg tab 149 omeprazole 20 cap 1x15 150 omeprazole+domp cap 1x15 151 ondensetron 4mg tab 152 pantoprazole 40mg +domp 30 mg sr cap 153 pantoproazole 40mg 154 paracetamol 650mg tab 155 paracetamol 500mg tab 156 piogilitazone 15mg tab 157 piogilitazone 30mg tab 158 piracetam 800mg tab 159 porpanolol 10mg tab 160 prazocin xl 2, 5mg tab 1x15 161 prazocin xl 5mg tab 1x15 162 prazosin hydrochloride 5mg 163 prazosin hydrochloride 5mg 164 prazosin hydrochloride 5mg 165 pregabalin 75mg & methycobalmin 750 mg cap 166 propanolol 40mg tab 167 rabeprazole 20mg + dom 10mg tab 168 rabeprazole 20mg + dom 30mg cap 169 rabeprazole 20mg tab 170 ramipril 2.5mg tab 171 ramipril 5mg tab 172 ranolazine 500mg 173 ranolazine 500mg 174 rosuvastatin 10mg +aspirin 75mg 175 rosuvastatin 10mg +aspirin 75mg 176 rosuvastatin 10mg tab 177 rosuvastatin 20mg tab 178 sertaline 50mg tab 179 silodosin 8 mg cap. 180 silodosin 8 mg cap. 181 silodosin 8 mg tab 182 sitagliptin 100mg 183 sitagliptin 100mg 184 sitagliptin 50 mg +metformin 500mg 185 sitagliptin 50 mg +metformin 500mg 186 sitagliptin 50mg 187 sitagliptin 50mg 188 tamsulosin .4mg +dutasteride .5mg 189 tamsulosin .4mg +dutasteride .5mg 190 tamsulosin 0.4mg tab 191 tamsulosin 0.4mg tab 1x15 192 telmisartan 20+amlodipine +hydroch tab 193 telmisartan 40 mg + amlodipin 5mg tab 194 telmisartan 40+amlodipine +hydroch tab 195 telmisartan 40mg + hydroch 12.5 mgtab 196 telmisartan 40mg tab 197 telmisartan 80 mg tab 198 telmisartan 80+hydrochlorothiazide tab 199 telmisartan 80+hydrochlorothiazide tab 200 teneligliptin 20mg 201 teneligliptin 20mg 202 teneligliptin 20mg + metformin 500mg 203 teneligliptin 20mg + metformin 500mg 204 terbutaline + guai+brom +menthol syp 100ml 205 thyroxine 100mg tab 1x1 206 thyroxine 25mg tab 1x1 207 ticagrelor 90mg tab 208 ticagrelor 90mg tab 209 ticagrelor 90mg tab 210 ticagrelor 90mg tab 211 tramadol 50mg+ paracetamol 375 mg tab 212 vildagliptina 50mg 213 vildagliptina 50mg 214 vildagliptina 50mg + metformin 500mg 215 vildagliptina 50mg + metformin 500mg 216 vitamin b complex cap 1x15 217 vitamin e tab 400ng 218 voglibose 0.2mg tab 219 voglibose 0.3mg tab 220 zoledronic acid inj 4 mg 221 zoledronic acid inj 4 mg 222 list of drugs and medicines with salt name and their combinations ( group b ) 223 aceclofenac sr tab 224 aciclovir 800 mg tab 1x10 225 albumin 100ml inj 226 alkaliser 100ml syp 227 alphal ipoic acid +mv +antioxi +ch 228 amlodipin 10mg tab 229 antacids tab 230 anti oxidant cap 231 arsinix trioxide inj 232 atenolol 25mg tab 233 atorvastatin 40 mg tab 234 azaciticline inj 235 b complex 200 ml syp 236 bendamustin 100 mg inj 237 bendamustin 100 mg inj 238 bevacizumnab inj 100 mg 239 bleomycin inj15 mg 240 bortezumib 2 mg inj 241 bortezumib 3.5mg inj 242 calcium + vitamin syp 243 capecitabine 500 mg tab 244 carboplatin 150 mg inj 245 carboplatin 150 mg inj 246 carboplatin 450 mg inj 247 carboplatin 450 mg inj 248 carvedilol 12.5 mg tab 249 caspofun xgin 50 mg inj 250 caspofunxgin 70 mg inj 251 cefixime 100 mg tab 252 ceftriaxone 1gm inj. 253 ceftriaxone 1gm+ sulbactm 500mg 254 cefuroxim 250 mg tab 255 cetrizine 30ml syp 256 cilnidipine 10 mg +telmisartan 40mg 257 cilnidipine 20 mg 258 cilnidipine 20 mg 259 cilnidipine 5mg 260 cinnarizine + domperidon tab 261 cinnarizine 25mg tab 262 cinnarzine 10mg tab 263 cipro +dexa eye drop 264 cipro +flucinolane + clorti cream 265 cipro 250 mg tab 266 ciprofloxacin eye / ear drop 267 ciprofloxin 500 mg 268 cisplatin 10 mg 269 cisplatin 10 mg inj 270 cisplatin 50 mg inj 271 cisplatin 50 mg inj 272 citicoline 500mg +piracetam 400mg 273 citicoline 500mg +piracetam 800mg 274 clobetasol 0 05%+ gentamicin 0 275 clonazepam 1mg tab 276 clotriamazole tab 277 clotrimazole oint 278 cyproheptadine 200ml syp 279 cytrabine 100 mg inj 280 cytrabine 100 mg inj 281 cytrabine 1000mg inj 282 cytrabine 500 mg inj 283 cytrabine 500 mg inj 284 dacarbizine 200 mg inj 285 dacarbizine 200 mg inj 286 dacarbizine 500 mg inj 287 dacarbizine 500 mg inj 288 dapagliflozin 5mg 289 dapagliflozin 5mg 290 darbepoetin 25mg inj 291 darbepoetin 60mg inj 292 daxotel inj 120 mg 293 daxotel inj 120 mg 294 ddripemem 500mg inj 295 dexamethason inj 296 dexamethasone + chloramphenicol 297 dexamethasone + ciprofloxacin 1 298 dexamethasone phos inj 299 dextromethopen + hydro+ bromhx +am 300 dextromethorphan 10+ guai 100 +br 301 diclofenac 50mg tab 302 diclofenac inj 303 diltiazem 30mg 304 diltiazem 60mg tab 305 diphenhydramine 14.08 + amni 38 syp 306 docetaxel 20 mg inj 307 docetaxel 20 mg inj 308 docetaxel 80mg 309 docetaxel 80mg inj 310 domeperidone dt 10mg tab 311 doxarubacin inj 10 mg 312 doxarubacin inj 10 mg 313 doxarubacin inj 50 mg 314 doxarubacin inj 50 mg 315 doxycycline 100 mg tab 1x8 316 doxycycline caps 317 drotaverine & mefenamic tab 318 ecitabine cap 500 mg 319 enalapril 10mg tab 320 enalapril 2.5mg tab 321 enapil 5 mg + amlodipine 5 mg tab 322 enoxaparin sodium 60mg inj 323 enzymes cap 324 enzymes syp 200ml 325 epirubicin 10 mg inj 326 epirubicin 10 mg tab 327 epirubicin 100 mg inj 328 epirubicin 100 mg inj 329 epribucin 50 mg inj 330 epribucin 50 mg inj 331 erlotinib 100mg tab 332 erlotinib 150 mg tab 333 erlotinib 150 mg tab 334 erythro protine inj 335 erythropoietin 10000 inj 336 erythropoietin 10000 inj 337 erythropoietin 40000 inj 338 erythropoietin 40000 inj 339 escitalopram 10mg tab 340 esomeprazole 40mg 341 esomeprazole 40mg 342 esomeprazole 40mg 343 etaner cept 250mg inj 344 etaner cept 50 mg inj 345 etophylin + theophylin 150mg tab 346 febuxostat 80mg tab 347 filgrastim pfs inj 300mg 348 filgrastim pfs inj 6mg 349 filgrastim pfs inj 300mg 350 fludocyte 50 mg inj 351 fluxoetin cap 352 fosapre ptant 150mg inj 353 frusemide 40mg tab 354 fusidic acid + beciomfth+ dipro c 355 fusidic acid cream 356 gatifloxacin 400 mg tab 357 gatifloxacin eye drop 358 geftinmib tab 250 mg 359 gemcitabine inj 1 gm 360 gemcitabine inj 1 gm 361 gemcitabine inj 20 mg 362 gemcitabine inj 200 mg 363 gemcitabine 1.4 mg inj 364 gentamicin 80mg inj 2 ml 365 gentamycin eye drop 366 ginsang + multi vit cap 367 glibenclamide 5mg + metformin 500 tab 368 glibenclamide smg tab 369 gliclazide 40mg tab 370 gliclazide 80mg tab 371 glipizide 5mg + metformin 500 372 glucosamine 500mg tab 373 griseofulvin 250 mg tab 374 haematinic with vitamins cap 375 human erythropoetin alfa inj 2000 iv 376 human erythropoetin alfa inj 4000 iv 377 human erythropoetin alfa inj 2000 iv 378 hydrocortisone 100 inj 379 ibandronate tab 380 ibandronate tab 381 ibuprofen 400 +para 325 mg tab 382 imatinib tab 100mg 383 imatinib tab 100mg 384 imatinib tab 100mg inj 385 indomethacin 75mg sr cap 386 indomethacin cap 387 irenotacan 100mg inj 388 irenotacan 100mg inj 389 irenotacan 40 mg inj 390 irenotacan 40 mg inj 391 iron + folic acid cap 392 iron 200ml syp 393 isosrbide mononitrare 10mg ta 394 ketoconazole 2% lot 395 lacto bacillus tab 1x15 396 lactoluse 100ml syp 397 lenalidmide 10mg tab 398 lenalidmide 5mg tab 399 letrazol 2.5 mg tab 400 levetiracetam 250mg 401 levetiracetam 750 mg 402 levocetrizine syp 403 levofloxacin 250 mg 404 levofloxacin 750mg tab 405 levofloxacin iv inj 100ml 406 levprolide inj 3.75mg 407 liq. paraffin + milk or magnesia 408 lisinopril 5mg tab 409 liver tonic 200 syp 410 loperamide 2mg tab 411 loratadine 10mg tab 412 luprolide depot 11.25 inj 413 luprolide depot 22.5 inj 414 lyophillzed doxetaxel inj 20 mg 415 lyophillzed doxetaxel inj 80 mg 416 magaldrate540 + simeth 50mg syp 417 mecobalamin 1500mg tab 418 mecobalamin 500mg inj 2ml inj 419 mecobalaminia lipo +facid +pyri 420 melphalan tab 2 mg 421 metformin 850mg tab 422 metformine 500mh+gliclazide 80 mhtab 423 metformin sr 1000mg tab 424 metformin sr 500mg tab 425 methylcobalami + mincrals cap 426 methylpredsolone 16 mg tab 427 methylpredsolone 4mg tab 428 methylpredsolone 8 mg tab 429 metronidazole 400mg tab 430 metronidazole inj 100ml 431 miconazole oint 10gm 432 mimesulide 100mg tab 433 minesulide gel 434 mirtazapine 15mg tab 435 misoprostol 200mg tab 436 momemtasone creasm 437 multivitamin soft gel cap 438 multivitamin syp 200ml 439 mycophenolate 500mg tab 440 nab paclitaxel 100 inj 441 nandrolone dacanote 25 inj 442 nano paclitaxel 100mg inj 443 nebivolol hydrochloride 2.5mg tab 444 nebivolol hydrochloride 5mg tab 445 nimesulide 100mg+tizanidine 2mg tab 446 nitroglycerin 2.6 tab 1x30 447 norfloxacin 400 tab 448 ofloxacin eye / ear drop 449 ofloxacin+ornidazol tab 450 olanzapine 5mg tab 451 oxaplatin 100mg inj 452 oxaplatin 100mg inj 453 oxaplatin 50 mg inj 454 oxaplatin 50 mg tab 455 paclitaxel inj 260mg 456 paclitaxel inj 260mg 457 paclitaxel 100mg inj 458 paclitaxel 100mg inj 459 paclitaxel 200 mg inj 460 paclitaxel 30 mg inj 461 paclitaxel 30 mg inj 462 paclitaxel 30 mg inj 463 paclitaxel 300 mg inj 464 paclitaxel 300 mg inj 465 pantoprazole inj 466 paracetamol 250mg syp 467 paracetamol tab 1x15 468 pegylated interferon alfa inj 1180mg 469 pemetrexed inj 100mg 470 pemetrexed inj 100mg 471 pemetrexed inj 500mg 472 phenobarbitone 30mg tab 473 phenobarbitone 60mg tab 474 piracetam 800mg tab 475 piroxicam disp 20mg tab 476 povidone 100ml liq 477 povidone 15gm oint 478 povidone 20gm oint 479 povidone oint 5gm 480 povidone powder 481 prazosin hydrochloride 2.5mg 482 prazosin hydrochloride 2.5mg 483 prazosin hydrochloride 2.5mg 484 pre & probiotic sachet 1x1 485 promethazine 25mg tab 486 propranolol40mg & alprazolam 0.25mg tab 487 quinine dthydrochloride inj 488 quinine sulpate 300mg tab 489 rijoximab inj 500 mg 490 rijoximab inj 500 mg 491 rijoximab inj 100 mg 492 rijoximab inj 100 mg 493 salbutamol 4mg tab 494 sertaline 100mg tab 495 silodosin 8 mg cap.+ dutasteride .5mg 496 silodosin 8 mg cap.+ dutasteride .5mg 497 sitagliptin 50 mg +metformin 1000mg 498 sitagliptin 50 mg +metformin 1000mg 499 sodium valproate cr 500mg tab 500 sorafenib 200mg tab 501 tacrolimus cap 1mg 502 tacrolimus cap 0.5mg 503 tacrolimus cap 0.5mg 504 tacrolimus 0.01% w / w ointment 505 tacrolimus 0.03% w / w ointment 506 tamzolamid tab 250 mg 507 tamzolamid tab 100mg 508 tamzolamid tab 100mg 509 tamzolamid tab 250 mg 510 temozolomide cap 20mg 511 temozolomide cap 100mg 512 temozolomide cap 100mg 513 temozolomide cap 20mg 514 teneligliptin 20mg + metformin 1000mg 515 teneligliptin 20mg + metformin 1000mg 516 terbipression inj 517 teripratide 750mg / ml inj 518 ticagrelor 60 mg tab 519 tigercyclin inj 520 tinidazole 500mg tab 521 tramadol inj 2ml 522 trastozumab 440 inj 523 ursodeoxycholic acid 300 mg tab 524 ursodeoxycholic acid 300 mg tab 525 vildagliptina 50mg + metformin 1000mg 526 vitamin c 500mg tab 527 voriconazole 200ml tab 528 zinc sulphate 60ml syp 529 zoledronic acid 5mg inj 530 zolpidem 5mg tab 531 list of drugs and medicines with salt name and their combinations ( group c ) 532 aceclofenac sr 200 mg tab 533 aceclofenac 100 mg tab 534 acyclovir 200 mg inj 535 acyclovir 200 mg tab 536 acyclovir 400 mg inj 537 acyclovir cream 538 adrenaline inj 539 albendazole drop 10ml 540 albendazole syp 541 all hydr + mag hydro+ dim. + sorb syp 200ml 542 amoxicillin 500 mg cap 543 amoxycillin 1.2 mg inj 544 amoxycillin 125 dry sup 545 amoxycillin 125 mg 30 ml syp 546 amoxycillin 250 mg 30 ml syp 547 amoxycillin 250 mg cap 548 antacid chew tab 549 antacid tab 1x9 550 artesunatge 50 mg tab 551 atenolol 100 mg tab 552 atenolol 100 mg tab 1x14 553 atenolol 50 mg + amlodipine 5 mg ta 554 atenolol 50 mg tab 555 atorvastain 10 mg + ezetimibe 10 mg tab 556 azithromycin +cefixime tab 1x6 557 azithromycin syp 558 azthromycin susp 100 mg 10 ml 559 azthromycin susp 200 mg 10ml 560 bandage 15 mtr 561 bandage 2x2.5 562 bandage 5mtr 563 bandaid 564 beclo+clotri+neomy 5 gm 565 beclomethason dipro 566 benzyl benzoate lotion 100 ml 567 betahistine tab 568 betamethasone lotion 569 betnameta sone tab 570 bisacodyl 5mg tab 571 boric acid 20gm 572 bromaxin dia cpm syp 573 bromhexine syp 574 buprenorphine 0.3 mg 2ml inj 575 c.p. 5 lac inj 576 calamine 100 ml lotion 577 calamine 3% diphen 1% lot 100 ml 578 calamine 50ml lotion 579 calcium + vita c inj 10 ml 580 calcium gluconate inj. 10 ml 581 cefadroxil 250 mg in 582 cefadroxil 250 mg tab 583 cefadroxil 500 mg inj 584 cefadroxil 500 mg tab 585 cefixime 50 dt tab 586 cefixime 50 mg tab 587 cefixime drops 10ml 588 ceforperazone 1gm inj 589 ceforperazone 500mg + sulbactum 590 cefotaxime 1gm inj 591 cefotaxime 500 mg inj 592 cefpodoxime proxetil 200 mg tab 593 cefpodoxime proxetil 50mg syp 594 cefpodoxime proxetil disp. 100 m 595 ceftazidime 1gm inj 596 ceftriaxone 1g+ tazobacctum 12 597 ceftriaxone 1gm +sulbact 598 ceftriaxone 250 inj 599 ceftriaxone 250 mg + sulbactm 250 600 ceftriaxone 250 mg + sulbactm 500 601 ceftriaxone 250 mg inj 602 ceftriaxone 250mg + sulbactm 125 603 ceftriaxone 500 inj 604 ceftriaxone 500 mg inj 605 cefuroxime 125 mg oral susp 606 cefuroxime axetil 250 mg 607 cefuroxime axetil 500 mg 608 cephalexin 125 mg dt tab 609 cephalexin 250 mg dt tab 610 cephalexin 250 mg tab 611 cephalexin 500 mg tab 612 cephalexin drop 10ml 613 cephalexin dry syp 614 cepodoxim 100mg tab 615 cepodoxim 200mg tab 616 cepodoxim syp 617 cetrizine + ambroxol tab 618 cetrizine + phenyl prop+ dextro s 619 cetrizine + pph+ ammo chlo + menth 620 cetrizine + pph+ammo chlo +menth 621 cetrizine hyd +pseudeph hyd +pcm 622 child tonic iron / calcium / vit 623 chiloramphenicol 1 mg inj 624 chiloramphenicol 1gm inj 625 chiloramphenicol 500mg cap 626 chiloramphenicol syp 627 chilrpheniramine 4mg + codeine 1 628 chloramphenicol 125 mg 60ml syp 629 chloramphenicol 250 mg cap 630 chlorhexidine 3% mouth wash 10 631 chloroquine phosphate 250 mg ta 632 chlorpheniramine + codein phos 633 chlorpheniramine + dextra + pcm +p 634 chlorpheniramine + pcm + phenylep 635 chlorquine 250 mg tab 636 chlorquine 500 mg tab 637 chlorquine ds tab 638 chlorquine syp 639 cinnarzine 10mg tab 640 cipro +dexa eye drop 641 cipro +flucinolane + clorti cream 642 ciprofloxacin 250mg 643 ciprofloxacin + fluocin + clotri 644 ciprofloxacin 500 + tinidanzole 500mg tab 645 ciprofloxacin iv inj 646 citicolin 500 mg tab 647 clarithromycin 250 mg tab 648 clavulanate pot + amoxycillin 649 clindamycim 1% gel 650 clobetasol 0.5 + miconazol 2 651 clobetasol pro 0.5% + miconazole 652 clotrimazol veg 653 clotrimazole + beclometh + neo 654 clotrimazole + beclomethasone + n 655 clotrimazole + fluclinolone + neom 656 clotrimazole 50 ml syp 657 clotrimazole power 658 co trimaxazole syp 659 codin + cpm + menthol 660 cotrimaxazole d.s. tab 661 cotton 500 gm 662 cotton woll 20gm 663 cpm 2.5 + ammonium chloride 125 +sod syp 664 cpm 2.5 ml + ammo+ chloride 1.25 + sod syp 665 cyprohepatidine + tricholine ci syp 666 cyproheptadine 4mg tab 667 d 1.0% 500ml 668 d 5% 1000ml inj 669 d 5% 500ml inj 670 d 25% 500ml inj 671 deca anabolin 50mg inj 672 dexamethasone + chloramphenicol 673 dexamethasone + ciprofloxacin 1 674 dexamethasone + neomycin 10ml 675 dexamethasone + neomycin 10ml 676 dexamethasone + ofloxacin 10ml 677 dexamethasone 0.5 mg tab 678 dexamethasone 5mg + phenyleph 5 679 dexamethasone phos inj 680 dextro 5ml + pheny 12.5 +cpm 2mg 681 dextromethorphan 10+ cpm+phenyl 682 dextromethorphan 5mg + pph+diphe 683 dextroproposyphen & hydroclo 684 dextroproposyphen + acetominophe 685 dextroproposyphene 65ml + para+ 686 dextropropoxiphen 65mg +pcm 325 687 diazepam 10mg tab 688 diazepam 2ml inj 689 diclofenac 50mg + serratiopeptidase 10mg tab 690 diclofenac eye drop 691 diclofenac poto 100 + pcm 500+ ser 692 diclofenic 100mg sr tab 693 dicyclomine + para 694 dicyclomine + para 695 dicyclomine 10mg 2 ml inj 696 dicyclomine drop 697 diphenhydramine 14.08+ amni 38+ x 698 diphenhydramine 25mg cap 699 disodium hydrogencitrate syp 700 dns 1000 ml 701 dns 500 ml 702 dobutamine 250 mg 5ml inj 703 domeperidone syp 704 domperidone 10+ pcm 500 mg tab 705 domperidone tab 706 doxylamine + pyridoxine + folic ac 707 electrolyte m 500 ml 708 enzymes cap 1x15 709 erythromycin +aloevera cream 710 erythromycin 250 mg 711 erythromycin 500mg tab 712 escitalopram 20mg tab 713 ethambutol 800mg tab 714 ethamsylate 250 tab 715 ethamsylate 2ml inj 716 ethamsylate 500 tab 717 etophylin + theeophylin 2ml inj 718 etophylin + theophyl in 300mg tab 719 etophyll ine 84.7mg + theoph 25.3 720 etophyllin + theophyllin tab 721 face mask 722 ferric + folicacid + cyanoco + sorbi syp 723 ferric+ folicacid tab 724 ferrous salt + folic acid syp 200 725 ferrous salt + folic acid tab 726 fluconazole 150 + azithromycin 1 727 fluconazole 50mg tab 728 fluoxetine + alprozolam tab 729 folic acid 5mg tab 730 fungal diastase 50 pcpsin 10 731 furazol idone 100 metronidazole 732 furazol idone tab 733 gabapentin 400 mg cap 734 gamabanzyl lot 735 gamabanzyl lot 736 gamma benzene hexachloride 1% 737 gatifloxacin 200mg + ornidazole 738 gauze 739 gentamicin 0.2% dexamethasone 740 gentamicin inj 2 ml 741 ginsang + multi vit 742 glucos c 100 + 200 gm 743 hacmatinic with vitamins 200ml 744 haematinic + vitamin+ folic acid cap 745 haematinic + zing cap 1x15 746 haematinic with vitamins syp 747 heparin sodium 50 i u gel 748 heparin sodium 50 i u +bengyl n 749 hydrogen peroxide 100ml 750 hydroxyprogesterone 250 inj 751 hydroxyprogesterone 500 inj 752 hyoscine butylbromide 10mg 753 hyoscine butylbromide 20mg 2 ml 754 hyoscine tab 755 ibuprofen 100 pcm 125 mg 60ml sy 756 ibuprofen 100 pcm 125 mg tab 757 ibuprofen 100 pcm 125 syp 758 ibuprofen 100 pcm 500 mg tab 759 ibuprofen 100 pcm 500 tab 1x15 760 intazyme cap 1x15 761 iron ( 111 ) hydr. poly cap 762 iron + folic acid cap ( g ) 1x15 763 iron 60ml syp 764 iron polymaltose comphfolic ac 765 isabgol 100 gm 766 iso sorbide monoitrate tab 767 isolyte p 500mg 768 isosorbide dinitrate 10mg tab 769 isosorbide mononitare 40mg ta 770 isosrbide dinitrate 5mg tab 771 ketoconazole 1% lot 772 lacobactllus tab 773 lactobacillus 60mill tab 774 lactolus tab 1x15 775 lansprazole 30mg cap 776 lefotaxime 1gm inj 777 lefotaxime 250mg inj 778 levamisole 150mg tab 779 levocetrizine + montelukast syp 780 levofloxacin 150mg 1x5 781 levofloxacin 500mg 782 levofloxacin 500mg tab 1x5 783 levonorgestrol 0.75 mg pills 784 lignocaile 30ml + adrenal in inj 785 lignocain hydroclorid 2% inj 786 lignocaine hydro 2% adrenaline 787 lincomycin 2ml inj 788 lincomycin cap 789 lisinopril 10mg tab 790 lisinopril 5mg+amlodipin 5mg 791 lithium carbonate 300mg tab 792 liver tonic 100 syp 793 loeramide 2mg tab 794 loratadine + ambroxol hci tab 795 loratadine 5mg +pseudoephedrine 796 lorazepam 1mg tab 797 lorazepam 2mg tab 798 los pot 50mg tab 799 losatan 50 + hydro 12.5 800 lycopen+vitamin tab 1x15 801 mcp inj 802 mcp tab 803 mecobalamin 500mg tab 804 mefenamic acid 500mg + diclo hyd 805 menadione sod 1 ml inj 806 meropenem 1gm inj 807 metformin+gl imepride tab 808 methycobalamine 2ml 1500mg inj 809 methyl + prednisolan tab 810 methyl cobalami tab 811 methylcobalami od tab 812 methylcobalamin alpha lip.+ro 813 methylcobalamin ivit 814 methylergometrine inj 815 methylergometrine inj 1x1 816 methylergometrine tab 817 metoclopramide inj 818 metro 100 ml 819 metronidazole + norfloxacin susp 820 metronidazole 200mg tab 821 miconazole nitrate + flucinole 822 mifepristone 200mg tab 823 minesulide + serrapep tab 824 misoprostol 200mtab 825 mosapride 5mg tab 826 mosapridecitrate 5mg tab 827 multivitamin +min+zinc cap 828 multivitamin 10ml inj 829 multivitamin 2ml inj 830 multivitamin drop 831 mvi inj ( g ) 832 nifeditine rt 20mg 833 nimesu+praa+serra tab 834 nimesulide 1% +methysalicylate oint 835 nimesulide 100mg + para 500 +ser tab 836 nimesulide 100mg +dicyclomine 2 837 nimesulide 100mg mouth diss tab 838 nimesulide 200mg tab 839 nimesulide 50+paracetamol 125m 840 nimesulide 50mg+para 125 ( neula 841 nimesulide dt 50mg tab 842 norfloxacin+tinidazole +betacyc 843 ns 500 ml 844 ofloxacin +metronidazole syp 845 ofloxacin +ornidazole syp 846 ofloxacin +tinidazole tab 847 ofloxacin inj 848 ofloxacin oral drop 849 ofloxacin syp 850 ofloxacin+dexamethasone drop 851 olanzapine 5mg tab 852 oleu 3% diclof 1.16% methyl 10 853 omeprazole 20mg cap 854 omeprazole 20mg +dom 10 mg cap 855 omeprazole 40mg tab 1x15 856 ondansetron 2ml inj 857 ondansetron 8mg tab 858 ondansetron md 4mg tab 859 ondensetron 4mg inj 860 ondensetron 8mg tab 861 ondensetron drop 862 ornidazole 500mg tab 863 ornidazole iv inj 100ml 864 ors 21.8 gm 865 ors 4 gm 866 ors powder 21gm 867 oxymethazole ine hydro nasla ors 868 oxytocin inj 869 pain kill oil 870 pantoprazole 40mg 871 pantoprazole 40mg + domperidone 30mg sr 872 pantoprazole+domp tab 873 paracetamol 100mg drop 874 paracetamol 125mg syp 875 paracetamol 2ml inj 876 paracetamol 650mg tab 877 paracetamol d / s syp 878 paracetamol+domperi ab 879 parafin 100ml 880 paralfin & milkof magnesia 881 pcm 125 mg +chlophe+sod cit+phe syp 882 pcm 450+brom 8mg +gui 100mg +cpm tab 883 pcm 500+serratio +aceclofenac tab 884 pcm 500mg tab 885 penicillin g potassium 200000 886 penicillin g potassium 400000 887 penicillin g potassium 4000000 888 penicillin g potassium 800000 889 pheniramine maleate 22.7 mg inj 890 pheniramine maleate 25mg inj 891 piracetam 400mg tab 892 piroxicam 40mg 2ml inj 893 piroxicam dt tab 894 polymer degarded gelatin 500m 895 potassium permegnate 20gm 896 povidone 250gm oint 897 povidone 500ml liq 898 prazosin 1mg tab 899 prazosin 2.5mg tab 900 prazosin 5mg tab 901 prednisolone 10mg tab 902 pregnancy test card 903 pregnency test card / kit 904 primaquine phosphate 15mg tab 905 primaquine phosphate 7.5 mg tab 906 promethazine 25mg 2ml inj 907 protine powder 20gm 908 pyra 1500 +rifa450+isonia 909 pyramethamine 25ml +sulpha 500 910 pyrazinamide 500mg 911 pyrazinamide 750 mg 912 quinine dthydrochloride inj 913 quinine sulpate 300mg tab 914 rabeprazole 20mg + dom 10mg tab 915 ranitidine 150+domperidone 10m 916 ranitidine 150mg tab 917 ranitidne 2ml inj 918 rifamicin 450 tab 919 risperidone 2mg tabroxithromyc 920 roxithromycin syp 921 roxituromycin 50mg tab 922 salbutamol 2mg +ambroxol 30mg syp 923 salbutamol tab 924 secnidazole 1gm tab 925 serratiopeptidase tab 10mg 926 sildenafil citrate 100mg tab 927 simvastatin 10mg tab 928 simvastatin 20mg tab 929 soda bi carb 25ml inj 930 sodium valaporate 200mg tab 931 sodiumbicarbonate inj 10ml 932 sparfloxacin 200mg tab 933 sparfloxin 100mg tab 934 sponge rolder 935 sterile gloves 936 streptomycin 1gm inj 937 streptomycin 2.75 inj 938 sucralfate 100ml susp 939 tadalafil 10mg tab 940 tadalafil 20mg tab 941 terbutaline sf syp 942 testosterone 250mg 1ml inj 943 tetanus toxoid inj 944 tetra cycline 250 mg cap 945 tetracycline 250mg tab 946 tobramycin & dexamethasone e / d 947 tobramycin 40mg inj 948 tobramycing 3% eye drop 949 tramadol hydrochloride inj 950 tramadol hydrochloride tab 951 uniron inj 952 urokinase 5lakh tu inj 953 vitamine b complex cap ( conci 954 vitamine e 200mg tab 955 vitamine e 400 mg tab 956 zinc sulphate 60ml syp...
27667899 supply of lincomycin 30mg./ml injection 2ml amp....
27638202 supply of lincomycin 500mg. cap. / tab....
27620285 tender for medicine supply in pddu hospital jaipur 1 abciximab inj 2 aceclofenac + serratiopeptidase tab 3 acenocoumarol tab 2mg ip 4 acetaminophen 325mg+ tramadol hydrochloride 37.5 mg tab 5 acetaminophen tab 650 mg 6 acetazolamide tablets i.p 250mg 7 acetyl salicylic acid ( aspirin ) tablet i.p 325mg 8 activated charcoal suspension 9 acyclovir and hydrocortisone cream 10 acyclovir cream 5% 11 acyclovir eye ointment 12 acyclovir inj 25 / ml 13 acyclovir intravenous infusion ip 250mg 14 acyclovir intravenous infusion ip 500mg 15 acyclovir oral suspension ip 400mg / 5ml 16 adapalene +clindamycin gel 17 adapalene 0.1 % w / v ointment 18 adapalene and benzoyl peroxide gel 19 adapalene lotion 20 albuterol inhalation 21 alemtuzumab inj 22 alendronate 10 mg tab 23 alendronate 35 mg tab 24 alendronate 70 mg tab 25 alendronate tab 26 alfacalcidol soft ge