Government Medical College - Rajasthan

34809893 supply of drug and medicine , essentail drug list of rmsc medicines , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , aceclofenac and paracetamol tablet 100 mg + 325 mg , acenocoumarol tablet 2 mg , acetazolamide tablet 250 mg , act kit containing 3 tablet of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg , act kit containing 3 tablet of artesunate ( 50mg each ) and 1tablet of sulphadoxine pyremethamine ( 500+25 ) mg , act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyremethamine ( 500+25 ) mg each , act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and 1 tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir injection250 mg , acyclovir injection500 mg , acyclovir suspension400 mg / 5ml , acyclovir tablet200 mg , acyclovir tablet 800 mg , adenosine injection6 mg / 2ml , adrenaline injection 1 mg / ml , albendazole oral suspension 400 mg / 10 ml , albendazole tablet ip 400 mg , alendronate sodium tablets usp / bp 35 mg , allopurinol tablet 100 mg , alpha interferon injection 3 million unit , alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , amikacininjection100 mg , amikacininjection 500 mg , amikacin injection250 mg , aminophylline injection25 mg / ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg / ml , amitriptyline tablets ip 25 mg , amlodipine and atenolol tablet 5 mg +50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin oral suspension ( dry syrup ) 125 mg / 5ml , amoxycillin trihydrate dispersible tablet 125 mg , amphotericin b injection 50 mg , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , antacidliquid , antacid tablet , anti a blood grouping serum ( anti a monoclonal serum ip ) , anti b blood grouping serum , anti drh blood grouping serum , anti inhibitor coagulation complex [ human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu ] , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg / 5ml , artemether + leumefantrine tablet ( 40 mg and 240 mg ) , artemether + leumefantrine tablet ( 80 mg and 480 mg ) , artisunate injection 60 mg ( combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) , ascorbic acid tablet 500 mg , aspirintablet ip ( gastro resistant ) 150 mg , aspirin delayed release tablet ( enteric coated ) 75 mg , atenolol tablet 25 mg , atenolol tablet 50 mg , atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , atracurium injection 10 mg / ml , atropine eye ointment 1% , atropine sulphate injection0.6 mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tablet ip 50 mg , azithromycin tablet ( dt ) 100 mg , azithromycin tablet 500 mg , azithromycin tablet ip 250 mg , aztreonam 1gm injection , aztreonam injection 500 mg , beclomethasone inhalation 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , benzathine benzylpenicillin injection 6 lac units , benzathine benzylpenicillin injection ip12 lac units , betahistine tabletip 8 mg , betahistine tablet ip 16 mg , betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , betamethasone sodiumphosphate injection 4 mg / ml , betamethasone tablet 0.5 mg , betaxolol eye drops 0.50% , biphasic isophane insulin injection30 / 70 ( 30% soluble insulin &70% isophane insulin ) 40 iu / ml , bisacodyl tablet 5 mg , black disinfectant fluid ( phenyl ) ( as per schedule o grade iii , bleomycin injection15 units , brimonidine tartrate and timolol eye drops0.15% + 0.5% , bromocriptine mesylate tablet2.5 mg , budesonide nebulizer suspension0.25 mg / ml , budesonide rotacap 200 mcg , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , calamine lotion ip , calcitriol capsule0.25 mcg , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu ) , calcium gluconate injection 10% , cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , cap. vitamin e 400 mg , capsuleprocarbazine hydrochloride usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , capsule lomustine ip 40 mg ( each capsule contains lomustine ip 40 mg ) , capsule mycophenolate mofetil usp 250 mg ( each capsule conatin mycophenolate mofetil usp 250 mg ) , capsule tacrolimus ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg / 5 ml , carbimazole tablet 5 mg , carboplatin injection 150mg , carboplatin injection 450mg , carboprosttromethamine injection0.25 mg / ml , carboxymethylcellulose sodium lubricant eyedrops 0.50% , cefepime injection500 mg , cefixime oral susp ( drops ) 25 mg / ml , cefixime tablet 100 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection 250 mg , ceftriaxone injection ip 1 g / vial , ceftriaxone injection ip 500 mg / vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5ml , cephalexin tablet ( dt ) 125 mg , cetirizine syrup 5 mg / ml , cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetrimide cream ip 0.50% , chlorambucil tablet 5 mg , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops 0.05% , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash bp 0.20% , chloridazepoxide tablets ip 10 mg , chloroquine phosphate injection 40 mg / ml , chloroquine phosphate suspension 50 mg / 5ml , chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) , chlorpheniramine maleate tablet 4 mg , chlorpromazineinjection ip 25 mg / ml , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip50 mg , chlorpromazinetablets ip 25 mg , chlorzoxazone, diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , cholecalciferol granules 60, 000 iu / 1gm , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , ciprofloxacin eye drops0.30% , ciprofloxacin injection 200 mg / 100 ml , ciprofloxacin ophthalmic ointment 0.30% , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , cisplatin injection 10 mg / 10 ml , cisplatin injection 50 mg / 50 ml , clindamycincapsule 150 mg , clindamycin capsule 300 mg , clindamycin phosphate gel usp 1% , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol cream 0.05% , clomiphene tablet 50 mg , clomiphene tablet ip 25 mg , clonazepam tablet 0.5 mg , clopidogrel and aspirin tablet 75 mg +75 mg , clopidogrel tablet ip 75 mg , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1% w / v ) 1% , clotrimazole vaginal tablet 500 mg , cloxacillin sodium injection 500 mg , coal tar 6% & salicylic acid 3% onitment , compoundbenzoin tinctureip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , compound sodium lactate injection , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , conjugated estrogen tablet 0.625 mg , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet160 mg + 800 mg , co trimoxazole tablet40 mg + 200 mg , cough syrup [ each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg ] , cough syrup / expectorant ( ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , cream mupirocin usp 2% ( each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base ) 15 gm size , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg / 5 ml , dacarbazine injection 500 mg , danazol capsule ip 50 mg , daunorubicininjection 20 mg , deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) 500 mg , dexamethasoneinjection 8 mg / 2ml , dexamethasone tablet 0.5 mg , dextromethorphan hydrobromide syrup 13.5 mg / 5ml , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic stip for sugar, ketone , diagnostic stip for sugar, protein , diatrizoate meglumine and diatrizoate sodium inj usp60% ( iodine conc.292 mg / ml ) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w / v ( iodine conc.370 mg / ml ) 76% , diazepam injection10 mg / 2ml , diazepam tablet 5 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg / ml , diclofenac sodium tablet 50 mg , diclofenac tablet ( sr ) 100 mg , dicyclomineinjection 10 mg / ml , dicyclominetablet 10 mg , dicyclomine and paracetamol tablet 20mg + 325mg , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine hydrochloride oral solution ip10 mg / 5ml , diethylcarbamazine tablets ip 100 mg , digoxin injection 0.25 mg / ml , digoxin tablet 0.25 mg , diltiazem tablet 30 mg , dinoprostone cream0.5 mg , diphtheria antitoxin 10, 000 iu , dobutamineinjection 50 mg / ml , domperidone oral drops 10 mg / ml , domperidone suspension 5 mg / 5ml , domperidone tablet 10 mg , dopamine hydrochloride injection40 mg / ml , doxorubicin injection50 mg / 25 ml , doxycycline capsule 100 mg , dried factor viii fraction ( iv use ) 1000 iu , dried factor viii fraction ( iv use ) 250 iu , dried factor viii fraction ( iv use ) 500 iu , drotaverine & mefenamic acidtablet 80 mg + 250 mg , drotaverine hydrochloride injection 40 mg / 2ml , drotaverine tablet 40 mg , enalapril maleate tablet 10 mg , enalapril maleate tablet 2.5 mg , enalapril maleate tablet 5 mg , enoxaparin sodium injection 60 mg , escitalopram tablets ip10 mg , ethamsylate injection 250 mg / 2ml , ethinyloestradiol tablet ip 50 mcg , etoposide injection 100 mg / 5 ml , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , eye drop moxifloxacin0.5% w / v ophthalmic solutionip 5ml size , factor – ix concentrate 600 iu , fenofibrate capsule 200 mg , fentanyl citrate injection50 mcg / ml , fentanyl citrate injection50 mcg / ml , feracrylum 1% w / w sterile solution 100 ml , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab. ( paediatric ) 20 mg + 0.1 mg , filgrastim injection 300mcg / ml , finasteride tablet 5 mg , flavoxate tablet 200 mg , fluconazole eye drops0.3% , fluconazole tablet 150 mg , flunarizine tablet 5 mg , fluorouracil injection 250 mg / 5 ml , fluoxetine capsule ip 20 mg , flurbiprofen sodium ophthalmic solution 0.03% , folic acidtablet ip 5 mg , formaldehyde solution ( 34.5% 38% ) , formoterol & budesoniderotacap 6 mcg+ 200 mcg , framycetin sulphate cream 1% , framycetin sulphate cream 1% , furosemide injection 10 mg / ml , furosemide tablet 40 mg , fusidic acid cream2% , gabapentine tablet / capsule 100 mg , gabapentine tablet / capsule 300 mg , gadodiamide injection0.5 mmol / ml , gamma benzene hexachloride lotion ( lindane lotion usp ) 1% , gemcitabine injection 1gm , gemcitabine injection 200 mg , gentamycin injection 80 mg / 2ml , gentian violet topical solution usp 1% , glibenclamide and metformin hydrochloride ( sr ) tablet 5 mg + 500 mg , glibenclamide tablet 5 mg , gliclazideand metformin tablet 80 mg + 500 mg , gliclazide tablets ip 40 mg , glimepiride tablet 1 mg , glimepiride tablet 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sr ) tablet2mg + 15mg + 500mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glipizide tablet ip 5 mg , glucagon injection usp 1 mg / ml , glutaraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablet 2.6 mg , glycopyrrolate injection 0.2 mg / ml , griseofulvin tablets 125 mg , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , haloperidol injection 5 mg / ml , haloperidol tablet5 mg , haloperidol tablet 1.5 mg , halothane , hameodialysis bicarbonate solution , heparin sodium injection 5000 iu / ml , homatropine eye drops 2% , humanalbumin solution 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection ( im use ) 300 mcg , human rabies immunoglobulin injection 150 iu / ml , hyaluronidase injection 1500 iu , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , hydrocortisone sodium succinate injection 100 mg base / vial , hydrogen peroxide solution 6% , hydroxychloroquine sulphatetablet 200 mg , hydroxyethyl starch ( 130 / 4 ) 6% w / vwith sodium chloride 0.9% w / v intravenous infusion , hydroxyprogesterone injection 250 mg / ml , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg / ml , hydroxyzine tablet 25 mg , hyoscine butylbromide injection ip 20 mg / ml , hyoscine butylbromide tablet 10 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen oral suspension 100 mg / 5ml , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ifosfamide injection 1gm , imatinib tablet 400 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , indomethacin capsule 25 mg , injbendamustine 100 mg , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg / 500mg ip powder for solution , inj colistimethate ip 1m iu powder for solution , inj diclofenac sodium aqueous 75mg / ml1ml size, iv & im use , inj human chorionic gonadotropin ip 5000 i.u. , inj meropenem ip 250 mg , inj piperacillin 2 gm + tazobactom 250mg usp , inj poractant alpha 80 mg / ml in pack of 1.5 ml , inj prochlorperazine mesylate 12.5mg / ml 5ml size , inj tranexamic acid ip 100mg / ml 5ml size , inj zoledronic acid ip 4mg / 100ml 100ml size , inj. amino acid 10% 100ml size , inj. bevacizumab 100 mg , inj. bevacizumab 400 mg , inj. bortezomib 2mg , inj. butorphanol tartrate usp 1mg / ml 1ml size , inj. caffeine citrate usp 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , inj. ceftriaxone 1 gm + tazobactum 1.25 gm , inj. cis atracurium besylate 2 mg / ml in 5 ml vial , inj. esmolol hydrochloride 10mg / ml 10ml size , inj. ferric carboxymaltose 50 mg / ml 10 ml size , inj. ganciclovir sodium 500mg ( lyophilized powder for reconstitution ) , inj. hepatitis b immunologlobin ip 100 i.u , inj. liposomol amphotericine b 10 mg , inj. n butyl alcohol 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , inj. polymixin sulphate b usp 5 lac i.u. , inj. sodium nitroprusside25mg / ml2ml size , inj. voriconazole200mg / vial , insulin glargine100 iu / mlwith 30 insulin syringes with needle , insulin glargine 100 iu / ml with 15 insulin syringes and needles / cartridge 100 iu / ml with 15 needles and 1 pen per 20 cartridges , intravenous fat emulsion 20% w / v ( pl / tg ratio 0.06 ) 250ml , iohexol ( non ionic contrastmedium in sterile aqueous solution ) 300 mg iodine / ml. , iohexol usp ( solution for injection ) non ionic contrastmedium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium rotacap40 mcg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg / ml usp / bp 20 mg / ml ( for iv use ) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , isoflurane , isophane insulin injection40 iu / ml , isoprenaline injection 2mg / ml , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , isoxsuprine injection 5 mg / ml , isoxsuprine tablet 20 mg , itraconazole capsule 100 mg , ketamine injection 50 mg / ml , ketoconazole cream 2% , labetalol hydrochloride injection 20 mg / 4ml , labetalol tablet 100 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm / 15ml , l asparaginase injection 10000 iu , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , leucovorin calcium injection 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500 mg / 5ml , levetiracetam oral solution suspension 100 mg / ml , levetiracetam tablet 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , levofloxacin tablet250 mg , lidocaine hydrochloride topical solution usp 4% , lignocaineointment 5% , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , lignocaine gelip 2% , lignocaine injection 2% , linezolid injection 200 mg / 100 ml , linezolid tablet ip 600 mg , liquid paraffin ip , liquid paraffin ip , lisinopril tablet 10 mg , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lithium carbonate tablet 300 mg , loperamide tablet ip 2 mg , lorazepam injection2 mg / ml , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , losartan tablet 25 mg , losartan tablet 50 mg , lysol ( cresol with soap solution ) ( cresol 50% + soap 50% ) , magnesium sulphate injection ( 50% ) 500 mg / ml , mannitolwith glycerin injection 10% + 10% , mannitol injection 20% , mecobalamin injection 500 mcg / ml , medroxyprogesterone acetate tablet ip 10 mg , mefenamic acid tablet 500 mg , mefloquine tablet250 mg , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , meropenem injection 1 g , meropenem injection 500 mg , metformin hydrochloride ( sr ) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride ( sustained release ) and glimepiride tablet500 mg + 2 mg , metformin hydrochloride sr tablet 1000 mg , metformin tablet 500 mg , methotrexate injection 50 mg / 2 ml , methotrexate tablet 2.5 mg , methotrexate tablet ip 10 mg , methyl prednisolone sodium succinate for injection 500 mg , methylcobalmin tablet 1500 mcg , methylcobalmin tablet 500 mcg , methyldopa tablet 250 mg , methylergometrine injection 0.2 mg / ml , methylergometrine tablet ip 0.125 mg , metoclopramide injection 10 mg / 2ml , metoclopramide syrup 5 mg / 5ml , metoclopramide tablet 10 mg , metoprolol suscinate tablet ( extended release ) usp 50 mg , metoprolol tablet ip 25 mg , metronidazoleinjection 500 mg / 100 ml , metronidazole and chlorhexidine gel 1%+ 0.25% , metronidazole benzoate oral suspension 100 mg / 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , miconazole nitrate cream2% , midazolam injection ip 1 mg / ml , mifepristone tablet200 mg , misoprostol tablet 200 mcg , mitomycin c injection 10 mg , montelukast 10 mg + levocetrizine 5mg tablet , morphine sulphate injection ip 10 mg / ml , multi vitamin syrup , multiple electrolytes & dextrose injection type iip ( electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip ( electrolyte m injection ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , n acetylcystine injection 200 mg / ml , naloxone injection ip 0.4 mg / ml , naproxen tablet ip 250 mg , naproxen tablet ip 500 mg , natural micronisedprogesteron soft gelatin capsule 200 mg ( each soft gelatin capsule containsprogesteron ip 200 mg ) , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , neomycin, polymixin b & hydrocortisone ear drops / otic solution usp ( neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml ) , neostigmine injection 2.5 mg / 5ml , neostigmine injection ip 0.5 mg / ml , neostigmine tablets ip 15 mg , nifedipine capsule 5 mg , nifedipine tablet ( sustained release ) 10 mg , nitrofurantoin tablet 100 mg , nitroglycerininjection 5 mg / ml , noradrenaline injection 2 mg / ml , norethisterone tablet 5 mg , norfloxacintablet 400 mg , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin injection 200mg / 100 ml , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin suspension 50 mg / 5 ml , ofloxacin tablet 200 mg , oint. terbinafine 1%w / w ( 10 gm tube ) , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , olanzapine tablet5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v usp ( e / d ) 5ml size , omeprazole capsule 20 mg , ondansetron injection 2 mg / ml , ondansetron orally disintegrating md tablet4 mg , ors powder , oseltamivir 30 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate oral suspension ip 12 mg / ml ( each ml contains : 12 mg oseltamivir after reconstitution , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg / ml. ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection 50 mg , oxytocin injection 5 iu / ml , paclitaxel injection 100 mg , paclitaxel injection 260 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , pantoprazole injection 40 mg , paracetamoldrops 150 mg / ml , paracetamolsyrup ip 125 mg / 5ml , paracetamoltablet 500 mg , paracetamol infusion ip 1% w / v 100ml size , paracetamol injection 150 mg / ml , pentazocine injection 30 mg / ml , peritonial dialysis solution ip , permethrinlotion 5% , permethrin cream 5% , pheniramine injection 22.75 mg / ml , phenobarbitone injection ip 200 mg / ml , phenobarbitone tablet 30 mg , phenylephrine hydrochloride ophthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection 50 mg / ml , phenytoin oral suspension 25 mg / ml , phenytoin tablet 100 mg , pioglitazone tablet ip 15 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride injection0.15 gm / ml , potassium chloride oral solution usp500 mg / 5ml , povidone iodine ointment 5% , povidone iodine ointment 5% , povidone iodine scrub solution / cleansing solution 7.5%w / v povidone iodine 7.5% , povidone iodine solution10% , povidone iodine solution5% , povidone iodine solution5% , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection 25 mg / ml , prazosin tablet ( extended release ) 2.5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , prednisolone tablet 5 mg , pregabalin capsule ip 75 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesteroneinjection 200 mg / 2ml , promethazinesyrup ip 5 mg / 5ml , promethazine injection 25 mg / ml , promethazine tablet 25 mg , propofol injection 10 mg / ml , propranolol tablet 40 mg , pyridoxine tablet40 mg , pyridoxine tablet 10 mg , quetiapine tablet ip 25 mg , quetiapine tablet ip 50 mg , quinine dihydrochlorideinjection 300 mg / ml , quinine sulphate tablet 300 mg , rabies antiserum ip ( equine ) ( i.m. / sc use ) 300 units / ml , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose , ramipril tablet / capsule 2.5 mg , ranitidine hcl injection 50 mg / 2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , ringer acetate infusion 500 ml , risperidone tablet2 mg , risperidone tablet 1 mg , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution 5 mg / ml , salbutamol syrup ip 2 mg / 5ml , salbutamol tablet 2 mg , saline nasal solution ( drops ) 0.65% , sertraline tablet 50 mg , sevoflurane , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , snake venom anti serum ( polyvalent anti snake venom ) lyophillized , sodium bicarbonate injection ip 7.5% , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , sodium phosphates enema bp , sodium valproatetablet 200 mg , sodium valproate ipinjection 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate ( gastro resistant ) ip tablet 500 mg , soluble insulin injection 40 iu / ml , spironolactone tablet 25 mg , spironolactone tablet 50 mg , streptokinase injection 15 lac units , succinylcholine injection 50 mg / ml , sulfasalazine delayed release tablet 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical spirit bp , surgical spirit bp , syp. alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , tab abiraterone acetate ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , tab baclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tab cabergoline ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , tab cyclophosphamide ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , tab dexamethasone ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg ) , tab ethamsylate bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , tab gefitinib ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , tab lacosamide 100 mg ( each film coated tablet contains lacosamide 100 mg ) , tab lamotrigine ip50 mg ( eachsustained releasetablet contains lamotrigineip 50 mg ) , tab letrozole usp2.5 mg ( each film coated tablet containsletrozole usp2.5 mg ) , tab levamisol hydrochloride ip 50 mg ( each uncoated tablet conatinlevamisol hydrochloride ip 50 mg ) , tab oxcarbazepine ip150 mg ( each film coated tablet contains oxcarbazepine ip150 mg ) , tab pyridostigmine usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) , tab rosuvastatin 10 mg , tab rosuvastatin ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , tab savelamer carbonate 400 mg ( each film coated tablet containssavelamer carbonate 400 mg ) , tab sodium bicarbonate usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , tab tizanidine hydrochloride ip 2 mg ( each uncoated tablet containstizanidine hydrochloride ip 2 mg ) , tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , tab. acebrophylline 100 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) , tab. carvedilol 3.125 mg , tab. clonidine hydrochloride usp 0.1 mg ( each tablet contains clonidine hydrochloride usp 0.1 mg ) , tab. dutasteride 0.5 mg , tab. entecavir ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , tab. faropenem sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , tab. ketorolac 10 mg , tab. levofloxacin ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , tab. levosulpiride 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , tab. lorazepam ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , tab. mesalamine usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , tab. mycophenolate sodium 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , tab. sacubitril 24 mg and valsartan 26 mg , tab. sotalol hydrochloride usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , tab. terbinafine hydrochloride 250 mg , tab. valganciclovir 450 mg , tab. zolpidem 5 mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , tab.phenazopyridine 5 mg , tamoxifen tablet 10 mg , tamsulosinhcltablet 0.4 mg , telmisartan tablet ip 40 mg , tenaligliptin tablet 20 mg , terbutaline sulphate tablet ip 2.5 mg , tetanus immunoglobulin 250iu , tetanus vaccine ( adsorbed ) ip , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet ( sr ) 400 mg , thiamine tablet 100 mg , thiopentone injection 0.5 g , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , timolol eye drops 0.50% , tinidazole tablet ip 300 mg ( film coated ) , tinidazole tablet ip 500 mg ( film coated ) , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , torsemide injection10 mg / ml , torsemide tablet 10 mg , tramadol capsule 50 mg , tramadol injection 50 mg / ml , tranexamic acid tablet 500 mg , travoprost ophthalmic solution 0.004% , tretenoin cream 0.03% , trifluperazine tablets ip5 mg , trihexyphenidyl hydrochloride tablet 2 mg , tropicamide eye drops 1% , urokinase injection 5 lac unit , ursodeoxycholic acid tablet 300 mg , valethamate bromide injection 8 mg / ml , vancomycin for intravenous infusion ip 1 gm , vancomycin injection 500 mg , vdrl antigen ( with +ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4 mg ( freeze dried ) , verapamil tablets ip 40 mg , vinblastineinjection 10 mg / 10 ml , vincristineinjection 1 mg / ml , vitamin a solution 1 lac iu / ml , vitamin b complex injectionnfi , vitamin b complex tablet nfi ( prophylactic ) , vitamin d3 oral solution 60000 iu , vitamin k injection10 mg / ml , vitamin k 1 ( phytomenadione ) 1 mg / 0.5ml injection , warfarin sod. tablet 5 mg , water for injection ip , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , xylometazolinenasal drops 0.1% , zinc sulphate dispersible ip elemental tablet 10 mg , essentail drug list of rmsc medicines , 6 mercaptopurine tablet 20mg , acebrophylline sr tablet 200mg , aceclofenac and paracetamol and serratiopeptidase tablet ( 100 and 325 and 15 mg ) , acetic acid otic solution 2% ear drop , acitretin cap ip 10 mg , adalimumab 40 mg injection , adaplene ( 0.1% w / w ) gel , amantidine tablet 100mg , ambroxol drop , ampicillin and salbactum 1.5g injection , apixaban tablet 2.5mg , apixaban tablet 5mg , artemether 40mg and lumefantrine 240 mg 30ml syrup , aspirin dispresible tablet 325mg , aspirin tablet ip 300mg , astymine c ( vitamin c and essential amino acid ) drop , azithromycin oral suspension 200mg / 5ml syrup , b. complex syrup , baclofen oral solution 5 mg / ml syrup , bortezomib 2.5 injection , bosentan tablet 62.5mg , botulinum toxin type a for injection / botulinum toxin type b for injection 100 iu injection , brinozolamide and brimonidine eye drop , brivaracetam tablet 50mg , budesonide 0.5mg / ml respules , budesonide 1ml respules , budesonide 200 mcg. mdi , budesonide capsule 9mg , caffeine cirate 20mg / ml injection , caffiene citrate oral solution oral drop , calcium acetate tablet 667 , calcium gluconate / folinate injection , carbimazole tablet 10mg , carboxymethylcellulose and glycerin eye drop , cefipime 1000mg and tazobactum 125mg injection , cefixime oral suspension 100mg syrup , cefixime oral suspension 50mg syrup , cefpodoxime oral suspension 20mg / ml drop , cefpodoxime proxetil oral suspension 50mg syrup , cefpodoxime proxetil tablet 100mg , cefpodoxime tablet cv 375 , ceftazidime 1gm and sulbactam500 mg injection , cefuroxime axetil oral suspension 125mg / 5ml syrup , cefuroxime axetil tablet 500mg. , ceritinib capsule 100mg , ceritinib capsule 200mg , chloramphenicol 0.5% eye ointment , chloramphenicol and polymycin eye ointment , chlordiazepoxide tablet 25mg , chlordiazsepoxide tablet 10 mg and clidinium 25 mg , chlorthalidone tablet 6.25mg , cholchicine tablet 0.5mg , cilnidipine tablet 20mg , cilnidipine tablet 5mg , clarithromycin for oral suspension 125mg / 5ml syrup , clarithromycin tablet 500mg , clindamycin 600mg / 4ml injection , clobetasol and salicylic acid 0.5% and 6% ointment , clomipramine capsule ip 25mg , clonazepam tablet 0.25 , clonidine 150mcg / ml injection , clotrimazole 1% and beclomethasone 0.25% lotion , clotrimazole 10mg lozenses , clozapine tablet 25mg , coloplast 60 gm paste , cyclosporine capsule 100mg , d penicillamine 250mg capsule , dabigatran tablet 110mg , dabigatran tablet 150mg , dacarbazine 200mg injection , deflazacort tablet 12mg , degarelix 120 mg injection , desonide 0.05% cream , dextromethorphan hcl and chlorpheniramine syrup , diastase pepsin with simethicone 15 ml drop , digoxin 0.25% elixir , digoxin 2mg injection , diltiazem 2% p / r gel , diltiazem prolonged released tablet 90mg , dimethyl fumarate tablet 120mg , dimethyl fumarate tablet 240mg , distilled water 10ml injection , docetaxel 120 mg injection , docetaxel 80 mg injection , dorzolamide 2% eye drop , drotavarine syrup , duloxitine gastro resistant tablet 30mg , eeg 400gm paste , erlotinib tablet 150mg , etizolam tablet 0.5mg , etoricoxib and thiocolchicoside tablet ( 60mg and 8mg ) , febuxostat tablet 80mg , fexofenadine tablet 120mg , fluconazole 100mg injection , flunarizine tablet 10mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography injection , fluromethalone 0.1% eye drop , folic acid and methylcobalamine 10 ml pack injection , formoterol 6 mcg. and budesonide 200 mcg. mdi , fosphenytoin sodium 150mg / ml injection , furosemide 10mg / ml drop , furosemide tablet 20mg and spironolactone tablet 50mg , gatifloxacin and prednisolone eye drop , glycerin 2 gm / ml suppsitory , hmf for pretem sachet , human albumin 20% injection 50 ml vial , hydrocortisone 1% cream , indomethacin lyophilized powder 1mg injection , indomethacin tablet 75mg , insulin glargine 300 iu per ml / prefilled pen injection , intralipds injection , isotretinoin capsule 10mg , isotretinoin capsule 20mg , ivermectin tablet 12mg , kojic acid 2%, arbutin, niacinamide cream , lacosamide tablet 50mg , lamotrigine dispersible tablet 100mg , l carnitine 500mg / 5ml in 30 ml syrup , levetiracetam tablet ip 250mg , levodopa and carbidopa and entacapone tablet 100mg / 25mg / 200mg , levodopa and carbidopa tablet 125 , levofloxacin oral solution syrup , levosalbutamol 2.5 mg and ipratropium 500 mcg 2.5 ml respules , levosulpride tablet 75mg , linaglipitin tablet 5mg , lorazepam 5 mg injection , mefenamice acid 100mg / 5ml syrup , mefenemic acid 50 mg and paracetamol 250 mg / 60 ml syrup , megestrol acetate tablet 160mg , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) injection , methotrexate tablet 15mg , methotrexate tablet 7.5mg , methylene blue injection , methylprednisolone tablet 4mg , methylprednisolone tablet 8mg , metolazone tablet 5mg , midazolam 0.5mg / 5ml nasal spray , midazolam 5mg / ml 1 ml injection , midodrine tablet 5mg , milrinone 10 mg injection , montelukast tablet 4mg , morphine tablet 30mg , moxifloxacin and dexamethasone eye drop , moxifloxacin and difluoprednate eye drop , mycophenolate mofetil capsule 500mg , n acetylcysteine ( nac ) 200mg / ml respule , natamycin opthalmic suspension 5% eye drop , nebivolol tablet 5mg , neomycin sulphate and bacitracin zinc ointment usp 5 mg and 500 iu / gm ointment , nicoumalone tablet 1mg , nicoumalone tablet 3mg , nicoumalone tablet 4mg , nifedipine and lidocaine p / r gel , nifidipine tablet 20mg , normal saline 500 ml glass bottle injection , octreotide 100mg injection , olaptadine & ketorolac eye drop , olmesartan medoxomil tablet 20mg , oloptadine opthalmic solution 0.1% eye drop , ondansetron oral solution 30 ml drop , orciprenaline tablet 10mg , oxcarbazepine tablet 300mg , oxcarbazepine tablet 450mg , pantoprazole tablet 20mg , paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory , paracetamol infusion 500 mg with both temper evident caps spray 10% injection , pemetrexed 100mg injection , pemetrexed 500 mg injection , perampanel tablet 2mg , permethrin 1% rinse cream , pheniramine tablet 25mg , phenobarbitone 20mg / 5ml in 100ml syrup , piperacillin 1 gm and tazobactum 125 mg injection , podophyliin toxin lotion , polyethyene glycol and sodium chloride and sodium bi carbonate and potassium chloride sachet , polyethyene glycol with elctrolyte approx 130gm solution , potassium chloride for injection injection , potassium magnesium citrate syrup , prednisolone acetate opthalmic suspension 10 ml eye drop , prednisolone tablet ip 50mg , prednisolone tablet ip40mg , primidone tablet 250mg , primidone tablet 50mg , prochlorperazine tablet 5mg , propranolol tablet 10mg , propranolol tablet 40mg sr , propylthiouracil tablet 100mg , prostaglandin 500mcg / ml injection , rabeprazole and levosulpiride capsule , racecadotril sachet 30 mg sachet , ranitidine oral suspension syrup , rasagiline1mg tablet , repaglinamide tablet 1mg , rifaximin syrup , rivaroxaban tablet 10mg , ropinirole tablet 0.25mg , rosuvastatin tablet 10mg and fenofibrate tablet 160mg , salmetrol 50mcg and fluticasone 500 mcg dpi , sildenafil 0.8mg injection , silymarin tablet 70mg. , sodium bicarbonate injection , sodium chloride 3% 100ml injection , sodium chloride and dextrose 0.45% infusion 500ml injection , sodium fluroresceine dye 20% injection , sodium hyaluronate 1.4mg injection , sofosbuvir tablet 400mg and velpatasvir tablet 100mg , tacrolimus tablet 1mg , tacrolimus tablet / capsule 0.25 , tamsulosin and dutasteride tablet , tenecteplase 40 mg injection , tetanus vaccine ( adsorbed ) injection ip in 0.5 ml , thiamine 100ml injection , tigecycline for injection 50mg injection , tofacitinib tablet 5mg , topiramate tablet 50mg , torsemide tablet 20mg , tramadol tablet 37.5mg and paracetamol tablet 325mg , tranexamic acid 500mg / 5ml injection , trastuzumab 150mg injection , trastuzumab 440 mg injection , triamcinolone acetonide 10 mg per ml injection , triclofos oral suspension500 mg / 5ml in 30ml syrup , tropicamide and phenylepherine eye drop , trypan blue 0.6% injection , ursodeoxycholic oral suspension 125mg / 5ml in 100ml syrup , vitamin a capsule 25000iu , vitamin d3 800iu / ml drop , zinc oral suspension 20 mg / 100 ml syrup , zinc tablet 50mg , zolpidem tablet 10mg , zonisamide tablet 100mg , zonisamide tablet 50mg ss , other essentail drug list dm2022 23 , aceclofenac 200 mg sr tab. , aceclofenec 100mg.+thiocolchicoside 4mg.tab. , advanced liquid cleaner for instruments, endoscopes , alfuzosin 10 mg. + dutasteride 0.5 mg tab , alfuzosin tab. 10 mg. , amino acid infusion inj. 7%w / v , amisulpride 50 mg. tab. , amlodipine tabs 10mg. , amoxicillin + clavulanic acid 150 mg.inj. , amoxicillin + clavulanic acid 300 mg.inj. , ampicillin 250 mg. inj. , ampicillin 250mg+cloxacillin 250mg inj. , anastrozole 1 mg.tab. , antiseptic for mucous membranes , wounds, skin & pre & post opreative scrub solution of 10% , antiseptic for mucous membranes , wounds, skin & pre & post opreative scrub solution of 5% , aripiprazole tab 10 mg , artemether+lumefantrine syp. , artesunate 120mg inj , artesunate tab 50 mg , atenolol tabs ip 100mg. , atracurium inj 10mg / ml , azithromycin 100mg / 5ml syp. , azithromycin 500 mg.inj. , balanced salt solution ( opth. ) inj. , benzathine benzylpenicillin inj. ip 24 lacs units , bethanechol chloride 25 mg tab , bimetoprost eye drops 0.03% , biotin 5 mg tab , bupropiontab.150 mg. , caffeine citrate tablet , calcitonin nasal spray , calcitrol 1mcg inj , calcium acetate tab 667mg , calcium chloride inj. , calcium gluconate +calcium lactobionate inj. , carvedilol 6.25 mg tab. , cefepime250 mg.inj , cefepime +sulbactum inj. 1.125gm. , cefepime 1 gm.inj. , cefepime 125 mg.inj. , cefixim 200mg+clavulanic acid 125 mg. tab , cefpodoxime 100mg. / 5ml. syp. , cefpodoxime 200 mg.tab , cefpodoxime proxetile 200 mg + ofloxacine 200 mg tab , ceftriaxone + sulbactum 1.5 gm inj. , cefuroxime1.5 gm inj. , cefuroxime750 mg inj. , cefuroxime oral susp.syp. , chlorpromazine oral solution bp 25mg / 5ml. , chlorthalidone tabs ip 25mg. , cilnidipine 10 mg tab , cilostazole 50mg tab , ciproflox 500 mg. tinidazole 600 mg.tab. , citicoline 500 mg inj , citicoline tab. 500 mg , clarithromycin 250 mg cap / tab , clarithromycin inj 500 mg , clarithromycin suspension 250 mg , clonazepam tab.1 mg. , clozapine tab. 100 mg. , clozapine tab. 50 mg. , colistimethate sod inj. 1 million , colistimethate sod inj. 2 million , crystalline penicillin 10 lacs iu inj , cyproheptadine syp. , deflazacort tab. 6 mg. , dextrose 5% 1000 ml , dextrose inj 5% glass bottle , dextrose inj 50% glass bottle , diacerin+glucosamin 50 mg. , diclofenac50mg.+ serrotiopeptidese 10 mg.tab. , diethylcarbamazine tabs ip 50mg , diloxanide furoate tabs ip 500mg , diltiazem inj. 5mg. / ml. , diltiazem tabs ip 60mg. , distilled water , dorzolamide eye drops 2% , dry powder inhaler device ( revlizer ) , duloxetine tab. 20 mg. tab. , ecg jelly 250 ml , emollient+aloevera+vit.e cream , enoxaparin sodium inj ip 40mg / 0.4ml , enzyme syp. , epirubicin 10 mg.inj. , epirubicin 50 mg. inj. , erlotinib 150 mg.tab. , ethamsylate 250 mg.tab. , ethionamide 250 mg. , febuxostat 40 mg.tab. , ferrous ascorbate 30mg + folic acid 550 mcg suspension , fibrain sealant 1 ml.inj. , filgrasim 6 mg. ( peg. ) inj. , fluconazole 200mg tab , fluconazole 50mg tab , fluconazole inj. 2mg / ml , flurometholone 1% eye drops , fluticasone furoate +azilastin nasal spray , fluticasone furoate inhaler , fluticasone nasal spray , fluticasone propionate 0.05% cream , fluticasone propionate 0.05% cream , fluvoxamine tab ip 100mg , fluvoxamine tab ip 50mg , formalin vaporiser tab. , formeterol+fluticasone ( 6ug+250ug ) , formeterol+fluticasone6ug / 100 ug , formeterol+tiotropium ( 12ug+18 ug ) , frusimide+spironolactone tab. , gentamycin inj. ip 10mg / ml , glutathion 600 mg. inj. , glycine irrigation solu. 1.5% , halothane liq for inhalation , handrub solution ( chlorhexidine gluconate +ethanol ) , hydralazine hydrochloride 20mg inj , hydroxyprogesterone caproate 500mg inj. , hydroxyurea 500 mg. tab. , hydroxyzinesyp , hydroxyzine drop , ibandronic acid 150 mg.tab. , indomethacin 75 mg. cap , influenza vaccine inj. , iron dextran inj. ip 50mg iron / ml , isotretinoin20 mg. , ketaconazole 2% lotion , levetiracetam 250 mg.tab , levofloxacin 500 mg inj. , levofloxacin750 mg tab. , levomisole tab 150 mg , levosalbutamol syp. , levosulpiride 25 mg. tab. , l glutamine powder , lincomycin 300mg / ml inj , linezolid 100 mg.tab. , linezolid 100mg syp. , l ornithine, l aspartateinj , mephentamine 30 mg. / ml.inj. , meropenem & salbactum1.5 gm.inj. , mesalarine 1.2 gm.tab. , methyleprednisolon 16 mg tab , methyleprednisolon 250mg inj. , methyleprednisolon 40mg inj. , methyleprednisolon acetate 125mg inj. , midazolam 10 mg inj. , milk formula lbw powder , milk formula low lactose powder , milk formula zero lactose powder , minoxidil5% , minoxidil 2% , mirtazapin 15mg tab , mirtazapine 7.5 , mometasone furoate 0.1% w / w cream , mometasone furoate 0.1% w / w cream , montelucast + levocetrizine syp , moxifloxacine 400mg inj , multivitamin iv use inj , n acetyl cystine 600mg tab , neostimine 2.5+ glycopyrolate 0.4 inj , netilmicin 10 mg inj. , netilmicin 25 mg inj. , nicomalone 4mg tab , nicorandil 5mg tab , nitrazepam tab. 10 mg , norfloxacin 100mg tab , norfloxacin 200mg tab , ofloxacin 200 mg+tinidazole 600mg tab , ofloxacin 400 mg tab. , ofloxacin 50mg+ornidazole125mg syp. , oxybutynin tab. 2.5 mg. , oxybutynin tab. 5 mg. , pancreatic enzyme cap 10000 iu , paracetamol 650mg tab , phenobarbitone syp. , piracetam 200 mg / ml inj 20% , piracetam 800 mg. tab. , piracetam syp 500 mg , piroxicam 20mg inj , povidone iodine gargles , pramipexol 1.5mg tab , pramipexol 1mg tab , prednisolone acetate 1% eye dro;ps , primaquine phosphate 15mg tab , pyridoxine 100mg tab , racecadotril100 mg. , ramipril 5mg , ringer lacted sodium 1000 ml , rituximab 100 mg.inj. , rituximab 500 mg.inj. , rocuromium 10mg / ml , salmetrol 50 mcg.+fluticasone 250 mcg. , serrotiopeptidase 10mg tab , sevelamer carbonate 800 mg.tab , sildenafil citrate 25 mg ( oral ) tab. , sodium chloride1.6% ( ns ) glass bottle , sodium chloride 0.45% ( ns ) glass bottle , sodium chloride irrigation solu. ( ns ) , sofosbuvir 400 mg. tab. , solifenacin succinate tab. 10 mg. , solifenacin succinatetab. 5 mg. , spironolactone tabs ip 100mg. , succinyl choline inj. , sucralfate gel 1 gm / 5ml , sulbactum 1 gm inj , sulfadoxine+pyrimethamine tab 500 mg +25 mg , sulphadoxine+pyrimethamine syp. , sultamicillin 375 mg tab , sumatriptan 50mg tab , sunscreen gel spf 15 , sunscreen lotion spf 30 , tadalafil 20 mg tab , teicoplanin 400 mg.inj. , tenofovir tab.300 mg. tab. , terbinafine 1.0% w / w cream / oint , terlipressin inj 1mg , thyroxine sodium 25mcg tab , thyroxine sodium 75mcg tab , tiotropium 18mcg dry powder cap , tirofiban 5mg inj. , tissue plasminogen activator 20 mg inj , tobramycin sulphate inj 80mg / 2ml , torsemide 20 mg.tab , triamacinolon eacetonide inj.40 mg. / ml. , tropicamide0.8%+phenyl ephrine 5% eye drop , trypsin chymotrypsin tab , usg jelly 250 ml , vasopressin inj 20 units , vitamin bcomplex + vitamin b12 inj , voglibose0.2mg tab , voglibose0.3mg tab , white soft parrafin oint / cream , zinc sulphate syp. , everolimus 0.75 mg tab , tacrolimus 2mg tab , cefpriome + sulbactum ( 1.5 gm ) , eye drop atropine 0.01% , injection moxifloxacin 0.5% intracameral , injection ranibizumab intravitreal 0.5 mg dose single use ( vial 1 2 ml ) & disposable 30g & 1 / 2 inch long hypo dermic needle & 1 ml syringe , pilocarpine inj. 1ml , inj.flucloxaillin 1000mg , cap flucloxacilline 500mg , inj.cotrimoxazole 10ml , inj.anidulafungin100 mg , inj anti t lymphocyte globulin 20mg / dl , inj.basiliximab 20 mg , inj anti thymocyte globulin ( rabbit atg ) 25 mg...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical College - Rajasthan

33634321 rate contract for antisera and antibiotic discs at microbiology department rate contract for antisera and antibiotic discs at microbiology department , electrical items : , shigella dysenteriae , shigella flexneri , shigella boydii , shigella soneii , salmonella polyvalent h antisera , salmonella polyvalent o antisera , salmonella typhi o 9 antisera , salmonella typhi h a antisera , salmonella typhi h b antisera , salmonella typhi h d antisera , vibrio cholerapolyvalentantisera , vibrio cholera inabaantisera , vibrio cholera ogawaantisera , salmonella sero quick id kit , amphotericin b , clotrimazole , fluconzole ( fluconazoleflc25 mcg ) , griesofulvin , itraconazole , ketoconazole , miconazole , nystatin , terbinafine , voriconazole , amikacin 30 ug , amoxycillin 30 ug , amoxyclav 20 / 10 ug , ampicillin 10 ug , azithromycin 15 ug , cefepime 30 ug , cefixime 5 ug , cefoperazone 75 ug , cefotaxime 30 ug , cefpodoxime 10 ug , ceftazidime 30 ug , ceftriaxone 30 ug , cefuroxime 30 ug , cephalexin 30 ug , chloramphenicol 30 ug , ciprofloxacin 5 ug , clindamycin 2 ug , doxycycline 30 ug , erythromycin 10 ug , furazolidone 50ug , gentamycin ( 10mcg ) , linezolid 30 ug , meropenem 10 ug , netilmycin 30 ug , nitrofurantoin 300 ug , doripenem 10ug , optochin , piperacillin 100 ug , piperacillin + tazobactum ( 100 / 10 ) , tetracycline 30 ug , tiecoplanin 30 ug , tobramycin 10ug , vancomycin 30ug , ofloxacin 5 ug , imipenem 10ug , cefoxitin 30 ug , ceftazidime + clavulanic acid 30+10 , aztreonam 30 ug , penicillin g 10ug , ticarcillin + clavulanic acid ( 75 / 10 mcg ) , cefaclor 30 ug , nitrate reagent disc , dalfopristin 15 ug , carbenicillin100ug , cefdinir 5 ug , clarithromycin 15ug , co trimoxazole 25 ug , fosfomycin 200 ug , fusidic acid 10 ug , levofloxacin 5ug , lincomycin , hi gentamicin 120 ug , moxalactam030 ug , pristinomycin 15 ug , hi streptomycin 180ug , ticarcillin 75ug , spectinomycin 100ug , tigecycline 15 ug , cefotatan 30ug , colistin 10ug , minocycline 30ug , cefoperazone + sulbactum 75 ug / 10ug , novobiocin disc 30 ug , moxifloxacin 5 ug , ertapenem 10ug , polymyxin b ( 300 units ) , rifampicin 5ug , rifampicin 5ug , esbl identification kot ( a ) cefotaxime 30ug & cefotaxime + clavulanic acid 30 + 10mcq ( b ) ceftazidime & ceftazidme + clavulanic ancid 30+10 mcq , e test for cefotaxime , e test for vancomycin , e test for penicillin , e test for tiecoplanin , e test for colistin , mc farland equivalence turbidity standard 0.5 , x factor disc , v factor disc , x+v factor disc , bacitracin ( 0.04 unit ) , bile esculin disc , fluconzole ( 0.016 to 256 mcg / ml ) e strip mic , griesofulvin ( 0.002 to 32 mcg / ml ) e strip mic , itraconazole ( 0.002 to 32 mcg / ml ) e strip mic , terbinafine ( 0.002 to 32 mcg / ml ) e strip mic...

Rajasthan University Of Health Science - Rajasthan

33465082 regents and consumables items for microbiology lab regents and consumables items for department microbiology lab , electrical items : , alberts stain , alkaline peptone water , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbeab elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , antiinuelear antibody ( ani ) elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , corn meal agar , cover slips 22 x 22 mm , crp test kit , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable polythene gloves , dubos medium , ecoshield , edta powder , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , mr vp medium ( glucose phosphate broth ) , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile transport medium ( stuart medium ) with test tube and swab individually packed , sulphanilamide , tcbs , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , hcv igmrapid card , occult blood stool , rpr test kit...

Rajasthan State Cooperative Consumer Federation Limited - Rajasthan

32049429 supply of generic medicines supply of generic medicines , abiraterone 250mg tab , acarbose 50 mg tab , aceclofenacsr 200 mg tab , aceclofenacsr 100 mg tab , aceclofenac 100 mg tab , aceclofenaic + para tab , aciclovir 800 mg tab 1x10 , acyclovir 200 mg inj , acyclovir 200 mg tab , acyclovir 400 mg inj , acyclovir cream , adrenaline inj , albendazole drop 10ml , albendazole syp , albumin 100ml inj , alkaliser 100ml syp , all hydr + mag hydro+ dim. + sorb syp 200ml , alphal ipoic acid +mv +antioxi +ch , alprazolam 0.25 mg tab 1x10 , alprazolam 0.25 mg tab 1x15 , alprazolam 0.5 1x15 , alprazolam 0.5 tab , amikacin 500 mg inj , amlodipin 10mg tab , amlodipin+ atenolol tab , amlodipine + atenolol tab , amlodipine 2.5 mg tab , amlodipine besilate 5mg tab , amoxicillin 500 mg cap , amoxycillin + claul 625 tab , amoxycillin 1.2 mg inj , amoxycillin 125 dry sup , amoxycillin 125 mg 30 ml syp , amoxycillin 250 mg 30 ml syp , amoxycillin 250 mg cap , amoxycillin+clav 625 mg tab , anacid 170ml syp , anstrazole 1mg tab , antacid chew tab , antacid tab 1x9 , antacids syp 200 ml , antacids tab , anti oxi+ lyco+ miner cap , anti oxidant cap , anticold tab , arsinix trioxide inj , artesunatge 50 mg tab , atenol 50 mg tab 1x14 , atenolol 100 mg tab , atenolol 100 mg tab 1x14 , atenolol 25mg tab , atenolol 50 mg + amlodipine 5 mg ta , atenolol 50 mg tab , atenolol 50 mg tab 1x14 , atorvastain 10 mg + ezetimibe 10 mg tab , atorvastatin 10 mg tab , atorvastatin 10mg +aspirin 75mg , atorvastatin 10mg +aspirin 75mg , atorvastatin 20 mg tab , atorvastatin 40 mg tab , azaciticline inj , azithromycin +cefixime tab 1x6 , azithromycin 250 mg tab 1x10 , azithromycin 250 mg tab 1x6 , azithromycin 500 mg tab 1x10 , azithromycin 500 mg tab 1x3 , azithromycin 500 mg tab 1x6 , azithromycin syp , azthromycin susp 100 mg 10 ml , azthromycin susp 200 mg 10ml , bandage 15 mtr , bandage 2x2.5 , bandage 5mtr , bandaid , b com+mv+mine+zinc forte cap , b com6mv+mine+zinc forte cap , b complex 200 ml syp , b complex cap 1x15 , b complex forte+ vit , b complex tab1x10 , beclo+clotri+neomy 10 gm oint , beclo+clotri+neomy 5 gm , beclomethason dipro , bendamustin 100 mg inj , benzyl benzoate lotion 100 ml , betahistine 16 mg tab , betahistine 8mg tab , betahistine tab , betamethasone lotion , betnameta sone tab , bevacizumnabinj 100 mg , bisacodyl 5mg tab , bleomycininj15 mg , boric acid 20gm , bortezumib 2 mg inj , bortezumib 3.5mg inj , bromaxin dia cpm syp , bromhexine syp , buprenorphine 0.3 mg 2ml inj , c.p. 5 lac inj , cal carbonate + vitd3 syp , calamine 100 ml lotion , calamine 3% diphen 1% lot 100 ml , calamine 50ml lotion , calcitrol seachet , calcium + vita c inj 10 ml , calcium + vitamin syp , calcium + vitd3 tab , calcium carbon + calcitriol + zinc , calcium carbon+ calcitriol + zinc , calcium citrate, calcitriol & vitamin k2 7tab , calcium citrate, calcitriol & vitamin k2 7tab , calcium gluconate inj. 10 ml , capecitabine500 mg tab , capecitbine tab , capecitbine tab500 mg , carboplatin 150 mg inj , carboplatin 450 mg inj , carvedilol 12.5 mg tab , carvedilol 6.25 mg tab , caspofun xgin 50 mginj , caspofunxgin 70 mg inj , cefadroxil 250 mg in , cefadroxil 250 mg tab , cefadroxil 500 mg inj , cefadroxil 500 mg tab , cefixime 100 mg tab , cefixime 200 mg tab , cefixime 50 dt tab , cefixime 50 mg tab , cefixime drops 10ml , ceforperazone 1gm inj , ceforperazone 500mg + sulbactum , cefotaxime 1gm inj , cefotaxime 500 mg inj , cefpodoxime proxetil 200 mg tab , cefpodoxime proxetil 50mg syp , cefpodoxime proxetil disp. 100 m , ceftazidime 1gm inj , ceftriaxone 1g+ tazobacctum 12 , ceftriaxone 1gm +sulbact , ceftriaxone 1gm inj. , ceftriaxone 1gm+ sulbactm 500mg , ceftriaxone 250inj , ceftriaxone 250 mg + sulbactm 250 , ceftriaxone 250 mg + sulbactm 500 , ceftriaxone 250 mg inj , ceftriaxone 250mg + sulbactm 125 , ceftriaxone 500 inj , ceftriaxone 500 mg inj , cefuroxim 250 mg tab , cefuroxime 125 mg oral susp , cefuroxime axetil 250 mg , cefuroxime axetil 250 mg tab , cefuroxime axetil 500 mg , cefuroxime axetil 500mg tab , cefuroxime axetil 500mg tab 1* , cephalexin 125 mg dt tab , cephalexin 250 mg dt tab , cephalexin 250 mg tab , cephalexin 500 mg tab , cephalexin drop 10ml , cephalexin dry syp , cepodoxim 100mg tab , cepodoxim 200mg tab , cepodoxim syp , cetrizine + ambroxol tab , cetrizine + phenyl prop+ dextro s , cetrizine + pph+ ammo chlo + menth , cetrizine + pph+ammo chlo+menth , cetrizine 10 mg tab , cetrizine 30ml syp , cetrizine hyd +pseudeph hyd +pcm , child tonic iron / calcium / vit , chiloramphenicol 1 mg inj , chiloramphenicol 1gm inj , chiloramphenicol 500mg cap , chiloramphenicol syp , chilrpheniramine 4mg + codeine 1 , chloramphenicol 125 mg 60ml syp , chloramphenicol 250 mg cap , chlorhexidine3% mouth wash 10 , chloroquine phosphate 250 mg ta , chlorpheniramine + codein phos , chlorpheniramine + dextra + pcm +p , chlorpheniramine + pcm + phenylep , chlorquine 250 mg tab , chlorquine 500 mg tab , chlorquine ds tab , chlorquine syp , cholecalciferol tab 1x4 , cilnidipine 10 mg +telmisartan 40mg , cilnidipine 10mg , cilnidipine 10mg , cilnidipine 20 mg , cilnidipine 20 mg , cilnidipine 5mg , cinnarizine + domperidon tab , cinnarizine 25mg tab , cinnarzine 10mg tab , cipro +dexa eye drop , cipro +flucinolane + clorti cream , cipro 250 mg tab , ciprofloxacin250mg , ciprofloxacin + fluocin + clotri , ciprofloxacin 500 + tinidanzole500mg tab , ciprofloxacin eye / ear drop , ciprofloxacin iv inj , ciprofloxin 500 mg , cisplatin 10 mg , cisplatin 10 mg inj , cisplatin 50 mg inj , citicolin 500 mg tab , citicoline 500mg +piracetam 400mg , citicoline 500mg +piracetam 800mg , clarithromycin 250 mg tab , clavulanate pot + amoxycillin , clindamycim 1% gel , clobetasol 0.5 + miconazol 2 , clobetasol 0 05%+gentamicin 0 , clobetasol pro 0.5% + miconazole , clonazepam 0.5 mg tab , clonazepam 1mg tab , clopidogrel 75mg + aspirin 75 ta , clotriamazole tab , clotrimazol veg , clotrimazole + beclometh + neo , clotrimazole + beclomethasone , clotrimazole + beclomethasone + n , clotrimazole + fluclinolone + neom , clotrimazole 50 ml syp , clotrimazole oint , clotrimazole power , co trimaxazole syp , codin + cpm + menthol , cotrimaxazole d.s. tab , cotton 500 gm , cotton woll 20gm , cpm 2.5 + ammonium chloride 125 +sod syp , cpm 2.5 ml + ammo+ chloride 1.25 + sod syp , cyprohepatidine + sorbi+ tricho , cyprohepatidine + tricholine ci syp , cyproheptadine 200ml syp , cyproheptadine 4mg tab , cytrabine 100 mg inj , cytrabine 1000mginj , cytrabine 500 mg inj , d 1.0% 500ml , d 5% 1000ml inj , d 5% 500ml inj , d 25% 500ml inj , dacarbizine 200 mg inj , dacarbizine 500 mg inj , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 10 mg , dapagliflozin 5mg , dapagliflozin 5mg , darbepoetin 25mginj , darbepoetin 40mg inj , darbepoetin 60mg inj , daxotelinj 120 mg , daxotelinj 120 mg , ddripemem 500mginj , deca anabolin 50mg inj , deflazcort 6mg tab , dexamethason inj , dexamethasone + chloramphenicol , dexamethasone + ciprofloxacin 1 , dexamethasone + neomycin 10ml , dexamethasone + ofloxacin 10ml , dexamethasone 0.5 mg tab , dexamethasone 5mg + phenyleph 5 , dexamethasone phos inj , dextro 5ml + pheny 12.5 +cpm 2mg , dextromethopen + hydro+ bromhx +am , dextromethorphan 10+ cpm+phenyl , dextromethorphan 10+ guai 100 +br , dextromethorphan 5mg + pph+diphe , dextroproposyphen & hydroclo , dextroproposyphen + acetominophe , dextroproposyphene 65ml + para+ , dextropropoxiphen 65mg +pcm 325 , diazepam 10mg tab , diazepam 2ml inj , diclo+ para+ chlorzox tab , diclofenac + diethyla+ met salt + oint 30gm , diclofenac + para+ tab , diclofenac + serra tab , diclofenac 50mg + serratiopeptidase 10mg tab , diclofenac 50mg tab , diclofenac eye drop , diclofenac inj , diclofenac oint 30gm , diclofenac poto 100 + pcm 500+ ser , diclofenic + para+ serra tab , diclofenic 100mg sr tab , dicyclomine + para , dicyclomine 10+ mefenamic 250mg , dicyclomine 10mg 2 ml inj , dicyclomine drop , diltiazem 30mg , diltiazem 60mg tab , diphenhydramine 14.08 + amni 38 syp , diphenhydramine 14.08+ amni 38+ x , diphenhydramine 25mg cap , disodium hydrogencitrate syp , dns 1000 ml , dns 500 ml , dobutamine 250 mg 5ml inj , docetaxel 20 mg inj , docetaxel 80mg , docetaxel 80mg inj , domeperidone 10mg tab , domeperidone dt 10mg tab , domeperidone syp , domperidone 10+ pcm 500 mg tab , domperidone tab , doxarubacininj10 mg , doxarubacininj 10 mg , doxarubacin inj 50 mg , doxarubacininj50 mg , doxycycline 100 mg tab 1x8 , doxycycline caps , doxylamine + pyridoxine + folic ac , drotaverine & mefenamic tab , dycerin 50 mg+ glucosamin 750 mgtab , ecitabinecap500 mg , electrolyte m 500 ml , enalapril 10mg tab , enalapril 2.5mg tab , enalapril 5mg tab , enapil 5 mg + amlodipine 5 mg tab , enoxaparin sodium 60mg inj , enzymes cap , enzymes cap1x15 , enzymes syp200ml , epirubicin 10 mg inj , epirubicin 10 mg tab , epirubicin 100 mg inj , epribucin 50 mginj , epribucin 50 mg inj , erlotinib 100mg tab , erlotinib 150 mg tab , erythro protine inj , erythromycin +aloevera cream , erythromycin 250 mg , erythromycin 500mg tab , erythropoietin inj 4000 , erythropoietin 10000 inj , erythropoietin 40000 inj , escitalopram 10mg + clonazepam0.5 ml , escitalopram 10mg tab , escitalopram 20mg tab , esomeprazole 40mg , esomeprazole 40mg , esomeprazole 40mg +domperidone , esomeprazole 40mg +domperidone , etaner cept 250mg inj , etaner cept 50 mg inj , ethambutol 800mg tab , ethamsylate 250 tab , ethamsylate 2ml inj , ethamsylate 500 tab , etophylin + theeophylin 2ml inj , etophylin + theophyl in 300mg tab , etophylin + theophylin 150mg tab , etophyll ine 84.7mg + theoph 25.3 , etophyllin + theophyllin tab , etoricoxib 120mg tab , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60 + thiocolchicoside 4 mg , etoricoxib 60mg tab , etoricoxib 90mg tab , face mask , febuxostat 40mg tab , febuxostat 80mg tab , ferric + folicacid + cyanoco + sorbi syp , ferric+ folicacid tab , ferrous salt + folic acid syp 200 , ferrous salt + folic acid tab , fexofenadine 120mg , fexofenadine 180mg tab , filgrastim pfsinj300mg , filgrastim pfsinj 6mg , filgrastim pfsinj 300mg , fluconazole 150 + azithromycin 1 , fluconazole 150 tab , fluconazole 50mg tab , fludocyte 50 mginj , fluoxetine + alprozolam tab , fluxoetin cap , folic acid 5mg tab , folic acid 5mg tab , folic acid 5mg tab1x30 , fosapre ptant 150mg inj , frusemide 40mg tab , fungal diastase 50 pcpsin 10 , furazol idone 100 metronidazole , furazol idone tab , fusidic acid + beciomfth+ dipro c , fusidic acid cream , gabapentin 300 mg + mecobalamine 500mg , gabapentin 300mg cap , gabapentin 400 mg cap , gamabanzyl lot , gamma benzene hexachloride 1% , gatifloxacin 200mg + ornidazole , gatifloxacin 400 mg tab , gatifloxacin eye drop , gauze , geftinmib tab 250 mg , gemcitabine inj 1 gm , gemcitabine inj 1 gm , gemcitabine inj 20 mg , gemcitabineinj 200 mg , gemcitabine 1.4 mg inj , gentamicin 0.2% dexamethasone , gentamicin 80mg inj 2 ml , gentamicin inj 2 ml , gentamycin eye drop , ginsang + multi vit , ginsang + multi vit cap , glibenclamide 5mg + metformin 500 tab , glibenclamide smg tab , gliclazide 40mg tab , gliclazide 80mg + metformin 500 , gliclazide 80mg tab , glime 1mg + metfor 500 mg+ piogl 15mg tab , glime 2 mg + metfor 500+ piogl 15 mgtab , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 1000t , glimepride 1 mg + metformin 500 t , glimepride 1 mg tab , glimepride 2 mg + metformin 1000t , glimepride 2 mg + metformin 1000t , glimepride 2mg +metformin 500 tab , glimepride 2mg tab , glipizide 5mg + metformin 500 , glucos c 100 + 200 gm , glucosamine 500mg tab , glucosamine 750mg+ diacerein 50 mg+msm tab , griseofulvin 250 mg tab , hacmatinic with vitamins 200ml , haematinic + vitamin+ folic acid cap , haematinic + zing cap 1x15 , haematinic with vitamins cap , haematinic with vitamins syp , heparin sodium 50 iu gel , heparin sodium 50 i u +bengyl n , human erythropoetin alfainj2000 iv , human erythropoetin alfa inj4000 iv , human erythropoetin alfa inj 4000 iv , human erythropoetin alfainj 2000 iv , hydrocortisone 100 inj , hydrogen peroxide 100ml , hydroxyprogesterone 250 inj , hydroxyprogesterone 500 inj , hyoscine butylbromide 10mg , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibandronate tab , ibuprofen 100pcm 125 mg 60ml sy , ibuprofen 100pcm 125 mg tab , ibuprofen 100 pcm 125 syp , ibuprofen 100 pcm 500 mg tab , ibuprofen 100 pcm 500 tab 1x15 , ibuprofen 400 +para 325 mg tab , imatinibtab 100mg , imatinib tab 400 mg , imatinibtab400 mg , imatinibtab 100mg , imatinib tab100mg inj , indomethacin 75mg sr cap , indomethacin cap , intazyme cap 1x15 , irenotacan 100mg inj , irenotacan 40 mg inj , iron ( 111 ) hydr. poly cap , iron + folic acid cap , iron + folic acid cap ( g ) 1x15 , iron 200ml syp , iron 60ml syp , iron polymaltose comphfolic ac , isabgol 100 gm , iso sorbide monoitrate tab , isolyte p500mg , isosorbide dinitrate 10mg tab , isosorbide mononitare 40mg ta , isosorbide mononitrare 20mg tab , isosrbide dinitrate 5mg tab , isosrbide mononitrare 10mg tab , ketoconazole 1% lot , ketoconazole 2% lot , lacobactllus tab , lacto bacillus tab 1x15 , lactobacillus 60mill tab , lactolus tab 1x15 , lactoluse 100ml syp , lactoluse syp 20, ml , lansprazole 30mg cap , lefotaxime 1gm inj , lefotaxime 250mg inj , lenalidmide 10mgtab , lenalidmide 5mg tab , letrazol 2.5 mg tab , levamisole 150mg tab , levetiracetam 250mg , levetiracetam 500 mg , levetiracetam 500 mg , levetiracetam 750 mg , levocetrizine + montelukast syp , levocetrizine syp , levocetrizine tab , levofloxacin 150mg 1x5 , levofloxacin 250 mg , levofloxacin 500mg , levofloxacin 500mg tab 1x5 , levofloxacin 500mg tab 1x5 , levofloxacin 750mg tab , levofloxacin iv inj 100ml , levonorgestrol 0.75 mg pills , levprolideinj 3.75mg , lignocaile 30ml + adrenal in inj , lignocain hydroclorid 2% inj , lignocaine hydro 2% adrenaline , lin oil + diclo sod+ methyl+ ment , lincomycin 2ml inj , lincomycin cap , liq. paraffin + milk or magnesia , lisinopril 10mg tab , lisinopril 5mg tab , lisinopril 5mg+amlodipin 5mg , lithium carbonate 300mg tab , liver tonic 100 syp , liver tonic 200 syp , loeramide 2mg tab , loperamide 2mg tab , loratadine + ambroxol hci tab , loratadine 10mg tab , loratadine 5mg +pseudoephedrine , lorazepam 1mg tab , lorazepam 2mg tab , los pot 50mg tab , losartan 50+ amlodipine 5 tab , losartan 50mg tab , losartan 50mg+ hydroch 12.5 mgtab , losartan pota 50+ amlodipine 5mg tab , losatan 50 + hydro 12.5 , luprolide depot 11.25inj , luprolide depot 22.5 inj , lycopen cap , lycopen+vitamin tab 1x15 , lyophillzed doxetaxel inj 20 mg , lyophillzed doxetaxel inj 80 mg , magaldrate540 + simeth 50mg syp , mandrolone dacanote 50 inj , mcp inj , mcp tab , mecobalamin + thiamine +pyridoxi , mecobalamin 1500mg tab , mecobalamin 500mg inj 2ml inj , mecobalamin 500mg tab , mecobalaminia lipo +facid +pyri , mefenamic acid 500mg + diclo hyd , melphalantab 2 mg , menadione sod 1 ml inj , meropenem 1gm inj , metformin 500mg tab , metformin 500mg tab 1x20 , metformin 850mg tab , metformin sr 1gm tab , metformin sr 500mg tab , metformin+gl imepride tab , metformine 500mh+gliclazide 80 mhtab , metformin sr 1000mg tab , metformin sr 500mg tab , methycobalamine 2ml 1500mg inj , methyl + prednisolan tab , methyl cobalami tab , methylcobalami + mincrals cap , methylcobalami od tab , methylcobalamin alpha lip.+ro , methylcobalamin ivit , methylergometrine inj , methylergometrine inj 1x1 , methylergometrine tab , methylpredsolone 16 mg tab , methylpredsolone 4mg tab , methylpredsolone 8 mg tab , metoclopramide inj , metoprolol 25mg tab , metoprolol 50mg tab , metoprolol xl 50mg tab 1x10 , metoprolol xl 25mg tab , metro 100 ml , metronidazole + norfloxacin susp , metronidazole 200mg tab , metronidazole 400mg tab , metronidazole inj 100ml , miconazole nitrate + flucinole , miconazole oint 10gm , mifepristone 200mg tab , mimesulide 100mg tab , minesulide + serrapep tab , minesulide gel , mirtazapine 15mg tab , misoprostol 200mg tab , misoprostol 200mtab , momemtasone creasm , montelukast 10mg + levo.d hcl 5 , mosapride 5mg tab , mosapridecitrate 5mg tab , multivitamin +min+zinc cap , multivitamin 10ml inj , multivitamin 2ml inj , multivitamin and minerals cap , multivitamin drop , multivitamin soft gel cap , multivitamin syp 200ml , mvi inj ( g ) , mycophenolate 500mg tab , nab paclitaxel 100 inj , nandrolone dacanote 25 inj , nano paclitaxel 100mg inj , nebivolol hydrochloride 2.5mg tab , nebivolol hydrochloride 5mg tab , nicorandil 5mg tab , nifeditine rt 20mg , nimesu+praa+serra tab , nimesulide + para tab , nimesulide 1% +methysalicylate oint , nimesulide 100mg + para 500 +ser tab , nimesulide 100mg +dicyclomine 2 , nimesulide 100mg mouth diss tab , nimesulide 100mg+tizanidine 2mg tab , nimesulide 200mg tab , nimesulide 50+paracetamol 125m , nimesulide 50mg+para 125 ( neula , nimesulide dt 50mg tab , nitroglycerin 2.6 tab 1x30 , norfloxacin 400 tab , norfloxacin+tinidazole +betacyc , ns 500 ml , ofloxacin +metronidazole syp , ofloxacin +ornidazole syp , ofloxacin +tinidazole tab , ofloxacin 200mg tab , ofloxacin eye / ear drop , ofloxacin inj , ofloxacin oral drop , ofloxacin syp , ofloxacin+dexamethasone drop , ofloxacin+ornidazol tab , olanzapine 5mg tab , olemesartan 40mg tab 1x10 , oleu 3% diclof 1.16% methyl 10 , olmesartan 20mg& hydroch 12.5tab , olmesartan 20mg tab , omeprazole 20 cap 1x15 , omeprazole 20mgcap , omeprazole 20mg +dom 10 mg cap , omeprazole 40mg tab 1x15 , omeprazole+domp cap 1x15 , ondansetron 2ml inj , ondansetron 8mg tab , ondansetron md 4mg tab , ondensetron 4mg inj , ondensetron 4mg tab , ondensetron 8mg tab , ondensetron drop , ornidazole 500mg tab , ornidazole iv inj 100ml , ors 21.8 gm , ors 4 gm , ors powder 21gm , oxaplatin 100mg inj , oxaplatin 50 mg inj , oxaplatin 50 mg tab , oxymethazole ine hydro nasla ors , oxytocin inj , paclitaxel inj 260mg , paclitaxelinj 260mg , paclitaxel 100mg inj , paclitaxel 200 mg inj , paclitaxel 30 mg inj , paclitaxel 300 mg inj , pain kill oil , pantoprazole 40mg , pantoprazole 40mg+domp 30 mg sr cap , pantoprazole 40mg + domperidone 30mg sr , pantoprazole inj , pantoprazole+domp tab , pantoproazole 40mg , paracetamol650mg tab , paracetamol 100mg drop , paracetamol 125mg syp , paracetamol 250mg syp , paracetamol 2ml inj , paracetamol 500mg tab , paracetamol 650mg tab , paracetamol d / s syp , paracetamol tab 1x15 , paracetamol+domperi ab , parafin 100ml , paralfin & milkof magnesia , pcm 125 mg +chlophe+sod cit+phe syp , pcm 450+brom 8mg +gui 100mg +cpm tab , pcm 500+serratio +aceclofenac tab , pcm 500mg tab , pegylated interferon alfainj1180mg , pemetrexed inj100mg , pemetrexed inj 100mg , pemetrexedinj500mg , penicillin g potassium 200000 , penicillin g potassium 400000 , penicillin g potassium 4000000 , penicillin g potassium 800000 , pheniramine maleate 22.7 mg inj , pheniramine maleate 25mg inj , phenobarbitone 30mg tab , phenobarbitone 60mg tab , piogilitazone 15mg tab , piogilitazone 30mg tab , piracetam 400mg tab , piracetam 800mg tab , piroxicam 40mg 2ml inj , piroxicam disp 20mg tab , piroxicam dt tab , polymer degarded gelatin 500m , porpanolol 10mg tab , potassium permegnate 20gm , povidone 100ml liq , povidone 15gm oint , povidone 20gm oint , povidone 250gm oint , povidone 500ml liq , povidone oint 5gm , povidone powder , prazocin xl 2, 5mg tab 1x15 , prazocin xl 5mg tab 1x15 , prazosin 1mg tab , prazosin 2.5mg tab , prazosin 5mg tab , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 2.5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , prazosin hydrochloride 5mg , pre & probiotic sachet 1x1 , prednisolone 10mg tab , pregabalin 75mg & methycobalmin750 mg cap , pregnancy test card , pregnency test card / kit , primaquine phosphate 15mg tab , primaquine phosphate 7.5 mg tab , promethazine 25mg 2mlinj , promethazine 25mg tab , propanolol 40mg tab , propranolol40mg & alprazolam 0.25mg tab , protine powder20gm , pyra 1500 +rifa450+isonia , pyramethamine 25ml +sulpha 500 , pyrazinamide 500mg , pyrazinamide 750 mg , quinine dthydrochloride inj , quinine sulpate 300mg tab , rabeprazole 20mg + dom 10mg tab , rabeprazole 20mg + dom 30mg cap , rabeprazole 20mg tab , ramipril 2.5mg tab , ramipril 5mg tab , ranitidine 150+domperidone 10m , ranitidine 150mg tab , ranitidne 2ml inj , ranolazine 500mg , ranolazine 500mg , rifamicin 450 tab , rijoximabinj500 mg , rijoximabinj 100 mg , risperidone 2mg tabroxithromyc , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 10mg tab , rosuvastatin 20mg tab , roxithromycin syp , roxituromycin 50mg tab , salbutamol 2mg +ambroxol 30mgsyp , salbutamol 4mg tab , salbutamol tab , secnidazole 1gm tab , serratiopeptidase tab10mg , sertaline 100mg tab , sertaline 50mg tab , sildenafil citrate 100mg tab , silodosin 8 mg cap. , silodosin 8 mg cap. , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg cap.+ dutasteride .5mg , silodosin 8 mg tab , simvastatin 10mg tab , simvastatin 20mg tab , sitagliptin 100mg , sitagliptin 100mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 1000mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 mg +metformin 500mg , sitagliptin 50mg , sitagliptin 50mg , soda bi carb 25ml inj , sodium valaporate 200mg tab , sodium valproate cr 500mg tab , sodiumbicarbonate inj 10ml , sorafenib 200mgtab , sparfloxacin 200mg tab , sparfloxin 100mg tab , sponge rolder , sterile gloves , streptomycin 1gm inj , streptomycin 2.75 inj , sucralfate 100ml susp , tacrolimus cap 1mg , tacrolimuscap 0.5mg , tacrolimus cap 0.5mg , tacrolimus 0.01% w / w ointment , tacrolimus 0.03% w / w ointment , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin .4mg +dutasteride .5mg , tamsulosin .4mg +dutasteride .5mg , tamsulosin 0.4mg tab , tamsulosin 0.4mg tab 1x15 , tamzolamid tab250 mg , tamzolamidtab 100mg , tamzolamid tab100mg , tamzolamid tab 250 mg , telmisartan 20+amlodipine +hydroch tab , telmisartan 40 mg + amlodipin 5mg tab , telmisartan 40+amlodipine +hydroch tab , telmisartan 40mg+ hydroch 12.5 mgtab , telmisartan 40mg tab , telmisartan 80 mg tab , telmisartan 80+hydrochlorothiazide tab , telmisartan 80+hydrochlorothiazide tab , temozolomidecap20mg , temozolomidecap 100mg , temozolomidecap 100mg , temozolomidecap 20mg , teneligliptin 20mg , teneligliptin 20mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin1000mg , teneligliptin 20mg + metformin 500mg , teneligliptin 20mg + metformin 500mg , terbipression inj , terbutalinesfsyp , terbutaline + guai+brom +menthol syp 100ml , teripratide 750mg / ml inj , testosterone 250mg 1ml inj , tetanus toxoid inj , tetra cycline 250 mg cap , tetracycline 250mg tab , thyroxine 100mg tab 1x1 , thyroxine 25mg tab 1x1 , ticagrelor 60 mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , ticagrelor 90mg tab , tigercyclin inj , tinidazole 500mg tab , tobramycin & dexamethasone e / d , tobramycin 40mg inj , tobramycing 3% eye drop , tramadol 50mg+ paracetamol 375 mg tab , tramadol hydrochloride inj , tramadol hydrochloride tab , tramadol inj 2ml , trastozumab 440 inj , uniron inj , urokinase 5lakh tu inj , ursodeoxycholic acid 300 mg tab , ursodeoxycholic acid 300 mg tab , vildagliptina 50mg , vildagliptina 50mg , vildagliptina 50mg+ metformin 500mg , vildagliptina 50mg + metformin 1000mg , vildagliptina 50mg + metformin 500mg , vitamin b complex cap 1x15 , vitamin c 500mg tab , vitamin e tab 400ng , vitamine b complex cap ( conci , vitamine e 200mg tab , vitamine e 400 mg tab , voglibose 0.2mg tab , voglibose 0.3mg tab , voriconazole 200ml tab , zinc sulphate 60ml syp , zoledronic acidinj 4 mg , zoledronic acidinj 4 mg , zoledronic acid 5mg inj , zolpidem 5mg tab...

Medical Health And Family Welfare - Rajasthan

32024476 supply of medicine in govt bdm hospital kotputli supply of medicine in govt bdm hospital kotputli , injection list , adrenaline 1 ml , adenosine inj. 3mg / ml , aipha beta artemether inj 2ml , alpha beta artemether inj 1ml , amikacin 100mg inj 2ml , amikacin 250mg inj 2ml , amikacin 500mg inj 2ml , aminophyllin inj 10ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj 1.2gm , amoxicillin and potassium clavulanic inj 600mg , ampicillininj 1gm , ampicillininj 500mg , ampicillin + cloxacillin inj 1gm , anti d human immunoglobulin inj 300 mcg , anti tetanus serum inj ( tetanus immunoglobulin ) 250 iu / vial , ars inj ( rabies antiserum ) 5 ml vial , artesunate inj 60mg vial , artisunate inj 120mg , asv inj ( snake venum antiserum ) lyophilized , atracurium inj 10 mg / ml , atropine sulphate inj 1 ml , benzathine benzylpenicilline inj 12 lac units , benzathine benzylpenicilline inj 6 lac units , betamethasone sod phos inj 1 ml , botropase inj 1ml , bupivacaine 0.5% inj 20ml , bupivacaine in dextrose inj ( heavy ) 4ml , butorphanol tartrate inj 1 ml , caffeine citrate inj 3 ml , calcium gluconate 10% inj 10ml , carboprost tromethamine inj 1ml , cefoperazone 1 gm & sulbactum 0.5 gm inj , cefotaxime + salbactam inj 375mg , cefotaxime inj 125mg , cefotaxime inj 1gm , cefotaxime inj 250mg , cefotaxime inj 500mg , ceftazidime inj 1 gm , ceftazidime inj 250 mg , ceftazidime inj 500 mg , ceftriaxone inj 125mg , ceftriaxone inj 1gm , ceftriaxone inj 250mg , ceftriaxone inj 500mg , chloroprozmine inj 25 mg / ml , chloroquine phosphate inj 5ml , ciprofloxacin inj 100ml , clindamycin phosphate inj 300mg , cloxacillin sodium inj 500 mg , dexamethasone inj 2ml , dextrose 10% inj 500ml , dextrose 25% inj 100ml , dextrose 5% inj 1000ml , dextrose 5% inj 500ml , diazepam inj 2ml , diclofenac sodium inj 1 ml , diclofenac sodium inj 3ml , dicyclomine inj 2ml , digoxin inj 2ml , diltiazem inj 5ml , distal water 10ml ( water for inj. ) , dns inj 1000ml , dns inj 500ml ( sodium chloride 0.9% & dextrose 5% ) , dobutamine inj 250 mg / 5ml , dopamine hcl inj 5ml , dried factor viii fraction 1000 iu / vial ( iv use ) , dried factor viii fraction 500 iu / vial ( iv use ) , dried human anti haemophlic fraction inj ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine hydrochloride inj 2ml , electrolyte m inj500 ml , enaxoparine sodium 60mg inj , ethamsylate inj 2ml , etophylline + theophylline 2ml inj , fentanyl citrate inj 2 ml , ferric carboxymaltose inj 10 ml , fructodox 10% inj 500ml , frusemide inj 2ml , gentamycin 80mg inj 2ml , gentamycin inj 20mg , glycopyrrolate inj 0.2 mg / ml , haemaceel inj ( polygeline+ nacl+ kcl+cacl2 ) 500ml , haloperidol inj 1ml , halothane inj 250 ml , heparin sodium 5000 iu / ml inj 5 ml , hepatitis b immunoglobulin inj 100 iu , human albumin solution 20% 100 ml , human chorionic gonadotropin inj 5000 iu , hyaluronidase inj ( hylase ) 1500 iu , hydrocortisone inj 100mg , hydrocortisone inj200mg , hydroxyethyl starch 6% with sodium chloride 0.9 % 500 ml intravenous infusion , hydroxyprogesterone inj 250mg , hydroxyprogesterone inj 500mg , hyoscine butylbromide inj 20 mg / ml , insulin 30%:70% inj ( 10ml ) biphasic , insulin n inj ( 10ml ) isophane 40 iu / ml , insulin r inj ( 10ml ) soluble 40 iu / ml , insuline glargine inj 100 iu / ml 3 ml cartridge , insuline glargine inj100 iu / ml 10 ml vial , iron sucrose inj 5ml , isoflurane inj 100 ml , isolyte p inj 500ml ( electrolyte p ) , isoxsuprine inj 2 ml , ketamine inj 10ml , labetalol inj 4 ml , levetiracetam inj 500 mg / 5ml , lignocaine & adrenaline inj 30 ml , lignocaine 2% inj 30ml , linezolid inj 200mg / 100ml , lorazepam inj 2ml , magnesium sulphat inj 500mg / ml 2ml , mannittol 20% inj 350ml , mannittol 20% w / v inj 100ml , mecobalamin 500 mcg / ml inj 1 ml , meropenem inj 1 gm , meropenem inj 500 mg , methyl ergometrine inj 1ml , methyl prednisolone sod. succinate inj 500 mg , metoclopramide inj 2 ml , metronidazole inj 100ml , morphine sulphate inj 10 mg / ml , mvi inj 10 ml , naloxone inj 0.4mg / ml 1 ml , natural progesteron inj 200mg / 2ml , neostigmine inj 0.5 mg / ml 10 ml , neostigmine inj 2.5mg / 5ml , nitroglycerin inj 5 mg / ml , noradrenaline inj 2 ml , normal saline inj 500ml ( sodium chloride ) , ofloxacin 100ml infusion , ondansetron inj 2ml , orinidazole inj 100ml , oxytocin inj 1ml , paracetamol infusion 100 ml , paractamol inj 2 ml , pentazocine inj 1 ml , pentoprazole inj 40 mg vial , pheniramine mealate inj 2ml , phenobarbitone inj 1ml , phenytoin sodium inj 2ml , pilocarpin inj 1ml , piperacillin + tazobactum inj 4gm+500mg , potasium chloride inj 10ml , pralidoxime chloride inj 25 mg / ml / 500 mg , prochlor perazine mesylate inj 5ml , promethazine inj 2 ml , promethazine inj 2ml , propofol inj 20 ml vial , quinine dihydrochloride inj 2ml , rabies vaccine human ( cell culture ) inj 2.5 iu dose ( 1 ml vial with 1 ml diluent ) , ranitidine hcl inj 2ml , remdesivir 100 mg inj. , ringer acetate infusion 500 ml , ringer lactate inj 1000ml , ringer lactate inj 500ml ( compound lactate ) , ringer lactate inj 500ml ( glass bottel ) , sodium biocarbonate inj 10ml , sodium chloride inj 100 ml ( normal saline ) , sodium valproate inj 100 mg / ml , streptokinase inj 15 lac units , succinyl choline inj 10ml , t.t. inj 0.5ml , tetanus vaccine ( adsorbed ) inj 5 ml vial , thiopentone inj 0.5 gm , torsemide inj 10mg / ml , tramadol 50mg / ml inj 2 ml , traxenamie acid inj 5ml , urokinase inj 5 lac unit ( lyophilized ) , valethamate bromide 8mg / ml inj 1ml , vancomycin for intravenous infusion 250 mg , vancomycin for intravenous infusion 500 mg , vecuronium bromide inj 4 mg ( freeze dried ) , vitamin b complex inj 10 ml , vitamin k inj 1ml ( menadione ) , vitamin k 1 inj ( phytomenadione ) 1 mg / 0.5ml , alpha beta arteether [ lp.26 ] [ m ] , multivitamine 10 ml , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , doxcyline100 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , vitamin d ( 600000 iu ) 15 mg , cefepime injection ip 500 mg [ 510 ] , ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] , esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] , linezolid inj200mg / 100ml [ 517 ] , normal human intravenous immunoglobulin 5g / 100ml [ 633 ] , rh erythropoetininj 10000 iu [ 176 ] , rh erythropoetininj 4000 iu [ 179 ] , tablets / capsules list , acebrophylline 100 mg tab , aceclo 50 mg +para 325 mg+sera 10 mg tab , aceclofenac 100mg + paracetamol 325mg tab , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , act kit ( containing3 tab of artesunate 1x37.5mg ) , act kit ( containing3 tab of artesunate 200mg, 2 tab of sulphadoxine 750 mg & pyrimethamine 37.5mg ) , act kit ( containing3 tab of artesunate 50mg, 1 tab of sulphadoxine 500 mg & pyrimethamine 25mg ) , acyclovir 200mg tab , acyclovir 800mg tab , albendazole 400mg tab , allopurinol 100 mg tab , alprazolam 0.25mg tab , alprazolam 0.5 mg tab , amitriptyline tab ip 25mg film coated , amlodipine2.5 mg tab , amlodipine 5 mg & enalapril 5 mg tab , amlodipine 5mg+ atenonol 50mg tab , amlodipine 5mg +lisinopril 5mg tab , amlodipine tablets ip 5 mg , amoxycillin 250mg & cloxacillin 250 mg cap , amoxycillin 250mg + calvulanic acid 1x375mg , amoxycillin 250mg cap , amoxycillin 500mg + calvulanic acid 1x625mg , amoxycillin 500mg cap , amoxycillin dispersible tab 125 mg , ampicilline 500mg cap , antacid tab ( aluminium hydroxide+magnesium trisilicate+peppermint oil ) , anticold tab ( cetirizine 5 mg, phenylephrine 1x325 mg ) , artemether 40 mg and leumefantrine 240 mg tablet , artemether 80 mg and leumefantrine 480 mg tablet , ascorbre acid 500mg tab , aspirin 150mg ( gastro resistant ) tab , aspirin 75mg tab delayed release , atenolol 25mg tab , atenolol 50mg tab , atorvastatin tablets ip 40 mg , atorvastin 10mg tab , atorvastin 20mg tab , azithromycin 100mg tab , azithromycin 250mg tab , azithromycin 500mg tab , b. complex tab ( prophylactic ) , baclofen 10 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg tab , betemethasone 0.5 mg tab , bisacodyl 5mg tab , cabergoline 0.5 mg tab , calcitriol capules 0.25mcg , calcium 500mg with vitamin d3 250 iu tab , cap vitamin a , carbamazepine 100 mg tab , carbamazepine 200mg tab , carbimazole tabs ip 5 mg ( film coated ) , carvedilol 3.125 mg tab , cefadroxil 250 mg tab , cefadroxil 500 mg tab , cefixime 100mg tab , cefixime 200mg tab , cefpodoxime 100mg tab , cefpodoxime dispersible tab 50 mg , cefuroxime axetil tab ip 250 mg , cephalexin 125mg dt tab , cephalexin 250 mg cap , cephalexin cap500 mg , cetrizine 10mg tab , chlordiazepoxide tablets ip 10mg , chloroquine phosphate 250mg tab , chlorpheniramine maleate 4mg tab , cinnarizine 25mg tab , cinnarizine 75mg tab , ciprofloxacin 250mg tab , ciprofloxacin 500mg tab , ciprofloxacin+tinidazole tab , clindamycine 150mg cap , clobazam 10 mg tab , clobazam 5 mg tab , clomifene 25 mg tab , clomifene 50 mg tab , clonazepam 0.5mg tab , clopidogrel 75 mg and aspirin 75 mg tab , clopidogrel 75mg tab , clotrimazole ( vaginal ) 500 mg tab , clotrimazole powder 1x30 gm , deflozacort 0.6mg tab , dexamethasone 0.5mg tab , diazepam 5mg tab , diclofenac 50 mg +paracetamol 325 mg +chloroxozone 250mg tab , diclofenac gastro resistant50 mg tab , diclofenac sodium + serrtiapeptidase + paracetamol 325mg tab , diclofenac sodium 100 mg sr tab , diclofenac sodium 50 mg + paracetamol 325mg tab , dicyclomin+mephenic acid tab , dicyclomine hcl 20mg + paracetamol 325mg tab , dicyclomine tab ip 10 mg , digoxin 0.25mg tab , diltiazem tabs ip 30 mg film coated , divalproex extended release 250 mg tab , domperidone tab ip 10 mg , doxycyclin 100mg cap , doxylamine succinate 20mg & pyridoxine hcl 20 mg tab , drotaverine 40mg tab , drotaverine 80mg +mephenic acid 250mg tab , dutasteride 0.5 mg tab , enalapril maleate 10 mg tab , enalapril maleate 2.5 mg tab , enalapril maleate 5mg tab , escitalopram tab ip 10 mg , ethamsylate 500mg tab , etophylline 23mg +theophyllin 77mg tab , etoricoxib120mg tab , etoricoxib 90mg tab , ferrous sulphate 100 mg with folic acid 0.5mg tab ( iron folic acid tab ) , flavoxate tablets ip / bp 200 mg ( coated tablet ) , fluconazole 150mg tab , flunarizine 5mg tab , fluoxetine 20 mg cap , folic acid 5mg tab , formalin tablet , frusemide tab ip 40 mg , gabapentine 300mg tab , glibenclamide 5mg tab , glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride tab ( sustained release ) 500 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , gliperimide 1mg+metformin 500mg sr tab , gliperimide 2mg+metformin 500mg sr tab , glipizide 5mg + metformin 500 mg tab , glipizide 5mg tab , glyceryl trinitrate 2.6mg controlled release tab , griseofulvin 125mg tab , haloperidol 1.5mg tab , haloperidol 5mg tab , hydrochlorthiazide 12.5 mg tab , hydrochlorthiazide 25 mg tab , hydroxychloroquine sulphate 200 mg tab , hydroxychloroquine sulphate 400 mg tab , hydroxyzine 25 mg tab , hyoscine butyl bromide 10mg tab , ibuprofen400 mg tab , ibuprofen 400mg + paracetamol 325mg tab , imipramine 25 mg tab , imipramine 75 mg tab , indomethacin 25 mg cap , isosorbide dinitrate 5mg tab , isosorbide mononitrate 20mg tab , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , itraconazole cap 200 mg , ketorolac 10 mg tab , labetalol 100 mg tab , lactic acid bacillus tab 60 million spores , levetiracetam 500 mg tab , levocetrizine 5mg tab , levodopa 1x10mg tab , levodopa 250mg and carbidopa 25mg tab , levofloxacin 500 mg tab , levofloxacin tablets ip 250 mg , levosulpiride 25mg tab , lincomycin 500mg tab , linezolid tablets ip 600 mg , lisinopril 10mg tab , lisinopril 2.5 mg tab , lisinopril tab ip 5 mg , lithium carbonate 300 mg tab , loperamide tab ip 2 mg , lorazepam 2mg tab , losartan 25 mg tab , losartan 50mg + amlodipine 5mg tab , losartan pot. 50mg & hydrochlorothiazide 12.5 mg tab , losartan tab ip 50 mg , mefenamic acid 500mg tab , mesalamine 1.2 gm enteric coated tab , metformin500mg film coated tab , metformin hcl sr 1000mg tab , methotrexate 10 mg , methyl cobalamine 500 mcg tab , methylcobamin 1500mcg tab , methyldopa 250mg tab ( film coated ) , methylergometrin0.125mg tab , metoclopramide 10mg tab , metoprolol 25mg tab , metoprolol succinate 50 mg tab , metronidazole 200mg tab , metronidazole 400mg tab , mifepristone 200 mg tab , misoprostol 200 mcg tab , montelucast 10mg + levocetrizine 5mg tab , multivitamin + f.a.+ minerals tab , naproxen 250 mg tab , naproxen 500 mg tab , natural micronised progesteron soft gelatin cap 200 mg , neomycin, bacitracin and sulphacetamide powder 10 gm , neostigmine 15 mg tab , neproxen 500 mg tab , nifedipine 5 mg cap ( nicardia ) , nifedipine sr 10 mg tab ( nicardia ) , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin 400mg ( film coated ) tab , ofloxacin 200mg + ornidizole 500mg tab , ofloxacin 200mg tab , olanzapine tab ip 5 mg , omeprazole 20mg cap , omperazole 20mg + domeradom cap , ondensetron orally disintegrating 4mg tab , ors powder ( who formula ) 20.5 gm , oseltamivir capsule ip 30 mg , oseltamivir capsule ip 45 mg capsule , oseltamivir capsule ip 75 mg capsule , oxcarbazepine 150mg tab , pantoperazole 40mg tab , pantoprazole 40mg and domperidone 30mg sr cap , paracetamol 500mg tab , phenazopyridine 5 mg tab , pheneramine mealate 25mg tab , phenobarbitone 30mg tab , phenytoin 100mg tab , pioglitazone tab ip 15 mg , piracetam 200mg tab , piracetam 800mg tab , prazosin 2.5 mg tab , prednisolone 10mg tab , prednisolone 20mg tab , prednisolone 5 mg tab , pregabaline 75 mg cap , primaquine 2.5mg tab , primaquine 7.5mg tab , probiotic sachets 1 gm size , prochlorperazine 5mg tab , promethazine 25 mg tab , propranolol 40mg tab , pyridoxine 10mg tab , pyridoxine 40mg tab , quinnine sulphate ( enteric coated ) 300mg tab , rampril 2.5mg tab , rantidine 150mg film coated tab , rantidine 300mg film coated tab , risperidone 1 mg tab , risperidone 2 mg tab , rotacap budesonide powder for inhalation 40 mcg ( budecort ) , rotacap formoterol fumerate & budesonide powder for inhalation 6 mcg +200 mcg ( foracort ) , salbutamol 2mg tab , salbutamol 4mg tab , serraptionpeptidase 10mg tab , sertaline 50mg tab , sodium bicarbonate 1 gm tab , sodium valproate gastro resistant 200 mg tab , sodium valproate gastro resistant 500 mg tab , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , tamsulosin hcl tablets 0.4 mg , telmisartan 40mg tab , tenaligliptin tab 20mg , terbinafine hcl 250 mg , terbutaline 2.5 mg tab , theophyllin 400mg prolonged release tab , thiamine 100mg tab , thyroxine 100 mcg tab , thyroxine 50 mcg tab , tinidazol 300mg tab , tinidazol 500mg tab , tizanidine hcl 2 mg tab , torsemide 10 mg tab , tramadol 50mg cap , traxenamic 500 mg + ethamsylate 250 mgtab , traxenamic acid 500 mg + mephenic acid 250 mg tab , traxenamic acid 500mg tab , trifluperazine 5 mg coated tab , trihexyphenidyl hcl tab ip 2 mg , trypsin & chemotrypsin tab , ursodeoxycholic acid tablets 300 mg , verapamil 40mg tab ( film coated ) , vitamin c 500mg + zinc 20mg tab , vitamin d 1 gm sachets ( cholecaciferol granules ) , vitamin e 200mg tab , zinc 20mg tab , zinc sulphate 10mg tab , zolpidem 5mg tab , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , clarithromycin 500mg , deflazacort 6 mg , esomeprazole 40 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , rifaximin 500mg , rosuvastatin 160mg + finofib 10mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , clonidine hydrochloride tablet ip 0.1 mg , finasteride tablets ip 5 mg , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] , rosuvastatin tablet 10 mg [ 757 ] , linezolid tablets ip 600 mg [ 516 ] , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , zinc 50mg , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole 20mg +levosulpiride 75 mg , syrup / ointment list , acyclovir cream 5% , acyclovir oral susp. 400mg / 5ml , albendazole oral suspension ip 400 mg / 10ml , amoxycillin & pot. clavunate oral susp. ( 30ml ) , amoxycillin 125mg / 5ml susp. ( 30ml ) , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , anticold syrup 30 ml ( each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg ) , azithromycine syp 15ml ( 100mg / 5ml ) , beclomethasone + neomycin + clotrimazole cream 10gm , beclomethasone inhalation ip 200 mcg / dose ( 200 metered dose container ) , betamethasone dipropionate cream 0.05% 15 gm , betamethasone lotion ip 0.05 o / o 50ml , betamethasone+ salisilic acid cream 5gm , budesonide inhaler 200 mcg , budesonide nebulizer susp. 0.25mg / ml 2 ml , calamine lotion 100 ml , calcium + vtamin d3 susp. ( 100ml ) , calcium phosphate syp 200 ml , carbamazepine oral susp. 100 ml , cefadroxil syp ( 30ml ) , cefixime oral susp. ( paed drops ) 10 ml , cefpodoxim syp ( 30ml ) , cephalexin susp. ( 30ml ) , cetirizine syrup ip 5mg / 5 ml 30 ml , cetrimide cream 15 gm , chlorhexidine mouthwash 0.2% 50 ml , chloroquine phosphate susp. ( 60ml ) , clindamycin phosphate gel usp 1o / o 20gm , clobetasol propionate cream 0.05% 20gm , clotrimazole 1 o / o w / v mouth paint 15 ml , clotrimazole cream ip 2% w / w 15gm , compound benzoic acid ointment 15 gm , co trimoxazole oral susp. 50 ml , cough syrup ( each 5 ml contains chloropheniramine maleate 3mg, ammonium chloride 130mg, sodium citrate 65mg, methol 0.5 mg ) 50ml , cough / expetotrant ( ambroxol hydrochloride ip 15mg+tebutaline sulphate ip 1.5mg+guaiphenesin ip 50mg+menthol ip 1mg ) 50ml , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , dextromethorphen + bromhexine + cpm + menthol syp 60 ml , diclofenac gel 20 gm ( dicofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3% menthol 5% ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml 30ml , dicylomine hcl + activated dimethicon 10ml drop , disodicum hydrogem citrate 100ml alkylizer syp , domperidon oral drops 10ml , domperidon susp. ( 30ml ) , drop caffeine citrus , formaldehyde solution 450ml , framycetin sulphate cream 1% 30 gm , fusidic acid cream 2% , gamabenzine hexachloride lotion 100ml 1% ( lindane lotion ) , gluteraldehyde solution 2% 5 ltrs can , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 10ml , hand sanitizer 500 ml ( alcoholic rub in hand ) , hydrogen peroxide solution 6% 400ml , ipratropium bromide nebulizer solution 250 mcg / ml , iron and folic acid suspension 100ml , ketoconazole 1% shampo 50ml , ketoconazole cream 2% 15 gm , lactulose solution 100ml , levetiracetam oralsusp. 100 ml , lignocine jelly 2% 30gm , lincomycin syp 60ml , liquid formalin 5ltr. , liquid paraffin 100ml , liquide glycerine 100ml , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60ml , miconazole nitrate cream ip 2% 15gm , multi vitamin drops 15ml , multi vitamin syrup 200 ml , mupirocin ointment 2% 5gm , oflaxacin + ornidazole syp ( 30ml ) , oflaxacin + tinidazole syp 30 ml , oflaxacin oral susp. 30ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oseltamivir phosphate for oral suspension ip 12 mg / ml 75 ml , paracetamol drops paediatric 15 ml , paracetamol syp 125 mg / 5ml 60 ml , permethrin lotion 5% 30ml , phenyl ( black disinfectant fluid ) 5 ltrs can , phenytoin oral susp. 100 ml , potascium chloride oral solution 200ml , povidone iodine ointment 250 gm jar , povidone iodine ointment 5% 15gm , povidone iodine scrub solution 7.5% 500ml , povidone iodine solution 5% 500ml , povidone iodine solution 5%100ml , promethazine 60 ml syp , salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup2mg / 5ml 100 ml , silver sulphadiazine 1% cream ( 500gm jar ) , silver sulphadiazine 1% cream 250gm , silver sulphadiazine cream 10gm , silver sulphadiazine1% cream 50gm , sodium hypochloride solution 5 lt can 10% , sodium hypochloride solution 5 lt can 6% , sodium phosphates enema 100 ml , sodium valprorate oral solution 200 mg / 5ml 100 ml , surgical spirit ip / bp ( 100 ml ) , surgical spirit ip / bp ( 500 ml ) , terbinafine cream 1% w / w 10 gm , tooth gel 50 gm ( sodium monoflurophosphate 0.7% and potassium nitrate 5% , tretenoin cream 0.025% 20gm , vitamine a paediatric oral solution 100ml , vitamine d3 oral solution 60000 iu 5ml , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine 200 ml , drotavarine 60 ml , mefenamice acid 100mg / 5ml , montelucast+levocetrizine 60 ml , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine 60 ml , ondansetron 30 ml , zink 20 mg, 100 ml , lignocain mouth paint 10 ml , cream luliconazole 1% w / w , eye / ear / nasal drops , aciclovir eye ointment 3% 5gm , acyclovireye ointment 5 mg , amikacin eye drop 5 ml , atropin sulphate 1% e / d 10ml , atropine eye ointment 1% 3 gm tube , b.p. blade no. 11 , b.p. blade no. 15 , black gogals , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , buds sticks , carbolic acid 400gm , carboxymethyl celluslose 0.5%e / d 10ml , carboxymethyl celluslose 5ml e / d , chloramphenicol 1% w / w eye ointment 3 gm tube , chloramphenicol eye drops ip 0.5 0 / 0 5ml , cipro + dexa 10ml e / d , ciprofloxacin &dexamethasone 5ml e / d , ciprofloxacin eye drops 0.3 o / o w / v 5ml , ciprofloxacin ophthalmic ointment usp 0.3% 5gm tube , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , cresent blade 2.8mm ( 1 piece rate ) , cyclopentolate eye drop 5 ml , disposal eye pad ( 6cmx8cm ) 01 no , eyebuds ( 100 buds ) , fluconazole 0.3% e / d 5ml , flurbiprofen eye drop 10 ml , flurbiprofen sod. e / d0.03% 5ml , foldable intra ocular lence with injector ( size 18 to 24 no. ) ( sterile hydrophilic acrylic ) , fumigation with silver hydrogen peroxide, grade standard , genta+dexa 10ml eye / ear , gentamycin 10ml e / d , gentamycin 10ml e / d , homatropine 2% e / d , hydroxy propyl methyl cellulose solution ( 2mlglass syringe with cannula ) , hypersol s e / d 10 ml , inj. viscomet ( 3ml ) , iol single piece lence ( size 18 to 24 no. ) standard pama intraocular lenses , keratome blade 3.5mm , ketorolac tromethamine + moxyfloxacine eye drop 5 ml , lidocaine hcl topical solution 4% 30 ml , metal frame with glasses ( spects ) , moxifloxacin + dexamethasone 10ml eye / ear , moxifloxacin + dexamethasone 5ml eye / ear , moxifloxacin 0.5% e / d 5ml , moxifloxocin + prednisolone e / d 5 ml , moxigram e / d 5ml , nasal spray 100mg ( azelistin + nometozone ) 15 ml , nasal spray 100mg ( flutosone ) , neomycin, polymixin b and hydrocortisone ear drops 10 ml , nephazoline & pheniramine eye drop 10 ml , oflax+prednesolon e / d 10 ml , oflaxacin eye / ear 10ml , ofloxa + betamethasone + acetcic acid e / d 10 ml , ofloxa+dexamethasone eye / ear ( 10ml ) , oxymetazolin nasal drop 10ml , phenylephrine hcl 5% e / d 5 ml , pilocarine 2% e / d 5ml , potassium permanganate ( kmno4 ) crystal 20gm , povidone iodine eye drop 10 ml , predinislone e / d 10ml , predinislone e / d 5ml , saline nasal drops 10 ml , suture 10 0 , timolol + pilocarpin e / d 5 ml , timolol 0.5 % e / d 5ml , tobra d eye ointment 3.5 gm , tobramycin e / d 0.3% 5ml , tobramycin ophthalmic ointment usp 0.3% 5gm , tobriamycin + dexamethasone e / d5ml , tobrimycin + dexa e / d10ml , travoprost 0.004% 3 ml , tropicacil e / d ( tropicamide ) 5 ml , tropicacil plus 10ml e / d , tropicacil plus 5ml e / d , trypen blue dye 1ml , wax dissolving ear / drops ( ceruminolytic drops ) 10ml , xylometazoline nasal drops 0.1% 5 ml , chloramphenicol +polymycine 5 gm , chloramphenicol +polymycine + dexamethason 5 gm , carboxymethylcellulose + glycerin 10 ml , gatifloxacin and prednisolone 10 ml , moxifloxacilline+ dyliprednate 5 ml , moxifloxacilline+ prednisone 5 ml , natamycin 5%5 ml , sodium chloride 5%5 ml , tropicamide + phenlyephrine 5 ml , dorzolamide 5 ml , moxifloxacin and prednisolone 5 ml , olaptadine & ketrolac 5 ml , polymyxin b 10000iu / gm + neomycin 3400iu / gm 5 ml , betaxolol eye drops 0.5 o / o5 ml , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin 15 ml , vitamind3 400 iu 15 ml , vitamind3 800 iu 15 ml...

Medical And Health Services - Rajasthan

31778068 supply of medicine and surgical items in rmrs chittorgarh tablet injection syrup etc abdominal drain kit all size , aldehydes solution for fogger machine ` , b p instrument non mercury , b.p. bulb , b.p. cuff ( rubber & cloth ) , b.t. set , baby dipper , black googles for catractract operation , blood doner set , blue dye , bp instrument ( mercury ) diamond / pagoda , bp instrument digital ( omron, bpl, infy ) , cannula fixator , cap.aerocort rotacap , cap. indomethacin 25 mg , cap. indomethacin 75 mg sr , cap. multivitamin + minerals + zinc , cap. pantoprazole 40 mg + domperidone 30 mg dsr , cap. progeston 200 mg , cap. progeston 300 mg , cap.rabeprazole 20mg+dom. 10mg , cap.vitamin e 400 mg , cervical color , clotrimazole 1 % talcum , cord clamp , corrugated drain sheet , cotton roll , cream. acyclovir , cream. beclomethasone0.025% + clotrimazole 1% + , cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% , cream. erythromycin + alov vera , cream. fusidic acid + beclometh. dipro. , cream. mometasone furoate , crepe bendage 10 inch , crepe bendage 6 inch , crepe bendage 8 inch , delivary kit , dispo needle24, 26 no. , dispo syringe 10 ml , dispo syringe 2 ml , dispo syringe 20 ml , dispo syringe 3 ml , dispo syringe 5 ml , dispo syringe 50 ml , dispo. e.t tube size 2.5 / 3.0 / 3.5 , disposable ot gown , drop dizestive+ enzyme 30ml , drop hydroxyzime 15ml , drop. lactac enzyme 15 ml , drop. vitamin d 3 30ml , drop.chlolcicolchpherol30ml , drop.fungal distare+ papsine15 ml , drops. chloprheniramine + pcm + phenyleph , drops. dexamethasone + chloramphenicol , drops. dexamethasone + gentamycin , drops. dexamethasone + ofloxacin , drops. gentamicin eye / ear , drops. paracetamol 100 mg , drops. phenylephrine hyd + cpm. maleate , drops. salbutamol+ ambroxol , drops. sulphacetamide eye , drops. tobramycin 0.3 % eye , drops. xylometazoline 0.01% nasal , drops. xylometazoline 0.05% nasal , e.c.g. electrode ( chest lid. ) , eye drop prednisolo 10 ml , f.b.n.c. kit ( strelise iso certifyed ) , fast absorable poliglactin 910 , fetal doppler , flatus tube , foleys cathater no. 12 , foleys cathater no. 14 , foleys cathater no. 16 , foleys cathater no. 18 , gallent blade , gel. cervi prime , gel. clindamycim 1% , gel. diclofenac , gel. lignocaine hydrochloride , gel. piroxicam , gloves all size6.5, 7, 7.5 , h.i.v. kit ( strelise iso certifyed ) , homotropine 2% , hypersol eye drop 10 ml , i.v. canula18 , 20 , 22 , i.v. canula 24, 26 ( romson, medicath, neocath, neocan ) , i.v. set , infant feeding tube all size , ing. amoxiclav 150mg ( amoxiclove ) , ing. ampoxin / megapain 1 gm , ing. ampoxin / megapain 500 mg , ing. ascorbicacid 500 ml , ing. buscogast 2ml , ing. calcium sandoz 10ml , ing. cefrin plus 375 mg , ing. cefrine plus 750 mg , ing. ceftzoxon+tezbactm 281.25mg , ing. ceftzoxon+tezbactm562.50 mg , ing. diclofanic 1ml ( aqua ) , ing. drotavarin 2ml , ing. hucog 5000 iu ( human cronic gonadotrotine 5000 iu , ing. liycomicen 2 ml , ing. mefentermin 10 ml , ing. netilmican 10mg , ing. netilmican 25mg , ing. netilmican 50mg , ing. superspas / nobalspas 2ml , ing. velthamate 2ml , ing. vit .bcomplex2 ml , ing.ampoxin / megapain 250 mg , ing.c amoxiclav 300mg ( amoxiclove ) , ing.cefepime500mg , ing.dilzem 1 ml , ing.liycomicen 1 ml , ing.meropenam 1 gram , ing.montaz250mg , ing.natuzampragestoen 100mg ( 2ml ) , ing.oxytocin 1 mg , inj. acuclav / agclav / mega cv 150 mg , inj. acuclav / agclav / mega cv 300 mg , inj. adrenaline , inj. alamin sn , inj. alpha beta arteether 2 ml , inj. amiadarone , inj. amikacin 100 mg , inj. amikacin 250 mg , inj. amikacin 500 mg , inj. amoxycillin + clavulanate pot. 1.2gm , inj. anti snake venum , inj. anti d , inj. artesunate 60 mgwith soda. bicarb 5 ml combo pack , inj. ascorbic acid 150 mg. , inj. atropine , inj. azithro mycin 500 ml , inj. betamethasone 4 mg , inj. botropase , inj. butrum , inj. butrum , inj. cefoparazone + sulbactum 1.5 gm , inj. ceftazidine 1 gm. , inj. ceftriaxone 1gm , inj. ceftriaxone 1gm. + sulbactum 500 mg , inj. ceftriaxone 1gm. + tazobactum 125 mg , inj. ceftriaxone 2 gm , inj. ceftriaxone 250mg , inj. ceftriaxone 250mg. + sulbactum 125 gm , inj. ceftriaxone 500mg , inj. ceftriaxone 500mg. + sulbactum 500 mg , inj. citicoline 4 ml , inj. clindmicin 2ml , inj. ct contrast , inj. ct contrast , inj. d 10% ( f.f.s. ) , inj. d 5% ( f.f.s. ) , inj. d.n.s. ( f.f.s. ) , inj. daizepam 10mg / 2ml , inj. dexamethasone , inj. diclofenac , inj. diclofenac+dicyclomine , inj. dobutamine , inj. dobutamine 250mg / 5 ml , inj. dopamine 40mg / ml , inj. dopanine , inj. enoxaparin sodium 60mg , inj. envas , inj. erythroptrin 4000 iu , inj. etophylline 84.7mg + theophylline 25.3mg / 2ml , inj. frusemide 10mg / 1ml , inj. gentamicin 80 mg40 mg / 1 ml , inj. glargine , inj. h.insulin , inj. heparin vial , inj. human mixtard30 / 70 , inj. hyalase1500 iu , inj. hydrocoritison 200mg , inj. hydrocortisone 100mg , inj. hydroxyprogesterone 500 mg , inj. isolate p ( f.f.s. ) , inj. l orthinh l asprite , inj. levi taretam , inj. levo sulphride , inj. lignocaine 4% , inj. lignocaine hydrochloride 2% vial , inj. lincomycin 1ml , inj. lincomycin 2 ml , inj. linezolid , inj. livofloxacne , inj. mannitol 20% ( f.f.s. ) , inj. mecobalamin 500 mcg , inj. meg. sulf. ( 50% ) , inj. menadione sodium 1 ml , inj. meropannum 125 mg , inj. metoclopromide , inj. metronidazoleiv ( f.f.s. ) , inj. midazolan , inj. multivitamin 10 ml. vial , inj. multivitamin 2 ml. amp. , inj. n.s. ( f.f.s. ) , inj. naloxone hcl , inj. nandrolone decanoate 25mg , inj. nandrolone decanoate 50mg , inj. nitroglycerine , inj. nor adrenaline , inj. oflaxacin ( f.f.s. ) , inj. ondansetron2 mg / 1ml , inj. ondansetron2 mg / 1ml , inj. ornidazole ( f.f.s. ) , inj. ornidazole iv , inj. oxytocin 5 i.u. / 1 ml , inj. pantoprazole 40 mg , inj. paracetamol 150 mg / 1 ml , inj. pentazocine 30 mg / 1 ml amp. , inj. pheniramine maleate22.7 mg , inj. phenytion , inj. pilocarpinole , inj. piperacillin 4 gm + tazobactum 500 mg , inj. piperacillin / tazobactam 1.125 mg , inj. piracetam , inj. piroxicam 40 mg , inj. promethazine 25 mg / mlamp. , inj. propofol , inj. pyridoxime , inj. pyridoxime , inj. quinine dihydrochloride , inj. rabeprazole 20 mg , inj. rabies vaccine ( human ) ( anti ) , inj. ranitidine , inj. rl. ( f.f.s. ) , inj. soda. bi carb 25 ml , inj. stemetil 1ml / 2ml , inj. streptokinase 15 lakh iu , inj. terliprincine , inj. termin 10ml , inj. tetanus toxoid 250 iu , inj. tirofiban 5mg / 100ml , inj. tramadol hydrochloride , inj. tranexamic acid 500 mg , inj. triamcinolone 40 mg , inj. urokinase 5 lakh iu , inj. vitamin b complex , inj.carbaprost 250 mg. , inj.methargin 2ml , k 90, k 91 cathetor , knife blade 23, 24 no. , liquid o.r.s.packet , lotion. calamine , lotion. gamma benzene hexachloride 1 % , lotion. ketoconazole1 % , lotion. povidone iodine , lotion. povidone iodine , malecot cathetor no. 28, 30, 32 , malt protin +multi vitamin 250 gram , micro i v set , micropore1 inch ( 3 mtr length ) , micropore1 inch ( 3 mtr length ) , micropore2 inch ( 3 mtr length ) , micropore3 inch ( 3 mtr length ) , mop ped , mt fog solution for fogger , mucas extractor , n 95 mask , n.s. 100 ml , n.s. 500 ml ( glass bottle ) , nasal prongs for cpap size 0 & 1 , neb. mask sizeaudlt , nebuliser mask child , nebuliser mask machine , needle cutter ( 1000 ml capacity ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r55 ] , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r56 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) [ r20 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) [ r45 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) [ r46 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) [ r34 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm [ r50 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm [ r40 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm [ r51 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) [ r36 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) [ r48 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) [ r35 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm [ r29 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) [ r32 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) [ r23 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) [ r25 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) [ r53 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) [ r54 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 [ r30 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm [ r39 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm [ r49 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) [ r41 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) [ r31 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) [ r47 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) [ r26 ] , o.t. sheet , o2 nasal canulla , neonatal , paed, adult , oil vitamin ad 60ml , oint. clobetasol 0.05 % + gentamicin 0.1 % , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. heparin / thrombotas , oint. miconazole , oint. povidoneiodine10 gm , oint. silver sulphadiazine , oint. silver sulphadiazine + chlorhexidin , orthopaedic cotton roll 10 cm x 300 cm , oxygen delivery tube with mask , ped. blood doner set , pedia set , pilocarpinole eye drop 10 ml , plaster of paris , powderdexolac 500 gram , powder arginine 5 gram , ppe kit iso certified , proctoclys enema , prolin no. 1 length 70 cms , protein powder , prulin 2 / 0 ( suture ) , pv rubbergloves all size , r.l. 500 ml ( glass bottle ) , res.budecort ( budesunide ) , res.duolin ( levosalbutamol + ipratropium ) , resp. duolin , resp. levosalbutamol , romadrain under water seal bag , round band aid , ryles tube n0. 12, 14, 16, 18 , sachatvitamin d3 , sachet agysee d , sachet powder prebioatic+ lactic acid 1 gram , sanitary pad , sanitizer 100 ml70 % , sanitizer 500 ml70 % , sanitizer alcohal base 70 % , shampoo. ketoconazole 2 % , spinal needle 23 no. ( pricon ) , suction canula size 6 / 8 / 10 / 12 , suction tube for suction machine , sup. azithromycin200mg / 5ml , sup. m.v.+minerals 100ml , sup. potasium cloride 100ml , swine flue vaccine .5 ml , swine flue vaccine 5 ml , syp.pre probiotic 60ml , syp.sod.picosulphate 100 ml , syp. albendazole + ivermectin , syp. amoxycillin + clavulanate , syp. antacid ( mag.hy. + allum.hy. ) , syp. arthmether+lumither 30 ml , syp. bpricilne 100ml , syp. cepodoxim+clavonate 30 ml , syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml , syp. cotrimoxazole , syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg , syp. cyprohepatidine + tricholin citrate , syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg , syp. dextromethorphan 10 mg + phenyl hcl2 mg , syp. disodium hydrogen citrate , syp. ferrous salt + folic acid , syp. haematinic with vitamins , syp. hydroxyzime 100 ml , syp. ibuprofen 100mg + pcm 125 mg + / 5ml , syp. lactulose 10gm / 15 ml , syp. levocetrizine , syp. levocetrizine + montelokast 60ml , syp. liq.paraffin + milk of magnesia , syp. livertonice 200ml , syp. longifene 200ml / buclizine 200ml , syp. lycopin 200ml , syp. magaldrate 480 mg + simeth. 20 mg , syp. mefanic acid 60 ml , syp. mefanic+ peracitamol 60ml , syp. moxclav / mega cv 30 ml , syp. moxclav / mega cv 60 ml , syp. multivitamin+ multiminaral + amino acid200ml , syp. multivitamin+ multiminaral + lycopin 200ml , syp. multvitamin+antioxidant 200ml , syp. ofloxacin + ornidazole , syp. ofloxacin oral , syp. paracetamol 125 mg , syp. paracetamol 250 mg , syp. pcm + cpm + sod. cit. + pph , syp. pcm + promehazine , syp. polybion 100ml , syp. racecortodil+ofloxacin 60ml , syp. roxithromycin 50 mg / 5 ml , syp. salbutamol 2 mg + ambroxol 30 mg , syp. solvin cold / reconite / sinerest 60 ml , syp. sucralfate 1 g / 10 ml , syp. terbutaline sul. + bromh. + guaip. , syp. zinc 60ml , syp.cefuroxime 60ml , syp.digsestiv enzyme 200ml , tab.alprazolam0.25mg , tab.arither and lumethar ( 400mg ) , tab.cabergoline , tab.citicolin 500 mg , tab.l orthinh l asprite , tab.linezolid 600 , tab.linezolid 600mg , tab.n.t.g. sr 2.6 mg , tab.nicoran 5 mg , tab.phenytoin 100 mg , tab.sodium valporal 500 mg , tab.temsulofin0.4mg , tab.thyroxine 100 mg , tab.ursodil 300 mg , tab. aceclo + pcm + serra , tab. acelofenac 100mg , tab. acelofenac 100mg + serratiopeptidase 10mg , tab. acelofenac 100mg + thiocolchicoside 250 mg , tab. acyclovir 400 mg , tab. albendazole 400mg , tab. alprazolam0.25mg + propranolol 20mg , tab. alprazolam0.5mg , tab. amlodipine 2.5mg , tab. amlodipine 5mg + atenolol 50mg , tab. amlodipine besilate5mg , tab. amoxy 250mg + clav. acid 125mg , tab. amoxy 500mg + clavulanate 125 mg , tab. amoxyciline +lactiacid 625mg , tab. atenolol 25mg , tab. atenolol 50mg , tab. atorvastatin80 mg , tab. atorvastatin 10mg , tab. atorvastatin 40mg , tab. azithromycin 100mg dt , tab. azithromycin 250mg , tab. azithromycin 500mg , tab. betahistadin 16 mg , tab. calcium 500mg + vit. d3 , tab. carbamazepine 100mg , tab. carbamazepine 200mg , tab. cefixime 100mg disp. , tab. cefixime 200mg disp. , tab. cefixime 200mg+ clavalunicacid , tab. cefpodoxime proxetil 200 mg , tab. cefuroxime axetil 250mg , tab. cefuroxime axetil 500mg , tab. cetrizine 10 mg ( oval ) , tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg , tab. cinnarizine 20 mg + domperidone 15 mg , tab. cinnarizine 25 mg , tab. clotrimazole vaginal 500mg , tab. diclo + pcm +serra , tab. diclofenic+chymotripcin , tab. dicyclomine 10mg + mefenomic acid 250mg , tab. dicyclomine hci 10mg + pcm 500mg , tab. dothiepin 75 mg. , tab. ethamsylate 500mg , tab. ethamsylate inj. 2ml , tab. etophylline + theophylline , tab. ferobact 200 mg , tab. ferobact 300 mg , tab. ferrous sult + folic acid , tab. fexofenadine 120 mg , tab. fluconazole 150 mg , tab. fluconazole 50 mg , tab. fluoxetine 20 mg , tab. folic acid 5 mg , tab. frusemide 40 mg , tab. glimepiride 1 mg , tab. glimepiride 1 mg + metformin 500 mg , tab. glimepiride 2 mg , tab. glimepiride 2 mg + metformin 500 mg , tab. ibuprofen 100mg + pcm 125 mg , tab. ibuprofen 400mg + pcm 500mg , tab. isosorbide mononitrate 20 mg , tab. itraconzole 100 , tab. itraconzole 200 , tab. levocetrizine 5mg , tab. levofloxacin500mg , tab. lisinopril 5 mg , tab. lithium carbonate 300 mg , tab. loperamide 2 mg , tab. lorazepam 2 mg , tab. losartan 25 mg , tab. losartan patassium 50 mg , tab. losartan pota. 50 mg + amlodipine 5mg , tab. losartan potassium. 50 mg + hydroch.12.5mg , tab. lycopin+multivitamin , tab. mecobalamin 1500 mcg , tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg , tab. mefloc 100mg , tab. metformin 500 mg , tab. metoclopromide 10 mg , tab. napra d ( napraxone + domperidone ) , tab. nimesulide 100 mg , tab. nimesulide 100mg + serratiopeptidase 10mg , tab. normaxin 10 mg , tab. nynes , tab. ofloxacin + ornidazole 500 mg , tab. ofloxacin 200mg , tab. olanzapine 5 mg , tab. ondansetron 4mg , tab. ondansetron 8mg , tab. ornidazole 500mg , tab. pantoprazole 20 mg , tab. pantoprazole 40 mg , tab. pantoprazole 40 mg + domperidone 10 mg , tab. paracetamol 500 mg , tab. pheniramine maleate 25 mg , tab. phenobarbitone 30 mg , tab. phenobarbitone 60 mg , tab. pioglitazone 15 mg , tab. pioglitazone 30 mg , tab. piracetam 800 mg , tab. piroxicam disp. 20 mg , tab. prazosin 1 mg , tab. prazosin 2.5 mg , tab. prazosin 5 mg , tab. prednisolone 10 mg , tab. primaquine phosphate 15 mg , tab. primaquine phosphate 7.5 mg , tab. prochlorperazine 5 mg , tab. promethazine 25 mg , tab. quinine sulphate 300 mg , tab. rabeprazole 20 mg , tab. rabeprazole 20 mg + domperidone 10 mg , tab. rabiprazole + itopride , tab. ramipril 10 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. ranitidine 150 mg + domperidone 10 mg , tab. risperidone 2 mg , tab. sertaline 25 mg , tab. sertaline 50 mg , tab. sildenafil 50 mg , tab. spiromicyn500mg , tab. superspas / nobalspas , tab. tramadol hyd. 20 mg + pcm. 500 mg , tab. tranexamic+etamcylate , tab. tranexamic+mefanic acid , tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg , tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg , tab. trypsin chymotrypsin , tab. ursodeoxycholic 150 mg , tab. ursodeoxycholic 300 mg , tab. vitamin c 500 +zinc 50 mg , tab. vitamin c 500 mg ( ascorbic acid ) , tab. zinc 20 mg , tab. zinc 50 mg , tab. zolpidem 10 mg , tab. / cap. multivitamin+ multiminaral + lycopin , tab.cefpodoxime 200mg+ clavalunicacid , tab.clarithromycin 250 mg , tab.clonazepam 0.5mg , tab.clopidogrel 75 mg , tab.clopidogrel 75 mg+ aspirin 75mg , tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) , tab.diazepam 5 mg , tab.diclo + trypsin +chymotrypsin , tab.diclofenac 50mg + serratiopeptidase 10mg , tab.etori coxib 120mg+ gabapentin300mg , tab.etori coxib 90mg+ gabapentin100mg , tab.iver mactin 12 mg , tab.iver mactin 6 mg , tab.pregabaline75 mg +methylcobaline 1500mg , tab.rabiprazole+domperidon d , tab.zinc 10mg , triple layer mask with nose pin , tropicayl plus eye drop 10 ml , urine collection beg , venoline set200 cm , vicryl 1 no.1 / 2 cir rb 30 / 40mm needle 70 cm, , vypro mesh , weight machine ( digital ) , weight machine ( manual ) , weight machine for paediatric / neonatal ( digital ) ...

Medical Health And Family Welfare - Rajasthan

31760543 srno01 supply of medicine and surjical items in govt hospital chittorgarh , supply of medicine and surjiclail tems , abdominal drain kit all size , aldehydes solution for fogger machine ` , b p instrument non mercury , b.p. bulb , b.p. cuff ( rubber & cloth ) , b.t. set , baby dipper , black googles for catractract operation , blood doner set , blue dye , bp instrument ( mercury ) diamond / pagoda , bp instrument digital ( omron, bpl, infy ) , cannula fixator , cap.aerocort rotacap , cap. indomethacin 25 mg , cap. indomethacin 75 mg sr , cap. multivitamin + minerals + zinc , cap. pantoprazole 40 mg + domperidone 30 mg dsr , cap. progeston 200 mg , cap. progeston 300 mg , cap.rabeprazole 20mg+dom. 10mg , cap.vitamin e 400 mg , cervical color , clotrimazole 1 % talcum , cord clamp , corrugated drain sheet , cotton roll , cream. acyclovir , cream. beclomethasone0.025% + clotrimazole 1% + , cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% , cream. erythromycin + alov vera , cream. fusidic acid + beclometh. dipro. , cream. mometasone furoate , crepe bendage 10 inch , crepe bendage 6 inch , crepe bendage 8 inch , delivary kit , dispo needle24, 26 no. , dispo syringe 10 ml , dispo syringe 2 ml , dispo syringe 20 ml , dispo syringe 3 ml , dispo syringe 5 ml , dispo syringe 50 ml , dispo. e.t tube size 2.5 / 3.0 / 3.5 , disposable ot gown , drop dizestive+ enzyme 30ml , drop hydroxyzime 15ml , drop. lactac enzyme 15 ml , drop. vitamin d 3 30ml , drop.chlolcicolchpherol30ml , drop.fungal distare+ papsine15 ml , drops. chloprheniramine + pcm + phenyleph , drops. dexamethasone + chloramphenicol , drops. dexamethasone + gentamycin , drops. dexamethasone + ofloxacin , drops. gentamicin eye / ear , drops. paracetamol 100 mg , drops. phenylephrine hyd + cpm. maleate , drops. salbutamol+ ambroxol , drops. sulphacetamide eye , drops. tobramycin 0.3 % eye , drops. xylometazoline 0.01% nasal , drops. xylometazoline 0.05% nasal , e.c.g. electrode ( chest lid. ) , eye drop prednisolo 10 ml , f.b.n.c. kit ( strelise iso certifyed ) , fast absorable poliglactin 910 , fetal doppler , flatus tube , foleys cathater no. 12 , foleys cathater no. 14 , foleys cathater no. 16 , foleys cathater no. 18 , gallent blade , gel. cervi prime , gel. clindamycim 1% , gel. diclofenac , gel. lignocaine hydrochloride , gel. piroxicam , gloves all size6.5, 7, 7.5 , h.i.v. kit ( strelise iso certifyed ) , homotropine 2% , hypersol eye drop 10 ml , i.v. canula18 , 20 , 22 , i.v. canula 24, 26 ( romson, medicath, neocath, neocan ) , i.v. set , infant feeding tube all size , ing. amoxiclav 150mg ( amoxiclove ) , ing. ampoxin / megapain 1 gm , ing. ampoxin / megapain 500 mg , ing. ascorbicacid 500 ml , ing. buscogast 2ml , ing. calcium sandoz 10ml , ing. cefrin plus 375 mg , ing. cefrine plus 750 mg , ing. ceftzoxon+tezbactm 281.25mg , ing. ceftzoxon+tezbactm562.50 mg , ing. diclofanic 1ml ( aqua ) , ing. drotavarin 2ml , ing. hucog 5000 iu ( human cronic gonadotrotine 5000 iu , ing. liycomicen 2 ml , ing. mefentermin 10 ml , ing. netilmican 10mg , ing. netilmican 25mg , ing. netilmican 50mg , ing. superspas / nobalspas 2ml , ing. velthamate 2ml , ing. vit .bcomplex2 ml , ing.ampoxin / megapain 250 mg , ing.c amoxiclav 300mg ( amoxiclove ) , ing.cefepime500mg , ing.dilzem 1 ml , ing.liycomicen 1 ml , ing.meropenam 1 gram , ing.montaz250mg , ing.natuzampragestoen 100mg ( 2ml ) , ing.oxytocin 1 mg , inj. acuclav / agclav / mega cv 150 mg , inj. acuclav / agclav / mega cv 300 mg , inj. adrenaline , inj. alamin sn , inj. alpha beta arteether 2 ml , inj. amiadarone , inj. amikacin 100 mg , inj. amikacin 250 mg , inj. amikacin 500 mg , inj. amoxycillin + clavulanate pot. 1.2gm , inj. anti snake venum , inj. anti d , inj. artesunate 60 mgwith soda. bicarb 5 ml combo pack , inj. ascorbic acid 150 mg. , inj. atropine , inj. azithro mycin 500 ml , inj. betamethasone 4 mg , inj. botropase , inj. butrum , inj. butrum , inj. cefoparazone + sulbactum 1.5 gm , inj. ceftazidine 1 gm. , inj. ceftriaxone 1gm , inj. ceftriaxone 1gm. + sulbactum 500 mg , inj. ceftriaxone 1gm. + tazobactum 125 mg , inj. ceftriaxone 2 gm , inj. ceftriaxone 250mg , inj. ceftriaxone 250mg. + sulbactum 125 gm , inj. ceftriaxone 500mg , inj. ceftriaxone 500mg. + sulbactum 500 mg , inj. citicoline 4 ml , inj. clindmicin 2ml , inj. ct contrast , inj. ct contrast , inj. d 10% ( f.f.s. ) , inj. d 5% ( f.f.s. ) , inj. d.n.s. ( f.f.s. ) , inj. daizepam 10mg / 2ml , inj. dexamethasone , inj. diclofenac , inj. diclofenac+dicyclomine , inj. dobutamine , inj. dobutamine 250mg / 5 ml , inj. dopamine 40mg / ml , inj. dopanine , inj. enoxaparin sodium 60mg , inj. envas , inj. erythroptrin 4000 iu , inj. etophylline 84.7mg + theophylline 25.3mg / 2ml , inj. frusemide 10mg / 1ml , inj. gentamicin 80 mg40 mg / 1 ml , inj. glargine , inj. h.insulin , inj. heparin vial , inj. human mixtard30 / 70 , inj. hyalase1500 iu , inj. hydrocoritison 200mg , inj. hydrocortisone 100mg , inj. hydroxyprogesterone 500 mg , inj. isolate p ( f.f.s. ) , inj. l orthinh l asprite , inj. levi taretam , inj. levo sulphride , inj. lignocaine 4% , inj. lignocaine hydrochloride 2% vial , inj. lincomycin 1ml , inj. lincomycin 2 ml , inj. linezolid , inj. livofloxacne , inj. mannitol 20% ( f.f.s. ) , inj. mecobalamin 500 mcg , inj. meg. sulf. ( 50% ) , inj. menadione sodium 1 ml , inj. meropannum 125 mg , inj. metoclopromide , inj. metronidazoleiv ( f.f.s. ) , inj. midazolan , inj. multivitamin 10 ml. vial , inj. multivitamin 2 ml. amp. , inj. n.s. ( f.f.s. ) , inj. naloxone hcl , inj. nandrolone decanoate 25mg , inj. nandrolone decanoate 50mg , inj. nitroglycerine , inj. nor adrenaline , inj. oflaxacin ( f.f.s. ) , inj. ondansetron2 mg / 1ml , inj. ondansetron2 mg / 1ml , inj. ornidazole ( f.f.s. ) , inj. ornidazole iv , inj. oxytocin 5 i.u. / 1 ml , inj. pantoprazole 40 mg , inj. paracetamol 150 mg / 1 ml , inj. pentazocine 30 mg / 1 ml amp. , inj. pheniramine maleate22.7 mg , inj. phenytion , inj. pilocarpinole , inj. piperacillin 4 gm + tazobactum 500 mg , inj. piperacillin / tazobactam 1.125 mg , inj. piracetam , inj. piroxicam 40 mg , inj. promethazine 25 mg / mlamp. , inj. propofol , inj. pyridoxime , inj. pyridoxime , inj. quinine dihydrochloride , inj. rabeprazole 20 mg , inj. rabies vaccine ( human ) ( anti ) , inj. ranitidine , inj. rl. ( f.f.s. ) , inj. soda. bi carb 25 ml , inj. stemetil 1ml / 2ml , inj. streptokinase 15 lakh iu , inj. terliprincine , inj. termin 10ml , inj. tetanus toxoid 250 iu , inj. tirofiban 5mg / 100ml , inj. tramadol hydrochloride , inj. tranexamic acid 500 mg , inj. triamcinolone 40 mg , inj. urokinase 5 lakh iu , inj. vitamin b complex , inj.carbaprost 250 mg. , inj.methargin 2ml , k 90, k 91 cathetor , knife blade 23, 24 no. , liquid o.r.s.packet , lotion. calamine , lotion. gamma benzene hexachloride 1 % , lotion. ketoconazole1 % , lotion. povidone iodine , lotion. povidone iodine , malecot cathetor no. 28, 30, 32 , malt protin +multi vitamin 250 gram , micro i v set , micropore1 inch ( 3 mtr length ) , micropore1 inch ( 3 mtr length ) , micropore2 inch ( 3 mtr length ) , micropore3 inch ( 3 mtr length ) , mop ped , mt fog solution for fogger , mucas extractor , n 95 mask , n.s. 100 ml , n.s. 500 ml ( glass bottle ) , nasal prongs for cpap size 0 & 1 , neb. mask sizeaudlt , nebuliser mask child , nebuliser mask machine , needle cutter ( 1000 ml capacity ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r55 ] , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm [ r56 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) [ r22 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) [ r20 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) [ r21 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm [ r57 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) [ r45 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) [ r46 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) [ r34 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm [ r50 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm [ r40 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm [ r51 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) [ r44 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) [ r36 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) [ r48 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) [ r35 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm [ r29 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) [ r32 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm [ r42 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm [ r75 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) [ r23 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r28 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) [ r27 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) [ r25 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) [ r53 ] , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) [ r54 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 [ r30 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm [ r39 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) [ r43 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm [ r49 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) [ r41 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) [ r31 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) [ r47 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) [ r26 ] , o.t. sheet , o2 nasal canulla , neonatal , paed, adult , oil vitamin ad 60ml , oint. clobetasol 0.05 % + gentamicin 0.1 % , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% , oint. heparin / thrombotas , oint. miconazole , oint. povidoneiodine10 gm , oint. silver sulphadiazine , oint. silver sulphadiazine + chlorhexidin , orthopaedic cotton roll 10 cm x 300 cm , oxygen delivery tube with mask , ped. blood doner set , pedia set , pilocarpinole eye drop 10 ml , plaster of paris , powderdexolac 500 gram , powder arginine 5 gram , ppe kit iso certified , proctoclys enema , prolin no. 1 length 70 cms , protein powder , prulin 2 / 0 ( suture ) , pv rubbergloves all size , r.l. 500 ml ( glass bottle ) , res.budecort ( budesunide ) , res.duolin ( levosalbutamol + ipratropium ) , resp. duolin , resp. levosalbutamol , romadrain under water seal bag , round band aid , ryles tube n0. 12, 14, 16, 18 , sachatvitamin d3 , sachet agysee d , sachet powder prebioatic+ lactic acid 1 gram , sanitary pad , sanitizer 100 ml70 % , sanitizer 500 ml70 % , sanitizer alcohal base 70 % , shampoo. ketoconazole 2 % , spinal needle 23 no. ( pricon ) , suction canula size 6 / 8 / 10 / 12 , suction tube for suction machine , sup. azithromycin200mg / 5ml , sup. m.v.+minerals 100ml , sup. potasium cloride 100ml , swine flue vaccine .5 ml , swine flue vaccine 5 ml , syp.pre probiotic 60ml , syp.sod.picosulphate 100 ml , syp. albendazole + ivermectin , syp. amoxycillin + clavulanate , syp. antacid ( mag.hy. + allum.hy. ) , syp. arthmether+lumither 30 ml , syp. bpricilne 100ml , syp. cepodoxim+clavonate 30 ml , syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml , syp. cotrimoxazole , syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg , syp. cyprohepatidine + tricholin citrate , syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg , syp. dextromethorphan 10 mg + phenyl hcl2 mg , syp. disodium hydrogen citrate , syp. ferrous salt + folic acid , syp. haematinic with vitamins , syp. hydroxyzime 100 ml , syp. ibuprofen 100mg + pcm 125 mg + / 5ml , syp. lactulose 10gm / 15 ml , syp. levocetrizine , syp. levocetrizine + montelokast 60ml , syp. liq.paraffin + milk of magnesia , syp. livertonice 200ml , syp. longifene 200ml / buclizine 200ml , syp. lycopin 200ml , syp. magaldrate 480 mg + simeth. 20 mg , syp. mefanic acid 60 ml , syp. mefanic+ peracitamol 60ml , syp. moxclav / mega cv 30 ml , syp. moxclav / mega cv 60 ml , syp. multivitamin+ multiminaral + amino acid200ml , syp. multivitamin+ multiminaral + lycopin 200ml , syp. multvitamin+antioxidant 200ml , syp. ofloxacin + ornidazole , syp. ofloxacin oral , syp. paracetamol 125 mg , syp. paracetamol 250 mg , syp. pcm + cpm + sod. cit. + pph , syp. pcm + promehazine , syp. polybion 100ml , syp. racecortodil+ofloxacin 60ml , syp. roxithromycin 50 mg / 5 ml , syp. salbutamol 2 mg + ambroxol 30 mg , syp. solvin cold / reconite / sinerest 60 ml , syp. sucralfate 1 g / 10 ml , syp. terbutaline sul. + bromh. + guaip. , syp. zinc 60ml , syp.cefuroxime 60ml , syp.digsestiv enzyme 200ml , tab.alprazolam0.25mg , tab.arither and lumethar ( 400mg ) , tab.cabergoline , tab.citicolin 500 mg , tab.l orthinh l asprite , tab.linezolid 600 , tab.linezolid 600mg , tab.n.t.g. sr 2.6 mg , tab.nicoran 5 mg , tab.phenytoin 100 mg , tab.sodium valporal 500 mg , tab.temsulofin0.4mg , tab.thyroxine 100 mg , tab.ursodil 300 mg , tab. aceclo + pcm + serra , tab. acelofenac 100mg , tab. acelofenac 100mg + serratiopeptidase 10mg , tab. acelofenac 100mg + thiocolchicoside 250 mg , tab. acyclovir 400 mg , tab. albendazole 400mg , tab. alprazolam0.25mg + propranolol 20mg , tab. alprazolam0.5mg , tab. amlodipine 2.5mg , tab. amlodipine 5mg + atenolol 50mg , tab. amlodipine besilate5mg , tab. amoxy 250mg + clav. acid 125mg , tab. amoxy 500mg + clavulanate 125 mg , tab. amoxyciline +lactiacid 625mg , tab. atenolol 25mg , tab. atenolol 50mg , tab. atorvastatin80 mg , tab. atorvastatin 10mg , tab. atorvastatin 40mg , tab. azithromycin 100mg dt , tab. azithromycin 250mg , tab. azithromycin 500mg , tab. betahistadin 16 mg , tab. calcium 500mg + vit. d3 , tab. carbamazepine 100mg , tab. carbamazepine 200mg , tab. cefixime 100mg disp. , tab. cefixime 200mg disp. , tab. cefixime 200mg+ clavalunicacid , tab. cefpodoxime proxetil 200 mg , tab. cefuroxime axetil 250mg , tab. cefuroxime axetil 500mg , tab. cetrizine 10 mg ( oval ) , tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg , tab. cinnarizine 20 mg + domperidone 15 mg , tab. cinnarizine 25 mg , tab. clotrimazole vaginal 500mg , tab. diclo + pcm +serra , tab. diclofenic+chymotripcin , tab. dicyclomine 10mg + mefenomic acid 250mg , tab. dicyclomine hci 10mg + pcm 500mg , tab. dothiepin 75 mg. , tab. ethamsylate 500mg , tab. ethamsylate inj. 2ml , tab. etophylline + theophylline , tab. ferobact 200 mg , tab. ferobact 300 mg , tab. ferrous sult + folic acid , tab. fexofenadine 120 mg , tab. fluconazole 150 mg , tab. fluconazole 50 mg , tab. fluoxetine 20 mg , tab. folic acid 5 mg , tab. frusemide 40 mg , tab. glimepiride 1 mg , tab. glimepiride 1 mg + metformin 500 mg , tab. glimepiride 2 mg , tab. glimepiride 2 mg + metformin 500 mg , tab. ibuprofen 100mg + pcm 125 mg , tab. ibuprofen 400mg + pcm 500mg , tab. isosorbide mononitrate 20 mg , tab. itraconzole 100 , tab. itraconzole 200 , tab. levocetrizine 5mg , tab. levofloxacin500mg , tab. lisinopril 5 mg , tab. lithium carbonate 300 mg , tab. loperamide 2 mg , tab. lorazepam 2 mg , tab. losartan 25 mg , tab. losartan patassium 50 mg , tab. losartan pota. 50 mg + amlodipine 5mg , tab. losartan potassium. 50 mg + hydroch.12.5mg , tab. lycopin+multivitamin , tab. mecobalamin 1500 mcg , tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg , tab. mefloc 100mg , tab. metformin 500 mg , tab. metoclopromide 10 mg , tab. napra d ( napraxone + domperidone ) , tab. nimesulide 100 mg , tab. nimesulide 100mg + serratiopeptidase 10mg , tab. normaxin 10 mg , tab. nynes , tab. ofloxacin + ornidazole 500 mg , tab. ofloxacin 200mg , tab. olanzapine 5 mg , tab. ondansetron 4mg , tab. ondansetron 8mg , tab. ornidazole 500mg , tab. pantoprazole 20 mg , tab. pantoprazole 40 mg , tab. pantoprazole 40 mg + domperidone 10 mg , tab. paracetamol 500 mg , tab. pheniramine maleate 25 mg , tab. phenobarbitone 30 mg , tab. phenobarbitone 60 mg , tab. pioglitazone 15 mg , tab. pioglitazone 30 mg , tab. piracetam 800 mg , tab. piroxicam disp. 20 mg , tab. prazosin 1 mg , tab. prazosin 2.5 mg , tab. prazosin 5 mg , tab. prednisolone 10 mg , tab. primaquine phosphate 15 mg , tab. primaquine phosphate 7.5 mg , tab. prochlorperazine 5 mg , tab. promethazine 25 mg , tab. quinine sulphate 300 mg , tab. rabeprazole 20 mg , tab. rabeprazole 20 mg + domperidone 10 mg , tab. rabiprazole + itopride , tab. ramipril 10 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. ranitidine 150 mg + domperidone 10 mg , tab. risperidone 2 mg , tab. sertaline 25 mg , tab. sertaline 50 mg , tab. sildenafil 50 mg , tab. spiromicyn500mg , tab. superspas / nobalspas , tab. tramadol hyd. 20 mg + pcm. 500 mg , tab. tranexamic+etamcylate , tab. tranexamic+mefanic acid , tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg , tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg , tab. trypsin chymotrypsin , tab. ursodeoxycholic 150 mg , tab. ursodeoxycholic 300 mg , tab. vitamin c 500 +zinc 50 mg , tab. vitamin c 500 mg ( ascorbic acid ) , tab. zinc 20 mg , tab. zinc 50 mg , tab. zolpidem 10 mg , tab. / cap. multivitamin+ multiminaral + lycopin , tab.cefpodoxime 200mg+ clavalunicacid , tab.clarithromycin 250 mg , tab.clonazepam 0.5mg , tab.clopidogrel 75 mg , tab.clopidogrel 75 mg+ aspirin 75mg , tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) , tab.diazepam 5 mg , tab.diclo + trypsin +chymotrypsin , tab.diclofenac 50mg + serratiopeptidase 10mg , tab.etori coxib 120mg+ gabapentin300mg , tab.etori coxib 90mg+ gabapentin100mg , tab.iver mactin 12 mg , tab.iver mactin 6 mg , tab.pregabaline75 mg +methylcobaline 1500mg , tab.rabiprazole+domperidon d , tab.zinc 10mg , triple layer mask with nose pin , tropicayl plus eye drop 10 ml , urine collection beg , venoline set200 cm , vicryl 1 no.1 / 2 cir rb 30 / 40mm needle 70 cm, , vypro mesh , weight machine ( digital ) , weight machine ( manual ) , weight machine for paediatric / neonatal ( digital ) ...

Rajasthan University Of Health Science - Rajasthan

31583020 chemicals reagents consumable items for department of microbiologywork list of annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology sl. no. item description 1 electrical items : 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 alberts stain 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbc (igm & igg) total test 13 anti hbe elisa test kit 14 hbeag elisa kit 15 anti hbs antibody elisa kit 16 hbs ag elisa kit 17 cytomegalovirus (cmv) igg elisa kit 18 cytomegalovirus (cmv) igm elisa kit 19 dengue ns1 antigen elisa kit 20 hav igm elisa kit 21 hcv igm elisa kit 22 hev igm elisa kit 23 ds dna elisa kit 24 ana elisa kit 25 herpes simplex virus (hsv 1 & 2) igg elisa kit 26 herpes simplex virus (hsv 1 & 2) igm elisa kit 27 rubella igg elisa kit 28 rubella igm elisa kit 29 toxoplasma igg elisa kit 30 scrb typhus igm ag elisa kit 31 toxoplasma igm elisa kit 32 biodegradable plasic bags (yellow, red, blue, black) 33 bleaching powder 34 blood agar base 35 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 36 brain heart infusion broth 37 cled media 38 conc. h2so4 39 corn meal agar 40 cover slips 22 x 22 mm 41 crp test kit 42 deionized water 43 dengue rapid test card along with ns1 antigen 44 deoxycholate citrate agar 45 di sodium hydrogen phosphate 46 discarding plastic buckets (yellow, red, blue, black) 20 litre 47 disposable individually packed centrifuge tube conical bottom capacity 50 ml 48 disposable polythene gloves 49 disposable sterile test tube with swab individually packed 50 dubos medium 51 ecoshield 52 edta powder 53 face mask 54 ferric chloride 55 filter paper box whartman no. 1, 12.5 cm circular 56 filter paper sheet whartman no. 1 57 fluid thioglycollate broth (anaerobic) with indicator 58 formalin pellets 59 glass marking pencils (red, white) 60 glass test tube 100 mm x 12 mm without rim 61 glass test tube 75 mm x 12 mm without rim 62 h2o2 (30%) 63 koh pellets 64 kovcks indole reagents 65 l arginine 66 l lysine mono dihydrochloride 67 lactophenol cotton blue solution 68 liquid paraffin 69 loeffler serum medium base bovine serum 70 lowenstein jensen medium 71 macconkey agar 72 macconkey broth 73 maltose 74 mannitol 75 mannitol salt agar 76 mccartney bottle 77 methyl red powder 78 microcentrifuge tube with cap capacity 2 ml 79 mr vp medium (glucose phosphate broth) 80 muller hinton agar 81 n acetyl l cysteine 82 n naphthyl ethylene diamine dihydrochloride 83 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 84 nigrosin 10% 85 nutrient agar 86 oxidase disc 87 peptone water 88 perforated bucket (red, blue) 15 litre double bin 89 petridish glass 90 mm 90 petridish glass 75 mm 91 ph indicator strips 6.5 to 9 ph measurement 92 phenol 93 pottasium dihydrogen phosphate 94 pregnancy test card 95 ra factor kit 96 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 97 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 98 robertson cooked meat medium readymade 99 vdrl rapid test card 100 sabraud’s dextrose agar 101 selenite f broth bacteriological 102 sim agar 103 simmons citrate agar 104 sodium chloride 105 sodium hydroxide pellets 106 sodium hypochlorite solution 107 sterile autoclavable skirted plate 96 wells x 0.3 ml 108 sterile readymade plates of blood agar (90 mm size) 109 sterile readymade plates of macconkey agar (90 mm size) 110 sterile readymade plates of nutrient agar (90 mm size) 111 sterile storage vial 2 ml capacity 112 sterile storage vial 5 ml capacity 113 sterile transport medium (stuart medium) with test tube and swab individually packed 114 stool container with spoon 115 sulphanilamide 116 tcbs 117 triple layer mask 118 trypticase soya broth 119 tsi agar 120 urea agar base 121 viral transport medium 122 widal slide test 123 wilson and blair medium 124 xylene 125 xylose 126 resazurin powder 127 sterile readymade plates of dca (90mm size) 128 sterile readymade plates of tcbs (90mm ) 129 vancomycin powder 130 vencomycin disc 131 amikacin 30 µg 132 amoxycillin 30 µg 133 amoxyclav 20/10 µg 134 amphotericin b 135 ampicillin + sulbactum 136 azithromycin 15 µg 137 aztreonam 30µg 138 bacitracin (0.04 unit) 139 bile esculin disc 140 cefepime 30 µg 141 cefixime 5 µg 142 cefoperazone + sulbactum 75/10 µg 143 cefoperazone 75 µg 144 cefotaxime 30 µg 145 cefotetan 146 cefoxitin 30 µg 147 cefpirome 148 cefpodoxime 10 µg 149 ceftazidime + clavulanic acid 30/10µg 150 ceftazidime 30 µg 151 ceftriaxone 30 µg 152 cefuroxime 30 µg 153 cephalexin 30 µg 154 chloramphenicol 30 µg 155 ciprofloxacin 5 µg 156 clarithromycin 15 µg 157 clindamycin 2 µg 158 clotrimazole 159 colistin 160 cotrimoxazole 25 µg 161 cyclopirox 50 µg 162 dalfopristine 163 daptomycin 164 doripenam 10µg 165 doxycycline 30 µg 166 e strip for esbl detection 167 e strip for mbl detection 168 e strip oxacillin 169 ertapenam 10µg 170 erythromycin 10 µg 171 faropenam 172 fluconazole 25 µg 173 fosfomycin 200 µg 174 furazolidone 50 µg 175 fusidic acid 176 gentamicin 120µg 177 gentamicin 30µg 178 gentamycin 10 µg 179 griseofulvin 10 µg 180 hippurate 181 imipenam 10 µg 182 itraconazole 8 µg 183 kanamycin 184 ketoconazole 15 µg 185 levofloxacin 5µg 186 lincomycin 10 µg 187 linezolid 30 µg 188 meropenam 10 µg 189 miconazole 10 µg 190 moxalactum 191 nalidixic acid 30µg 192 netilmycin 30 µg 193 nitrofurantoin 300 µg 194 norfloxacin 10 µg 195 novobiocin 196 nystatin 197 ofloxacin 5 µg 198 onpg 199 optochin 200 oxacillin 1 µg 201 piperacillin + tazobactum 100/10 µg 202 piperacillin 100 µg 203 polymyxin b 30 units 204 pristinomycin 15µg 205 quinopristin 206 teicoplanin 30 µg 207 terbinafine 1 µg 208 tetracycline 30 µg 209 ticarcillin+clavulanic acid 75/10 µg 210 ticarcillin75µg 211 tigecyclin 15µg 212 tobramycin 10 µg 213 v factor 214 vancomycin 30 µg 215 voriconazole 1 µg 216 x + v factor 217 x factor 218 immersion oil 219 (occuet blood in stool ) kit hemoccult sensa aninophezone test 220 grams stain kit 221 hcv igmrapid card 222 sterile urine container single pack 223 culture loop (nicrome)1mm 24 gauge wire loop 224 culture loop (nicrome) 2mm24 gauge wire loop 225 cotton roll 226 disposable petri disc 90 mm 227 sterile disposable swab sticks with test tube 228 sterile disposable cotton swab (individual pack) 229 hbsag rapid test card 230 aluminium foil (72 meter) 231 rpr test kit 232 vaccutainer vial 4.5ml (serum activator without gel) 233 disposable plain tube 5ml (without cap) plastic 234 disposable plain tube 8ml (without cap) plastic 235 test tube stand 96 hole plastic 236 urea solu 40% 237 glass test tube 10ml 238 glass test tube 20 ml 239 aslo test kit 240 phenyl alanin agar 241 sulphide indole motility test (sim motility medium) 242 test tube holder bighole for 20ml test tube 243 disposable test tube 20ml ...

Rajasthan University Of Health Science - Rajasthan

30259092 chemicals reagents consumable items for department of microbiology chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , dengu igm elisa kit , chikungunya igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , lugols iodine solution , plastic scurbber , test tube washing brush , disposable test tube 20ml...

Medical Health And Family Welfare - Rajasthan

30106420 purchase of drug and medicine purchase of drug and medicine , drug and medicine purchase , acyclovir 250mg / 5ml injection ( 10ml ) , acyclovir 500mg / 10ml injection ( 10ml ) , adrenaline injection 1 mg / ml ( 1 ml amp ) , amikacin 100 mg injection 2ml vial , amikacin 250 mg inj 2ml vial , amikacin 500 mg injection 2ml vial , aminophylline 25 mg / ml injection 10 ml amp , amino caproic acid 5gm / 20ml , amiodarone 150mg / 3ml injection ( 3ml ) , amoxicillin and clavulanic acid 1.2gm injection with diluent , amoxicillin and clavulanic acid 150mg injection ( 5ml ) with diluent , amoxicillin and clavulanic acid 600mg injection with diluent , ampicillin 125mg with diluent ( 5ml ) , ampicillin 250mg with diluent ( 5ml ) , ampicillin 500 mg injection with diluent ( 5ml ) , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , arteether ( ? ? ) 150mg / 2ml injection ( 2ml ) , artisunate 60 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml , artisunate 120 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml , atracurium besilate 10 mg / ml injection ( 2.5ml ) , atracurium besilate 10 mg / ml injection ( 10ml ) , atropine sulphate 0.6 mg / ml injection ( 1 ml amp ) , atropine sulphate 100 ml injection ( 100ml ) , adenosine 3mg / ml 2ml injection , acetylcystine 200mg / ml injection 2ml , azetronam 500mg ( 10ml ) , azetronam 1000mg ( 20ml ) , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , betamethasone sodium phosphate 4 mg / ml injection ( 1 ml vial ) , biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin & 70% isophane insulin ) 40 iu / ml ( 10 ml vial ) , botrophage injection ( haemocagulase enzyme ) ( 1ml ) , bupivacaine hydrochloride in dextrose 5mg+80mg per ml ( 4 ml amp ) , bupivacaine injection 0.25% ( 20 ml vial ) , bupivacaine injection 0.5% ( 20ml vial ) , bleomycin 15mg injection , butrophanol tartrate 1mg / ml injection ( 1ml ) , butrophanol tartrate 2mg / ml injection ( 1ml ) , bupernorphine transdermal patch 5mcg / hr , bupernorphine injection , bendamustine injection 100 mg , bevacizumab injection 100 mg , bevacizumab injection 400 mg , bortezomib injection 2mg , calcium gluconate 10% injection ( 10 ml amp ) , carboplatin 450mg / 45ml injection , carboprost tromethamine 250 mcg / ml injection ( 1ml ) , cefepime 500 mg injection with diluent , cefoperazone and sulbactum 1 g + 0.5 g injection with diluent , cefotaxime 1 gm injection +dw ( 30ml ) , cefotaxime 250 mg injection with diluent , cefotaxime with sulbactum ( 250+125 ) mginjection with diluent , ceftazidime 1 gm injection with diluent , ceftazidime 250 mg injection with diluent , ceftazidime 500 mg injection with diluent , ceftriaxone 1 gm injection ( vial ) with dw , ceftriaxone 1 gm with tazobactum 125 mg injection with diluent , ceftriaxone 125 mg injection ( vial ) with dw , ceftriaxone 2 gm with tazobactum 250mg injection with diluent , ceftriaxone 250 mg injection ( vial ) with dw , ceftriaxone 500 mg injection ( vial ) with dw , ceftriaxone with sulbactam 1.5 gm injection with diluent , ceftriaxone with sulbactam 375 gm injection with diluent , cefuroxime250 mg with dw injection , cefuroxime 750 mg with dw injection , cefuroxime 1500 mg with dw injection , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , ciprofloxacin 200mg / 100ml injection ( 100 ml bottle ) , cloxacillin sodium 500 mg injection with diluent , compound sodium lactate 500 ml injection ( 500 ml glass bottle ) , compound sodium lactate injection ( pp bottle ) ( 500ml bottle ) , compound sodium lactate injection ( pp bottle ) 1000ml , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cisplatin 50mg / 50ml injection , cyclophosphamide 200mg injection , cyclophosphamide 500mg injection , cytarabine 500mg injection , caffein citrate 2ml injection , caffein citrate 1ml injection , clarithromycin infusion 500ml injection , chlorpromazine 25mg / ml injection , clindamycin phosphate 150mg / ml injection ( 4ml ) , camylofin hcl 25mg / ml injection ( 2ml ) , cholecalciferol 60000 iu / ml injection ( 1ml ) , citicoline 250mg / ml injection ( 2ml ) , colistimethate 2million iu / ml injection , colistimethate 1million iu / ml injection , dexamethasone 8 mg / 2ml injection ( 2 ml vial ) , dextrose 10% 1000 ml ( ppbottle ) injection , dextrose 10% 500 ml ( glassbottle ) injection , dextrose 10% 500 ml ( ppbottle ) injection , dextrose 5% ( ppbottle ) 1000 ml injection , dextrose 5% 500 ml ( ppbottle ) injection , dextrose 5% 500 ml ( glassbottle ) injection , dextrose injection 25% ( pp bottle ) ( 100 ml bottle ) , dextrose injection 25% ( glass bottle ) ( 100 ml bottle ) , dexmedetomidine hcl 100mcg / ml ( 1ml ) , dexmedetomidine hcl 100mcg / ml ( 2ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diclofenac sodium 25 mg / ml injection ( 3 ml amp ) , diclofenac aqua 75mg / mlinjection ( 1ml ) , dicyclomine 10 mg / ml injection ( 2 ml amp ) , diltiazem 5 mg / ml injection , dobutamine 50mg / ml ( 5ml injection ) , dopamine injection 40mg / ml ( 5ml ) , doxorubicin 50 mg / 25ml injection , daunorubicin 20 mg inj ip , drotaverine hydrochloride 40 mg / 2ml injection ( 2 ml amp ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , digoxin 0.25mg / ml injection , diptheria antitoxin 10000 iu injection , dinoprostone 0.5mg gel , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , ethamsylate 250 mg / 2ml injection ( 2 ml amp ) , etophylline 84.7mg +theophylline 25.3 mg / ml. ( 2ml. injection ) , etoposide 100mg injection , ephedrine 30mg / ml injection ( 1ml ) , esmolol hcl injection 10mg / 10ml , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , fosphenytion 2ml injection , fentanyl citrate 50mcg / ml injection 2ml , filgrastim 300 mcg / ml injection , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , furosemide 10 mg / ml injection ( 2 ml amp ) , factor ix concentrate 600 iu injection , ferric carboxymaltose 50mg / ml injection ( 10ml ) , fluconazole 100ml injection , gemcitabin 200mg injection , gemcitabin 1000mg injection , gentamicin 80 mg / 2ml injection ( 2 ml amp ) , glycopyrrolate 0.2 mg / ml injection ( 1 ml amp ) , glycopyrrolate 0.2 mg / ml injection ( 10 ml ) , granisetron injection 1mg. / ml. 3ml. amp. , glycine 3ltr injection , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , haloperidol 5 mg / mlinjection ( 2ml ) , hcg2000 i.u. injection , hcg5000 i.u. injection , heparin sodium 1000 i.u. / ml injection , heparin sodium 5000 i.u. / ml injection , human albumin solution 20% ( 100 ml bottle ) , human anti d immunoglobulin 150 mcg injection , human anti d immunoglobulin 300 mcg injection ( im use ) ( prefilled syringe / vial ) , human rabies immunoglobulin150 iu / ml injection , hyaluronidase 1500 iu injection , hydrocortisone sod. succinate 100 mginjection , hydrocortisone sod. succinate 200 mginjection , hydrocortisone sod. succinate 400 mginjection , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxyprogesterone 250 mg / ml injection ( 1 ml amp ) , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , halothane 50ml , halothane 100ml , hepatitis b immunologlobin injection ip 100 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , iron sucrose 20mg / ml injection ( 5ml ) , isoflurane liquid for inhalation ( 100ml ) , isoflurane liquid for inhalation ( 30ml ) , isoflurane liquid for inhalation ( 250ml ) , isolyte g ( each 100ml contains: sodium chloride usp 0.53 g; sodium gluconate usp 0.5 g sodium acetate trihydrate usp 0.37 g; potassium chloride usp 0.037 ) injection ( 500ml ) , isophane insulin 40 iu / ml injection ( 10ml vial ) , isoxsuprine 5 mg / ml injection ( 2ml amp ) , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) ( 10ml ) , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , intravenous fat emulsion 20% w / v 250ml , isoprenaline injection ip 2mg / ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , ketamine injection 50 mg / ml ( 10 ml vial ) , labetalol hydrochloride 20 mg / 4ml injection ( 4 ml amp ) , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg ( 30ml ) , lignocaine 2% injection ( 30 ml vial ) , lignocaine hcl 2% injection ( 50ml i.v. ) , lincomycin 600mg / 2ml injection , linezolid inj 200mg / 100ml ( 300ml ) , low mol. wt. heparin 60mg / 0.6mlinjection ( enoxaparin ) , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , levetiracetam injection 500mg / 5ml , lorazepam inj ip 2 mg / ml ( 2ml ) , levobupivacaine 5mg / ml ( 20ml ) , lignocaine hcl and dextrose injection ( 2ml ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , magnesium sulphate 500mg / ml injection ( 50% ) ( 2 ml amp ) , mannitol 20% injection ( 350 ml bottle ) , mannitol inj ip 20% w / v 100 ml , mannitol 10% w / v glycerin 10% w / v injection , mecobalamin 500 mcg / ml injection , mephentermine 30 mg / ml injection ( 10ml ) , meropenem 125 mg injection , meropenem 250 mg injection , meropenem 1gm injection , meropenem 500 mg injection , methylcobalamin 1500 mcg injection , methylcobalamin 1000 mcg vit.b 6 100mg nicotinamide 100mg injection ( 2ml ) , methylergometrine 0.2 mg / ml injection ( 1ml amp ) , methylprednisolone sodium succinate 500 mg ( vial ) , metoclopramide injection 10 mg / 2ml ( 2 ml amp ) , metronidazole injection 500 mg / 100ml ( 100ml bottle ) , midazolam 1 mg / ml injection ( 5 ml vial ) , midazolam 1 mg / ml injection ( 10 ml vial ) , morphine sulphate 10mg / ml injection , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) ( pp bottle ) ( 500ml bottle ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) glass bottle ( 500ml bottle ) , multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) ( pp bottle ) ( 500ml bottle ) , multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) glass bottle ( 500ml bottle ) , multivitamin 10 ml injection , methotrexate inj ip 50 mg / 2 ml , meropenem injection ip 250 mg , nandrolone decanoate25 mg injection , nandrolone decanoate 50 mg injection , neostigmine inj ip 0.5 mg / ml ( 1ml amp ) , neostigmine inj ip 0.5 mg / ml ( 5ml amp ) , nitroglycerin inj 5 mg / ml ( 1ml amp ) , nitroglycerin inj 5 mg / ml ( 5ml amp ) , noradrenaline injection ip 2 mg / ml ( 1mlamp ) , noradrenaline injection ip 2 mg / ml ( 5mlamp ) , normal saline ( sodium chloride ) 0.9% 100ml ( pp bottle ) , normal saline ( sodium chloride ) 0.9% 100ml glass bottle , naloxone inj ip 0.4mg / ml ( 1ml ) , normal saline ( sodium chloride ) 0.9% 3ltr , normal saline ( sodium chloride ) 3% 100ml glass bottle , normal saline ( sodium chloride ) 0.9% 10ml injection , netilmicin sulphate 300mg injection , netilmicin sulphate 50mg injection , normal human intravenous immunoglobulin 5g / 100ml , ofloxacin inj 200 mg / 100 ml , ondansetron 2 mg / ml injection ( 2 ml amp ) , oxytocin 5 iu / ml injection ( 1ml amp ) , octreotide injection 50 mcg / ml , paclitaxel 260mg injection , paclitaxel 100mg injection , pantoprazole 40 mg injection ( vial ) , paracetamol 150 mg / ml injection ( 2 ml amps ) , paracetamol infusion ip 1% w / v 100ml , pentazocine 30 mg / ml injection ( 1 ml amp ) , pheniramine 22.75 mg / ml injection ( 2ml amp ) , phenobarbitone 200 mg / ml injection ( 1ml ampoule / vial ) , phenytoin sodium 50 mg / ml injection ( 2ml amp ) , pilocarpine injection 0.5% mg / ml ( 1 ml injection ) , piperacillin and tazobactam 4 gm + 500 mg for injection ( vial ) with diluent , piperacillin with tazobactam 1gm + 125 mg injection with diluent , piperacillin injection 2 gm + tazobactom 250mg ip , potassium chloride injection 0.15 gm / ml ( 10ml amp ) , pralidoxime chloride 25mg / ml ( 20ml injection ) , pralidoxime iodide 25mg / ml ( 20 ml lnjection ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , progesterone 200 mg / 2ml injection ( 2 ml amp ) , promethazine 25 mg / ml injection ( 2 ml amp ) , propofol 10mg / ml injection ( 10ml ) , propofol 10mg / ml injection ( 20ml ) , phenylephrine hcl 10mg / ml injection ( 1ml ) , pottasium phosphate 15ml injection , prochlorperazine mesylate injection 12.5mg / ml 5ml , polygeline 3.5% solution with electrolytes for i.v. infusion , polymixin b 500000iu injection , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , protamine sulphate 50mg / 5ml injection , quinine dihydrochloride 300 mg / ml injection ( 2ml amp ) , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , ranitidine hcl 50 mg / 2ml injection ( 2 ml amp ) , rh erythropoitin injection 2000 iu , rh erythropoitin injection 4000 iu , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , ringer acetate infusion 500 ml , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , remdesivir 5mg / ml 20ml vial , rh erythropoetin inj ip 10000 iu , swine flu vaccine injection , snake venom antiserum ( polyvalent anti snake venum ) ( 10ml vial ) , sodium bicarbonate 7.5% injection ( 10 ml amp ) , sodium chloride 1000 ml ( pp bottle ) injection , sodium chloride 500 ml ( glass bottle ) injection , sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 500ml bottle ) , sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 1000ml bottle ) , sodium chloride and dextrose 0.9 % + 5 % injection ( glass bottle ) ( 500ml bottle ) , sodium chloride injection ( 500ml pp bottle ) , sodium valproate 100 mg / ml injection ( 5 ml vial ) , soluble insulin 40 iu / ml injection ( 10 ml vial ) , streptokinase15 lac units injection , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , succinylcholine 50 mg / ml injection ( 10 ml vial ) , sodium chloride 0.45% w / v polypack 500 ml , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium nitropruside 25mg / ml 2ml injection , thiopentone inj ip 0.5 gm , thiopentone inj ip 1 gm , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetanus vaccine 0.5 ml ( adsorbed ) ipamp , teicoplanin 200mg injection , teicoplanin 400mg injection , torsemide 10 mg / ml injection ( 2 ml amp ) , tramadol 50 mg / ml injection ( 2 ml amp ) , thiamine injection , triamcinolone 40mg / ml injection ( 1ml ) , tranexamic acid injection ip 100mg / ml 5ml , tirofiban hcl injection 5mg / 100ml , terlipressin acetate injection 1mg 10ml amp , tocilizumab 20 mg / ml 4ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , urokinase injection 5 lac unit ( lyophilized ) , valethamate bromide 8 mg / ml injection ( 1 ml amp ) , vancomycin 1 gm injection ( vial ) , vancomycin 500mg injection ( vial ) , vecuronium bromide 4 mg for injection ( freeze dried ) ( 2ml ) , vitamin b complex injection ( 10 ml vial ) , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , voriconazole injection 200mg / vial , water for injection ip ( 10 ml amp ) , water for injection ip ( 5 ml amp ) , zoledronic acid injection ip 4mg / 100ml 100ml , acyclovir cream 5 % ( 5 gm tube ) , beclomethasone, neomycin and clotrimazole cream 0.025%+0.5%+1% ( 10g tube ) , betamethasone dipropionate cream 0.05% ( 10gm ) , betamethasone with salicylic acid ( 15 gm ointment ) , betamethasone lotion 0.05% ( 50ml ) , calamine lotion ip ( 100ml bottle ) , cetrimide cream ip 15gm , cetrimide tincture 0.5% ( 200ml bottle ) , clindamycin phosphate gel 1% ( 20 gm ) , clobetasolpro pionate 0.05 % cream ( 15gm ) , clotrimazole 1% mouth paint ( 15ml ) , clotrimazole cream ip 2% w / w ( 15gm ) , coal tar 6% & salicylic acid 3% ointment ( 20gm ) , compound benzoic acid ointment ip 6%+ salicylic 3% ( 15gm tube , compound benzoin tincture ( 500ml bottle ) , chlorhexidine mouthwash 0.2% ( 50 ml ) , clotrimazole beclomethsone lotion 50ml , powder clotrimazole 1% w / w 100gm , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , dental gel: choline salicylate 8.75% + benzalkonium chloride 0.01% + lignocaine hcl 2% ( 10gm ) , desensitizing tooth gel with sodium mono fluoro phosphate 0.7% & pot. nitrate 5 % ( 50gm ) , diclofenac 1% gel ( 30 gm ) , diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil3% menthol 5% ( 15 gm ) , diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil 3%, menthol 5% ( 30 gm ) , dinoprostone 0.5 mg ( 3gm cream ) , framycetin sulphate 1% cream ( 30gm tube ) , fusidic acid cream bp 2% 10gm tube ( 10 gm tube ) , fusidic acid ointment 2% ( 10 gm. packing ) , gamma benzene hexachloride 2% lotion ( lindane lotion usp ) ( 100 ml bottle ) , gentian violet paint 1% ( 200 ml bottle ) , glycerin ( 100ml ) , glycerin ip ( 400 ml ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% ( 10ml ) , ketoconazole 2% cream ( 20gm ) , ketoconazole 2% zpto 1% shampoo 100ml , lignocaine 2% gel ( 30gm ) , lignocaine 5% ointment ( 10gm ) , liquid paraffin100 ml pack , liquid paraffin ip ( 400ml bottle ) , metronidazole 1% and chlorhexidine 0.25% gel ( 10gm ) , miconazole nitrate 2% cream ip ( 15g tube ) , mupirocin 2% ointment ( 5 gm ) , neomycin sulphate 5 mg and bacitracin 500 iu / gm ointment ( 10gm ) , ointment containing : lidocaine 3% , zinc oxide 5%, hydrocortisone 0.25% , allantoin 0.5% ( 15 g tube ) , permethrin cream 5% ( 30 gm pack ) , permethrin lotion 5% ( 50ml pack ) , permethrin soap 5% 75gm , povidone iodine ointment 5% ( 15 gm tube ) , povidone iodine ointment 5% ( 250 gm pack ) , povidone iodine ointment 5% ( 500 gm pack ) , silver sulfadiazine 1% cream ( 50 gm tube ) , silver sulfadiazine cream 1% 500 g pack ( each ) , tobramycin ophthalmic 0.3% ( 5gm ointment ) , tretenoin cream 0.025% ( 20 gm ) , terbinafine 1% w / w ( 10 gm ) cream , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , albendazole oral suspension 400 mg / 10ml ( 10 ml bottle ) , albendazole 200mg / 5ml, ivermectin 1.5mg / 5ml ( 10ml ) , alkalizer disodium hydrogen citrate 1.25 gm / 5ml ( 100 ml ) , amoxicillin 200 mg & clavulanic acid syrup 28.5 mg / 5 ml ( 30ml ) , amoxicillin oral suspension125 mg / 5ml ( dry syrup ) ( 30ml bottle ) , amoxicillin 100mg / ml drop ( 15ml ) , amoxy and clavulanic acid 80 mg+11.4 mg / ml ( 10 ml drop ) , antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, simethicone 20mg ) ( 170 ml ) , antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, polydimethylsiloxane ( 100 ml ) , anti cold syrup: phenylephrine hcl , cetirizine and paracetamol ( 60 ml bottle ) , anti cold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol2.5mg+1mg+125mg / 5ml ( 60 ml bottle ) , azithromycin syrup 100 mg / 5ml ( 15ml ) , azithromycin syrup 200 mg / 5ml ( 15ml ) , azithromycin syrup 200 mg / 5ml ( 30ml ) , calcium carbonate 250mg & vitamin d3 125iu suspension ( 100 ml bottle ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , carboxymethylcellulose sodium lubricant eye drops 0.5% , cefixime 25mg / ml drop ( 10ml ) with diluent , cefixime 50mg / 5ml suspension ( 30ml ) with diluent , cefixime 100mg / 5ml suspension ( 30ml ) with diluent , cefpodoxime 25mg / ml ( 10 ml drop ) with diluent , cefpodoxime syrup 100 mg / 5ml ( 30 ml ) with diluent , cefpodoxime syrup 50 mg / 5ml ( 30 ml ) with diluent , cephalexin 100mg / ml ( 15ml drop ) with diluent , cephalexin oral suspension 125 mg / 5ml ( 30 ml ) with diluent , cetirizine syrup 5mg / ml ( 30ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , chlorpheniramine oral solution 2.5 mg / 5ml ( 50 ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , cough syrup [ terbutaline 2.5mg bromhexine2mg ambroxol 15mg ] ( 100ml ) , cough syrup [ terbutaline 2.5mg guaiphensin 50mgambroxol 15mg ] ( 100ml ) , cough syrup [ levosalbutamol 1mg guaiphensin 50mgambroxol 15mg ] ( 100ml ) , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup ( 100ml ) , cough syrup each 5 ml contains chloropheniramine maleate ip 2 mg, phenylepherin hcl 5mg dextromethorphan hbr 10mg ( 100ml ) , dextromethorphan hydrobromide 13.5mg / 5ml syrup ( 100 ml ) , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml ( 10 ml bottle with dropper ) , domperidone oral drops 10mg / ml ( 10ml ) , dicyclomine oral solution 10mg / 5ml ( 30ml ) , domperidone suspension 5 mg / 5ml ( 30 ml bottle ) , drop anti cold ( paracetamol 125mg / ml, phenyephrine 2.5mg / ml & chlorpheniramine maleate 1mg / ml ( 15 ml drop ) , lactase enzyme ( 15 ml drop ) , fungal diastase with pepsin enzyme drop 15ml , enzyme drop each ml contains ( alpha emylase 20mg + papain 10mg + dill oil 2mg + anise oil 2mg + caraway oil 2mg ) ( 15ml ) , erythromycin estolate 125 mg / 5ml oral suspension ( 30ml bottle ) , ibuprofen 100 mg+paracetamol 162.5 mg syrup ( 60 ml bottle ) , ibuprofen 100 mg / 5ml oral suspension ( 60 ml bottle ) , ferrous fumerate 100mg and folic acid 500mcg syrup ( 100ml bottle ) , lactulose solution 10gm / 15ml ( 100ml ) , lidocaine hydrochloride topical solution 4% , syrup levocetirizine with montelukast 2.5mg+4mg / 5ml ( 60 ml ) , multivitamin drop ( vitamin a, thiamine 0.4mg, riboflavin 0.8mg, pyridoxine hydrochloride 0.8mg, nicotinamide 8mg, ascorbic acid 40mg ( 15ml ) , metronidazole 100 mg and norfloxacin 100 mg / 5ml suspension ( 30 ml bottle ) , metronidazole benzoate 100 mg / 5ml oral suspension ( 60 ml bottle ) , metochlopramide hcl 5mg / 5ml ( 30ml syrup ) , ondansetron 2mg / 5ml ( 30ml syrup ) , ondansetron 4mg / 5ml ( 30ml syrup ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , ofloxacin suspension 50 mg / 5ml ( 30 ml bottle ) , ofloxacin suspension 100 mg / 5ml ( 30 ml bottle ) , paracetamol 150 mg / ml drops ( 15ml bottle ) , peritoneal dialysis solution ip ( 1000ml pack ) , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , povidone iodine scrub solution 7.5% ( 500 ml bottle ) , povidone iodine solution 10 % ( 100 ml bottle ) , povidone iodine solution 5% ( 100 ml bottle ) , povidone iodine solution 5% ( 500 ml bottle ) , promethazine 5 mg / 5ml syrup ( 60 ml bottle ) , paracetamol 125 mg / 5mlsyrup ( 60ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , surgical spirit ( 70 % alcohol ) ( 450 ml bottle ) , surgical spirit ( 70% alcohol ) ( 100 ml bottle ) , salbutamol syrup 2 mg / 5ml ( 100 ml bottle ) , turpentine oil ( 100 ml ) , vitamin c and vitamin e drop , vitamin d3 oral solution 60000 i.u. , vitamin a solution 1 lac iu / ml ( 100ml bottle ) , zinc sulphate 60 ml syrup , beclomethasone inhalation 200 mcg / dose ( 200 metered doses container ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg rotocap ( 30 capsule ) , betamethasone with clotrimazole with lignocaine 5ml ear drop , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml , betaxolol eye drops 0.5 o / o ( 5ml ) , budesonide nebulizer suspension 0.25 mg / ml ( 2ml amp ) , budesonide powder for inhalation 200 mcg ( rotocap 30 capsul ) , chloramphenicol 0.05%eyedrop , chlorhexidine gluconate solution 2% ( 250ml ) , chlorhexidine gluconate solution 2% ( 100ml ) , chlorhexidine gluconate 2%, cetrimide solution ( 100ml ) , cholecalciferol granules 60000 iu / 1gm ( 1 gm sachet ) , ciprofloxacin 0.3% and dexamethasone 0.1% ear drops 10ml , ciprofloxacin 0.3% and dexamethasone 0.1% eye drops 10ml , ciprofloxacin 0.3% eye drops ( 10ml ) , ciprofloxacin ophthalmic ointment usp 0.3% 5gm , chloramphenicol 1% w / w eye ointment ip, 3gm size , clotrimazole 1% with beclomethasone 0.02% drops ( 5 ml drop ) , clotrimazole 1% with lignocaine 1% ear drops ( 5 ml drop ) , concentrated haemodialysis fluid b.p acetate concentrate in 10 litre cans. each 1000ml after 1:34 dilutions should provide sodium chloride 135 to 140 meq ( 10 litres plastic can ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , black disinfectant fluid ( phenyl ) as per schedule o grade iii , fluconazole 0.3% eye drops ( 5 ml drop ) , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5ml , formaldehyde solution ( 34.5 per. 38 per. ) , glutaraldehyde 2% solution ( 5 ltrs can ) , homatropine eye drop ( 2% ) 5 ml , hydrogen peroxide solution 6% ( 400 ml bottle ) , hydrogen peroxide solution 6% ( 100 ml bottle ) , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , ketorolac tromethamine 0.5% w / v eye drop 5ml , liquid soap ( 1000 ml ) , liquid soap ( 500 ml ) , liquid soap ( 5000 ml ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 5 ltrs can ) , miconazole 1% eye drops , moxifloxacin ( 0.5% w / v ) eye drop , nasal spray azelastine 140 mcg with fluticasone 50 mcg , neomycin, hydrocortisone and polymyxin b ear drops , ors powder , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , polymixin b, chloramphenicol, dexamethasone ear drop 5ml , phenylephrine opthalmic drops 5% ( 5 ml drop ) , pilocarpine hydrochloride 2%5 ml vial , pilocarpine hydrochloride 4%5 ml vial , powder neomycin, bacitracin withsulfacetamide 5mg+250units+60mg ( 10 gm plastic bottle ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) , salbutamol nebuliser solution 5 mg / ml ( 10 ml vial ) , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) ( 10ml bottle with dropper / squeeze bottle ) , sodium chloride 5%w / v opthalmic soln. 10ml , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sodium phosphates enema bp ( 100 ml polypropylene pack ) , sulfacetamide 20% eye drops ( 10 ml drop ) , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , timolol eye drops ip 0.5 o / o w / v5 ml , tobramycin 0.3% eye drops 5ml , tobramycin and dexamethasone 0.3%+0.1% ophthalmic suspension ( 5ml ) , tropicamide eye drop 1% 5 ml , travoprost eye drops ip 0.004 o / o 5ml , wax dissolving ear drops: paradichlorobenzene 2%, benzocaine 2.7%, chlorobutanol 5%, turpentine oil 15% , xylometazoline nasal drops 0.1% ( 10 ml drop ) , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , alendronate sodium tablets usp / bp 35 mg , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acamprosate calcium 333 mg tablet , acarbose 25mg tablet , aceclofenac & thiocolchicoside 100 mg+4mg tablet , aceclofenac 100 mg and paracetamol 325 mg tab , aceclofenac 100 mg, paracetamol 325 mg, chlorzoxazone 250mg tab , aceclofenac 100 mg, paracetamol 325 mg, serratiopeptidase 10mg tab , acebrophylline tablet 100 mg , acebrophylline tablet 200 mg , acenocoumarol1 mg tablet , acenocoumarol 2 mg tablet , acetazolamide 250 mg tablets , acyclovir 200 mg tablets , acyclovir 400 mg tablets , acyclovir 800 mg tablets , acetyl cystein 600mg tablet , albendazole 400 mg tablets , albendazole 400 mg, ivermectin 6mg tablets , alprazolam 0.25 mgtablets , alprazolam 0.5 mg tablets , amitriptyline hcl 25 mg tablet , amitriptyline hydrochloride50 mg tablet , amlodipine & lisinopril 5mg+10mg tablet , amlodipine 2.5 mg tablets ip ( 10 tab blister ) , amlodipine 5 mg tablets ( 10 tab blister ) , amlodipine and atenolol 5 mg +50mg tablet , amlodipine and enalapril maleate 5 mg +5mg tablets , amoxycillin and potassium clavulanate 500mg + 125mg tablet , amoxycillin trihydrate 125 mg dispersible tablets , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , artemether & lumefantrine tab artemether 80mg + lumefantrine 480mg , artemether & lumefantrine tab artemether 40mg + lumefantrine 480mg , artemether and lumefantrine tab artemether 20mg+lumefantrine 120mg , ascorbic acid 500 mg tablets , aspirin 300 mg tablets , aspirin 150 mg tablets , amiodarone tab ip 100 mg , amisulpride 100 mg tablet , amisulpride 50 mg tablet , amiodarone tab ip 200 mg , allopurinol tablets ip 100 mg , allopurinol tablets ip 300 mg , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , aspirin delayed release tablets 75 mg ( enteric coated gr tablet ) , atenolol 25 mg tablets , atenolol 50 mg tablets , atorvastatin 10 mg tablets , atorvastatin 20 mg tablets , atorvastatin 40 mgtablets , azithromycin 100 mg dt tablets , azithromycin 250 mg tablets , azithromycin 500 mg tablets , azathiopurine 50mg tablet , biotin 10mg tablet , biotin 10mg, acetylcystine 50mg, calcium pantothenate 100mg, selenium 65mcg, copper 3mg, zinc oxide 22.5mg tablet , betahistine 8mg tablet , betahistine 16mg tablet , betahistine 24mg tablet , baclofen 10mg tablet , baclofen 20mg tablet , baclofen 30mg tablet , betamethasone 0.5 mg tablets , bicalutamide 50 mg tablet , bisacodyl 5 mg tablets , bisoprolol 5 mg tab , bisoprolol 10 mg tab , bromocriptine tablets ip 2.5 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) , carbamazepine 100 mg tablets , carbamazepine 200 mg tablets , carbamazepine 400 mg tablets , carbimazole 10 mg tablets , carbimazole 5 mg tablets , cholecalciferol 60000 iu tablet , cefixime 100 mg tablets , cefixime 200 mg tablets , cefpodoxime 200 mg tablets , cefpodoxime 50 mg dispersible tablets , cefpodoxime proxetil 100 mg tablet , cefuroxime500 mg tablet , cefuroxime 250 mg tablet , cephalexin 125 mg tablets ( dt ) , cetirizine 10 mg tablet , cetirizine 5mg, phenylephrine 10mg& paracetamol 325 mg tablet , chlordiazepoxide + trifluoperazine 5mg+1mg tablet , chlordiazepoxide 10 mg tablets , chlordizepoxide 25 mg tablet , chlorine 500 mg tablet , chloroquine phosphate tablets 250mg , chlorpheniramine maleate 4 mg tablets , chlorpromazine 100 mg tablets , chlorpromazine 25 mg tablets , chlorpromazine 50 mg tablets , chlorpromazine 10 mg tablets , chlorzoxazone 250mg, diclofenac sodium 50mg & paracetamol 325 mg tablet , chymotrypsin 20 mg + trypsin 20mg tablet , cinnarizine + domperidone20 mg + 15 mg tablet , cinnarizine tab 25 mg tablet , cinnarizine tab 75 mg tablet , ciprofloxacin 250 mg tablets , ciprofloxacin 500 mg tablets , clobazam10 mg tablet , clobazam5 mg tablet , clonazepam 0.25 mg tablets , clonazepam 0.5 mg tablets , clonazepam 1 mg tablets , clopidogrel 75 mg and aspirin 75 mg tablet , clopidogrel 75 mg tablets , clotrimazole vaginal 500 mg tablets ( single tablet ) , clozapine 50 mg tablet , clozapine 25 mg tablet , cloimpiramine 25mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , citicoline 500mg tablet , conjugated estrogen 0.625mg tablet , clomifene 25mg tablet , clomifene 50mg tablet , carvedilol 3.125mg tablet , cefadroxil 250mg tablet , cefadroxil 500mg tablet , cabergoline 0.5mg tablet , calcitriol 0.25mg tablet / capsule , cerebroprotein hydrolysate 90mg tablet , chlorambucil 5mg tablet , cyclosporin 50mg tablet / capsule , capecitabine 500mg tablet , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , dapsone 100mg tablet , deflazacort6 mg tablet , deflazacort12 mg tablet , deflazacort24 mg tablet , deflazacort 30 mgtablet , dexamethasone 0.5 mg tablet , dexamethasone 4 mg tablet , diazepam 5 mg tablet , diclofenac 100 mg ( sr ) tablets , diclofenac potassium 50mg + serratiopeptidase 15mg + paracetamol 325mg tablet , diclofenac sodium + paracetamol tab 50+325mg tablet , diclofenac sodium 50 mg tablets , dicyclomine 10 mg tablets , dicyclomine 20 mg + paracetamol 325 mg tablet , diethylcarbamazine 100 mg tablets , digoxin 0.25 mg tablet , diltiazem30 mg tablet , diltiazem 60 mg tablet , diltiazem 90 mg tablet , divalproex sodium500 mg tablet , divalproex sodium250 mg tablet , divalproex sodium750 mg tablet , disulfiram 500mg tablet , desloratadine 5mg tablet , doxofyline 400mg tablet , domperidone 10 mg tablets , doxylamine succinate 20mg + pyridoxine 20mg + folic acid 2.5 mg tablets , drotaverin 40mg tablet , drotaverine 80 mg & mefenamic acid 250 mg tab ( 10 tab strip ) , drotaverine 80 mg tablets , donepezil hcl 5mg tablet , donepezil hcl 10mg tablet , duloxetine 20mg tablet , duloxetine 30mg tablet , duloxetine 40mg tablet , dutasteride 0.5mg tablet , deferasirox tab 100 mg , deferasirox tab 500 mg , dasatinib tab 100 mg , enalapril maleate 10 mg tablets , enalapril maleate 2.5 mg tablets , enalapril maleate 5 mg tablets , erythromycin stearate 250 mg tablets , erythromycin stearate 500 mg tablets , escitalopram 5 mg tablet , escitalopram 10 mg tablet , escitalopram 20 mg tablet , ethamsylate 250 mg tablet , ethamsylate 500 mg tablet , etoricoxib 90mg tablet , etoricoxib 120mg tablet , etoricoxib 60mg tablet , ethinyloestradiol 50mcg tablet , etizolam 0.5mg tablet , etizolam 0.25mg tablet , favipiravir 200 mg tablets , favipiravir 400 mg tablets , famotidine 20 mg tablets , famotidine 40 mg tablets , flavoxate 200 mg tablet , fluconazole 150 mg tablets tablet , fluconazole 50 mg dt tablet , flunarazine 10 mg tablet , flunarazine 5 mg tablet , fluoxitine 20 mg tablet , fluoxitine 60 mg capsule , flupentixol 1 mg. tablet , flupentixol 0.5mg, melitracen 10mg tablet , folic acid tablets ip 5 mg tablet , formalin tablet , furosemide 40 mg tablet , fexofenadine 120mg tablet , feropenum 200mg tablet , fenofibrate 200mg tablet , fenofibrate 160mg tablet , finasteride 5mg tablet , gabapentin 100mg tablet , gabapentin 300mg tablet , griseofulvin 125mg tablet , glyceryltrinitrate 2.6mg tablet , glibenclamide 5 mg tablets , glibenclamide and metformin hydrochloride 5 mg + 500 mg ( sr ) tablets , gliclazide 40 mg tablets , gliclazide 80 and metformin 500 mg tablet , glimepiride 1 mg tablets , glimepiride 2 mg tablets , glimepiride, pioglitazone and metformin hydrochloride 2mg + 15mg + 500mg ( sr ) tablets , glipizide 5 mg tablets , glipizide and metformin hydrochloride 5 mg + 500 mg tablets , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , haloperidol 1.5 mg tablets , haloperidol 5 mg tablet , hydrochlorothiazide 12.5 mg tablets , hydrochlorothiazide 25 mg tablets , hydroxychloroquine sulphate 200 mg , hydroxychloroquine sulphate 300 mg , hydroxychloroquine sulphate 400 mg , hydroxyzine 25 mg tablets , hyoscine butylbromide 10 mg tablets , ibuprofen 200 mg tablets , ibuprofen 400 mg tablets , ibuprofen and paracetamol 400 mg + 325 mg tablets , imiatinib 100mg tablet , imiatinib 400mg tablet , imipramine 25mg tablet , imipramine 75mg tablet , iron ( ferrous sulphate 100mg ) folic acid 0.5 mg tablet , iron ( ferrous sulphate 20mg ) folic acid 0.1 mg tablet , isosorbide dinitrate 5 mg tabletssl tab. , isosorbide mononitrate 20 mg tablets , isoxsuprine 20 mg tablets , ivermectin 6 mg tab , ivermectin 12 mg tab , ketorolac 10mg tablet , labetalol 100 mg tablets , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , lactic acid bacillus tab 60 million spores , levetiracetam250 mg tablet , levetiracetam500 mg tablet , levocetirizine 5mg with montelukast 10mg tab , levocetirizine 2.5mg with montelukast 4mg tab , levocetrizine 5mg tablet , levofloxacin 250 mg tablet , levofloxacin 500 mg tablet , levofloxacin 750 mg tablet , linezolid 600 mg tablet , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , lithium carbonate 300 mg tablet , loperamide 2 mg tablets , lorazepam2 mg tablet , lorazepam1 mg tablet , losartan 25 mg tablets , losartan 50 mg tablets , losartan potassium & amlodipine 50 mg + 5mg tablets , losartan potassium & hydrochlorothiazide 50 mg + 12.5mg tablets , lamotrigine 25mg tablet , lamotrigine 50mg tablet , lamotrigine 100mg tablet , levodopa 100mg + carbidopa 10mg tablet , levodopa 250mg + carbidopa 25mg tablet , levosulpiride 25mg tablet , letrozole 2.5mg tablet , loratidine 10mg tablet , leflunomide 10mg tablet , leflunomide 20mg tablet , melphalan 5mg tablet , mercaptopurine 50mg tablet , mefenamic acid 500 mg tablet , mefenamic acid 125 mg tablet , mefenamic acid 250 mg tablet , mefloquine 250 mg tablet , mesalamine800 mg tablet , mesalamine 400 mg tablet , mesalamine1.2gm tablet , medroxyprogestrone acetate 10mg tablet , metformin 500 mg tablets , metformin hydrochloride ( sr ) and glimepiride 500 mg + 1 mg tablets , metformin hydrochloride ( sustained release ) and glimepiride 500 mg + 2 mg tablets , metformin hydrochloride 1000 mg sr tablets , methotrexate 7.5 mgtablet , methotrexate 2.5 mgtablet , methotrexate 10 mgtablet , methyldopa 250 mg tablets , methylergometrine0.125 mg tablets , methylprednisolone 4 mg tablets , methylprednisolone 8 mg tablets , methylprednisolone 16 mg tablets , metoclopramide 10 mg tablets , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , metronidazole 200 mg tablets , metronidazole 400 mg tablets , misoprostol 200 mcg tablets , mifepristone tab ip 200mg , molnupiravir tab ip , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mirabegron 50mg er tablet , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , naproxen tablet ip 250mg , naproxen tablet ip 500mg , neostigmine tab ip 15 mg , nimesulide and paracetamol 100 mg+325 mg tablet , nitrofurantoin 100 mg tablets , nitroglycerin controlled release 2.6mg tablets , norethisterone 5 mg tablets , nortryptyline 10mg tablet , norfloxacin 400 mg tablets , ofloxacin 200 mg and ornidazole 500 mg tablet , ofloxacin 200 mg tablets , ofloxacin 400 mg tablets , olanzapine 10 mg tablet , olanzapine 5 mg tablet , ondansetron 4 mg md tablet , oxcarbazepine 300 mg tablet , oxcarbazepine 150 mg tablet , pantoprazole 40mgtablet , paracetamol 500 mg tablets , paracetamol 650 mg tablets , paroxetine 12.5 mg tablet , phenobarbitone 30 mg tablets , phenobarbitone 60 mg tablets , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 100 mg tablets , pioglitazone 15 mg tablets , prazosin hcl 2.5 mg tablets , prednisolone 10 mg tablets , prednisolone 20 mg tablets , prednisolone 5 mg tablets , primaquine 2.5 mg tablets , primaquine 7.5 mg tablets , prochlorperazine 5 mg tablet , prochlorperazine 10 mg tablet , promethazine25 mg tablet , propranolol 40 mg tablets , propranolol 10 mg tablets , pyridoxine 10 mg tablet , pyridoxine 40mg tablet , pyrimethamine 37.5 mg and sulphadoxine 750 mg tablet , phenazopyridine tablet 5 mg , piracetam 400mg tablet , pyridestigmine 60mg tablet , phenolphathaline 0.19gm tablet , quinine sulphate 300 mg tablets , quitiapine100 mgtablet , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , ramipril 2.5 mg tablets , ramipril 5 mg tablets , ramigliflozin 100mg tablet , rifaximin 200mg tablet , rifaximin 400mg tablet , ranitidine 150 mg tablets , ranitidine 300 mg tablets , resperidone 2 mg tablet , resperidone 1 mg tablet , ritonavir tablet ip , roxithromycin 150 mg tablet , rosuvastatin 10mg tablet , rosuvastatin 20mg tablet , rosuvastatin 40mg tablet , silymarin 70mg tablet , silodosin 4mg tablet , salbutamol 2 mg tablets , salbutamol 4 mg tablets , sodium valporate500 mg gr tablet , sodium valproate 200 mg tablets , sodium valproate 300 mg tablets ( sodium valproate 200+ valproic 87 mg, both corresponds 300 mg ) , sodium valproate 500 mg tablets , spironolactone 25 mg tablets , spironolactone 50 mg tablet , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , sertaline 50mg tablet , sotalol hcl 40mg tablet , sodiumbicarbonate 1gm tablet , sacubitril 24 mg and valsartan 26 mg tablet , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , tamoxifen 10 mg tablet , tamoxifen 20 mg tablet , tamsulosin hcl 0.4 mgtablet , tamsulosin with dutasteride 0.4mg+0.5mg tablet , tamsulosin with finasteride 0.4mg+5mg tablet , telmisartan 40 mg tablet , telmisartan 80 mg tablet , tenaligliptin 20 mgtablet , terbutaline sulphate 2.5mg tablet , theophylline 400 mg tablets ( sr ) , theophylline and etofylline 23mg + 77mg tablet , thiamine 100mg tablet , thyroxine sodium 100 mcg tablets , thyroxine sodium 50 mcg tablets , tinidazole 300 mg tablets , tinidazole 500 mg tablets , topiramate 50 mg tablet , topiramate 25 mg tablet , topiramate 100 mg tablet , torsemide 10 mg tablets , torsemide 10 mg + spironolactone 50mg tablets , tranexamic acid 500 mg tablet , tranexamic acid 500 mg, mefanimic acid 250mg tablet , tranexamic acid 250 mg, ethamsylate 250mg tablet , trifluoperazine 5 mgtablet , trihexyphenidyl2 mg tablet , temozolomide 100mg tablet / capsule , thalidomide 100mg tablet / capsule , 6 thioguanine 40mg tablet , tizanidine 2mg tablet , terbinafine 250mg tablet / capsule , ursodeoxycholic acid 300 mg tablet , ursodeoxycholic acid 150 mg tablet , venlafaxine 37.5 mg tablet , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg , verapamil 40mg tablet , valganciclovir tablet 450 mg , vitamin c 500mg, zinc sulphate 50mg & vitamin d 400iu chewable tablet , warfarin sodium 5mg tablet , warfarin sodium 2mg tablet , zinc sulphate dispersible 10 mg tablets , zinc sulphate dispersible 20 mg tablets , zinc sulphate dispersible 50 mg tablets , zolpidem 5mg tablet , zolpidem 10mg tablet , amoxicillin 250 mg capsules , amoxicillin 500 mg capsules , amoxicillin and cloxacillin 250mg+250mg capsules , ampicillin 500 mg capsules , cephalexin 250 mg capsules , cephalexin 500 mg capsule , clindamycin 300 mg cap , clindamycin150mg cap , diacerin 50mg capsule , diacerin 50mg, glucosamine 500mg capsule / tablet , deferiprone 250mg capsule , deferiprone 500mg capsule , danazol 50 mg capsules , doxycycline 100 mg capsules , fluoxetine 20 mg capsules , fluoxetine 60 mg capsules , fenofibrate 150mg capsules , indomethacin 25 mg capsules , iron & zinc & folic acid capsule , itraconazole 100 mg capsule , itraconazole 200 mg capsule , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , multivitamin tablet / capsules , nifedipine 10 mg capsules , nifedipine 5 mg capsules , omeprazole 20 mg capsules , oseltamivir 30mg capsule , oseltamivir 45 mg capsule , oseltamivir 75 mg capsule , orlistat 120mg capsule , pantoprazole 40mg & domperidone 30mg sr capsule , pregabalin 75 mg + methylcobalamin 750 mcg capsule , pregabalin 75mg capsule , pregabalin 75mg, nortryptyline 10mg capsule / tablet , preprobiotic capsule each capsule contains ( streptococcus faccalis 30million, clostridium butyricum 2million, bacillus mesntericus 1million, lactic acid bacillus 50million ) , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , natural micronised progesterone 200 mg ( capsule ) , tramadol 50 mg capsules , thiocolchicoside 4mg tablet / capsule , thiocolchicoside 8mg tablet / capsule , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , vitaminb complex capsules , vitamin a 10000iu capsules , vitamin e 400 mg capsules...

Rajasthan State Cooperative Consumer Federation Limited - Rajasthan

29067463 purchase for generic medicines , acebrophylline 100 , acebrophylline 200 , acebrophylline 200 + montelukast 10mg , aceclo 100 mg + pcm 500 mg tab. , aceclofenac +serratiopeptidase tab. , aceclofenac + pcm + serratio tab. , aceclofenac 100 mg tab. , aceclofenac inj. , aceclofenac sustained release tab. , acetylcyteine 600 mg tab , acyclovir 200 mg tab. , acyclovir 400 mg tab. , acyclovir 800 mg tab. , acyclovir cream , adriniline inj. , albendazole 10 ml sus. , albendazole 400 mg tab. , alendronic acid 35 cap , alendronic acid 70 cap , alfacalcidol calcium + zinc cap. , alfuzocin 10 , alfuzocin d , alpha beta arteether 2 ml inj. , alpha lio acid + mv + antioxi + chrom. cap. , alprazolam 0.25 mg + propanolol 20 mg tab. , alprazolam 0.25 mg tab. , alprazolam 0.5 mg tab. , ambroxol + terbutaline + guiphen. 100ml syp. , amikacin 100 mg inj. , amikacin 250 mginj. , amikacin 500 mg inj. , aminophylline 10 ml inj. , amiodarone hydrochloride 100 mg , amiodarone hydrochloride 200 mg , amisulpride 100 tab , amisulpride 50 tab , amlodipine + olmesartan tab. , amlodipine besilate 10 mg tab. , amlodipine besilate 2.5 mg tab. , amlodipine besilate 5 mg + ateno 50 mg tab. , amlodipine besilate 5 mg + lisino 5 mg tab. , amlodipine besilate 5 mg tab. , amoxy. + cloxa. cap. , amoxycillin 1.2 g + pot. clavu. 200 mg inj. , amoxycillin 125 mg + dicloxa 125 mg tab. , amoxycillin 200 mg + pot. clavu. 28.5 mg syp. , amoxycillin 250 mg + dicloxa 250 mg cap , amoxycillin 250 mg + pot. clavu. 125 mg tab , amoxycillin 250 mg dt , amoxycillin 500 mg + pot. clavu. 125 mg tab. , amoxycillin 500 mg cap. , amoxycillin dry syp. , ampicillin 250 mg + cloxacillin 250 mg cap. , antacid170ml syp. , antacidwith oxetacaine syp. , antioxidant softgels , atenolol 25 mg tab. , atenolol 50 mg tab. , atorvastatin 10 mg + ezetimibe 10 mg tab. , atorvastatin 10 mg + finofibrate 160mg tab , atorvastatin 10 mg tab. , atorvastatin 20 mg tab. , azathioprine 50 mg tab. , azelastine nasl spray , azilsartan kamedoxomil + chlorthalidone tab , azilsartan medoxomil 40 tab. , azithromycin 100mg sus. , azithromycin 200mg sus. , azithromycin 250 mg tab. , azithromycin 500 mg tab. , b.c. + l lysine 200 ml syp. , b.c. + mv+ mineral + zinc cap. , b.c. 200ml syp. , baclofen 10 tab , benidipine 4mg tab , benidipine 8 tab , betahistine 16 mg tab. , betahistine 8 mg tab. , betamethasone 0.5 tab. , bethanechol 25 mg tab , biscodyl 5 mg tab , bisoprolol 10 tab , bisoprolol 2.5 tab , bisoprolol 5 tab , bisoprolol2.5 + hydrochlorothiazide 6.25 tab , calamine 3% diphen 1% lot 100 ml , calamine lotion 100ml , calcium + vit. d3 tab. , calcium calcitriol + alfacalcidol cap , camylofin25mg+paracetamol300mg tab , canagliflozin + metformin 500 tab , canagliflozin 100mg tab , candesartan 4mg tab , candesartan 8mg tab , carbamezapine 100 mg tab. , carbamezapine 200 mg tab. , carbonyl iron + folic acid + zinc cap. , carvedilol 12.5 mg tab , carvedilol 6.25mg tab , cavedilol 3.125 mg tab , cefadroxil 250 mg dt tab. , cefadroxil 500 mg tab. , cefixime + azithromycin tab. , cefixime + clavu.200 mg tab. , cefixime + dicloxacillin tab. , cefixime + ofloxacin tab. , cefixime 100 mg dt tab. , cefixime 200 mg tab. , cefixime 50 mg dt tab. , cefpodoxime proxetil + clavuna. tab. , cefpodoxime proxetil 100 mg dt tab. , cefpodoxime proxetil 200 mg tab. , cefuroxime 250 mg + potassium clavulanate 125 tab. , cefuroxime 250 mg tab. , cefuroxime 500 mg + potassium clavulanate 125 tab. , cefuroxime 500 mg tab. , cephalexin 250 mg dt tab. , cephalexin 500 mg cap. , cetri. + nimu + pcm + phenyl + caffin tab. , cetrimide lotion , cetrizine 10 mg tab. , cetrizine5 mg+ambroxol 60 mg tab , chlordiazepoxide + clidinium bromide tab , chlordiazepoxide tab , chlorhexidine mouth wash , chloroquin 250 mg tab. , chloroquin 500 mg tab. , chlorthalidone 12.50 mg tab , chlorthalidone 6.25mg tab , cilnidipine 10 mg , cilnidipine 20 mg , cilnidipine10 mg+chlorthalidone12.5mg , cilnidipine 10mg+telmisartan40 mg , cinnarizine + domperidone tab. , cinnarizine 25 mg tab. , cinnarizine 75 mg tab. , ciprofaloxacin + tinidazole tab. , ciprofaloxacin 250 mg tab. , ciprofaloxacin 500 mg tab. , citicolin 500 mg tab , clarithromycin 250 mg tab , clindamycine 300 cap , clobetasol pro. + salicylic acid lotion , clobetasol pro. + salicylic acid oint. , clomifene citrate 50 mg , clonazepam 0.5 mg tab. , clonazepam 1 mg tab. , clonezapam 2 mg tab. , clopidogrel 75 mg + asprin 150 mg tab. , clopidogrel 75 mg + asprin 75 mg tab. , clopidogrel 75 mg tab. , clotrimazole + betame cream 15 gm , clotrimazole power , clotrimazole vag. tab. , cod liver oil 300 mg , coenzyme q1 with anti oxidant cap , collagen peptides + glucosamine sachet , coral calcium tab , coral calcium+vitamin k2 7 , cream beclometha. + genta. + miconaz. , cream beclomethasone + neomycin , cream beclomethasone + salisalic acid , cream beclomethasone 0.025 % + genta 0.2 % , cream beclomethasone dipropionate 0.025% , cream betamethasone + gentamycin , cream betamethasone + neomycin , cream chloramphenicol + hydrocortisone , cream clobetasole , cream clobetasone + genta , cream clotrimazole skin cream , cream clotrimazole vag. cream , cream fluocinolone +genta + clotri. , cream fusidic acid , cream fusidic acid+ beclomethasone , cream heparin + benzyl nicotinate , cream hydroquinone , cream luliconazole + beclometasone , cream luliconazole 10gm , cream luliconazole 20gm , cream luliconazole 30gm , cream miconazole , cream miconazole + fluocinolone , cream mometasone + fusidic acid , cream mometasone + salicylic acid , cream mometasone + terbinafine , cream mometasone furoate 1 mg , cream mupirocin 2% , cream nadifloxacin + mometasone + miconazole , cream nadifloxacine + clobetasol , cream nadifloxacine 10mg , cream neomycin + bacitracin eye oint. , cream neomycin + bacitracin skin oint , cream premethrine 5% , cream terbinafen , cyclobenzaprine ( 15mg ) + aceclofenac ( 200mg ) , cyproheptadine 4 mg tab. , dapagliflozin + metformin 500 tab , dapagliflozin 5mg , dapoxetine 30 tab , dapoxetine 60 tab , deflazacort 12 mg tab. , deflazacort 18 mg tab. , deflazacort 30 mg tab. , deflazacort 6 mg tab. , dexamethasone sod. phos. 0.5 mg tab. , diazepam 10 mg tab. , diazepam 5 mg tab. , dicerine 50 mg cap. , diclofenac + serratiopeptidase + pcm 500tab. , diclofenac + serratiopeptidase tab. , diclofenac 100 mg sr tab. , diclofenac 50 + paracetamol 325 tab. , diclofenac 50 mg tab. , dicyclo 10 mg + mefenimic acid 250 mg tab. , dicyclomin 10 mg + pcm 500 tab. , dicyclomin tab. , dicyclomine drop , digoxin 0.25 mg tab. , diltiazem 30 mg tab. , diltiazem 60 mg tab , diltiazem 90 mg sr tab. , disodium hydrogen citrate syp. , disulfiram 250 mg tab. , disulfiram 500 mg tab. , divalproex sodium 250 tab , divalproex sodium 500 tab , divalproex sodium 750 tab , domperi 10 mg + paracetamol 500 mg tab. , domperidone 10 mg tab , domperidone 5 mg tab. , domperidone sus. , dothipine 25 mg tab. , dothipine 75 mg tab. , doxofylline 400mg + montelukast 10mg , doxofylline 400mg tab , doxycillin 100 mg + lactic acid ba. tab. , doxylaminesuccinate + vit b6 tab. , drop cefpodoxime proxetil dry , drop hydroxyzine oral drop , drop multivitamin , drop paracetamol , drotavarin + mefenimic acid tab. , drotaverine 40 mg tab. , drotaverine 80+ paracetamol 325 tab. , ear drop benzo.+ paracu. + terpentin oil , ear drop chloram + beclo. + clotri + dipro. + ligno. , empagliflozin 25mg tab , enalapril 10 mg tab. , enalapril 2.5 mg tab. , enalapril 5 mg tab. , enzyme tab. , ergotamine+ caffine 100 mg + pcm 250 mg , erythromycin 250 mg , erythromycin 500mg tab , escitalopram + clonazepam tab. , escitalopram 10 mg + etizolam 0.5 tab. , escitalopram 10 mg tab. , escitalopram 5 mg tab. , esomeprazole 40mg , esomeprazole 40mg + levosulperide , esomeprazole 40mg +domperidone , ethamsylate 250 mg tab. , ethamsylate 500 mg tab. , etophyllin + theophyllin tab. , etophyllin r 150 tab. , etophyllin r 300 tab. , etoricoxib 120 mg tab. , etoricoxib 60 + paracetamol 325 tab , etoricoxib 60 + thiocolchicoside 4mg , etoricoxib 60 mg tab. , etoricoxib 90 mg tab. , evening primrose oil 1000 , evening primrose oil 500 mg , eye drop atropine , eye drop brimonidine , eye drop brimonidine + timolol , eye drop brinzolamide , eye drop bromfenac , eye drop carboxy methyl cellulose 0.5% , eye drop carboxy methyl cellulose 1% , eye drop chloram + dexamethasone , eye drop chloram + poly + dexame , eye drop chloram + sulphacetamide , eye drop ciprofloxacin , eye drop ciprofloxacin+ dexamethasone , eye drop cromolyn sodium , eye drop dorzolamide , eye drop dorzolamide + timolol , eye drop flurbiprofen , eye drop gatifloxacin 0.3% , eye drop gatifloxacin 0.3% + prednisolone , eye drop hydro carboxy cellu + sulpha , eye drop hydro carboxy methyl cellulose , eye drop ketorolac 0.4% , eye drop ketorolac 0.5% , eye drop levofloxacin 1.5 , eye drop moxifloxacin 0.5 , eye drop moxifloxacin 0.5 + dexamethasone , eye drop moxifloxacin 0.5 + ketorolac , eye drop naphazoline + camphor + cpm , eye drop neomycin + bacitracin , eye drop ofloxacin , eye drop ofloxacin , eye drop ofloxacin + betamethasone , eye drop ofloxacin + dexamethasone , eye drop ofloxacin + ketorolac , eye drop ofloxacin + prednisolone , eye drop olopatdine , eye drop olopatdine + ketorolac , eye drop pilocarpine + timolol , eye drop pilocarpine 2% , eye drop polyvinyl alcohol + povidone , eye drop pot iod + sod chlo + cal chlo , eye drop prednisolone , eye drop timolol 0.5% , eye drop tobramycin , eye drop tobramycin + dexamethasone , eye drop tobramycin + flurometholone , eye drop tropicamide + phenylephrine , eye drop xylometazoline , eye drop zinc sulphate + boric acid + cpm , eye gel carboxy methyl cellulose 0.5% , eye gel carboxy methyl cellulose 1% , eye oint moxifloxacin oint. , eye oint. atropine , eye oint. ciprofloxacin , eye oint. ofloxacin , eye oint. tobramycin , eye oint. tobramycin + dexamethasone oint. , face mask 3 layer , faropenam 200 tab , febuxostat 40 tab , febuxostat 80 tab , fexofenadine 120 mg tab. , fexofenadine 180 mg tab. , fluconazole 150 mg tab. , fluconazole 200 mg tab. , flunarizine 10 mg tab. , flunarizine 5 mg tab. , fluoxetine 10 mg cap. , fluoxetine 20 mg cap. , flupentixo + melitracen tab. , fluticasone + azelastine nasal spray , fluticasone cream , folic acid tab. , frusemide + spirolactone tab. , frusemide 40 mg tab. , gabapentin + mecobolamine cap. , gabapentin 100 mg cap. , gabapentin 300 mg cap. , gabapentin 400 mg cap. , gabapentin400mg + nortriptyline10mg , gatifloxacin 400 mg tab , gbhc + chlorhexi. + cetrimide lotion , gbhc lotion 100ml , gel aceclofenac + lins oil + methyl sali. , gel clindamycine , gel clindamycine + isotretinoin , gel clindamycine +nicotinamide , gel diclofenac + oleum etc. gel 30gm , gel diclofenac 30gm , gel erythromycin , gel lignocaine gel , gel metronidazole , gel mouth ulser gel , gel piroxicam 30 gm , gel povidone iodin + metronidazole oit. , gel povidone iodin 10% oit. , gel povidone iodin 5% oit. , gel pro sali+ benzyl ko chloride oral gel , ginseng with multivitamin cap , gliclazide 40 mg tab. , gliclazide 80 mg + metformine 500 mg tab. , gliclazide 80 mg tab. , glime 1 mg+ metfo 500mg+ piog 15mg tab. , glime 2mg+ metf 500mg+ pioglati 15mg tab. , glimepride 1 mg + metformine 1000 mg tab. , glimepride 1 mg + metformine 500 mg tab. , glimepride 1 mg tab. , glimepride 2 mg + metformine 1000 mg tab. , glimepride 2 mg + metformine 500 mg tab. , glimepride 2 mg tab. , glucosamine + dicerine + mms tab. , glucosamine + dicerine cap. , glucosamine + mms tab. , glucosamine cap. , glycerin liquid 100 ml , glyceryl trinitrate 2.6 mg tab. , glyceryl trinitrate 6.4 mg tab. , haematinic with vitamin cap. , hcg pregnancy test card , herbal liver tonic 100 ml , herbal liver tonic 200 ml , hydro + tretoin + memetasone cream , hydroxychloroquine 400mg tab , hydroxychloroqune 200mg tab , hydroxyzine 10 mg tab. , hydroxyzine 25 mg tab. , hyoscine butylbromide 20mg 2 ml , hyoscine tab , ibuprofen + paracetamol sus. 60ml , ibuprofen + paracetamol tab. , ibuprofen 400 mg tab. , indomethacin 25 mg cap. , indomethacin 75 mg sr cap. , inj.erythropoietin inj 4000 , inj. amoxycillin 125 mg + dicloxa 125 mg , inj. amoxycillin 250 mg + dicloxa 250 mg , inj. ampicillin + cloxacillin 1gm , inj. ampicillin + cloxacillin 500 mg , inj. ampicillin 500 mg , inj. anti snake venum ( liquid ) , inj. anti snake venum ( powder ) , inj. anti tetanus immunog human 250 , inj. anti tetanus immunog human 500 , inj. anti d immunoglobulin ( human ) , inj. arte mether 2 ml , inj. artesunate 50 mg , inj. arv , inj. atracurium 2.5 ml , inj. atropine 0.6 mg , inj. benzothine benzyl penicillin 12 la , inj. bupivacaine 0.5 % 30 ml , inj. bupivacaine heavy 0.5 mg ( 4 ml ) , inj. butarphenol 1 mg , inj. butarphenol 2 mg , inj. cafotaxime + salbutamol 1.5 gm , inj. calcium gluconate 10 ml , inj. cefaperazone + salbactum 1 gm , inj. cefaperazone + salbactum 1.5 gm , inj. cefazidime 1 gm , inj. cefazidime 1.5 gm , inj. cefazidime 2 gm , inj. cefotaxime 1 gm , inj. cefotaxime 250 mg , inj. cefotaxime 500 mg , inj. ceftriaxone+ salbactum 1.5 gm , inj. ceftriaxone+ salbactum 750 mg , inj. ceftriaxone + tazobactum 375 mg , inj. ceftriaxone 1000 mg , inj. ceftriaxone 1000 mg + tazoba125 mg , inj. ceftriaxone 250 mg , inj. ceftriaxone 500 mg , inj. cefuroxime 1.5 gm , inj. cefuroxime 250 mg , inj. cefuroxime 500 mg , inj. cefuroxime 750 mg , inj. ciprofloxacin 100 ml iv , inj. d10 1000 ml , inj. d10 500 ml , inj. d5 1000 ml , inj. d5 500 ml , inj. dexamethasone sod. phos. 2 ml , inj. dextran 40 , inj. dextran 70 , inj. dextrose 25% , inj. diazepam 2 ml , inj. diclofenac , inj. dicyclomin , inj. digoxin 0.5 mg / 2 ml , inj. dihydroergotamine 1 ml , inj. diltiazem 5 mg / ml , inj. distild water for inj ( d.w. ) 5ml , inj. distilled water 10 ml , inj. dns 1000 ml , inj. dns 500 ml , inj. dobutamine , inj. dopamine 5 ml , inj. drotaverine 2 ml , inj. drotaverine 80 mg , inj. enoxpirin 0.4% , inj. enoxpirin 0.6% , inj. ergometrine , inj. ethamsylate 2 ml , inj. etophyllin + theophyllin , inj. fenobarbitone , inj. frusemide , inj. gentamycin 80 mg , inj. glyceryl trinitrate , inj. glycopyrolate 0.2 mg , inj. haemaccoeal 500 ml , inj. halothane 20 ml , inj. halothane 30 ml , inj. heparin , inj. hyalunoridase 1500 , inj. hydrocortisone 100 mg , inj. hydroxyprogestron 250 mg , inj. hydroxyprogestron 500 mg , inj. insuline 30 / 70 , inj. insuline lente , inj. insuline nph , inj. iron dextran , inj. isolyte e 500 ml , inj. isolyte g 500 ml , inj. isolyte m 500 ml , inj. isolyte p 500 ml , inj. isoxsuprine hcl , inj. ketamine 2 ml , inj. levofloxacin 100ml , inj. lorazepam , inj. mannitol 100 ml , inj. mannitol 350 ml , inj. mecobalamin 500mcg 2ml , inj. megsulf , inj. menadione sodium 1 ml , inj. methyl cellulose pre filled syringe , inj. methyl ergometrine maleate , inj. metoclopromide 2ml , inj. metronidazole 100 ml , inj. midazolam 5 ml , inj. multivitamine 10 ml , inj. nandrolone decanote 25 mg , inj. nandrolone decanote 50 mg , inj. neostig 2.5 mg + glycopyrolate 0.5 mg , inj. neostigmine 5 ml , inj. normal saline 1000 ml , inj. normal saline 500 ml , inj. ofloxacin 100 ml iv , inj. omeprazole , inj. ondansetron , inj. ondansetron + ranitidin , inj. ornidazole iv , inj. oxytocin , inj. pantoprazole , inj. pantozocine 30 mg / ml , inj. paracetamol 2ml , inj. phenaramine maleate , inj. phenobarbitone , inj. pilocarpine , inj. piperacilline + tazobactum 2.5 gm , inj. piperacilline + tazobactum 4.5 gm , inj. piroxicam , inj. potassium chloride , inj. progestirone 100 mg , inj. progestirone 200 mg , inj. promethazine hcl 50 mg , inj. propofol 10 ml , inj. ranitidine , inj. rl 1000 ml , inj. rl 500 ml , inj. soda bi carb 10 ml , inj. streptokinase 15 lac iu , inj. succinyl choline 10 ml , inj. t.t. , inj. theopentone sodium , inj. tinidazole 400 ml , inj. tramadol hydrochoride , inj. tranexamic , inj. urokinase 5 lac i.u. , inj. valethamate 8 mg. , inj. vecuronium 4 mg , inj. xylocain 2% with adrenaline 3 ml , inj. xylocain 4% 30 ml , inj. xylocaine heavy 5% ( lox ) ( 2ml ) , inj.benzothine benzyl penicillin 24 la , iron cap. , iron iii tab. , isosorbide mononitrate 10 mg tab. , isosorbide mononitrate 20 mg tab. , isosorbide mononitrate 30 mg tab. , itraconazole 100 mg , itraconazole 200 mg , itraconazole 400 mg , ivermectin 12 mg + albenad 400 mg tab. , ivermectin 12 mg tab. , ivermectin 3 mg tab. , ivermectin 6 mg + albenadazole 400 mg tab. , ivermectin 6 mg tab. , ketaconazole + coaltar lotion , ketaconazole + zpto lotion , ketoconazole 200 mg tab. , ketoconazole lotion , ketorolac 10 mg tab , lactobacillus sporgenes 120 million tab. , letrozole 2.5mg tab , levetiracetam 250 mg , levetiracetam 500mg , levetiracetam 750 mg , levocetrizine + phenylpro + pcm tab. , levocetrizine 5 mg tab. , levofloxacin 250 mg tab. , levofloxacin 500 mg tab. , levofloxacin 750 mg tab. , levonorgestrol 0.75 mg tab. , lignocain hydroclorid 2% inj , linagliptin + metformin tab , linagliptin tab , lincomycin 2ml inj , lincomycin cap , linezolid syp , linezolide 600mg tab , liquide paraffine+ milk of magnesia + sodium picosulphate syp , lisinopril 5 mg tab. , lithium carbonate 300 mg tab. , lithium carbonate 450 mg tab. , loperamide tab. , loratadine 10 mg tab. , lorazepam 1 mg tab. , lorazepam 2 mg tab. , losartan + amlodipine tab. , losartan + atenolol tab. , losartan + hydrochlor. tab. , losartan 25 mg tab. , losartan 50 mg tab. , lycopen+vitamin cap , mebeverine 200 tab , mecobalamine + liopic acid + f. acid cap. , mecobalamine 1500 mcg tab. , metformin 1gm sustained release tab , metformin 500 mg sustained release tab , metformin 500 mg tab. , metformin 850mg tab , methotrexate 10 mg , methotrexate 2.5 mg , methotrexate 5 mg , methotrexate 7.5 mg , methyl ergometrine maleate 0.2 mg tab. , methyl prednisolone 16 mg tab. , methyl prednisolone 24 mg tab. , methyl prednisolone 4 mg tab. , methyl prednisolone 8 mg tab. , metoclopramide tab. , metoprolol 25mg , metoprolol 25mg + amlodipine 5 tab , metoprolol 25mg xl tab , metoprolol 50mg , metoprolol 50mg + amlodipine 5 tab , metoprolol 50mg xl tab , metronidazole + clorhexidin gel , metronidazole 200 mg tab. , metronidazole 400 mg tab. , mirtazapine 15 mg tab , monmtelukast 10 mg+fexofenadine 120 mg , montelukast 10 mg + levoce 5 mg tab. , montelukast 10 mg+fexofenadine hcl 120 mg+acebrophylline , mosapride 5mg tab , moxifloxacin + dexamethasone eye drop , multivitamin sogtgel cap. , mv + minerals cap. , myo inositol 1g+lmethyl folate 100mcg+vitamind3 cap , n 95 mask , naproxen + paracetamol tab. , naproxen 250 mg tab. , naproxen 250mg , naproxen 500 mg tab. , naproxen 500 mg+domperidone 10 tab , naproxen 750 mg tab. , natural progestirone 100 mg cap. , natural progestirone 200 mg cap. , nebivolol 5 mg + amlodipine 5 tab , nebivolol 5 mg tab , nicorandil 10mg tab , nicorandil 5mg tab , nifedipine 10 mg cap. , nifedipine 5 mg cap. , nifedipine extended release 10 mg tab , nifedipine extended release 20 mg tab. , nimesulide 100 mg + pcm500 mg tab. , nimesulide 100 mg + serratio 10 mg tab. , nimesulide 100 mg + tizanidine 2 mg tab. , nimesulide 100 mg tab. , nimesulide 200 mg tab. , nimesulide mouth disolving tab. , nitrofurantoin 100 mg , norethisterone 5 mg tab. , norfloxacin 400 mg + tinidazole 600 mg tab. , norfloxacin 400 mg tab. , ofloxacin + ornidazole tab. , ofloxacin 200 mg tab. , ofloxacin 400 mg tab. , olanzapine 10 mg tab. , olanzapine 15 mg tab. , olanzapine 5 mg tab. , olmesartan + hydrochlorthiazide tab , olmesartan 20 tab , olmesartan 20 tab chlorthalidone 12.5 , olmesartan 40 tab , omeprazole + domperidone cap. , omeprazole 20 mg cap. , ondansetron + ranitidin tab. , ondansetron 4 mg tab. , ondansetron 8 mg tab. , oral rehydration salts ( o.r.s. ) , ornidazole 500 mg tab. , oxcarbazepine 150mg , oxcarbazepine 300mg , oxymetazolin nasal solution ( a ) , oxymetazolin nasal solution ( p ) , pancreatin tab , pantoprazole + domperidone cap. ( dsr ) , pantoprazole + itopride cap. , pantoprazole + levosulpride tab. , pantoprazole 40 mg tab. , pantozocine tab. , paracetamol + camylofin tab , paracetamol 500 mg tab. , paracetamol 650 mg tab. , phenobarbitone 30 mg tab. , phenobarbitone 60 mg tab. , phenytoin 100 tab , phenytoin 300 er tab , phenytoin syp , pioglatazone 15 mg tab. , pioglatazone 30 mg tab. , piracetam + citicoline tab , piracetam 800mg tab , piroxicam 20 mg dt tab. , povidone iodin + metronidazole lotion , povidone iodin gergle 100ml , povidone iodin lotion 100ml , prazocin 1 mg tab. , prazocin 2 mg tab. , prazocin xl 2.5 tab , prazocin xl 5 mg , pre pro biotic cap , pre probiotic sachet 1x1 , prednisolone 10 mg tab. , prednisolone 20 mg tab. , prednisolone 40 mg tab. , prednisolone 5 mg tab. , pregabalin 75 mg + meco 750 mcg cap. , pregabalin 75 mg cap. , pregabalin 75 mg+nortriptyline 10mg , pregabaline 75 mg+nortriptyline 10 mg+methylcobalamine 1500 mc , pregnancy test card , premethrine 5% lotion , premethrine soap , primaquin 15mg tab. , primaquin 7.5mg tab. , prochlorperazine tab , promethazine 10 mg tab. , promethazine 5 mg tab. , propranolol 10 mg tab. , propranolol 20 mg tab. , propranolol 40 mg sr tab. , propranolol 40 mg tab. , protein powder , quetiapine 100 mg , quetiapine 50 mg , rabeprazole + domperidone dsr cap. , rabeprazole + itopride cap. , rabeprazole + itopride cap. , rabeprazole + levosulpride cap. , rabeprazole 20 mg tab. , racecadotril 100 mg , racecadotril sachet , ramipril 10 mg tab. , ramipril 2.5 mg tab. , ramipril 5 mg tab. , ranitidine + domperidone tab. , ranitidine 150 mg tab. , ranolazine 500mg , resperidone 2 mg tab. , resperidone 3 mg tab. , resperidone 4 mg tab. , riboflavin10mg, folic acid, niacinamide 100mg , rosehip powder cap , rosuvastatin 10 + finofibrate tab , rosuvastatin 10 tab , rosuvastatin 10mg +aspirin 75mg , rosuvastatin 20 tab , roxythromycin 150 mg tab. , roxythromycin 50 mg tab. , sachet antacid , salbutamol 2 mg tab. , salbutamol 4 mg tab. , scanidazole 1 gm tab. , serratiopeptidase 10 mg tab. , serratiopeptidase 5 mg tab. , sertaline 25 mg tab. , sertaline 50 mg tab. , sidenafil 100 mg tab. , sidenafil 50 mg tab. , silodosin 4 mg , silodosin 4 mg + dutasteride 0.5 mg , silodosin 8 mg , silodosin 8 mg + dutasteride 0.5 mg , silver nitrate + chlorhexidine cream , silver sulphadiazine + chlorhexidine oint. , silver sulphadiazine oit. , sitagliptin 100 tab , sitagliptin 50 mg +metformin 500mg , sitagliptin 50 tab , soap anti acne , sodium chloride nasal spray , sodium picosulphate syp , sodium picosulphate tab. , sodium valproate 200 mg tab. , sodium valproate 300 mg tab. , sodium valproate 500 mg tab. , spironolactone + aldectone tab. , spironolactone 100 mg tab. , spironolactone 25 mg tab. , spironolactone 50 mg tab. , sun screen lotion , sur. abdominal binder , sur. adapter 3 way , sur. adhesive plaster ( cloth ) , sur. arm pouch sling , sur. asepto syringe , sur. b.k. skin traction kit , sur. b.k. sponge traction kit , sur. b.p. blade 10 , sur. b.p. blade 11 , sur. b.p. blade 15 , sur. b.p. blade 22 , sur. b.p. blade 23 , sur. b.p. blade 24 , sur. b.t. set , sur. bactigras , sur. band aid , sur. bandage 2 , sur. bandage 4 , sur. bandage 6 , sur. barbers thread60 , sur. barbers thread80 , sur. barbers thread 40 , sur. bed pan , sur. cap , sur. cervical collar , sur. chest belt , sur. clavicular brace , sur. cord clamp , sur. cotton 100 , sur. cotton 200 , sur. cotton 500 , sur. crd ( corrugated rubber drain ) , sur. crepe bandage 10 cm , sur. crepe bandage 15 cm , sur. crepe bandage 7.5 cm , sur. dispovan 1 ml , sur. dispovan 10 ml , sur. dispovan 2 ml , sur. dispovan 20 ml , sur. dispovan 5 ml , sur. dispovan 50 ml , sur. dynaplast , sur. flatus tube , sur. foleys catheter12 no. , sur. foleys catheter20 no. , sur. foleys catheter8 no. , sur. foleys catheter 10 no. , sur. foleys catheter 14 no. , sur. foleys catheter 16 no. , sur. foleys catheter 18 no. , sur. gastric levage tube , sur. gauze , sur. gel foam , sur. gloves 6 , sur. gloves 6½ , sur. gloves 7 , sur. gloves 7½ , sur. gloves 8 , sur. hernia mesh , sur. hydrogen peroxide 100 ml , sur. i.v. cannula 18 ( one way ) , sur. i.v. cannula 18 ( threeway ) , sur. i.v. cannula 20 ( one way ) , sur. i.v. cannula 20 ( threeway ) , sur. i.v. cannula 22 ( one way ) , sur. i.v. cannula 22 ( threeway ) , sur. i.v. cannula 24 ( one way ) , sur. i.v. cannula 24 ( threeway ) , sur. i.v. microdrip set , sur. i.v. set , sur. infant feeding tube 10 , sur. infant feeding tube 12 , sur. infant feeding tube 6 , sur. infant feeding tube 8 , sur. iol 20, 21, 22 no , sur. k 90 , sur. k 91 , sur. l.s. brace , sur. lap pad , sur. malleycots catheter 10 , sur. malleycots catheter 12 , sur. malleycots catheter 14 , sur. malleycots catheter 16 , sur. malleycots catheter 18 , sur. malleycots catheter 20 , sur. malleycots catheter 22 , sur. malleycots catheter 24 , sur. malleycots catheter 26 , sur. malleycots catheter 28 , sur. malleycots catheter 30 , sur. malleycots catheter 32 , sur. malleycots catheter 8 , sur. mask , sur. medicated soap ( savlon, dettol ) , sur. micropore 1 , sur. micropore 2 , sur. micropore 3 , sur. micropore 4 , sur. micropore 6 , sur. monocryl 1 , sur. monocryl 1.0 , sur. monocryl 2.0 , sur. monocryl 3.0 , sur. monocryl 4.0 , sur. mucous extractor , sur. nasal catheter , sur. neck arm pouch , sur. ng tube , sur. nitrofix , sur. paedia set , sur. pan rose drain , sur. patient dress female , sur. patient dress male , sur. pds 1 , sur. pds 1 0 , sur. pds 2 0 , sur. pds 3 0 , sur. pds 4 0 , sur. pds 5 0 , sur. plain rubber catheter ( all size ) , sur. plaster of paris 4 , sur. plaster of paris 6 , sur. polypropylene mesh , sur. profofol 10 ml , sur. profofol 20 ml , sur. prolene 1 pregabine , sur. prolene 1.0 , sur. prolene 2.0 , sur. prolene 3.0 , sur. prolene 4.0 , sur. prolene 5.0 , sur. romo suction drain 14 , sur. romo suction drain 16 , sur. romo suction drain 18 , sur. romo under water seal , sur. ryles tabe 10 , sur. ryles tabe 12 , sur. ryles tabe 14 , sur. ryles tabe 16 , sur. ryles tabe 18 , sur. ryles tabe 8 , sur. sanitary napkin , sur. scalp vein set 18 , sur. scalp vein set 20 , sur. scalp vein set 22 , sur. scalp vein set 24 , sur. silk 1 , sur. silk 1.0 , sur. silk 2.0 , sur. silk 3.0 , sur. silk 4.0 , sur. silk 5.0 , sur. skin grafting blade , sur. sofra tullae , sur. spinal needle no. 23 , sur. spinal needle no. 25 , sur. spinal needle no. 27 , sur. spirit 100ml , sur. sponge , sur. sponge tractian kit , sur. stapler , sur. stapples removal forcep , sur. stockinets , sur. suction catheter , sur. suction tube , sur. suction tubing set , sur. supra cath , sur. surgi gel , sur. surgical shirt , sur. surgical trouser , sur. t tube , sur. thermometer , sur. thermometer digital , sur. urinal , sur. urobag , sur. vickryl 1 , sur. vickryl 1.0 , sur. vickryl 2.0 , sur. vickryl 3.0 , sur. vickryl 4.0 , sur. vicryl rapide 1 , sur. vicryl rapide 1 o , sur. vicryl rapide 2 o , sur. vicryl rapide 3 o , syp. cefdinir 125 , syp. cefixime dry , syp. cefpodoxime proxetil dry , syp. cephalexin dry , syp. cet. + pph. + ammo. chloride + menthol 100ml , syp. codein + cpm 100ml , syp. codein + triprolidine 100ml , syp. colistin sulphate , syp. cyprohep. + tricholine citrate 200ml , syp. cyproheptadine , syp. cyproheptadine + sorbi. + tricho. 200ml , syp. dextro + brom + amm. c. + menth. 100ml , syp. dextro. + cpm + phenylpro. 100ml , syp. dextrome + guiph. + bromh. 100ml , syp. dextromethorphan cough syp sugar free , syp. enzyme ayurvedic , syp. fungal diastage + pepsin 200ml , syp. hydroxyzine , syp. iron , syp. iron iii , syp. lactulose 100 ml sus. , syp. lactulose 200 ml sus. , syp. levocetrizine 60 ml , syp. liver tonic 200 ml , syp. metoclopramide , syp. norfloxacin + metronidazole sus. , syp. ofloxacin , syp. ofloxacin + ornidazole sus. , syp. ondansetron , syp. paracetamol , syp. pcm + cpm + sod. citrate + pph , syp. pcm + promethazine , syp. piracetam 100 ml , syp. potassium chloride liquid , syp. potassium citrate + sodium citrate , syp. sodium picosulphate sus. , syp. terbutaline + brom + guiphen.100ml , syp. zinc acetate , tadalafil 10mg tab , tadalafil 20mg tab , tamsulosin 0.4 , tamsulosin 0.4 + dutasteride , tamsulosin 0.4 + finasteride 5 , tapentadol 100 , telmisartan 20 tab , telmisartan 20+amlodipine 5 +hydroch 12.5tab , telmisartan 40 + amlodipine tab , telmisartan 40 + chlorthalidone 12.5 tab , telmisartan 40 + chlorthalidone 6.25 tab , telmisartan 40 + clinidipine 10 + chlorthadone 12.5mg , telmisartan 40 + hydrochlorthiazide tab , telmisartan 40 tab , telmisartan 40+amlodipine 5 +hydroch 12.5 tab , telmisartan 80 + hydrochlorthiazide 12.5tab , telmisartan 80 tab , teneligliptin 20 mg tab , teneligliptin 20mg + metformin 500 mg , teneligliptin 20mg + metformine 1000mg , terbinafen 250 mg tab. , terbinafen 500 mg tab. , tetracycline cap. , thiocochicoside 4mg , thiocochicoside 4mg + etoricoxib , thiocochicoside 8mg , thiocochicoside 8mg + etoricoxib , thiolchicoside 4 + aceclofenec 100 tab , thiolchicoside 8 + aceclofenec 100 tab , thyroxine 100 mcg , thyroxine 25 mcg , thyroxine 50 mcg , thyroxine 75 mcg , ticagrelor 90mg tab , tinidazole 500 mg tab. , tolperisone 150 mg , topiramate 25 mg , topiramate 50 mg , torsemide 10 mg tab , torsemide 5mg tab , tramadol + paracetamol tab. , tramadol + pcm + diclofenac tab. , tramadol tab. , tranexamic acid + ethamsylate tab. , tranexamic acid + mefenamic acid tab. , tranexamic acid tab. , trifuoperazine + chlordiazepoxide tab. , trihexyphenidyl 2mg tab. , trypsin chymotrypsin tab. , trypsin chymotrypsin+paracetamol+aceclofenac tab , ursodeoxycholic acid 150 tab , ursodeoxycholic acid 300 tab , veldagliptin 50mg tab , veldagliptin+metformin 500 tab , veldagliptin+metformin1000 tab , vitamin b complex cap , vitamin c + zinc tab. , vitamin c tab. , vitamin e 400 mg cap , voglibose 0.2mg tab , voglibose 0.3mg tab , xylometazolin nasal solution ( a ) , xylometazolin nasal solution ( p ) , zoledronic acidinj 4 mg , zolpidem 10 mg tab. , zolpidem 5 mg tab....

Medical College - Rajasthan

28239104 rate contract of antibiotic disc for microbiology department penicilin g ( 10u ) , oxacilin ( 1mcg ) , ampicillin 10 ug , amoxycilin ( 20mcg ) , carbencillin ( 100 mcg ) , ticarcilin ( 15mcg ) , piperacilin ( 100mcg ) , amoxycilin + clavulanic acid ( 20/10 ) , ticarcilin + clavulanic acid ( 75/10mcg ) , piperacilin + tazobactum ( 100/10 ) , cefazolin / cephlothin ( 30/ ) , cefalexin ( 30 mcg ) , cefoxitin ( 30mcg ) , cefuroxime ( 30 mcg ) , cefoperazone ( 75 mcg ) , cefixime ( 5mcg ) , cefotaxime ( 30mcg ) , ceftriaxone ( 30 mcg ) , ceftazidime ( 30 mcg ) , ceftazidime + clavulanic acid ( 30/10 ) , cefoperazone + salbactum ( 75/10 ) , cefipime ( 30 mcg ) , imipenem ( 10 mcg ) , meropenem 10 ug , imipenem + edta , ertapenem ( 10mcg ) , aztreonam ( 30 mcg ) , vancomycin ( mic/vsa ) ( 30 mcg ) , tiecoplanin ( 30 mcg ) , polymyxin b ( 300 u ) , colistin ( mic ) ( 10mcg ) , amikacin ( 30 mcg ) , gentamycin ( 10 mcg ) , high gentamycin ( 120 mcg ) , netilmycin ( 320 mcg ) , tobramycin ( 10 mcg ) , streptomycin , high streptomycin , pristinomycin , tetracycline e ( 30 mcg ) , doxycycline ( 30 mcg ) , tigecycline ( 15 mcg ) , minocycline ( 30mcg ) , chloramphenicol ( 30 mcg ) , erythromycin ( 15 mcg ) , azithromycin ( 15 mcg ) , clarithromycin , linezolid ( 30 mcg ) , dalfopristin , norfloxacin ( 10 mcg0 , ciprofloxacin ( 5 mcg ) , ofloxacin ( 5 mcg ) , levofloxacin ( 5 mcg ) , clotrimoxazole ( 1 . 25/23 . 75 ) , nitrofurantoin ( 300 mcg ) , novobiocin , clindamycin ( 2mcg ) , lincomycin , fosfomycin ( 200u ) , furazolidone ( 50mcg ) , bacitracin ( 0 . 04 u ) , optochin ( 5 mcg ) , nalidixic acid ( 30 mcg ) , bile esculin disc , rifampicin , x factor disc , v factor disc , x + v factor disc , ceftarolin ( 30 mcg ) , ceftolozone tazobactum ( 30/10 mcg ) , ceftobiprol ( 30 mcg ) , daptomycin , levonadifloxacin , ceftazidim + avibactum ( 30/20 mcg ) , fluconazole ( 25mcg ) , voriconazole ( 1mcg ) , amphotericin b ( 100 units ) , itraconazole ( 10 mcg ) , ketoconazole ( 15 mcg ) , miconazole ( 10 mcg ) , nystantin ( 100 units ) , clotrimoxazole ( 10 mcg ) ...

Rajasthan State Co-operative Marketing Federation Limited - Rajasthan

28197675 supply drugs and medicines as per salt name and their combinations at drug stores run by confed , district wholesale coop bhandars and kvss in rajasthan 2 abiraterone 250mg tab 3 acarbose 50 mg tab 4 aceclofenaic + para tab 5 alprazolam 0.25 mg tab 1x10 6 alprazolam 0.25 mg tab 1x15 7 alprazolam 0.5 1x15 8 alprazolam 0.5 tab 9 amikacin 500 mg inj 10 amlodipin+ atenolol tab 11 amlodipine + atenolol tab 12 amlodipine 2.5 mg tab 13 amlodipine besilate 5mg tab 14 amoxycillin + claul 625 tab 15 amoxycillin+clav 625 mg tab 16 anacid 170ml syp 17 anstrazole 1mg tab 18 anstrazole 1mg tab 19 antacids syp 200 ml 20 anti oxi+ lyco+ miner cap 21 anti oxidant cap 22 anticold tab 23 atenol 50 mg tab 1x14 24 atenolol 50 mg tab 1x14 25 atorvastatin 10 mg tab 26 atorvastatin 10mg +aspirin 75mg 27 atorvastatin 10mg +aspirin 75mg 28 atorvastatin 20 mg tab 29 azithromycin 250 mg tab 1x10 30 azithromycin 250 mg tab 1x6 31 azithromycin 500 mg tab 1x10 32 azithromycin 500 mg tab 1x3 33 azithromycin 500 mg tab 1x6 34 b com+mv+mine+zinc forte cap 35 b com6mv+mine+zinc forte cap 36 b complex 200 ml syp 37 b complex cap 1x15 38 b complex forte+ vit 39 b complex tab 1x10 40 beclo+clotri+neomy 10 gm oint 41 beclo+clotri+neomy 5 gm 42 betahistine 16 mg tab 43 betahistine 8mg tab 44 bortezumib 2 mg inj 45 bortezumib 2 mg inj 46 cal carbonate + vitd3 syp 47 calcitrol seachet 48 calcium + vitd3 tab 49 calcium carbon + calcitriol + zinc 50 calcium carbon+ calcitriol + zinc 51 calcium citrate, calcitriol & vitamin k2 7tab 52 calcium citrate, calcitriol & vitamin k2 7tab 53 capecitabine 500 mg tab 54 capecitbine tab 55 capecitbine tab 500 mg 56 carvedilol 6.25 mg tab 57 cefixime 200 mg tab 58 cefuroxime axetil 250 mg tab 59 cefuroxime axetil 500mg tab 60 cefuroxime axetil 500mg tab 1* 61 cetrizine 10 mg tab 62 cholecalciferol tab 1x4 63 cilnidipine 10mg 64 cilnidipine 10mg 65 clonazepam 0.5 mg tab 66 clopidogrel 75mg + aspirin 75 ta 67 clotrimazole + beclomethasone 68 cyprohepatidine + sorbi+ tricho 69 dapagliflozin 10 mg 70 dapagliflozin 10 mg 71 dapagliflozin 10 mg 72 darbepoetin 40mg inj 73 deflazcort 6mg tab 74 diclo+ para+ chlorzox tab 75 diclofenac + diethyla+ met salt + oint 30gm 76 diclofenac + para+ tab 77 diclofenac + serra tab 78 diclofenac oint 30gm 79 diclofenic + para+ serra tab 80 dicyclomine 10+ mefenamic 250mg 81 domeperidone 10mg tab 82 dycerin 50 mg+ glucosamin 750 mgtab 83 enalapril 5mg tab 84 erythropoietin inj 4000 85 escitalopram 10mg + clonazepam0.5 ml 86 esomeprazole 40mg +domperidone 87 esomeprazole 40mg +domperidone 88 etoricoxib 120mg tab 89 etoricoxib 60 + thiocolchicoside 4 mg 90 etoricoxib 60 + thiocolchicoside 4 mg 91 etoricoxib 60mg tab 92 etoricoxib 90mg tab 93 febuxostat 40mg tab 94 fexofenadine 120mg 95 fexofenadine 180mg tab 96 fluconazole 150 tab 97 folic acid 5mg tab 98 folic acid 5mg tab 1x30 99 gabapentin 300 mg + mecobalamine 500mg 100 gabapentin 300mg cap 101 geftinmib tab 250 mg 102 gliclazide 80mg + metformin 500 103 glime 1mg + metfor 500 mg+ piogl 15mg tab 104 glime 2 mg + metfor 500+ piogl 15 mgtab 105 glimepride 1 mg + metformin 1000t 106 glimepride 1 mg + metformin 1000t 107 glimepride 1 mg + metformin 500 t 108 glimepride 1 mg tab 109 glimepride 2 mg + metformin 1000t 110 glimepride 2 mg + metformin 1000t 111 glimepride 2mg +metformin 500 tab 112 glimepride 2mg tab 113 glucosamine 750mg+ diacerein 50 mg+msm tab 114 human erythropoetin alfa inj 4000 iv 115 imatinib tab 400 mg 116 imatinib tab 400 mg 117 isosorbide mononitrare 20mg tab 118 lactoluse syp 20, ml 119 lenalidmide 10mg tab 120 levetiracetam 500 mg 121 levetiracetam 500 mg 122 levocetrizine tab 123 levofloxacin 500mg tab 1x5 124 lin oil + diclo sod+ methyl+ ment 125 losartan 50+ amlodipine 5 tab 126 losartan 50mg tab 127 losartan 50mg tab 128 losartan 50mg+ hydroch 12.5 mgtab 129 losartan pota 50+ amlodipine 5mg tab 130 lycopen cap 131 mandrolone dacanote 50 inj 132 mecobalamin + thiamine +pyridoxi 133 metformin 500mg tab 134 metformin 500mg tab 1x20 135 metformin sr 1gm tab 136 metformin sr 500mg tab 137 metoprolol 25mg tab 138 metoprolol 50mg tab 139 metoprolol xl 50mg tab 1x10 140 metoprolol xl 25mg tab 141 montelukast 10mg + levo.d hcl 5 142 multivitamin and minerals cap 143 nicorandil 5mg tab 144 nimesulide + para tab 145 ofloxacin 200mg tab 146 olemesartan 40mg tab 1x10 147 olmesartan 20mg & hydroch 12.5tab 148 olmesartan 20mg tab 149 omeprazole 20 cap 1x15 150 omeprazole+domp cap 1x15 151 ondensetron 4mg tab 152 pantoprazole 40mg +domp 30 mg sr cap 153 pantoproazole 40mg 154 paracetamol 650mg tab 155 paracetamol 500mg tab 156 piogilitazone 15mg tab 157 piogilitazone 30mg tab 158 piracetam 800mg tab 159 porpanolol 10mg tab 160 prazocin xl 2, 5mg tab 1x15 161 prazocin xl 5mg tab 1x15 162 prazosin hydrochloride 5mg 163 prazosin hydrochloride 5mg 164 prazosin hydrochloride 5mg 165 pregabalin 75mg & methycobalmin 750 mg cap 166 propanolol 40mg tab 167 rabeprazole 20mg + dom 10mg tab 168 rabeprazole 20mg + dom 30mg cap 169 rabeprazole 20mg tab 170 ramipril 2.5mg tab 171 ramipril 5mg tab 172 ranolazine 500mg 173 ranolazine 500mg 174 rosuvastatin 10mg +aspirin 75mg 175 rosuvastatin 10mg +aspirin 75mg 176 rosuvastatin 10mg tab 177 rosuvastatin 20mg tab 178 sertaline 50mg tab 179 silodosin 8 mg cap. 180 silodosin 8 mg cap. 181 silodosin 8 mg tab 182 sitagliptin 100mg 183 sitagliptin 100mg 184 sitagliptin 50 mg +metformin 500mg 185 sitagliptin 50 mg +metformin 500mg 186 sitagliptin 50mg 187 sitagliptin 50mg 188 tamsulosin .4mg +dutasteride .5mg 189 tamsulosin .4mg +dutasteride .5mg 190 tamsulosin 0.4mg tab 191 tamsulosin 0.4mg tab 1x15 192 telmisartan 20+amlodipine +hydroch tab 193 telmisartan 40 mg + amlodipin 5mg tab 194 telmisartan 40+amlodipine +hydroch tab 195 telmisartan 40mg + hydroch 12.5 mgtab 196 telmisartan 40mg tab 197 telmisartan 80 mg tab 198 telmisartan 80+hydrochlorothiazide tab 199 telmisartan 80+hydrochlorothiazide tab 200 teneligliptin 20mg 201 teneligliptin 20mg 202 teneligliptin 20mg + metformin 500mg 203 teneligliptin 20mg + metformin 500mg 204 terbutaline + guai+brom +menthol syp 100ml 205 thyroxine 100mg tab 1x1 206 thyroxine 25mg tab 1x1 207 ticagrelor 90mg tab 208 ticagrelor 90mg tab 209 ticagrelor 90mg tab 210 ticagrelor 90mg tab 211 tramadol 50mg+ paracetamol 375 mg tab 212 vildagliptina 50mg 213 vildagliptina 50mg 214 vildagliptina 50mg + metformin 500mg 215 vildagliptina 50mg + metformin 500mg 216 vitamin b complex cap 1x15 217 vitamin e tab 400ng 218 voglibose 0.2mg tab 219 voglibose 0.3mg tab 220 zoledronic acid inj 4 mg 221 zoledronic acid inj 4 mg 222 list of drugs and medicines with salt name and their combinations ( group b ) 223 aceclofenac sr tab 224 aciclovir 800 mg tab 1x10 225 albumin 100ml inj 226 alkaliser 100ml syp 227 alphal ipoic acid +mv +antioxi +ch 228 amlodipin 10mg tab 229 antacids tab 230 anti oxidant cap 231 arsinix trioxide inj 232 atenolol 25mg tab 233 atorvastatin 40 mg tab 234 azaciticline inj 235 b complex 200 ml syp 236 bendamustin 100 mg inj 237 bendamustin 100 mg inj 238 bevacizumnab inj 100 mg 239 bleomycin inj15 mg 240 bortezumib 2 mg inj 241 bortezumib 3.5mg inj 242 calcium + vitamin syp 243 capecitabine 500 mg tab 244 carboplatin 150 mg inj 245 carboplatin 150 mg inj 246 carboplatin 450 mg inj 247 carboplatin 450 mg inj 248 carvedilol 12.5 mg tab 249 caspofun xgin 50 mg inj 250 caspofunxgin 70 mg inj 251 cefixime 100 mg tab 252 ceftriaxone 1gm inj. 253 ceftriaxone 1gm+ sulbactm 500mg 254 cefuroxim 250 mg tab 255 cetrizine 30ml syp 256 cilnidipine 10 mg +telmisartan 40mg 257 cilnidipine 20 mg 258 cilnidipine 20 mg 259 cilnidipine 5mg 260 cinnarizine + domperidon tab 261 cinnarizine 25mg tab 262 cinnarzine 10mg tab 263 cipro +dexa eye drop 264 cipro +flucinolane + clorti cream 265 cipro 250 mg tab 266 ciprofloxacin eye / ear drop 267 ciprofloxin 500 mg 268 cisplatin 10 mg 269 cisplatin 10 mg inj 270 cisplatin 50 mg inj 271 cisplatin 50 mg inj 272 citicoline 500mg +piracetam 400mg 273 citicoline 500mg +piracetam 800mg 274 clobetasol 0 05%+ gentamicin 0 275 clonazepam 1mg tab 276 clotriamazole tab 277 clotrimazole oint 278 cyproheptadine 200ml syp 279 cytrabine 100 mg inj 280 cytrabine 100 mg inj 281 cytrabine 1000mg inj 282 cytrabine 500 mg inj 283 cytrabine 500 mg inj 284 dacarbizine 200 mg inj 285 dacarbizine 200 mg inj 286 dacarbizine 500 mg inj 287 dacarbizine 500 mg inj 288 dapagliflozin 5mg 289 dapagliflozin 5mg 290 darbepoetin 25mg inj 291 darbepoetin 60mg inj 292 daxotel inj 120 mg 293 daxotel inj 120 mg 294 ddripemem 500mg inj 295 dexamethason inj 296 dexamethasone + chloramphenicol 297 dexamethasone + ciprofloxacin 1 298 dexamethasone phos inj 299 dextromethopen + hydro+ bromhx +am 300 dextromethorphan 10+ guai 100 +br 301 diclofenac 50mg tab 302 diclofenac inj 303 diltiazem 30mg 304 diltiazem 60mg tab 305 diphenhydramine 14.08 + amni 38 syp 306 docetaxel 20 mg inj 307 docetaxel 20 mg inj 308 docetaxel 80mg 309 docetaxel 80mg inj 310 domeperidone dt 10mg tab 311 doxarubacin inj 10 mg 312 doxarubacin inj 10 mg 313 doxarubacin inj 50 mg 314 doxarubacin inj 50 mg 315 doxycycline 100 mg tab 1x8 316 doxycycline caps 317 drotaverine & mefenamic tab 318 ecitabine cap 500 mg 319 enalapril 10mg tab 320 enalapril 2.5mg tab 321 enapil 5 mg + amlodipine 5 mg tab 322 enoxaparin sodium 60mg inj 323 enzymes cap 324 enzymes syp 200ml 325 epirubicin 10 mg inj 326 epirubicin 10 mg tab 327 epirubicin 100 mg inj 328 epirubicin 100 mg inj 329 epribucin 50 mg inj 330 epribucin 50 mg inj 331 erlotinib 100mg tab 332 erlotinib 150 mg tab 333 erlotinib 150 mg tab 334 erythro protine inj 335 erythropoietin 10000 inj 336 erythropoietin 10000 inj 337 erythropoietin 40000 inj 338 erythropoietin 40000 inj 339 escitalopram 10mg tab 340 esomeprazole 40mg 341 esomeprazole 40mg 342 esomeprazole 40mg 343 etaner cept 250mg inj 344 etaner cept 50 mg inj 345 etophylin + theophylin 150mg tab 346 febuxostat 80mg tab 347 filgrastim pfs inj 300mg 348 filgrastim pfs inj 6mg 349 filgrastim pfs inj 300mg 350 fludocyte 50 mg inj 351 fluxoetin cap 352 fosapre ptant 150mg inj 353 frusemide 40mg tab 354 fusidic acid + beciomfth+ dipro c 355 fusidic acid cream 356 gatifloxacin 400 mg tab 357 gatifloxacin eye drop 358 geftinmib tab 250 mg 359 gemcitabine inj 1 gm 360 gemcitabine inj 1 gm 361 gemcitabine inj 20 mg 362 gemcitabine inj 200 mg 363 gemcitabine 1.4 mg inj 364 gentamicin 80mg inj 2 ml 365 gentamycin eye drop 366 ginsang + multi vit cap 367 glibenclamide 5mg + metformin 500 tab 368 glibenclamide smg tab 369 gliclazide 40mg tab 370 gliclazide 80mg tab 371 glipizide 5mg + metformin 500 372 glucosamine 500mg tab 373 griseofulvin 250 mg tab 374 haematinic with vitamins cap 375 human erythropoetin alfa inj 2000 iv 376 human erythropoetin alfa inj 4000 iv 377 human erythropoetin alfa inj 2000 iv 378 hydrocortisone 100 inj 379 ibandronate tab 380 ibandronate tab 381 ibuprofen 400 +para 325 mg tab 382 imatinib tab 100mg 383 imatinib tab 100mg 384 imatinib tab 100mg inj 385 indomethacin 75mg sr cap 386 indomethacin cap 387 irenotacan 100mg inj 388 irenotacan 100mg inj 389 irenotacan 40 mg inj 390 irenotacan 40 mg inj 391 iron + folic acid cap 392 iron 200ml syp 393 isosrbide mononitrare 10mg ta 394 ketoconazole 2% lot 395 lacto bacillus tab 1x15 396 lactoluse 100ml syp 397 lenalidmide 10mg tab 398 lenalidmide 5mg tab 399 letrazol 2.5 mg tab 400 levetiracetam 250mg 401 levetiracetam 750 mg 402 levocetrizine syp 403 levofloxacin 250 mg 404 levofloxacin 750mg tab 405 levofloxacin iv inj 100ml 406 levprolide inj 3.75mg 407 liq. paraffin + milk or magnesia 408 lisinopril 5mg tab 409 liver tonic 200 syp 410 loperamide 2mg tab 411 loratadine 10mg tab 412 luprolide depot 11.25 inj 413 luprolide depot 22.5 inj 414 lyophillzed doxetaxel inj 20 mg 415 lyophillzed doxetaxel inj 80 mg 416 magaldrate540 + simeth 50mg syp 417 mecobalamin 1500mg tab 418 mecobalamin 500mg inj 2ml inj 419 mecobalaminia lipo +facid +pyri 420 melphalan tab 2 mg 421 metformin 850mg tab 422 metformine 500mh+gliclazide 80 mhtab 423 metformin sr 1000mg tab 424 metformin sr 500mg tab 425 methylcobalami + mincrals cap 426 methylpredsolone 16 mg tab 427 methylpredsolone 4mg tab 428 methylpredsolone 8 mg tab 429 metronidazole 400mg tab 430 metronidazole inj 100ml 431 miconazole oint 10gm 432 mimesulide 100mg tab 433 minesulide gel 434 mirtazapine 15mg tab 435 misoprostol 200mg tab 436 momemtasone creasm 437 multivitamin soft gel cap 438 multivitamin syp 200ml 439 mycophenolate 500mg tab 440 nab paclitaxel 100 inj 441 nandrolone dacanote 25 inj 442 nano paclitaxel 100mg inj 443 nebivolol hydrochloride 2.5mg tab 444 nebivolol hydrochloride 5mg tab 445 nimesulide 100mg+tizanidine 2mg tab 446 nitroglycerin 2.6 tab 1x30 447 norfloxacin 400 tab 448 ofloxacin eye / ear drop 449 ofloxacin+ornidazol tab 450 olanzapine 5mg tab 451 oxaplatin 100mg inj 452 oxaplatin 100mg inj 453 oxaplatin 50 mg inj 454 oxaplatin 50 mg tab 455 paclitaxel inj 260mg 456 paclitaxel inj 260mg 457 paclitaxel 100mg inj 458 paclitaxel 100mg inj 459 paclitaxel 200 mg inj 460 paclitaxel 30 mg inj 461 paclitaxel 30 mg inj 462 paclitaxel 30 mg inj 463 paclitaxel 300 mg inj 464 paclitaxel 300 mg inj 465 pantoprazole inj 466 paracetamol 250mg syp 467 paracetamol tab 1x15 468 pegylated interferon alfa inj 1180mg 469 pemetrexed inj 100mg 470 pemetrexed inj 100mg 471 pemetrexed inj 500mg 472 phenobarbitone 30mg tab 473 phenobarbitone 60mg tab 474 piracetam 800mg tab 475 piroxicam disp 20mg tab 476 povidone 100ml liq 477 povidone 15gm oint 478 povidone 20gm oint 479 povidone oint 5gm 480 povidone powder 481 prazosin hydrochloride 2.5mg 482 prazosin hydrochloride 2.5mg 483 prazosin hydrochloride 2.5mg 484 pre & probiotic sachet 1x1 485 promethazine 25mg tab 486 propranolol40mg & alprazolam 0.25mg tab 487 quinine dthydrochloride inj 488 quinine sulpate 300mg tab 489 rijoximab inj 500 mg 490 rijoximab inj 500 mg 491 rijoximab inj 100 mg 492 rijoximab inj 100 mg 493 salbutamol 4mg tab 494 sertaline 100mg tab 495 silodosin 8 mg cap.+ dutasteride .5mg 496 silodosin 8 mg cap.+ dutasteride .5mg 497 sitagliptin 50 mg +metformin 1000mg 498 sitagliptin 50 mg +metformin 1000mg 499 sodium valproate cr 500mg tab 500 sorafenib 200mg tab 501 tacrolimus cap 1mg 502 tacrolimus cap 0.5mg 503 tacrolimus cap 0.5mg 504 tacrolimus 0.01% w / w ointment 505 tacrolimus 0.03% w / w ointment 506 tamzolamid tab 250 mg 507 tamzolamid tab 100mg 508 tamzolamid tab 100mg 509 tamzolamid tab 250 mg 510 temozolomide cap 20mg 511 temozolomide cap 100mg 512 temozolomide cap 100mg 513 temozolomide cap 20mg 514 teneligliptin 20mg + metformin 1000mg 515 teneligliptin 20mg + metformin 1000mg 516 terbipression inj 517 teripratide 750mg / ml inj 518 ticagrelor 60 mg tab 519 tigercyclin inj 520 tinidazole 500mg tab 521 tramadol inj 2ml 522 trastozumab 440 inj 523 ursodeoxycholic acid 300 mg tab 524 ursodeoxycholic acid 300 mg tab 525 vildagliptina 50mg + metformin 1000mg 526 vitamin c 500mg tab 527 voriconazole 200ml tab 528 zinc sulphate 60ml syp 529 zoledronic acid 5mg inj 530 zolpidem 5mg tab 531 list of drugs and medicines with salt name and their combinations ( group c ) 532 aceclofenac sr 200 mg tab 533 aceclofenac 100 mg tab 534 acyclovir 200 mg inj 535 acyclovir 200 mg tab 536 acyclovir 400 mg inj 537 acyclovir cream 538 adrenaline inj 539 albendazole drop 10ml 540 albendazole syp 541 all hydr + mag hydro+ dim. + sorb syp 200ml 542 amoxicillin 500 mg cap 543 amoxycillin 1.2 mg inj 544 amoxycillin 125 dry sup 545 amoxycillin 125 mg 30 ml syp 546 amoxycillin 250 mg 30 ml syp 547 amoxycillin 250 mg cap 548 antacid chew tab 549 antacid tab 1x9 550 artesunatge 50 mg tab 551 atenolol 100 mg tab 552 atenolol 100 mg tab 1x14 553 atenolol 50 mg + amlodipine 5 mg ta 554 atenolol 50 mg tab 555 atorvastain 10 mg + ezetimibe 10 mg tab 556 azithromycin +cefixime tab 1x6 557 azithromycin syp 558 azthromycin susp 100 mg 10 ml 559 azthromycin susp 200 mg 10ml 560 bandage 15 mtr 561 bandage 2x2.5 562 bandage 5mtr 563 bandaid 564 beclo+clotri+neomy 5 gm 565 beclomethason dipro 566 benzyl benzoate lotion 100 ml 567 betahistine tab 568 betamethasone lotion 569 betnameta sone tab 570 bisacodyl 5mg tab 571 boric acid 20gm 572 bromaxin dia cpm syp 573 bromhexine syp 574 buprenorphine 0.3 mg 2ml inj 575 c.p. 5 lac inj 576 calamine 100 ml lotion 577 calamine 3% diphen 1% lot 100 ml 578 calamine 50ml lotion 579 calcium + vita c inj 10 ml 580 calcium gluconate inj. 10 ml 581 cefadroxil 250 mg in 582 cefadroxil 250 mg tab 583 cefadroxil 500 mg inj 584 cefadroxil 500 mg tab 585 cefixime 50 dt tab 586 cefixime 50 mg tab 587 cefixime drops 10ml 588 ceforperazone 1gm inj 589 ceforperazone 500mg + sulbactum 590 cefotaxime 1gm inj 591 cefotaxime 500 mg inj 592 cefpodoxime proxetil 200 mg tab 593 cefpodoxime proxetil 50mg syp 594 cefpodoxime proxetil disp. 100 m 595 ceftazidime 1gm inj 596 ceftriaxone 1g+ tazobacctum 12 597 ceftriaxone 1gm +sulbact 598 ceftriaxone 250 inj 599 ceftriaxone 250 mg + sulbactm 250 600 ceftriaxone 250 mg + sulbactm 500 601 ceftriaxone 250 mg inj 602 ceftriaxone 250mg + sulbactm 125 603 ceftriaxone 500 inj 604 ceftriaxone 500 mg inj 605 cefuroxime 125 mg oral susp 606 cefuroxime axetil 250 mg 607 cefuroxime axetil 500 mg 608 cephalexin 125 mg dt tab 609 cephalexin 250 mg dt tab 610 cephalexin 250 mg tab 611 cephalexin 500 mg tab 612 cephalexin drop 10ml 613 cephalexin dry syp 614 cepodoxim 100mg tab 615 cepodoxim 200mg tab 616 cepodoxim syp 617 cetrizine + ambroxol tab 618 cetrizine + phenyl prop+ dextro s 619 cetrizine + pph+ ammo chlo + menth 620 cetrizine + pph+ammo chlo +menth 621 cetrizine hyd +pseudeph hyd +pcm 622 child tonic iron / calcium / vit 623 chiloramphenicol 1 mg inj 624 chiloramphenicol 1gm inj 625 chiloramphenicol 500mg cap 626 chiloramphenicol syp 627 chilrpheniramine 4mg + codeine 1 628 chloramphenicol 125 mg 60ml syp 629 chloramphenicol 250 mg cap 630 chlorhexidine 3% mouth wash 10 631 chloroquine phosphate 250 mg ta 632 chlorpheniramine + codein phos 633 chlorpheniramine + dextra + pcm +p 634 chlorpheniramine + pcm + phenylep 635 chlorquine 250 mg tab 636 chlorquine 500 mg tab 637 chlorquine ds tab 638 chlorquine syp 639 cinnarzine 10mg tab 640 cipro +dexa eye drop 641 cipro +flucinolane + clorti cream 642 ciprofloxacin 250mg 643 ciprofloxacin + fluocin + clotri 644 ciprofloxacin 500 + tinidanzole 500mg tab 645 ciprofloxacin iv inj 646 citicolin 500 mg tab 647 clarithromycin 250 mg tab 648 clavulanate pot + amoxycillin 649 clindamycim 1% gel 650 clobetasol 0.5 + miconazol 2 651 clobetasol pro 0.5% + miconazole 652 clotrimazol veg 653 clotrimazole + beclometh + neo 654 clotrimazole + beclomethasone + n 655 clotrimazole + fluclinolone + neom 656 clotrimazole 50 ml syp 657 clotrimazole power 658 co trimaxazole syp 659 codin + cpm + menthol 660 cotrimaxazole d.s. tab 661 cotton 500 gm 662 cotton woll 20gm 663 cpm 2.5 + ammonium chloride 125 +sod syp 664 cpm 2.5 ml + ammo+ chloride 1.25 + sod syp 665 cyprohepatidine + tricholine ci syp 666 cyproheptadine 4mg tab 667 d 1.0% 500ml 668 d 5% 1000ml inj 669 d 5% 500ml inj 670 d 25% 500ml inj 671 deca anabolin 50mg inj 672 dexamethasone + chloramphenicol 673 dexamethasone + ciprofloxacin 1 674 dexamethasone + neomycin 10ml 675 dexamethasone + neomycin 10ml 676 dexamethasone + ofloxacin 10ml 677 dexamethasone 0.5 mg tab 678 dexamethasone 5mg + phenyleph 5 679 dexamethasone phos inj 680 dextro 5ml + pheny 12.5 +cpm 2mg 681 dextromethorphan 10+ cpm+phenyl 682 dextromethorphan 5mg + pph+diphe 683 dextroproposyphen & hydroclo 684 dextroproposyphen + acetominophe 685 dextroproposyphene 65ml + para+ 686 dextropropoxiphen 65mg +pcm 325 687 diazepam 10mg tab 688 diazepam 2ml inj 689 diclofenac 50mg + serratiopeptidase 10mg tab 690 diclofenac eye drop 691 diclofenac poto 100 + pcm 500+ ser 692 diclofenic 100mg sr tab 693 dicyclomine + para 694 dicyclomine + para 695 dicyclomine 10mg 2 ml inj 696 dicyclomine drop 697 diphenhydramine 14.08+ amni 38+ x 698 diphenhydramine 25mg cap 699 disodium hydrogencitrate syp 700 dns 1000 ml 701 dns 500 ml 702 dobutamine 250 mg 5ml inj 703 domeperidone syp 704 domperidone 10+ pcm 500 mg tab 705 domperidone tab 706 doxylamine + pyridoxine + folic ac 707 electrolyte m 500 ml 708 enzymes cap 1x15 709 erythromycin +aloevera cream 710 erythromycin 250 mg 711 erythromycin 500mg tab 712 escitalopram 20mg tab 713 ethambutol 800mg tab 714 ethamsylate 250 tab 715 ethamsylate 2ml inj 716 ethamsylate 500 tab 717 etophylin + theeophylin 2ml inj 718 etophylin + theophyl in 300mg tab 719 etophyll ine 84.7mg + theoph 25.3 720 etophyllin + theophyllin tab 721 face mask 722 ferric + folicacid + cyanoco + sorbi syp 723 ferric+ folicacid tab 724 ferrous salt + folic acid syp 200 725 ferrous salt + folic acid tab 726 fluconazole 150 + azithromycin 1 727 fluconazole 50mg tab 728 fluoxetine + alprozolam tab 729 folic acid 5mg tab 730 fungal diastase 50 pcpsin 10 731 furazol idone 100 metronidazole 732 furazol idone tab 733 gabapentin 400 mg cap 734 gamabanzyl lot 735 gamabanzyl lot 736 gamma benzene hexachloride 1% 737 gatifloxacin 200mg + ornidazole 738 gauze 739 gentamicin 0.2% dexamethasone 740 gentamicin inj 2 ml 741 ginsang + multi vit 742 glucos c 100 + 200 gm 743 hacmatinic with vitamins 200ml 744 haematinic + vitamin+ folic acid cap 745 haematinic + zing cap 1x15 746 haematinic with vitamins syp 747 heparin sodium 50 i u gel 748 heparin sodium 50 i u +bengyl n 749 hydrogen peroxide 100ml 750 hydroxyprogesterone 250 inj 751 hydroxyprogesterone 500 inj 752 hyoscine butylbromide 10mg 753 hyoscine butylbromide 20mg 2 ml 754 hyoscine tab 755 ibuprofen 100 pcm 125 mg 60ml sy 756 ibuprofen 100 pcm 125 mg tab 757 ibuprofen 100 pcm 125 syp 758 ibuprofen 100 pcm 500 mg tab 759 ibuprofen 100 pcm 500 tab 1x15 760 intazyme cap 1x15 761 iron ( 111 ) hydr. poly cap 762 iron + folic acid cap ( g ) 1x15 763 iron 60ml syp 764 iron polymaltose comphfolic ac 765 isabgol 100 gm 766 iso sorbide monoitrate tab 767 isolyte p 500mg 768 isosorbide dinitrate 10mg tab 769 isosorbide mononitare 40mg ta 770 isosrbide dinitrate 5mg tab 771 ketoconazole 1% lot 772 lacobactllus tab 773 lactobacillus 60mill tab 774 lactolus tab 1x15 775 lansprazole 30mg cap 776 lefotaxime 1gm inj 777 lefotaxime 250mg inj 778 levamisole 150mg tab 779 levocetrizine + montelukast syp 780 levofloxacin 150mg 1x5 781 levofloxacin 500mg 782 levofloxacin 500mg tab 1x5 783 levonorgestrol 0.75 mg pills 784 lignocaile 30ml + adrenal in inj 785 lignocain hydroclorid 2% inj 786 lignocaine hydro 2% adrenaline 787 lincomycin 2ml inj 788 lincomycin cap 789 lisinopril 10mg tab 790 lisinopril 5mg+amlodipin 5mg 791 lithium carbonate 300mg tab 792 liver tonic 100 syp 793 loeramide 2mg tab 794 loratadine + ambroxol hci tab 795 loratadine 5mg +pseudoephedrine 796 lorazepam 1mg tab 797 lorazepam 2mg tab 798 los pot 50mg tab 799 losatan 50 + hydro 12.5 800 lycopen+vitamin tab 1x15 801 mcp inj 802 mcp tab 803 mecobalamin 500mg tab 804 mefenamic acid 500mg + diclo hyd 805 menadione sod 1 ml inj 806 meropenem 1gm inj 807 metformin+gl imepride tab 808 methycobalamine 2ml 1500mg inj 809 methyl + prednisolan tab 810 methyl cobalami tab 811 methylcobalami od tab 812 methylcobalamin alpha lip.+ro 813 methylcobalamin ivit 814 methylergometrine inj 815 methylergometrine inj 1x1 816 methylergometrine tab 817 metoclopramide inj 818 metro 100 ml 819 metronidazole + norfloxacin susp 820 metronidazole 200mg tab 821 miconazole nitrate + flucinole 822 mifepristone 200mg tab 823 minesulide + serrapep tab 824 misoprostol 200mtab 825 mosapride 5mg tab 826 mosapridecitrate 5mg tab 827 multivitamin +min+zinc cap 828 multivitamin 10ml inj 829 multivitamin 2ml inj 830 multivitamin drop 831 mvi inj ( g ) 832 nifeditine rt 20mg 833 nimesu+praa+serra tab 834 nimesulide 1% +methysalicylate oint 835 nimesulide 100mg + para 500 +ser tab 836 nimesulide 100mg +dicyclomine 2 837 nimesulide 100mg mouth diss tab 838 nimesulide 200mg tab 839 nimesulide 50+paracetamol 125m 840 nimesulide 50mg+para 125 ( neula 841 nimesulide dt 50mg tab 842 norfloxacin+tinidazole +betacyc 843 ns 500 ml 844 ofloxacin +metronidazole syp 845 ofloxacin +ornidazole syp 846 ofloxacin +tinidazole tab 847 ofloxacin inj 848 ofloxacin oral drop 849 ofloxacin syp 850 ofloxacin+dexamethasone drop 851 olanzapine 5mg tab 852 oleu 3% diclof 1.16% methyl 10 853 omeprazole 20mg cap 854 omeprazole 20mg +dom 10 mg cap 855 omeprazole 40mg tab 1x15 856 ondansetron 2ml inj 857 ondansetron 8mg tab 858 ondansetron md 4mg tab 859 ondensetron 4mg inj 860 ondensetron 8mg tab 861 ondensetron drop 862 ornidazole 500mg tab 863 ornidazole iv inj 100ml 864 ors 21.8 gm 865 ors 4 gm 866 ors powder 21gm 867 oxymethazole ine hydro nasla ors 868 oxytocin inj 869 pain kill oil 870 pantoprazole 40mg 871 pantoprazole 40mg + domperidone 30mg sr 872 pantoprazole+domp tab 873 paracetamol 100mg drop 874 paracetamol 125mg syp 875 paracetamol 2ml inj 876 paracetamol 650mg tab 877 paracetamol d / s syp 878 paracetamol+domperi ab 879 parafin 100ml 880 paralfin & milkof magnesia 881 pcm 125 mg +chlophe+sod cit+phe syp 882 pcm 450+brom 8mg +gui 100mg +cpm tab 883 pcm 500+serratio +aceclofenac tab 884 pcm 500mg tab 885 penicillin g potassium 200000 886 penicillin g potassium 400000 887 penicillin g potassium 4000000 888 penicillin g potassium 800000 889 pheniramine maleate 22.7 mg inj 890 pheniramine maleate 25mg inj 891 piracetam 400mg tab 892 piroxicam 40mg 2ml inj 893 piroxicam dt tab 894 polymer degarded gelatin 500m 895 potassium permegnate 20gm 896 povidone 250gm oint 897 povidone 500ml liq 898 prazosin 1mg tab 899 prazosin 2.5mg tab 900 prazosin 5mg tab 901 prednisolone 10mg tab 902 pregnancy test card 903 pregnency test card / kit 904 primaquine phosphate 15mg tab 905 primaquine phosphate 7.5 mg tab 906 promethazine 25mg 2ml inj 907 protine powder 20gm 908 pyra 1500 +rifa450+isonia 909 pyramethamine 25ml +sulpha 500 910 pyrazinamide 500mg 911 pyrazinamide 750 mg 912 quinine dthydrochloride inj 913 quinine sulpate 300mg tab 914 rabeprazole 20mg + dom 10mg tab 915 ranitidine 150+domperidone 10m 916 ranitidine 150mg tab 917 ranitidne 2ml inj 918 rifamicin 450 tab 919 risperidone 2mg tabroxithromyc 920 roxithromycin syp 921 roxituromycin 50mg tab 922 salbutamol 2mg +ambroxol 30mg syp 923 salbutamol tab 924 secnidazole 1gm tab 925 serratiopeptidase tab 10mg 926 sildenafil citrate 100mg tab 927 simvastatin 10mg tab 928 simvastatin 20mg tab 929 soda bi carb 25ml inj 930 sodium valaporate 200mg tab 931 sodiumbicarbonate inj 10ml 932 sparfloxacin 200mg tab 933 sparfloxin 100mg tab 934 sponge rolder 935 sterile gloves 936 streptomycin 1gm inj 937 streptomycin 2.75 inj 938 sucralfate 100ml susp 939 tadalafil 10mg tab 940 tadalafil 20mg tab 941 terbutaline sf syp 942 testosterone 250mg 1ml inj 943 tetanus toxoid inj 944 tetra cycline 250 mg cap 945 tetracycline 250mg tab 946 tobramycin & dexamethasone e / d 947 tobramycin 40mg inj 948 tobramycing 3% eye drop 949 tramadol hydrochloride inj 950 tramadol hydrochloride tab 951 uniron inj 952 urokinase 5lakh tu inj 953 vitamine b complex cap ( conci 954 vitamine e 200mg tab 955 vitamine e 400 mg tab 956 zinc sulphate 60ml syp...

Sawai Man Singh Medical College - Rajasthan

27620285 tender for medicine supply in pddu hospital jaipur 1 abciximab inj 2 aceclofenac + serratiopeptidase tab 3 acenocoumarol tab 2mg ip 4 acetaminophen 325mg+ tramadol hydrochloride 37.5 mg tab 5 acetaminophen tab 650 mg 6 acetazolamide tablets i.p 250mg 7 acetyl salicylic acid ( aspirin ) tablet i.p 325mg 8 activated charcoal suspension 9 acyclovir and hydrocortisone cream 10 acyclovir cream 5% 11 acyclovir eye ointment 12 acyclovir inj 25 / ml 13 acyclovir intravenous infusion ip 250mg 14 acyclovir intravenous infusion ip 500mg 15 acyclovir oral suspension ip 400mg / 5ml 16 adapalene +clindamycin gel 17 adapalene 0.1 % w / v ointment 18 adapalene and benzoyl peroxide gel 19 adapalene lotion 20 albuterol inhalation 21 alemtuzumab inj 22 alendronate 10 mg tab 23 alendronate 35 mg tab 24 alendronate 70 mg tab 25 alendronate tab 26 alfacalcidol soft gelatin 0.25mcg caps 27 allopurinol 300mg tab 28 alprazolam 0.25 + propranolol 40 mg tab 29 alprazolam 0.25 + sertraline 50 mg tab 30 alprazolam 0.25 mg tabs 31 alprazolam 0.5 mg tabs 32 alprazolam 1 mg tab 33 alprazolam 0.25mg, fluoxetine 20mg tab 34 alteplase inj 2 mg 35 aluminium hydroxide 250mg + mg hydroxide 250mg tabs 36 ambroxol + levocetrazin tab 37 ambroxol 15 mg / 2ml syp 38 ambroxol hcl + desloratadine syp 39 ambroxol hcl + terbutaline + guaphenasin 50 ml syp 40 ambroxol tab 41 amino acid 10% injection 100ml size 42 amino acid 5% 250ml pack inj. 43 amino acid injection 100 ml 44 amino acids + electrolytes 200 ml inj 45 amino acids + electrolytes 500 ml inj 46 aminolevulinic acid solution 47 amiodarone 200mg tab 48 amisulpride tablets i.p 50mg 49 amlodipine + atorvastatin tab 50 amlodipine + benazepril hcl tab 51 amlodipine + bisoprolol tab 52 amlodipine + olmesartan medoxomil tab 53 amlodipine + ramipril tab 54 amlodipine + valsartan tab 55 amoxy & pota. clavulana 300mg inj. 56 amoxy 250 mg + clav 50 mg ( =300 mg vial ) inj. 57 amoxycillin + clavulanate 250 mg inj. 58 amoxycillin + clavulanate 375 mg inj. 59 amoxycillin + cloxacillin 30ml syp 60 amoxycillin + dicloxacillin 250 mg cap 61 amoxycillin 125 mg + clavulanate 25 mg syp 62 amoxycillin 125mg / 5ml powder for suspension ip 63 amoxycillin 250 mg + dicloxacillin 250 mg cap 64 amoxycillin 250mg + clavulanic acid 50 mg inj. 65 amoxycillin 250mg + cloxacillin 250mg caps 66 amoxycillin 250mg with potassium clavulanate 125mg tab 67 amoxycillin 500 mg + dicloxacillin 500 mg cap 68 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 69 amphotericin b 10 mg + lyphosomal inj 70 amphotericin b 25 mg + lyphosomal inj 71 amphotericin b 50 mg + lyphosomal inj 72 amphotericin b inj ip 50 mg 73 ampi 250mg + cloxy 250 mg cap 74 ampicillin + cloxacillin cap 75 ampicillin +sulbactam 250 mg inj. 76 ampicillin 1 gm inj 77 ampicillin 250 mg inj. 78 amrinone inj 79 antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 80 anti a blood grouping serum ip ( anti a monoclonal serum ) 81 anti b blood grouping serum ip ( anti b mono clonal serum ) 82 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 83 anti human papillomavirus type 16 inj 84 anti snake venon inj polyvalent injection ( asv ) 85 anti acne gel adapalene bp…0.1 % w / w, clindamycin phosphate usp equivalent to clindamycin…1% w / w, methyl paraben ip…0.1 % w / w, phenoxyethanol bp…0.25 % w / w 86 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 87 antihemophilic factor recombinant inj 88 antihemophillic factor ix inj 89 antihemophillic factor viii inj 90 antioxidant cap 91 antitetnus human immunoglobulin injection 250mg 92 antitetnus human immunoglobulin injection 500mg 93 antithrombin inj 500 94 antithymocyte immunoglobulin ( atg ) inj 95 appetite enhancer ( peptone, minerals, vitamins ) syrup 96 application benzyl benzoate 25 % w / w lotion 97 aqueous colloidal solution of vitamin k1 inj 98 arteether 150mg inj 99 artemether + lumefantrine 20mg tab 100 artemether + lumefantrine 40mg tab 101 artemether + lumefantrine 80mg tab 102 artemether + lumefantrine tab 103 artemether tab 104 artether 50 mg tab 105 ascorbic acid tablets ip 100 mg ( vitamin c chewable tablet ip 100mg ) 106 aspirin + dipyridamole cap 107 aspirin 150 mg tab 108 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 109 aspirin enteric coated tablets i.p.75mg 110 atenolol + chlorthalidone tab 111 atenolol + hydrochlorothiazide tab 112 atorvastatin + niacin tab 113 atracurium 5 ml inj 114 atracurium inj 10 mg / ml 115 azathioprine inj 116 azithromycin 100 mg dt tab 117 aztreonam injection usp 500 mg 118 bacitracin ( neomycin / polymyxin b ) ophthalmic oint. 119 bacitracin oint. 120 bacitracin zinc 250 iu neomycin 5 mg, sulphacetamide sodium 60mg per 1gm powder 121 beclamethasone dipropionate..0.025% w / , neomycin sxulphate..0.5% w / w ( 3500 unit / g ) chlorocresol 0.1% w / w cream 122 beclomethasone 123 beclomethasone 0.025% + clotrimazole 1.0% + gentamycin 0.1% w / w cream 124 beclomethasone dipropionate + levosalbutamol inhaler 125 beclomethasone inhalation ip 200 mcg / dose 126 benzathine benzylpenicillin inj ip 12 lac units 127 benzathine benzylpenicillin inj ip 6 lac units 128 benzene hexachloride lotion 129 benzoyl peroxide 20 gm cream 130 benzyl penecillin inj 131 betamethasone 0.05% w / w + salicylic acid 3% w / w cream 132 betamethasone 0.5mg lotion 133 betamethasone dipropionate cream ip 0.05% 134 betamethasone lotion ip 0.05 o / o 135 betamethasone sod phos inj ip 4mg / ml 136 betamethasone tab ip 0.5mg 137 betamethasone valerat 0.1% w / w + neomycin sulfate 0.5% w / w cream 138 biphasic isophane insulin inj 40iu / ml ( 50:50 ) 139 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 140 biphasic isophane insulin injection i.p 100 iu / ml ( 30:70 ) ( 30% soluble insulin and 70% isophane insulin ) 141 bismuth subcitrate potassium cap 142 bisoprolol + amlodipine tan 143 bisoprolol + hydrochlorothiazide tab 144 bortezomib injection 3.5 mg 145 bosentan 125 mg tab 146 bosentan 62.5 mg tab 147 botrapase inj. 148 bromfenac sodium eye drop 0.09% 149 bromhexine + dexrometharphan + ammonium chloride + menthol syp 150 bromhexine + terbutalin + guiphenesin 100 ml syp 151 bromhexine + terbutalin + guiphenesin 50 ml syp 152 bromhexine 100 ml sol 153 bromocriptine 0.8mg tab 154 budesonide 0.5 mg / ml respule 155 budesonide 100 micro gram and formoterol fumarate 6 mg dihydrate inhaler 156 budesonide 100 micro gram inhaler 157 budesonide 200 micro gram and formoterol fumarate 6 mg dihydrate inhaler 158 budesonide 400 micro gram and formoterol fumarate 6 mg dihydrate inhaler 159 budesonide nebulizer suspension 0.25mg / ml 160 budesonide powder for inhalation 200 mcg 161 bupivacaine hydrochloride and epinephrine injection 162 buprenorphin + naloxone tab 163 buprenorphine inj. 164 butorphanol tartrate injection usp 1mg / ml 1ml size 165 cabergoline 1 mg tab 166 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 167 calcimax+p syp. 168 calcium carbonate 500mg + calcitriol 0.25mcg + zinc 7.5mg tab 169 calcium chloride injection 170 calcium dobesilate tab 171 calcium folinate 15mg tab 172 calcium folinate 50mg tab 173 calcium gluconate + vitamin d3 + cyanacobalamin 15 ml syp 174 calcium laevulinate powder 175 calcium phosphorus 200 ml syp. 176 captopril and hydrochlorothiazide tab 177 captopril tab 178 carbachol intraocular solution 179 carbamazepine 100mg tabs 180 carbamazepine 200mg tabs 181 carbamazepine 300 mg cr tabs 182 carbenicillin tab 183 carbidopa levodopa tab 184 carbidopa, levodopa and entacapone tab 185 carbimazole 10mg tab 186 carbimazole 5mg tab 187 carbonyl iron tab 188 carvedilol 25 mg tab 189 cefaclor cap 190 cefadroxil 125 mg 30 ml syp 191 cefadroxil 250mg + clavulanate 62.5mg tab 192 cefadroxil 500mg tab 193 cefadroxil 500mg+ clavulanate 125mg tab 194 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 195 cefadroxil film coated tablets ip 250mg 196 cefazolin 1gm inj 197 cefdinir 125 dt tab 198 cefdinir 300 mg tab 199 cefepime + tazobactum 2.25gm inj 200 cefepime 0.5 gm inj 201 cefepime hydrochloride 1000 mg + salbactum 500 mg inj 202 cefepime hydrochloride 500 mg + salbactum 250 mg inj 203 cefepime injection ip 500 mg 204 cefixime 100 mg + clavulanate 125 mg syp 205 cefixime 50 mg+ clavulanate 31.25 mg syp 206 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 207 cefixime tab ip 100 mg 208 cefixime tab ip 200 mg 209 cefoperazone 1gm + sulbactam 1gm inj. 210 cefoperazone 2000 gm + sulbactam 1000 mg inj 211 cefotaxime sodium 1gm + sulbactam sodium 500 mg inj. 212 cefotaxime sodium 250mg + sulbactam sodium 125 mg inj. 213 cefotaxime sodium 500mg + sulbactam sodium 250 mg inj. 214 cefoxitime 500 mg inj 215 cefpirome inj 216 cefpodoxime dispersible tab 50 mg 217 cefpodoxime proxetil dispersible 50mg tab 218 ceftazidime inj ip 500 mg 219 ceftazidine + salbactum inj 220 ceftizoxime 1gm inj. 221 ceftriaxone + sulbactam 375 mg inj 222 ceftriaxone 250mg + sulbactam 125 mg inj. 223 ceftriaxone 500 gm + tazobactum 62.50 mg inj 224 ceftriaxone 500mg + sulbactam 250 mg inj. 225 ceftriaxone inj ip 250 mg / vial 226 cefuroxime 750 mg inj 227 cefuroxime 125mg tab 228 cefuroxime 500mg + clavulanic acid 125mg ( as pot. clavulanate ) tab 229 cephalexin 100 mg tab 230 cephalexin 250 dt tab 231 cephalexin 125 mg dt tab 232 cephalexin 125mg / 5ml dry syrup 233 cephalexin 250 mg caps 234 cephalexin 500 mg caps 235 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 236 cephalexin tablets 125 mg ( dispersible tablets ) 237 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 238 cerviprine gel 239 cetirizine syp 60 ml 240 cetirizine dihydrochloride ip 5 mg, phenylephrine hydrochloride ip 10 mg, paracetamol ip 325 mg tab 241 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 242 cetrizine + ambroxol 100 ml syp 243 cetrizine + ambroxol tab 244 chloramphenicol 250 mg inj 245 chloramphenicol 500 mg inj 246 chloramphenicol + beclomethasone dipropionate + clotrimazole + lignocaine + glycerine & propylene glycol ip base gel 247 chloramphenicol 1000 inj 248 chloramphenicol eye drop 0.4 %, 5ml 249 chlordiazepoxide and clidinium bromide tab 250 chloroquine phosphate 250 mg tabs 251 chloroquine phosphate 500 mg tab 252 chloroquine phosphate syp 125 mg / 60 ml 253 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 254 chlorothiazide tab 255 chlorpheniramine maleate tab 256 chlorpheniramine maleate tab ip 4mg 257 chlorpromazine tab 258 chlorthalidone tablets 12.5mg 259 chlorzoxazone 500mg+ diclofenac 50mg + paracetamol 325mg tab 260 cholera vaccine 261 cholestyramine susp. 262 chymotrypsin + trypsin ( 1:5 ) enteric cated 120k au tab 263 cilnidipine 10mg+ metoprolol 50mg tab 264 cilnidipine 10mg+ telmisartan 40mg tab 265 cimetidine tab 266 cinnarizine + domperidonetab 267 ciprofloxacin + dexamethasone eye drop 268 ciprofloxacin + flucanazole eye drop 269 ciprofloxacin 0.3% w / v eye drop 270 ciprofloxacin 250mg + tinidazole 300 mg tabs 271 ciprofloxacin 500mg + tinidazole 600 mg tabs 272 cisatracurium besylate 2 mg / ml ; 10 ml inj 273 citalopram 10 mg tabs 274 citicoline tablets 500mg inj. 275 clarithromycin 500mg inj. 276 clidinium bromide 2.5mg + chlordiazepoxide 5mg tab 277 clindamycin 20 gm inj. 278 clindamycin 30 gm inj. 279 clindamycin 600 mg tab 280 clindamycin and benzoyl peroxide gel 281 clindamycin capsule ip 150mg 282 clindamycin hcl 150 mg caps 283 clobazam 10mg tabs 284 clobazam tablet 5mg 285 clobetasol propinate +miconazole nitrate+ ofloxacin cream 286 clobetasol propinate 10 gm cream 287 clobetasol propionate + miconazole + gentamycin cream 288 clobetasol propionate bp…0.05 % w / w, neomycin sulphate ip…0.50 % w / w., miconazole nitrate ip…2.00 % w / w, chlorocresol ip ( as preservative ) 0.10 % w / w cream / ointment 289 clobetasol propionate cream ip 0.05 o / o 290 clofazimine 100mg capsule 291 clofazimine 50 mg capsule 292 clofibrate 293 clomifene tab ip 25 mg 294 clomiphene 25mg tabs 295 clomiphene citrate 50 mg tabs 296 clomiphene tab ip 50 mg 297 clonidine 100 mcg inj. 298 clonidine inj. 299 clotrimazole + beclomethasone cream 300 clotrimazole eye drop 301 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 302 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w cream 15 gm tube 303 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w 15ml lotion 304 clotrimazole cream ip 2% w / w 305 clotrimazole vaginal tab ip 500mg 306 coagulation factor ix human 307 coagulation factor ix recombinant 308 coagulation factor viia recombinant 309 codeine phosphate tablets bp 30mg 310 codeine sulfate 311 colchicine 0.6 mg capsules 312 cold suspn.n / f ( paracetamol 125 mg+ phenylephrine hydrocloride ip 5mg + 313 colistin sulfate + neomycin + hydrocortisone suspension 314 collagenase ointment 315 colostrum powder 316 conjugated estrogens tabs 317 conjugated estrogens, medroxyprogesterone acetate tabs 318 cotrimoxazole tabs 319 cotrimoxazole oral suspension 320 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 321 cough syrup / expectorant ( 50 ) ml 322 cromolyn sodium nebulization solution 323 cyproheptadine hcl 2mg + tricholine citrate 275 mg syrup 324 cyproheptadine, hydrochloride ( anhydrous ) ip..2 mg.in a flavoured syrup base..q.s. 325 cyproterone + ethinyloestradiol coated tablets 326 cytomegalovirus immune globulin intravenous human 327 danazol 100 mg caps 328 danazol 200 mg caps 329 dantrolene sodium inj. 330 dapsone tabs 331 deferasirox 250mg tabs 332 deferoxamine inj. 333 deflazacort 1 mg tabs 334 dehydroepiandrosterone 25 mg capsule 335 demeclocycline tabs 336 desferrioxamine inj. 337 desipramine hydrochloride tabs 338 desmopressin tabs 339 dexamethasone 0.5 mg tabs 340 dextran 0 40, 500 ml 341 dextromethorphan + guiphenesin + brom + cpm 100 ml oral liquid 342 dextromethorphan + guiphenesin + brom + cpm tabs 343 dextromethorphan hbr syrup ip 13.5mg / 5ml 344 dextropropoxyphene + acetaminophen + dicyclomine 345 dextropropoxyphene + paracetamol + dicyclomine tabs 346 dextropropoxyphene + paracetamol capsule 347 dextropropoxyphene oral 348 dextrose ( 10% ) with paediatric maintenance solution 349 dextrose + fructose infusion 350 dextrose 5% + ringer lactate iv inj. 351 dextrose monohydrate powder 75g. ( glucodex 75 ) 352 dextrose normal saline 500 ml pps inj. 353 diacerein 50 mg + glucaramine tablet 354 diacerein 50 mg + glucosamine sulphate 500 mg tablet 355 diazepam 2 mg tab 356 diazepam 2 ml inj. 10mg 357 diazepam 5 mg tabs 358 diclofenac di + menthol 5%+ oleum 3% + methyl salicylate 359 diclofenac diethylamine bp 1.116% ( equivalent to diclofenac sodium 1.0%, linseed oil bp 3.0% + methyl salicylate ip 10.0%, capsiacin usp 0.025%, menthol ip 0.025%, benzyl alcohol ip 1.0% ( as preservative ) in a gel base q.s. 360 diclofenac sodium + misoprostol tablet 361 diclofenac sodium 30 ml inj. 362 dicloxacillin capsule 363 dicyclomine 10 mg tabs 364 dicyclomine 10mg + dimethicone 40mg / 5ml suspension 365 dicyclomine drop 366 dicyclomine hcl ( dicycloverine ) injection ip 10mg / ml 367 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 368 dicyclomine hydrochloride oral solution ip 10mg / 5ml 369 dicyclomine inj ip 10 mg / ml 370 dicyclomine tab ip 10 mg 371 diethylcarbamazine 50mg tab 372 digoxin 250mg ( 0.25mg ) tab 373 digoxin inj ip 0.25 mg / ml 374 digoxin inj. 375 diltiazem 30 mg tabs 376 diltiazem 60 mg tabs 377 diltiazem 90mg tab 378 dimercaprol inj. 379 diphenhydramine + ammonium chl. + sodium cit. 100 ml syrup 380 diphenhydramine + ammonium chl. + sodium cit. 50 ml syrup 381 diphenhydramine 25 mg tabs 382 diphenoxylate + atropine inj. 383 diphenoxylate tabs 384 distilled water 5ml ffs 385 disulfiram 250 mg tabs 386 disulfiram ip 500 mg tabs 387 domperidone + esomeprazole ( 30 / 40mg ) capsule 388 domperidone + paracetamol tabs 389 domperidone 10 mg tabs 390 domperidone 5 mg. / 5 ml susp 391 domperidone oral drops 10mg / ml ( 10ml ) 392 domperidone suspension ip 5mg / 5ml 393 domperidone tab ip 10 mg 394 doxofylline + montelukast tabs 395 doxylamine 20 mg. + pyridoxine 20 mg + folic acid 5mg. tab 396 doxylamine 20 mg. + pyridoxine 20 mg. tab 397 doxylamine succinate + pyridoxine + folic acid ( 10 mg + 10 mg + 2.5 mg ) tabs 398 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 399 doxylamine tabs 400 dried aluminium hydroxide 250mg + magnesium hydroxide 250mg / 5ml susp + activated dimethicone 50mg 401 drotaverine + nimesulide tabs 402 drotaverine + paracetamol tabs 403 drotaverine hcl tablets ip 40mg tabs 404 drotaverine hydrochloride inj 40 mg / 2 ml 405 drotaverine tab ip 40 mg 406 duloxetine 20mg tabs 407 duloxetine 30mg tabs 408 duloxetine 40mg tabs 409 duloxetine 60mg tabs 410 dutasteride + tamsulosin hydrochloride caps 411 dutasteride caps 412 dydrogesterone tab. i.p. 10mg 413 ear drops ( paradichlorobenzene 2%+benzocaine 2.7%+chlorbutol 5%+turpentine oil15% 414 ebastine film coated tablets 10mg 415 efavirenz 200 mg caps 416 efavirenz 600 mg + emtricitabine 200 mg + tenofovir disoproxil fumarate 300 mg tabs 417 efavirenz tablets ip 600mg 418 electrolyte g iv 500 ml ffs inj. 419 electrolyte g iv 500 ml pps inj. 420 electrolyte p iv 500 ml pps inj. 421 electrolyte m iv 500 ml pps inj. 422 elemental calcium tabs 423 elemental iron 50 mg tabs 424 enalapril + amlodipine tabs 425 enalapril maleate + felodipine tab 426 enalapril maleate + hydrochlorothiazide tab 427 enalapril maleate tablets ip 10 mg 428 enalaprilat injection 429 entecavir 1mg tabs 430 enyme syrup mix fruit flavour pepsin 7.5 mg + fungal diastase 12.5 mg / 5 ml 431 enzyme drops pepsin ( 1:3000 ) 5 mg + fungal diastase ( 1:1200 ) 33.33 mg / ml 432 ephidrine inj. 433 epinephrine hydrochloride inj. 434 eplerenone tabs 435 ergotamine tartrate + caffeine tabs 436 erythromycin 250 mg tabs 437 erythromycin 500 mg tabs 438 erythropoietin 40 k inj. 439 esomeprazole 20 mg caps 440 esomeprazole 40 mg caps 441 esomeprazole + domperidone caps 442 estradiol tabs 443 estradiol + levonorgestrel transdermal tabs 444 estradiol + norethindrone acetate tabs 445 estradiol cypionate inj. 446 estradiol transdermal system 447 estradiol vaginal ring 448 estradiol vaginal tablets 449 estradiol valerate + estradiol valerate dienogest tabs 450 estradiol valerate inj. 451 estradiol, norethindrone acetate transdermal system tabs 452 estradiol, norgestimate tabs 453 estrogens + ethinyl oestradial tabs 454 etanercept inj. 455 ethacrynic acid tabs 456 ethambutol 800mg tab 457 ethamsylate tabs 458 ethamsylate b.p 250 mg. inj. 459 ethamsylate b.p 500 mg. inj. 460 ethamsylate inj 250 mg / 2ml ( im / iv ) 461 ethinyl estradiol tabs 462 ethinyl estradiol + ethynodiol diacetate tabs 463 ethinyloestradiol tabs ip 50 mcg 464 etizolam tablet 0.5mg 465 etophylline + theophylline 150 mg srtabs 466 etophylline + theophylline 2 ml inj. 467 etophylline + theophylline 300 mg sr tabs 468 etophylline + theophylline 300 mg tabs 469 etophylline ip 115mg + theophylline 35mg tablet 470 evening primrose oil 471 everolimus tabs 472 ezetimibe + simvastatin tabs 473 ezetimibe 10mg tabs 474 fabrazyme inj. 475 factor vlll sdh 1000 iu inj. 476 factor vlll sdh 250 iu inj. 477 factor vlll sdh 500 iu inj. 478 famotidine 20 mg tabs 479 famotidine 40 mg tabs 480 faropenem sodium 200 mg tabs 481 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 482 felodipine tabs 483 fenofibrate 145 mg tabs 484 fentanyl citrate inj. 485 fentanyl citrate injection 50mcg / ml 486 fentanyl citrate injection ip 2 ml 487 fentanyl skin patches 488 feracrylam 1% 100ml solution 489 feracrylam 1% 50ml solution 490 feracrylam 3% 100ml solution 491 feracrylam 3% 50ml solution 492 feracrylam gell 30 gm 493 feracrylam gell 50 gm 494 feracrylum 1% w / v sterile solution 100 ml 495 ferric carboxymaltose 1000 mg. ( inj. ) ( brand name ferium 1k ) 496 ferrous ammonium citrate 160mg + cyano cobalamine 7.5mcg+folic acid 0.5mg / 15ml syrup 497 ferrous salt + folic acid+ cyanocobalamin tabs 498 ferrous sucrose inj. 499 ferrous sulfate – iron tabs 500 fexofenadine 60ml syp 501 fibrinogen concentrate ( human ) solution 502 filgrastim 300mcg / 1ml prefilled syringe 503 finasteride 1 mg tabs 504 flubiprofen sodium eye drop 505 flucona zole 100 ml inj. 506 fluconazole 0 .5 % 15gm cream 507 fluconazole + azithromycin + ornidazole kit 508 fluconazole 10 mg / ml inj. 509 flucticasone propionate 50mcg per puff nasal spray 510 flucticasone propionate respule 0.5mg / 2ml 511 fludrocortisone tabs 512 flumazenil tabs 513 flunarizine tab 5 mg 514 flunarzine 10mg tabs 515 flunarzine 5mg tabs 516 fluoxetine + alprazolam tabs 517 fluoxetine hydrochloride 20 mg caps 518 flurbiprofen sodium eye drop 519 fluticasone propionate and salmeterol nasal spray 520 fluticasone propionate nasal spray 521 fondaparinux sodium prefilled syringe 522 formoterol caps 523 formoterol fumarate + budesonide caps 524 formoterol fumarate 6 mcg + futicasone caps 525 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 526 fosinopril 600 mg tabs 527 fosinopril sodium + hydrochlorothiazide tabs 528 fosphenytoin 75 mg / 10ml inj. 529 fosphenytoin 75 mg / 2ml inj. 530 framycetin sulphate cream 1 o / o 100 gm pack 531 framycetin sulphate cream 1 o / o 30gm pack 532 fungal diastase + pepsin 100 ml syp 533 fungal diastase + pepsin 200 ml syp 534 furazolidone + metronidazole + dicyclomine syp 535 furazolidone + metronidazole syp 536 furazolidone 100 mg tabs 537 fusidic acid + beclomethasone dipropionate cream 538 fusidic acid 2 % w / v cream 539 fusidic acid cream ip 2% 540 gabapentin 100 mg tabs 541 gabapentin 400 mg tabs 542 gabapentin 600 mg tabs 543 gabapentin 800 mg tabs 544 gabapentin+nortriptyline ( 400 / 10mg ) tablets 545 ganciclovir 500 mg inj. 546 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) 547 gatifloxacin ophthalmic solution, 548 gemfibrozil tabs 549 gemifloxacin mesylate 320 mg tabs 550 genevac b 10mg ( 10 ml vial ) inj. 551 gentamicin + dexamethasone inj. 552 gentamicin + prednisolone acetate inj. 553 gentamicin 10ml inj. 554 gentamicin 20ml inj. 555 gentamicin 30ml inj 556 gentamicin eye drop 557 gentamycin injection ip 80mg / 2ml ( im / iv use ) 558 gentamycin sulphate 80 mg / 2ml inj. 559 ginkgo biloba capsule 560 ginseng extract 42.5 mg, vitamin a 2500 iu, vitamin b1 1 mg, vitamin b2 1.5 mg, vitamin b6 1 mg, vitamin b12 1 mcg, vitamin c 50 mg, vitamin e 5 mg, vitamin d 200 iu, nicotinamide 10 mg, carbohydrates 0.1 g, folic acid 0.15 mg, ferrous fumarate 30 mg, copper 0.5 mg, potassium sulphate 2 mg, manganese 0.5 mg, magnesium sulphate 3 mg, zinc oxide 10 mg, calcium 75 mg, phosphate 58 mg, iodine 0.1 mg, protein 0.2 g, fat 0.38 g inj. 561 glargine 100 iu / ml inj 562 glibenclamide + metformin + rosiglitazone tabs 563 glibenclamide 2.5 mg tabs ( scored oval ) 564 glibenclamide 5 mg tabs ( scored oval ) 565 glibenclamide 5mg + metforminhcl 500mg tab 566 glibenclamide tab ip 5 mg 567 gliclazide + metformin hcl tabs 568 gliclazide 40 mg tabs 569 gliclazide 60mg tab 570 gliclazide 80 mg tabs 571 gliclazide 80mg + metformin hydrochloride 500mg tab 572 gliclazide tab ip 40 mg 573 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 574 glimipride 3mg tab 575 glimipride 4mg tab 576 glimperide 2mg + metformnin hydrochloride 500mg tab 577 glipizide 10 mg tabs 578 glipizide 2.5 mg tabs 579 glipizide 5 mg tabs 580 glipizide 5mg + metformin hydrochloride 500mg tab 581 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 582 glipizide tab ip 5mg 583 glucagon 1 mg / vail inj. 584 glucosamine powder 585 glucosamine sulphate + chondroitin powder 586 glyburide + metformin tab 587 glyburide tab 588 glycerin ip 100 ml 589 glycerin ip 400 gm 590 glycerin ip 98%w / w liquid 591 glycerine 100 ml 592 glycerine 3000 ml 593 glycerine 400 ml 594 glyceryl trinitrate injection 595 gnrh analogue inj 596 gns 0.45% 100 ml iv 597 gns 0.45% 500 ml iv 598 gns 0.90% 500 ml iv 599 granisetron 1 mg tab 600 granisetron 3 mg tab 601 griseofulvin tab ip 125 mg 602 guaifenesin 100mg + terbutaline 2.5mg + bromhexine 8mg / 10ml syrup 603 h. pylori kit 1x 6 604 haemaccel 500 ml inj. 605 halobetasol propionate cream 606 haloperidol 5ml inj 607 halothane 250 ml inj 608 halothane bp 609 hamycin suspension 610 hemin injection 611 heparin + benzyl nicotinate 20 gm powder 612 hepatitis b immunoglobulin 100 iu inj. 613 hepatitis b immunoglubin for intravenous 2000 iu 40ml inj. 614 hepatitis b immunoglubin 200 iu 1ml inj. 615 homatropine eye drop 616 human anti d immunoglobulin inj 300 mcg 617 human immune globulin subcutaneous inj 618 human milk fortifier ( hmf sachets ) 619 hyaluronidase inj 620 hydralazine + hydrochlorothiazide tab 621 hydralazine tab 622 hydrochlorothiazide + triamterene tab 623 hydrocortisone, neomycin, polymyxin b 5gm susp. 624 hydrogen peroxide 100 ml liquid 625 hydrogen peroxide 400 ml liquid 626 hydroquinone 2% + mometasone 0.1% + tretinoin 0.025 % cream 627 hydroquinone 2% cream 628 hydroquinone 2.0% w / w + tretinoin 0.025% w / w + mometasone furoate 0.1% w / w in a cream base q.s cream 629 hydroxychloroquine 400 mg tab 630 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 631 hydroxyethyl starch in sodium chloride injection 3 % 632 hydroxyethyl starch in sodium chloride injection 6 % 633 hydroxyprogesterone 250 mg inj 634 hydroxyprogesterone inj ip 250mg / ml 635 hydroxyurea 500mg cap 636 hyoscine butylbromide + paracetamol tab 637 hypertonic saline ophthalmic solution 638 hypromellose ( isopto tears ) ophthalmic solution 639 i v i g inj. 640 ibuprofen 400 mg tab 641 ibuprofen + paracetamol + caffeine tab 642 ibuprofen 400mg + paracetamol 325 mg tab 643 ibuprofen 600 mg tab 644 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 645 ibuprofen film coated tablets ip 200mg 646 ibuprofen oral suspension bp / usp 100 mg / 5 ml 647 ibuprofen tab ip 200 mg ( coated ) 648 ibuprofen tab ip 400 mg ( coated ) 649 ibutilide fumarate inj 650 imipenem + cilastatin injection 500mg / 500mg ip powder for solution 651 imipenem 250 mg + cilastatin 250 mg inj 652 imipramine 25 mg tab 653 imipramine 75 mg tab 654 imipramine + diazepam tab 655 immune globulin intravenous infusion 5 mg 100 ml 656 indapamide 1.5mg tab 657 indomethacin 1 mg inj. 658 indomethacin 25 mg cap 659 indomethacin cap ip 25 mg 660 indomethacin inj. 661 infant milk formula lactogen & nanpro 1 400mg 662 infliximab inj 663 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 664 inj. pilocarpine 665 inj. trypham. blue ( dyc ) 666 insulin 30 / 70 ( human mistard ) inj 667 insulin aspart inj 668 insulin detemir inj 669 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 670 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 671 insulin glargine inj 672 insulin injection ( human ) ( 40iu / ml ) 673 insulin lispro inj 674 intravenous fat emulsion infusion 675 iohexol solution 300mg. 676 ipratropium 20mcg + levosalbutamol 50 mcg inhaler 677 ipratropium 20mcg, inhaler 678 ipratropium 500mcg + levosalbutamol 1.25mg / 2.5 ml neb. 679 ipratropium bromide + albuterol sulfate neb. 680 ipratropium bromide inhalation 681 ipratropium bromide nasal spray 682 ipratropium bromide nebulizer solution 250 mcg / ml 683 ipratropium powder for inhalation ip 40 mcg 684 iron & zinc tab ( carbonyl iron 50 mg+ zinc sulphate monohydrate usp 61.8 mg equivalent to elemental zinc 22.5 mg + folic acid ip 0.5mg ) 685 iron + folic acid + vitamin b12 tab 686 iron + folic acid syrup 687 iron dextran inj 688 iron polymaltose complex + folic acid tab 689 iron sorbitol inj 690 iron sucrose 2 ml inj 691 isabgol husk powder 692 isoflurane 250mg inj 693 isoflurane usp 694 isolyte p 500 ml 10% inj 695 isoniazid inj 696 isoprenaline inj 697 isoprenaline injection ip 2mg / ml 698 isosorbide dinitrate 10 mg tabs 699 isosorbide dinitrate 5mg tab 700 isosorbide dinitrate tab ip 5 mg 701 isosorbide mononitrate tabs ip 20 mg 702 isotretinoin cap 20 mg 703 isoxsuprine inj 704 isoxsuprine inj ip 5 mg / ml 705 isoxsuprine tab 10 mg 706 isoxsuprine tab ip 20 mg 707 itopride 20 mg tab 708 itopride 10 mg tab 709 itopride 50mg tab 710 itraconazole 200 mg cap 711 ivermectin + albendazole tab 712 ivermectin 6 mg tab 713 kabilyte 500 ml bottle ( balance fluid replenishment ) 714 kanamycin inj 75 mg / 2 ml 715 ketamine hydrochloride +amitriptyline 15gm inj 716 ketamine hydrochloride 10 ml inj 717 ketamine hydrochloride 2 ml inj 718 ketamine inj ip 50 mg / ml 719 ketoconazole soap 720 ketoconazole 200mg tab 721 ketotifen ophthalmic solution 722 kit of mifepristone 200mg ( 1 tab ) + misoprostol 200mcg ( 4 tabs ) 723 lactated ringers and 5% dextrose injection ffs 724 lactated ringers and 5% dextrose injection pps 725 lactic acid + nicotinamide + folic acid oral susp. 726 lactitol sachet 727 lactose face furmula milk sol 728 lactulose enema 250 ml oral sol. 729 lamivudine + nevirapine + stavudine tab 730 lamivudine + stavudine tab 731 lamivudine + zidovudine + nevirapine tab 732 lamivudine 100 mg tab 733 lamivudine 150 mg + zidovudine 300 mg tab 734 lanreotide inj 735 lansoprazole 15 mg inj 736 lansoprazole 30 mg inj 737 lansoprazole + amoxicillin + clarithromycin cap 738 laxative suspension liqid paraffin 3.75ml+milk of magnesia 11.25ml ) 739 lbw formula milk 740 leflunomide tablets ip 10mg ( film coated ) 741 lenalidomide capsules 10mg 742 leucovorin calcium 15 mg tab 743 leucovorin calcium 50 mg tab 744 levamisole adult 745 levamisole paed 746 levocarnitine 250 mg 747 levocetirizine 30 ml inj 748 levocetirizine 60 ml inj 749 levocetrizine hcl 5mg, phenylephrine hcl 5mg, ambroxol hcl 30mg, paracetamol 325mg tab 750 levodopa + carbidopa + entacapone tab 751 levodopa and carbidopa tab 752 levodopa tab 753 levodropropizine oral susp 754 levofloxacin 750 mg tab 755 levoleucovorin inj 756 levonorgestrel + ethinyl estradiol tab 757 levonorgestrel tab 758 levosalbutamol + ipratopium neb 759 levosalbutamol 100ml syp 760 levosalbutamol 1mg tab 761 levosalbutamol 2mg tab 762 levosulpiride 50 mg tab 763 levosulpiride 75mg + esomeprazole 40mg caps 764 levosulpiride 75mg + pantoprazole 40mg caps 765 levosulpiride tablets 25mg 766 levosulpiride ( sr ) 75mg + rabeprazole ( ec ) 20mg caps 767 levo thyroxine sodium 100mcg tab 768 levo thyroxine tablets ip 50 mcg ip 769 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg 770 lignocaine heavy 5% inj 771 lignocaine inj ip 2 o / o 772 lignocaine ointment 5 o / o 773 lincomycin 2 mg tab 774 lincomycin 2 ml inj 775 linezolid 100 mg tab 776 linezolid 300 mg tab 777 lipid complex inj. 778 liposomal amphotericin b inj. 779 liposomol amphotericine b injection 10 mg 780 liquid medical oxygen ( lmo ) 781 liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg / 5ml emulsion sol 782 lisinopril 2.5 mg tab 783 lisinopril + amlodipine ( 5 mg + 5mg ) tabs 784 lisinopril + hydrochlorothiazide tab 785 lisinopril 5mg tabs 786 lisinopril tab ip 2.5 mg 787 lisinopril tab ip 5 mg 788 lisinopril tablets ip 10 mg 789 lithium carbonate tab 790 l methylfolate calcium 7.5mg tablet 791 loperamide tab 792 loperamide tab ip 2 mg 793 loratadine + ambroxol tab 794 loratadine + pseudoephedrine tab 795 loratidine 10mg tab 796 lorazepam 0.5 mg tab 797 lorazepam 0 .25 mg tab 798 lorazepam tablets ip 1mg 799 lorazepam tablets ip 2mg 800 losartan 50mg + amlodipine 5mg tab 801 losartan tab ip 25 mg 802 lotion betamethasone 0.05% 803 low lactose formula nanlolac 200mg 804 lumafantrine + artesunate tab 805 lumefantrine tab 806 lycopene antioxidant + multi vitamin cap 807 lymphocyte immune globulin inj 808 magaldrate + simethicone + oxetacaine syp 809 magaldrate 400 mg + simethiocone 20 mg syp 810 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 811 mannitol ( 10% ) with glycerin inj 812 mannitol + glycerine iv inj 813 measles, mumps, and rubella ( mmr ) vaccine inj 814 meclizine tab 815 mecobalamin 10 ml inj 816 mecobalamin 1500 mcg tab 817 mecobalamin + lipoic acid + folic acid + pyridoxine tab / cap 818 mecobalamin + pregabalin cap 819 mecobalamin + thiamine + pyridoxine + l0lysine + d 0 panthenol tab / cap 820 medium chain triglyceride ( mct oil ) 50 ml 821 medroxyprogesterone 10 mg tab 822 mefenamic acid 250 mg tab 823 mefenamic acid 500 mg tab 824 mefenamic acid + dicyclomine tab 825 mefenamic acid 500mg + paracetamol 325mg tab 826 mefenamic acid 50mg, paracetamol 125mg / 5ml suspension 827 mefenamic acid suspension 100mg / 5ml 828 mefenamic acid tablets bp 500 mg 829 mefloquine + artesunate tab 830 mefloquine tab 831 melatonin supplement 832 melphalan inj 833 metformin sr tablets ip 850mg 834 methacholine chloride inj 835 methamphetamine hydrochloride tab 836 methlprednisolone iv inj. 837 methotrexate 1 gm inj 838 methotrexate 15 gm inj 839 methotrexate 500mg inj 840 methoxsalen inj 841 methyl ergometrine 0.125mg tabs 842 methylcobalamin + nicotinamide tab 843 methylcobalamin 500 mcg + vitamin tab 844 methylcobalamin + pyridoxine + folic acid tab 845 methylcobalamin 200 ml bottle syp 846 methylcobalamin 5 ml / 500 mg syp 847 methyldopa 250 mg cap 848 methyldopa + hydrochlorothiazide cap 849 methyldopa tab ip 250mg film coated 850 methylphenidate hydrochloride tab 851 methylprednisolone 4 mg tab 852 methylprednisolone 8 mg tab 853 methylprednisolone 16 mg tab 854 metoclopramide hydrochloride syrup ip 5 mg / 5ml 855 metoclopramide inj ip 10mg / 2ml 856 metoclopramide injections ip 5mg / ml 857 metoclopramide tab ip 10 mg 858 metolazone tab 859 metoprolol 100mg tab 860 metoprolol 50mg + amlodipine 5mg tab 861 metoprolol succinate extended release tablets ip 50 mg 862 metoprolol tablets ip 25 mg 863 metoprolol tartrate and hydochlorothiazide tab 864 metronidazole 400 mg tabs 865 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 866 metronidazole film coated tablets ip 200mg 867 metronidazole tablets ip 200 mg ( film coated ) 868 metronidazole tablets ip 400 mg ( film coated ) 869 miconazole + flucinolone 15gm cream 870 midodrine hydrochloride tab 871 mifepristone 200 mg tabs 872 mifepristone tab ip 200mg 873 miglitol 25 mg tab 874 miglitol 50 mg tab 875 milk formula for lbw 100ml 876 milk formula for lbw 340ml 877 milrinone inj 878 minocycline hydrochloride cap 879 minoxidil 10% topical solution 880 minoxidil 2% topical solution 881 mirabegron er 50 mg. tablets 882 mirtazapine 30mg tab 883 mirtazapine 7.5mg tab 884 misoprostol 200mcg film coated tabs 885 misoprostol tab ip 200 mcg 886 mometasone + nadifloxacin + miconazole cream 887 mometasone furoate + hydroquinone + tretinoin 15gm cream 888 montelukast 4 mg tab 889 morphine sulfate + naltrexone hydrochloride inj 890 morphine sulfate inj 891 morphine sulphate inj ip 10mg / ml 892 mosapride sol. 893 mouth ulcer gel ( choline salicylate sodium 9% w / v, benzalkonium chloride 0.01% w / w ) 894 moxifloxacin 400mg tab 895 moxifloxacin hcl+ dexamethasone + benzalkonium chloride solution 0.02% v / v sterile opthelmic sol 896 moxifloxacin inj 897 mucodilator expectorant terbutaline sulphate 1.25 mg, bromhexine 4 mg, guaiphenesin 50 mg, menthol 2.5 mg per 5 ml syp 898 multiple electrolytes & dextrose inj. 10% 500ml i.v. bottle ( e.g.: isolyte p rorte 10% ) 899 multiple electrolytes and dextrose injection ffs 900 multistix plt. 901 multivitamin syp 902 multivitamins ( b complex ) tab 903 mupirocin ointment 2% w / w 904 n acetyl cysteine neb. 905 nalidixic acid oral syp 906 naloxone inj 907 naltrexone tab 908 nandrolone decanoate 25mg / ml inj 909 naproxen 275 mg tab 910 naproxen 550 mg tab 911 naproxen + esomeprazole magnesium tab 912 naproxen tablet ip 250mg 913 naproxen tablet ip 500mg 914 naratriptan tab 915 nateglinide tab 916 nebivolol 2.5 mg tab 917 nebivolol 5 mg tab 918 nebivolol + amlodipine tab 919 nebivolol + valsartan tab 920 nebivolol 5 mg, hydrochlorothiazide 12.5 mg tab. 921 nebivolol tablets ip 10mg 922 neomycin 0.5% +fluocinalone0.025%+clotrimazole 1% 15gm cream 923 neomycin and dexamethasone ophthalmic ointment 924 neomycin and polymyxin b sulfates and hydrocortisone otic solution 925 neomycin and polymyxin b sulfates, bacitracin zinc, and hydrocortisone oint 5 gm 926 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 927 neomycin powder 928 neomycin, polymyxin and bacitracin zinc ophthalmic ointment 20 gm 929 neomycin, polymyxin and bacitracin zinc ophthalmic powder 10gm oint 930 neomycin, polymyxin b and dexamethasone ophthalmic otic solution 931 neomycin, polymyxin b and hydrocortisone 5gm oint 932 neomycin, sulphacetamide sodium, bacitracin zinc powder 933 neostigmine 1 ml inj 934 neostigmine 5 ml inj 935 neostigmine tab ip 15 mg 936 nepafenac 0.1% w / v eye drop 937 nesiritide inj 938 netilmicin 10 mg inj 939 netilmicin 20 mg inj 940 netilmicin 25 mg inj 941 netilmicin 50 mg inj 942 nevirapine 200 mg tab 943 niacin + lovastatin tab 944 niacin tab 945 nicardipine hydrochloride infusion solution 20mg / 200ml 946 nicorandil 10mg tab 947 nicorandil 5 mg tab 948 nicotine gum 949 nicotine inhalation system inhaler 950 nicotine nasal spray 951 nifedipine 10mg cap 952 nifedipine cap ip 5mg 953 nifedipine prolonged release 20mg tab 954 nifedipine tablets ip 10 mg ( sustained release ) 955 nimesulide + dicyclomine tab 956 nimesulide + paracetamol + chlorozoxone tab 957 nimesulide + pcm+ cet+pph+caffine tab 958 nimesulide + serratiopeptidase tab 959 nimesulide + tizanidine tab 960 nimesulide 1% w / w gel 961 nimesulide 100 mg tab 962 nimodipine cap 963 nitroglycerin 2.6 mg tab 964 nitroglycerin ointment 965 nitroprusside sodium inj 966 norepinephrine bitartrate inj 967 norethindrone acetate and ethinyl estradiol tab 968 norethisterone 5mg tab 969 norethisterone tab ip 5 mg 970 norfloxacin 400 mg tab 971 norfloxacin + metronidazole 30 ml tab 972 norfloxacin 400mg + tinidazole 600 mg tabs 973 norfloxacin tab ip 400mg film coated 974 norgestimate and ethinyl estradiol tablets 975 nortriptyline tablet 25mg tablet 976 octreotide injection 50 mcg / ml 977 ofloxacin 100 mg tab 978 ofloxacin 50mg tab 979 ofloxacin + dexamethasone infusion 980 ofloxacin + metronidazole infusion 981 ofloxacin + tinidazole infusion 982 ofloxacin 200mg+ornidazole500mg infusion 983 ofloxacin eye drops 0.3%w / v 984 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 985 ofloxacin oral suspension ip 50mg / 5ml 986 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 987 oitment mupirocin ip 2% 988 olanzapine and fluoxetine cap 989 olanzapine tablets i.p 10mg 990 olanzapine tablets i.p 5mg 991 olmesartan 20mg + amlodipine 5mg tab 992 olmesartan medoxomil 20 mg+ hydrochlorothiazide 12.5 mg tab 993 olmesartan medoxomil 40mg + hydroclorthiazide 12.5mg tab 994 olmesartan tablets 20mg 995 olmesatan medoxomil & metoproloi succinate er tablet 25 mg 996 olmesatan medoxomil tablet 20 mg 997 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 998 olopattadine eye drops 999 omalizumab inj 1000 omega 3 acid ethyl esters cap 1001 omeprazole 40 mg cap 1002 ondansetron 10 ml inj 1003 ondansetron 4 mg tabs 1004 ondansetron oral solution i.p 2 mg / 5ml 1005 ondansetron orally disintegrating tablets ip 4mg 1006 oral rehydration salts citrate ip 21 gm ( who formula ) sachet 1007 orciprenaline syp 1008 orlistat 120 mg cap 1009 orlistat 60 mg cap 1010 ornidazole 500 mg tabs 1011 ors powder 21.2 gm 1012 ors powder 4.21 gm 1013 oseltamivir 75 mg cap 1014 oxaliplatin 100 mg inj 1015 oxaliplatin injections 50mg 1016 oxazepam cap 1017 oxcarbazepine 150 mg tab 1018 oxcarbazepine tablets i.p 300mg 1019 oxetacaine 10mg + aluminium 0.291mg + magnesium 98mg / 5ml gel 1020 oxymetazoline 0.5mg / ml nasal drops 1021 paclitaxel 30 mg vial inj 1022 pamidronate inj 1023 pancreatin 150 mg tab 1024 pancrelipase delayed release cap 1025 pancuronium bromide inj 1026 pantoprazole 40mg + itopride 150mg s.r. tab 1027 paracetamol 100 ml ffs infusion 1028 paracetamol 125mg+ cpm 1 mg + sodium citrate 60mg in a flavour syrup base 1029 paracetamol 325mg + diclofenac sodium 50 mg tab 1030 paracetamol 325mg + tramadol 37.5mg tab 1031 paracetamol 500mg + phenylephrine 10mg + chlorpheniramine 2mg tab 1032 paracetamol 500mg tab 1033 paracetamol ds syrup / 250 mg 1034 paracetamol infusion ip 1% w / v 100ml size 1035 paracetamol ip 125mg, promethazine hcl 5mg suspension 1036 paracetamol ip…125 mg., mefanamic acid ip…50 mg., in a flavoured syrup base…q.s. 1037 paracetamol tab ip 500 mg 1038 paracetomal 650mg tab 1039 paroxetine 12.5 mg tab 1040 paroxetine 25 mg tab 1041 paroxetine 37.5 mg tab 1042 pefloxacin tab 1043 peg ( alprastadil ) ( prostaglandin e1 500 mcg inj. 1044 penicillamine cap 1045 penicillin g benzathine and penicillin g procaine inj 1046 penicillin g potassium inj 1047 penicillin g potassium or sodium injection 1048 penicillin procaine inj 1049 penicillin v potassium oral syp 1050 pentamidine isethionate inj 1051 pentazocine + acetaminophen tab 1052 pentazocine + aspirin tab 1053 pentazocine + naloxone tab 1054 pentazocine inj ip 30mg / ml ( im / iv use ) 1055 pentobarbital inj 1056 pentoxifylline inj 1057 pepsin 10mg + diastase 50mg oral liquid / 5 ml 1058 perindopril + indapamide tab 1059 perindopril 4 mg tab 1060 pheniramine inj ip 22.75mg / ml 1061 pheniramine maleate 25 mg tabs 1062 pheniramine maleate i.p. 22.75mg, methyl paraben ( as preservative ) i.p. 0.135% w / v, propyl paraben ( as preservative ) i.p. 0.015% w / v, water for injection i.p. q.s. inj 1063 phenobarbitone 60 mg tab 1064 phenobarbitone inj 1065 phenobarbitone tablets i.p 30mg 1066 phenoxybenzamine cap 1067 phentermine cap 1068 phentolamine mesylate inj 1069 phenylbutazone cap 1070 phenylephrine inj 1071 phenylephrine hydrochloride 5.00mg chlorpheniranmine maleate 2.00mg eye drops 1072 phenytoin 200 ml inj 1073 phenytoin 50 mg tab 1074 phenytoin 50 mg / ml, 2 ml inj 1075 phenytoin sodium 100 mg tabs 1076 physostigmine inj. 1077 pilocarpine tab 1078 pimecrolimus cream 1079 pioglitazone 7.5 mg tab 1080 pioglitazone 15 mg tabs 1081 pioglitazone 15 mg tabs + metformin 500mg tab 1082 pioglitazone hydrochloride + glimepiride tab 1083 piperacillin sodium inj 1084 piracetam 100ml inj 1085 piracetam 200ml inj 1086 piracetam 800mg tab 1087 piracetam syrup 500mg / 5ml 1088 piroxicam cap 1089 piroxicam 20 mg tablets 1090 piroxicam 20 mg with bezyl alcohol injection 1091 piroxicam 20mg caps 1092 piroxicam 40 mg with bezyl alcohol injection 1093 polyvitamin ( prophylactic ) nfi tabs 1094 potassium chloride 200 ml inj 1095 potassium nitrate + sodium fluoride mouthwash 1096 povidone iodine + metronidazole 15 gm tube 1097 povidone iodine 500 gm 1098 povidone vaginal cream 1099 powder clotrimazole 1% w / w 30 gm 1100 pralidoxime chloride ( pam ) inj 1101 praziquantel tab 1102 prazosin 5mg tab 1103 pre biotic sachet ( 1 gm sachet ) 1104 pre probiotics sachet 1105 prednisolone tab ip 20 mg 1106 prednisolone tablet ip 10 mg 1107 prednisolone tablets ip 5 mg 1108 prednisolone, neomycin and polymyxin b ophthalmic suspension 1109 pregabalin + methylcobalamine + alphalipoic acid + folic acid + pyridoxine cap 1110 pregabalin capsules 75mg 1111 preterm / l.b.w. formula milk powder ( packaging 400 gm ) 1112 primaquine 15 mg tabs 1113 primaquine tab ip 2.5 mg 1114 primaquine tab ip 7.5 mg 1115 prochlorperazine 5 mg tabs 1116 prochlorperazine maleate tablets i.p 5mg 1117 prochlorperazine mesylate injection 12.5mg / ml 5ml size 1118 progesterone 100 mg cap 1119 progesterone 200 mg 1 ml inj 1120 progesterone inj 200 mg / 2ml 1121 promethazine + pcm tab 1122 promethazine ( 5 mg / 5ml ) syrup 1123 promethazine 25mg tab 1124 promethazine hcl + dextromethorphan hydrobromide syp 1125 promethazine hcl + phenylephrine hcl syrup 1126 promethazine inj ip 25mg / ml 1127 promethazine syrup ip 5 mg / 5ml 1128 promethazine tab ip 25 mg 1129 propoxyphene tab 1130 propoxyphene napsylate and acetaminophen cap 1131 propoxyphene, aspirin, and caffeine tab 1132 propranolol hydrochloride + hydrochlorothiazide tab 1133 propranolol tab ip 40 mg 1134 propranolol tablets ip 10mg 1135 protamine sulphate iv solution 1136 protein supplement 1137 psoralen inj 1138 pyrantal pamoate tab 1139 pyrazinamide 750 mg tab 1140 pyrazinamide tablets i.p 1000mg 1141 pyridostigmine inj 1142 pyridoxine 40 mg tab 1143 pyridoxine + folic acid sustained release tab 1144 quetiapine fumarate tablets i.p 200mg 1145 quinine 300 mg / 2ml inj 1146 quinine sulphate 300mg tab 1147 rabeprazole 20 mg tabs 1148 rabeprazole 20mg + domperidone 10mg cap 1149 rabies immune globulin ( human ) inj 1150 racecadotril 10 mg tab 1151 racecadotril 100 mg tab 1152 racecadotril 30 mg tab 1153 racecadotril sachet 1 gm 1154 ramipril 10 mg tab 1155 ramipril + telmisartan tab 1156 ramipril 2.5 mg tabs 1157 ramipril 5 mg tabs 1158 ramipril 5mg + hydroclorthiazide 12.5mg tab 1159 ranitidine + domperidone tab 1160 ranitidine hcl. 150 mg tabs 1161 ranitidine hcl. 300 mg tabs 1162 ranolazine tab 1163 rattle snake antivenin polyvalent inj 1164 ravlon solution ( chlorhexidine + cetramide ) ( 1.5 % w / v + 3% w / v ) solution 1165 recombinant hpv bivalent vaccine inj 1166 recombinant hpv quadrivalent vaccine inj 1167 recombinant interferon inj 1168 rectified spirit 1169 repaglinide tab 1170 repaglinide + metformin hcl tab 1171 resp. levosalbutamol 2.5ml for 5 resp. 1172 reteplase inj 1173 rho ( d ) immune globulin human inj 1174 ribavirin tab 1175 ribavirin, interferon alfa 2b, recombinant inj 1176 rifabutin oral solution 1177 rifampicin 150 mg tab 1178 rifampicin 300 mg tab 1179 rifampicin 450 mg tab 1180 rifampicin 600 mg tab 1181 rifampicin and isoniazide tablets ip ( 450 mg+300 mg ) 1182 rifampin + isoniazid + ethambutol tab 1183 rifampin + isoniazid + pyrazinamide kid tab 1184 rifapentine tab 1185 ringer lactate iv 500 ml glass inj 1186 ringer lactate iv 500 ml pps inj 1187 risperidone 1 mg tab 1188 risperidone 3mg tab 1189 risperidone tablets 4mg 1190 ritodrine tab 1191 ritonavir 100 mg tab 1192 rituximab inj 1193 rivastigmine cap 1194 rizatriptan wafer 10 mg cap 1195 rocuronium 50 mg inj 1196 rofecoxib tab 1197 rosiglitazone maleate + glimepiride tab 1198 rosiglitazone maleate + metformin hcl tab 1199 rosiglitazone maleate tab 1200 rosuvastatin 10mg + asprin 75mg tab 1201 rosuvastatin 40mg tab 1202 rosuvastatin 10mg + fenofibrates 160mg tab 1203 rosuvastatin 20mg tab 1204 rosuvastatin tablet 10 mg 1205 rosuvastatin tablet i.p 5mg 1206 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 1207 roxithromycin 50 mg tab 1208 roxithromycin ( 50 mg / 5ml ) susp. 1209 roxithromycin + ambroxol tab 1210 roxithromycin 150 mg tabs 1211 roxithromycin ip 300 mg tabs 1212 rucoranium inj 1213 salbutamol 100 mcg neb 1214 salbutamol 2.5 mg / 2.5 ml syrup 1215 salbutamol 200 mcg inhaler 1216 salbutamol + ambroxyl 100 ml syp 1217 salbutamol + bromhexine+ guiphenesin+menthol 100 ml syp 1218 salbutamol + bromhexine+ guiphenesin+menthol 60 ml syp 1219 salbutamol + theophylline 100 ml syp 1220 salbutamol 2 mg tabs 1221 salbutamol inhalation 100 mcg / dose 1222 salbutamol nebuliser solution bp 5 mg / ml 1223 salbutamol syrup ip 2mg / 5ml 1224 salbutamol tab ip 2 mg 1225 salbutamol tablet ip 4 mg 1226 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 1227 salmeterol inhalation powder 1228 salmeterol xinafoate + fluticasone powder for inhalation 1229 saxagliptin tab 1230 sclerosol intrapleural aerosol ( talc ) powder 1231 scopolamine transdermal patch 1232 scorpion vaccine 1233 secnidazole oral granules 1234 selegiline tab 1235 selenium inj 1236 serratiopeptidase 5 mg tab 1237 sertraline tablets i.p 25mg 1238 sevoflurane 1239 sildenafil 10 mg inj. 1240 sildenafil 50mg tab 1241 sildenafil citrarte inj. 10mg / 12.5 ml for iv use 1242 sildenafil tablets 100 mg 1243 silver sulfadiazine 10 gm cream 1244 silver sulfadiazine 15 gm cream 1245 silver sulfadiazine 500 gm cream 1246 silver sulphadiazine cream ip 1% 50gm tube 1247 simvastatin 10 mg tabs 1248 simvastatin 20 mg tabs 1249 sitagliptin + metformin hcl tab 1250 sitagliptin tab 1251 sodium chloride 0.65% w / v nasal drops 1252 sodium chloride 500 ml pps inj 1253 sodium cromoglycate oral concentrate 1254 sodium hyaluronate intra articular injection 1255 sodium nitroprusside inj 1256 sodium phosphate enema 100 ml 1257 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 1258 sodium picosulphate 10mg tab 1259 sodium polystyrene sulfonate oral syp 1260 sodium sulfacetamide lotion 1261 sodium sulphacetamide 10 % ophthalmic solution 1262 sodium valproate + valproic acid tab 1263 sodium valproate 1ml 100 mg inj. 1264 sodium valproate 500 mg tab 1265 sodium valproate ec tablets i.p 200mg 1266 sodium valproate tablets 300mg 1267 somatostatin cap 1268 somatropin injection 1269 sotalol inj 1270 sparfloxacin 200 mg tab 1271 spectinomycin inj 1272 spiramycin inj 1273 spironolactone + hydrochlorothiazide tab 1274 spironolactone tablets ip 50 mg 1275 stavudine 30 mg cap 1276 stavudine 40 mg cap 1277 sterilized umbilical cotton tape width 3 mm , length 75 cm 1278 sterlium hand wash 1279 streptokinase 1500000 iu inj 1280 streptokinase injection 15 lac units ip 1281 streptomycin 1 gm inj 1282 sucralfate + metronidazole + lignocain cream 1283 sucralfate 1gm with oxetacain 10mg / 10ml suspension 1284 sucralfate suspension 500mg / 5ml 1285 sulfacetamide eye drop 10 % 1286 sulfacetamide eye drop 20 % 1287 sulfadoxine + pyrimethamine eye oint 1288 sulfamethoxazole + trimethoprim tab 1289 sulfamethoxazole inj 1290 sulfamethoxazole, trimethoprim, phenazopyridine tab 1291 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 1292 sulfasalazine tab ec bp 500mg 1293 sumatriptan and naproxen sodium tab 1294 sumatriptan inj 1295 sumatriptan succinate25mg tab 1296 surfactant 3ml inj 1297 surfactant 4ml inj 1298 surfactant 5ml inj 1299 surfactant 8ml inj 1300 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 1301 surgical spirit 5lt. 1302 synthetic conjugated estrogens 1303 syrup vitamin d3 200 iu + vitamin b12 2.5 mcg + calcium phosphate eq. to elemental calcium 82 mg / 5 ml 1304 tacrolimus 0.03% oint 1305 tacrolimus 0.1% oint 1306 tadalafil 10 mg tab 1307 tamoxifen citrate 10 mg tab 1308 tamsulosin 0.2 mg tab 1309 tamsulosin 0.4mg + dutasteride 0.5mg tab 1310 tamsulosin hydrochloride 0.4mg + finasteride 5 mg tab 1311 tamsulosin modified release capsules 0.4 mg 1312 tegaserod maleate 6 mg 1313 telmisartan 80 mg tab 1314 telmisartan + hydrochlorthiazide ( 40 mg + 12.5 mg ) tabs 1315 telmisartan 40mg + chlorthalidone 12.5mg tab 1316 telmisartan 80mg, hydroclorthiazide 12.5mg tablets 1317 telmisartan+metoprolol ( 50 / 40 mg ) tablets 1318 tenecteplase inj 1319 tenofovir 300 mg tab 1320 tenofovir disoproxil fumarate + emtricitabine tab 1321 terazosin cap 1322 terbinafine cream 1%w / w ( 10 gm tube ) 1323 terbinafine hydrochloride tablet 250 mg 1324 terbutaline 2.5 mg tab 1325 terbutaline 5 mg tab 1326 terbutaline 2.5mg + bromhexine 8mg / 10 ml syrup 1327 terbutaline sulfate + brom + guiphenesin 100 ml syrup 1328 terbutaline sulfate + brom + guiphenesin 50 ml syrup 1329 terbutaline tablets ip 2.5 mg 1330 terlipressin tab 1331 testosterone inj 1332 tetanus and diphtheria toxoids adsorbed inj 1333 tetanus immune globulin ( human ) inj 1334 tetanus toxoid inj 1335 tetracycline 250 mg cap 1336 tetracycline 500 mg cap 1337 theophylline 25.3 mg+ etophylline 84.7mg / 2ml injections 1338 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 1339 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 1340 thiamine 2 ml inj 1341 thiamine 30 ml inj 1342 thiocokhicoside 4 mg tab 1343 thiocokhicoside 8 mg tab 1344 thiocolchicoside + aceclofenac + pcm tab 1345 thiocolchicoside 4mg + aceclofenac 100mg tab 1346 thiopental sodium 1 gm inj 1347 thiopental sodium 500 mg inj 1348 thiopentone inj ip 0.5 g 1349 thyroxine 100mcg tab 1350 thyroxine 25mcg tab 1351 thyroxine 12.5mcg tab 1352 thyroxine tablets ip 50 mcg 1353 ticarcillin disodium + clavulanate potassium inj 1354 ticarcillin iv inj 1355 timolol maeleate 0.5 % eye drops 1356 timolol maleate + hydrochlorothiazide oint 1357 tinidazole 400 ml iv inj 1358 tinidazole tab ip 300 mg ( film coated ) 1359 tinidazole tab ip 500 mg ( film coated ) 1360 tiotropium bromide cap 1361 tobramycin and dexamethasone eye drop 1362 torasemide 10 mg + spirolactone 100 mg tab 1363 torasemide 10 mg + spirolactone 50 mg tab 1364 torsemide 10mg / ml 2ml amp. inj. 1365 tramadol 100 mg inj. 1366 tramadol 100mg tab 1367 tramadol 50 mg inj. 1368 tramadol 50 mg tab 1369 tramadol cap ip 50 mg 1370 tramadol hcl + pcm + domperidone tab 1371 tramadol hcl + pcm tab 1372 tramadol inj 50 mg / ml 1373 tranexamic acid + ethamsylate tab 1374 tranexamic acid injection ip 100mg / ml 5ml size 1375 tretenoin cream usp 0.025% 1376 tretinoin cream 1377 triamcinolone acetomide 40 mg tab 1378 tricholine citrate 550 mg + sorbitol 7.15 gm syrup / 10 ml 1379 trihexyphenidyl 2 mg tab 1380 trimcelone acetonide 0.1 % mouth ulcer gel 1381 trimethoprim + sulfamethoxazole tab 1382 trimethoprim + sulfamethoxazole ds tab 1383 trimethoprim + sulfamethoxazole ss tab 1384 trimethoprim tab 1385 trop t kit 1386 troylase ( haemocougalase ) 1ml ( like botrapase ) inj. 1387 trypsin chymotrypsin cap 1388 turpentine oil 100 ml 1389 typhoid vaccine, live 1390 urea ip 1 % + salicylic acid ip 1% w / w zinc sulphate 0.1 % w / w cream 1391 urokinase 250000 inj 1392 urokinase 500000 inj 1393 urokinase injection 5 lac unit ( lyophilized ) 1394 ursodeoxycholic acid 450 mg tab 1395 ursodeoxycholic acid 100ml syp. 1396 ursodiol 150 mg tab 1397 vaccine h. influenzae b inj 1398 vaccine hepatitis a inj 1399 vaccine hepatitis b ( recombinant ) 1 ml inj 1400 vaccine adenovirus inj 1401 vaccine chicken pox inj 1402 vaccine hepatitis b ( recombinant ) 0.5 ml inj 1403 vaccine hpv bivalent, recombinant inj 1404 vaccine human papilloma virus inj 1405 vaccine immune globulin intravenous inj 1406 vaccine influenza inj 1407 vaccine influenza virus inj 1408 vaccine mmr inj 1409 vaccine oral rota virus 1410 vaccine rabies 2.5 iu inj ( intradermal ) ) 1411 vaccine rabies 2.5 iu inj ( intramuscular ) 1412 vaccine typhoid 1413 vaccine yellow fever 1414 vaccinehpv quadrivalent , recombinant 1415 valacyclovir 1 gm inj 1416 valacyclovir 500 mg tab 1417 valdecoxib + paracetamol cap 1418 valdecoxib cap 1419 valganciclovir tablet 450 mg 1420 valproate sodium 134 mg + valporic acid 58mg cap 1421 valproate sodium 200mg + valporic acid 87mg cap 1422 valsartan + hydrochlorothiazide tab 1423 valsartan tab ip 80mg tab 1424 valthamate bromide 8 mg inj 1425 vecuronium 10 mg tab 1426 venlafaxine 100 mg tab 1427 verapamil 40 mg tab 1428 verapamil 5 mg / 2ml amp. inj. 1429 vinblastine 10 mg 10 ml inj 1430 vincristine 1 mg inj 1431 vitamin a syp 1432 vitamin + iron tonic syrup 1433 vitamin b complex with vitamin c & zinc ( cebexin z ) caps 1434 vitamin b6 50mg tab 1435 vitamin b complex ( prophylactic ) tabs 1436 vitamin b complex nfi syrup 1437 vitamin e 600 mg cap 1438 vitamin e + levocarnitine cap 1439 vitamin e 200 mg cap 1440 vitamin k 3 inj 1441 vitamins a, c, d, e and b complex and minerals syrup 1442 vitimin c tab 1443 vitneurin b1 b6 b12 3ml amp. inj. 1444 voglibose 0.2mg, metformin 500mg tablets 1445 voglibose 0.3 mg, metformin 500mg tablets 1446 voriconazole 200 mg 1447 voriconazole injection 200mg / vial 1448 warfarin 5mg tab 1449 xylometazoline 0.1 % w / v nasal drop 1450 xylometazoline nasal drops ip 0.1% 1451 zaleplon cap 1452 zidovudine inj 1453 zinc 100 ml syp 1454 zinc sulphate 20mg / ml oral solution 1455 zinc sulphate 10mg tab. 1456 zolpidem 5 mg tab 1457 zolpidem tablets i.p 10mg...

Sawai Man Singh Medical College - Rajasthan

26804471 tender for medicine supply in pddu hospital medicine supply in pddu hospital gangori bazar , jaipur 1 0.45 n.s. 500 ml n / 2 inj. 2 3% n.s. 100 ml inj. 3 abciximab inj 4 acarbose 25mg tab 5 acarbose 50mg tab 6 acebrophylline 100mg caps 7 acebrophylline tablet / capsule 100 mg 8 aceclofenac + paracetamol ( 100 mg + 325mg ) tab 9 aceclofenac + serratiopeptidase tab 10 aceclofenac 100 mg + paracetamol 325 mg + chorzoxazone 250 mg film coated tab. 11 aceclofenac 100 mg tab 12 aceclofenac 100mg + paracetamol 325mg + serratiopeptidase 15mg tab 13 aceclofenac 200mg sr / cr tab 14 acenocoumarol tab 2mg ip 15 acetaminophen 325mg+ tramadol hydrochloride 37.5 mg tab 16 acetaminophen tab 650 mg 17 acetazolamide tab ip 250mg 18 acetazolamide tablets i.p 250mg 19 acetyl salicylic acid ( aspirin ) tablet i.p 325mg 20 acetylcysteine 600mg tab 21 aceytyl cysteine ( 2 ml amp. ) inj. 22 aciclovir intravenous infusion 500mg / vial 23 activated charcoal suspension 24 acyclovir 200 mg tab 25 acyclovir 250 mg inj. 26 acyclovir 400 mg tab 27 acyclovir and hydrocortisone cream 28 acyclovir cream 5% 29 acyclovir dispersible 800mg tab 30 acyclovir eye ointment 31 acyclovir inj 25 / ml 32 acyclovir intravenous infusion ip 250mg 33 acyclovir intravenous infusion ip 500mg 34 acyclovir oral suspension ip 400mg / 5ml 35 acyclovir tab ip 200 mg 36 acyclovir tab ip 800 mg 37 adapalene +clindamycin gel 38 adapalene 0.1 % w / v ointment 39 adapalene and benzoyl peroxide gel 40 adapalene lotion 41 adenosine injection 3mg / ml 42 adenosine injection ip 6 mg / 2ml 43 aderaline 1mg / ml inj. 44 adrenaline bitartrate injection 45 adrenaline injection ip 1mg / ml im / iv use 46 albendazole ( 200 mg / 5ml ) syrup 47 albendazole + ivermectin ( 400 mg + 6mg ) tab 48 albendazole 400mg tabs 49 albendazole oral suspension ip 400 mg / 10ml 50 albendazole tablets ip 400 mg ( detail in rc ) 51 albumin 20% 100ml inj. 52 albuterol inhalation 53 alemtuzumab inj 54 alendronate 10 mg tab 55 alendronate 35 mg tab 56 alendronate 70 mg tab 57 alendronate tab 58 alfacalcidol soft gelatin 0.25mcg caps 59 alfuzosin 10mg tab 60 allopurinol 100 mg tabs 61 allopurinol 300mg tab 62 allopurinol tablets ip 100 mg 63 alprazolam 0.25 + propranolol 40 mg tab 64 alprazolam 0.25 + sertraline 50 mg tab 65 alprazolam 0.25 mg tabs 66 alprazolam 0.5 mg tabs 67 alprazolam 1 mg tab 68 alprazolam 0.25mg, fluoxetine 20mg tab 69 alteplase inj 2 mg 70 aluminium hydroxide 250mg + mg hydroxide 250mg tabs 71 aluminum hydroxide and magnesium hydroxide syp 72 ambroxol + levocetrazin tab 73 ambroxol 15 mg / 2ml syp 74 ambroxol hcl + desloratadine syp 75 ambroxol hcl + terbutaline + guaphenasin 100 ml syp 76 ambroxol hcl + terbutaline + guaphenasin 50 ml syp 77 ambroxol tab 78 amikacin 100mg inj. 79 amikacin 250mg inj. 80 amikacin 500mg inj. 81 amino acid 10% injection 100ml size 82 amino acid 5% 250ml pack inj. 83 amino acid injection 100 ml 84 amino acids + electrolytes 200 ml inj 85 amino acids + electrolytes 500 ml inj 86 aminolevulinic acid solution 87 aminophylline 10 ml inj. 88 aminophylline inj ip 25 mg / ml 89 amiodarone 150 mg / 3ml amp. inj. 90 amiodarone 200mg tab 91 amisulpride 100 mg tab 92 amisulpride 200 mg tab 93 amisulpride tablets i.p 50mg 94 amitriptyline 25 mg tab 95 amitriptyline hydrochloride 10mg tablets i.p 96 amlodipine + atenolol ( 5 mg + 50 mg ) tabs 97 amlodipine + atorvastatin tab 98 amlodipine + benazepril hcl tab 99 amlodipine + bisoprolol tab 100 amlodipine + lisonopril tab 101 amlodipine + losartan tab 102 amlodipine + olmesartan medoxomil tab 103 amlodipine + ramipril tab 104 amlodipine + valsartan tab 105 amlodipine 10 mg tab 106 amlodipine 2.5 mg tab 107 amlodipine 5mg tabs 108 amoxy & pota. clavulana 300mg inj. 109 amoxy & pota. clavulana 600mg inj. 110 amoxy 250 mg + clav 50 mg ( =300 mg vial ) inj. 111 amoxycillin + clavulanate 228.5 mg syp 112 amoxycillin + clavulanate 250 mg inj. 113 amoxycillin + clavulanate 375 mg inj. 114 amoxycillin + clavulanate 600 mg inj. 115 amoxycillin + cloxacillin 30ml syp 116 amoxycillin + dicloxacillin 250 mg cap 117 amoxycillin 1000mg + clavulanic acid 200mg inj. 118 amoxycillin 125 mg + clavulanate 25 mg syp 119 amoxycillin 125 mg kid tabs 120 amoxycillin 125mg / 5ml powder for suspension ip 121 amoxycillin 200mg + clavulanic acid 28.5 mg / 5ml dry syrup 122 amoxycillin 250 mg + dicloxacillin 250 mg cap 123 amoxycillin 250 mg caps 124 amoxycillin 250 mg dt tab 125 amoxycillin 250mg + clavulanic acid 50 mg inj. 126 amoxycillin 250mg + cloxacillin 250mg caps 127 amoxycillin 250mg with potassium clavulanate 125mg tab 128 amoxycillin 500 mg + dicloxacillin 500 mg cap 129 amoxycillin 500 mg caps 130 amoxycillin 500mg + clavulanic acid 100mg inj. 131 amoxycillin 500mg + clavulanic acid 125 mg tabs 132 amoxycillin 875mg + potassium clavulanate 125mg tab 133 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 134 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) 135 amoxycillin cap ip 250mg 136 amoxycillin cap ip 500mg 137 amoxycillin dispersible tablets ip 125 mg 138 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 139 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 140 amphotericin b 10 mg + lyphosomal inj 141 amphotericin b 25 mg + lyphosomal inj 142 amphotericin b 50 mg + lyphosomal inj 143 amphotericin b inj ip 50 mg 144 ampi 250mg + cloxy 250 mg cap 145 ampicillin + cloxacillin cap 146 ampicillin +sulbactam 250 mg inj. 147 ampicillin 1 gm inj 148 ampicillin 250 mg inj. 149 ampicillin 500mg inj. 150 ampicillin cap ip 500mg 151 ampicillin injection ip 500 mg 152 amrinone inj 153 anastrozole tablets ip 1mg 154 antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 155 antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 156 antacids syp 157 anti a blood grouping serum ip ( anti a monoclonal serum ) 158 anti b blood grouping serum ip ( anti b mono clonal serum ) 159 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 160 anti human papillomavirus type 16 inj 161 anti snake venon inj polyvalent injection ( asv ) 162 anti acne gel adapalene bp…0.1 % w / w, clindamycin phosphate usp equivalent to clindamycin…1% w / w, methyl paraben ip…0.1 % w / w, phenoxyethanol bp…0.25 % w / w 163 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 164 antihemophilic factor recombinant inj 165 antihemophillic factor ix inj 166 antihemophillic factor viii inj 167 antioxidant cap 168 antitetnus human immunoglobulin injection 250mg 169 antitetnus human immunoglobulin injection 500mg 170 antithrombin inj 500 171 antithymocyte immunoglobulin ( atg ) inj 172 appetite enhancer ( peptone, minerals, vitamins ) syrup 173 application benzyl benzoate 25 % w / w lotion 174 aqueous colloidal solution of vitamin k1 inj 175 arteether 150mg inj 176 artemether + lumefantrine 20mg tab 177 artemether + lumefantrine 40mg tab 178 artemether + lumefantrine 80mg tab 179 artemether + lumefantrine tab 180 artemether 80mg + lumefantrine ( banflumetol ) 480mg tab 181 artemether tab 182 artesunate 60mg inj. 183 artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) 184 artether 50 mg tab 185 ascorbic acid 500 mg.tab. 186 ascorbic acid tablets ip 100 mg ( vitamin c chewable tablet ip 100mg ) 187 aspirin + dipyridamole cap 188 aspirin 150 mg tab 189 aspirin 75 mg + clopidogrel 150 mg tab 190 aspirin 75 mg + clopidogrel 75 mg tab 191 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 192 aspirin enteric coated tablets i.p.75mg 193 atenolol + chlorthalidone tab 194 atenolol + hydrochlorothiazide tab 195 atenolol 25 mg tab 196 atenolol 25 mg, amlodipine 5 mg tablets 197 atenolol 50 mg tabs 198 atenolol tab ip 25 mg 199 atorvastatin + clopidogrel ( 10 / 75mg ) capsules 200 atorvastatin + ezetimibe tab 201 atorvastatin + niacin tab 202 atorvastatin 10mg + fenofibrates 160mg tab 203 atorvastatin 10mg tabs 204 atorvastatin 20 mg tabs 205 atorvastatin 40mg tab 206 atorvastatin i.p 10mg, aspirin i.p ( ec ) 75mg capsules 207 atracurim 10 mg / ml ( 2.5 ml amp. ) inj. 208 atracurium 5 ml inj 209 atracurium besilate injection i.p 25mg / 2.5ml 210 atracurium inj 10 mg / ml 211 atropine ( 0.6mg / ml ) inj. 212 atropine sulphate injection 0.6mg / ml 213 azathioprine inj 214 azithromycin ( 100mg / 5ml ) syrup 215 azithromycin 100 mg dt tab 216 azithromycin 200 mg 15 ml oral syp 217 azithromycin 500 mg inj. 218 azithromycin tab ip 500 mg 219 azithromycin tablets ip 250mg 220 aztreonam inj. 221 aztreonam injection 1gm 222 aztreonam injection usp 500 mg 223 bacitracin ( neomycin / polymyxin b ) ophthalmic oint. 224 bacitracin oint. 225 bacitracin zinc 250 iu neomycin 5 mg, sulphacetamide sodium 60mg per 1gm powder 226 baclofen 10mg tab 227 beclamethasone dipropionate..0.025% w / , neomycin sxulphate..0.5% w / w ( 3500 unit / g ) chlorocresol 0.1% w / w cream 228 beclomethasone 229 beclomethasone 0.025% + clotrimazole 1.0% + gentamycin 0.1% w / w cream 230 beclomethasone dipropionate + levosalbutamol inhaler 231 beclomethasone inhalation ip 200 mcg / dose 232 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 233 benzathine benzylpenicillin inj ip 12 lac units 234 benzathine benzylpenicillin inj ip 6 lac units 235 benzene hexachloride lotion 236 benzoyl peroxide 20 gm cream 237 benzyl penecillin inj 238 betahistidine 16 mg tab 239 betahistidine 24 mg tab 240 betahistine 8 mg tabs 241 betamethasone 0.05% w / w + salicylic acid 3% w / w cream 242 betamethasone 0.5mg lotion 243 betamethasone dipropionate cream ip 0.05% 244 betamethasone inj. i.p 4 mg / ml 245 betamethasone lotion ip 0.05 o / o 246 betamethasone sod phos inj ip 4mg / ml 247 betamethasone tab ip 0.5mg 248 betamethasone valerat 0.1% w / w + neomycin sulfate 0.5% w / w cream 249 bicalutamide tab i.p 50mg 250 biphasic isophane insulin inj 40iu / ml ( 50:50 ) 251 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 252 biphasic isophane insulin injection i.p 100 iu / ml ( 30:70 ) ( 30% soluble insulin and 70% isophane insulin ) 253 bisacodyl 5mg tabs 254 bisacodyl tab ip 5 mg 255 bismuth subcitrate potassium cap 256 bisoprolol + amlodipine tan 257 bisoprolol + hydrochlorothiazide tab 258 bisoprolol 2.5 mg tab 259 bisoprolol 5mg tab 260 bleomycin 15 mg inj. 261 bortezomib injection 3.5 mg 262 bosentan 125 mg tab 263 bosentan 62.5 mg tab 264 botrapase inj. 265 bromfenac sodium eye drop 0.09% 266 bromhexine + dexrometharphan + ammonium chloride + menthol syp 267 bromhexine + terbutalin + guiphenesin 100 ml syp 268 bromhexine + terbutalin + guiphenesin 50 ml syp 269 bromhexine 100 ml sol 270 bromocriptine 0.8mg tab 271 budesonide 0.5 mg / ml respule 272 budesonide 100 micro gram and formoterol fumarate 6 mg dihydrate inhaler 273 budesonide 100 micro gram inhaler 274 budesonide 200 micro gram and formoterol fumarate 6 mg dihydrate inhaler 275 budesonide 400 micro gram and formoterol fumarate 6 mg dihydrate inhaler 276 budesonide nebulizer suspension 0.25mg / ml 277 budesonide powder for inhalation 200 mcg 278 bupivacaine hci injections 20ml 279 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 280 bupivacaine hydrochloride and epinephrine injection 281 bupivacaine hydrochloride heavy 0.5% w / w inj. 4 ml 282 bupivacaine inj ip 0.5% 283 buprenorphin + naloxone tab 284 buprenorphine inj. 285 butorphanol tartrate injection usp 1mg / ml 1ml size 286 cabergoline 0.5 mg tab 287 cabergoline 1 mg tab 288 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 289 caffeine citrate 20 mg / 1ml inj. 290 caffeine citrate 20 mg / 2ml inj. 291 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 292 calamine lotion sol. 293 calcimax+p syp. 294 calcitriol capsules i.p 0.25mcg 295 calcium + vitamin d3 syp 200 ml 296 calcium + vitamin d3 250iu tabs 297 calcium + vitamin d3 500iu tabs 298 calcium 500mg + calcitriol 0.25mg tab 299 calcium carbonate 500mg + calcitriol 0.25mcg + zinc 7.5mg tab 300 calcium chloride injection 301 calcium dobesilate tab 302 calcium folinate 15mg tab 303 calcium folinate 50mg tab 304 calcium gluconate + vitamin d3 + cyanacobalamin 15 ml syp 305 calcium gluconate inj. 306 calcium laevulinate powder 307 calcium phosphorus 200 ml syp. 308 capecitabine tab i.p 500 mg 309 captopril and hydrochlorothiazide tab 310 captopril tab 311 carbachol intraocular solution 312 carbamazepine 100mg tabs 313 carbamazepine 200mg tabs 314 carbamazepine 300 mg cr tabs 315 carbenicillin tab 316 carbidopa levodopa tab 317 carbidopa, levodopa and entacapone tab 318 carbimazole 10mg tab 319 carbimazole 5mg tab 320 carbonyl iron tab 321 carboprost tromethamine injection ip 250 mcg / ml 322 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 323 carboxymethyl cellulose 0.5 % w / v eye drop 324 carvedilol 12.5 mg tab 325 carvedilol 25 mg tab 326 carvedilol 3.125mg tab 327 carvedilol tablets ip 6.25mg 328 caspofingin 50 mg inj. 329 caspofungin 70 mg inj. 330 cefaclor cap 331 cefadroxil 125 mg 30 ml syp 332 cefadroxil 250mg + clavulanate 62.5mg tab 333 cefadroxil 500mg tab 334 cefadroxil 500mg+ clavulanate 125mg tab 335 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 336 cefadroxil film coated tablets ip 250mg 337 cefazolin 1gm inj 338 cefdinir 125 dt tab 339 cefdinir 300 mg tab 340 cefdinir inj 341 cefepime 0.5 gm inj 342 cefepime 1gm inj 343 cefepime hydrochloride + tazobactum inj 344 cefepime hydrochloride 1000 mg + salbactum 500 mg inj 345 cefepime hydrochloride 500 mg + salbactum 250 mg inj 346 cefepime injection ip 500 mg 347 cefixime 200 mg tab 348 cefixime ( 50 mg / 5ml ) dry syrup 349 cefixime 100 mg + clavulanate 125 mg syp 350 cefixime 100mg tab. 351 cefixime 200mg + clavulanic acid 125mg ( as pot. clavulanate ) tab 352 cefixime 200mg + ofloxacin 200mg tab 353 cefixime 200mg tab. 354 cefixime 50 mg+ clavulanate 31.25 mg syp 355 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 356 cefixime tab ip 100 mg 357 cefixime tab ip 200 mg 358 cefoperazone 1 gm + sulbactam 500 mg inj 359 cefoperazone 1 gm inj. 360 cefoperazone 1gm + sulbactam 1gm inj. 361 cefoperazone 2000 gm + sulbactam 1000 mg inj 362 cefoperazone 500mg + sulbactam 500 mg inj. 363 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) 364 cefotaxim 1g inj. 365 cefotaxim 250 mg inj. 366 cefotaxime inj ip 250 mg 367 cefotaxime injection ip 1 g 368 cefotaxime sodium 1000mg inj. 369 cefotaxime sodium 1gm + sulbactam sodium 500 mg inj. 370 cefotaxime sodium 250mg + sulbactam sodium 125 mg inj. 371 cefotaxime sodium 500mg + sulbactam sodium 250 mg inj. 372 cefotaxime sodium injections ip 250 mg 373 cefoxitime 1 gm inj 374 cefoxitime 250 mg inj 375 cefoxitime 500 mg inj 376 cefpirome inj 377 cefpodoxime 100 mg dt tab 378 cefpodoxime 200 mg tabs 379 cefpodoxime dispersible tab 50 mg 380 cefpodoxime proxetil 50 mg ds dry syrup 381 cefpodoxime proxetil dispersible 50mg tab 382 cefpodxime 200mg + clavulanic acid 125mg tab 383 ceftazadime 1000 mg inj. 384 ceftazidime inj ip 1g 385 ceftazidime inj ip 250 mg 386 ceftazidime inj ip 500 mg 387 ceftazidine + salbactum inj 388 ceftriaxone + sulbactam 375 mg inj 389 ceftriaxone 1 g inj. 390 ceftriaxone 1000mg + sulbactam 500 mg inj. 391 ceftriaxone 1000mg + tazobactum 125 mg inj. 392 ceftriaxone 250 gm + tazobactum 31.25 mg inj 393 ceftriaxone 250 mg inj. 394 ceftriaxone 250mg + sulbactam 125 mg inj. 395 ceftriaxone 500 gm + tazobactum 62.50 mg inj 396 ceftriaxone 500 mg inj. 397 ceftriaxone 500mg + sulbactam 250 mg inj. 398 ceftriaxone inj ip 1g / vial 399 ceftriaxone inj ip 250 mg / vial 400 ceftriaxone inj ip 500mg / vial 401 ceftriaxone injection 1 gm + tazobactum 1.25 gm 402 cefuroxime 250 mg tab 403 cefuroxime 750 mg inj 404 cefuroxime 125mg tab 405 cefuroxime 500mg + clavulanic acid 125mg ( as pot. clavulanate ) tab 406 cefuroxime axetil 250 mg tabs 407 cefuroxime axetil 500mg tabs 408 cefuroxime axetil tab ip 250 mg 409 cefuroxime injection 1500 mg 410 cephalexin 100 mg tab 411 cephalexin 250 dt tab 412 cephalexin 125 mg dt tab 413 cephalexin 125mg / 5ml dry syrup 414 cephalexin 250 mg caps 415 cephalexin 500 mg caps 416 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 417 cephalexin tablets 125 mg ( dispersible tablets ) 418 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 419 cerviprine gel 420 cetirizine syp 60 ml 421 cetirizine dihydrochloride ip 5 mg, phenylephrine hydrochloride ip 10 mg, paracetamol ip 325 mg tab 422 cetirizine syrup ip 5mg / 5 ml 423 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 424 cetrizine ( 5 mg / 5 ml ) syrup 425 cetrizine + ambroxol 100 ml syp 426 cetrizine + ambroxol tab 427 cetrizine 10mg tabs 428 chlolecalciferol sachet 429 chloramphenicol 250 mg inj 430 chloramphenicol 500 mg inj 431 chloramphenicol + beclomethasone dipropionate + clotrimazole + lignocaine + glycerine & propylene glycol ip base gel 432 chloramphenicol 1000 inj 433 chloramphenicol eye drop 0.4 %, 5ml 434 chlordiazepoxide 10mg tab 435 chlordiazepoxide 25mg tab 436 chlordiazepoxide + amitriptyline tab 437 chlordiazepoxide and clidinium bromide tab 438 chlorhexidine gluconate 0.2% mouth wash 439 chlorhexidine gluconate 0.3% v / v + cetrimide 0.6% w / v sol. 440 chloroquine phosphate 250 mg tabs 441 chloroquine phosphate 500 mg tab 442 chloroquine phosphate syp 125 mg / 60 ml 443 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 444 chlorothiazide tab 445 chlorpheniramine maleate tab 446 chlorpheniramine maleate tab ip 4mg 447 chlorpromazine tab 448 chlorthalidone tablets 12.5mg 449 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 450 chlorzoxazone 500mg+ diclofenac 50mg + paracetamol 325mg tab 451 cholecalciferol granules 452 cholera vaccine 453 cholestyramine susp. 454 chorionic gonadotropin inj 455 chymotrypsin + trypsin ( 1:5 ) enteric cated 120k au tab 456 cidex solution ( gluteraldehyde ) 457 cilnidipine 10mg tab 458 cilnidipine 10mg+ metoprolol 50mg tab 459 cilnidipine 10mg+ telmisartan 40mg tab 460 cilnidipine tablets 20mg 461 cilostazol 100 mg tab 462 cilostazol tablets ip 50mg 463 cimetidine tab 464 cinnarizine + domperidonetab 465 cinnarizine tablets 25mg 466 ciprofloxacin ( 2mg / ml ) infusion 467 ciprofloxacin + dexamethasone eye drop 468 ciprofloxacin + flucanazole eye drop 469 ciprofloxacin 0.3% w / v eye drop 470 ciprofloxacin 100 ml inj. 471 ciprofloxacin 250 mg tabs 472 ciprofloxacin 250mg + tinidazole 300 mg tabs 473 ciprofloxacin 500 mg tabs 474 ciprofloxacin 500mg + tinidazole 600 mg tabs 475 ciprofloxacin tablet ip 500 mg film coated 476 ciprofloxacin tablets ip 250 mg film coated 477 cis atracurium besylate injection 2 mg / ml in 5 ml vial 478 cisatracurium besylate 2 mg / ml ; 10 ml inj 479 cisatracurium besylate 2 mg / ml ; 5 ml inj 480 cisplatin 10 mg inj. 481 cisplatin 50 mg inj. 482 citalopram 10 mg tabs 483 citicoline sodium 250 mg / 2ml inj. 484 citicoline sodium 250 mg / 4ml inj. 485 citicoline tablets 500mg inj. 486 clarithromycin 250mg tab 487 clarithromycin 500mg tab 488 clarithromycin gel 20 gm 1% 489 clidinium bromide 2.5mg + chlordiazepoxide 5mg tab 490 clindamycin 150mg / 2 ml inj. 491 clindamycin 150mg / 4 ml inj. 492 clindamycin 20 gm inj. 493 clindamycin 30 gm inj. 494 clindamycin 300mg caps 495 clindamycin 300mg / 2 ml inj 496 clindamycin 600 mg tab 497 clindamycin 600mg 4 ml inj. 498 clindamycin and benzoyl peroxide gel 499 clindamycin capsule ip 150mg 500 clindamycin hcl 150 mg caps 501 clindamycin phosphate gel usp 1 o / o 502 clindamycin phosphate injection ip 300 mg 503 clobazam 10mg tabs 504 clobazam tablet 5mg 505 clobetasol propinate +miconazole nitrate+ ofloxacin cream 506 clobetasol propinate + salicylic acid cream 507 clobetasol propinate 10 gm cream 508 clobetasol propionate + miconazole + gentamycin cream 509 clobetasol propionate bp…0.05 % w / w, neomycin sulphate ip…0.50 % w / w., miconazole nitrate ip…2.00 % w / w, chlorocresol ip ( as preservative ) 0.10 % w / w cream / ointment 510 clobetasol propionate cream ip 0.05 o / o 511 clofazimine 100mg capsule 512 clofazimine 50 mg capsule 513 clofibrate 514 clomifene tab ip 25 mg 515 clomiphene 25mg tabs 516 clomiphene citrate 50 mg tabs 517 clomiphene tab ip 50 mg 518 clonazepam 0.25 mg tabs 519 clonazepam 0.5 mg tabs 520 clonazepam tablets ip 1mg 521 clonidine 100 mcg inj. 522 clonidine inj. 523 clopidogrel 75mg tabs 524 clopidogrel 75mg tabs + aspirin 75 mg tabs 525 clotrimazole + beclomethasone cream 526 clotrimazole eye drop 527 clotrimazole vaginal gel 30 gm 528 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 529 clotrimazole 1% 100gm powder 530 clotrimazole 1% w / w 0int. 531 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w cream 15 gm tube 532 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w 15ml lotion 533 clotrimazole 100 mg vaginal tab 534 clotrimazole cream ip 2% w / w 535 clotrimazole mouth paint 536 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) 537 clotrimazole vaginal tab ip 500mg 538 coagulation factor ix human 539 coagulation factor ix recombinant 540 coagulation factor viia recombinant 541 codeine phosphate tablets bp 30mg 542 codeine sulfate 543 colchicine 0.6 mg capsules 544 cold suspn.n / f ( paracetamol 125 mg+ phenylephrine hydrocloride ip 5mg + 545 colistil inj. 546 colistimethate injection ip 1m iu powder for solution 547 colistin iv 548 colistin sulfate + neomycin + hydrocortisone suspension 549 collagenase ointment 550 colostrum powder 551 conjugated estrogens tabs 552 conjugated estrogens, medroxyprogesterone acetate tabs 553 cotrimoxazole tabs 554 cotrimoxazole oral suspension 555 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 556 cough syrup / expectorant ( 50 ) ml 557 cromolyn sodium nebulization solution 558 cyproheptadine 4mg tab 559 cyproheptadine hcl 2mg + tricholine citrate 275 mg syrup 560 cyproheptadine, hydrochloride ( anhydrous ) ip..2 mg.in a flavoured syrup base..q.s. 561 cyproterone + ethinyloestradiol coated tablets 562 cytomegalovirus immune globulin intravenous human 563 danazol 100 mg caps 564 danazol 200 mg caps 565 danazol 50 mg caps 566 dandruf shampoo ketoconazole ip shampoo 2%w / v 567 dantrolene sodium inj. 568 dapsone tabs 569 deferasirox 250mg tabs 570 deferasirox 500mg tabs 571 deferoxamine inj. 572 deflazacort 1 mg tabs 573 deflazacort 30 mg tabs 574 deflazacort 6mg tab 575 dehydroepiandrosterone 25 mg capsule 576 demeclocycline tabs 577 desferrioxamine inj. 578 desipramine hydrochloride tabs 579 desmopressin tabs 580 dethylamine bp…1.16 %, linseed oil bp…3 % w / w, methyl salicylate ip…10 % w / w, menthol ip…5 % w / w, excipients and propellant q.s. to…100 % w / w spray 581 dexamethasone 0.5 mg tabs 582 dexamethasone 4 mg inj. 583 dexamethasone inj ip 8mg / 2ml 584 dexona 2 ml inj. 585 dextran 0 40, 500 ml 586 dextromethorphan + guiphenesin + brom + cpm 100 ml oral liquid 587 dextromethorphan + guiphenesin + brom + cpm tabs 588 dextromethorphan hbr syrup ip 13.5mg / 5ml 589 dextropropoxyphene + acetaminophen + dicyclomine 590 dextropropoxyphene + paracetamol + dicyclomine tabs 591 dextropropoxyphene + paracetamol capsule 592 dextropropoxyphene oral 593 dextrose ( 10% ) with paediatric maintenance solution 594 dextrose + fructose infusion 595 dextrose 10% iv 500 ml ffs inj. 596 dextrose 25% 100 ml inj. 597 dextrose 25% iv 100 ml ffs inj. 598 dextrose 5% iv 500 ml ffs inj. 599 dextrose 5% + ringer lactate iv inj. 600 dextrose normal saline 500 ml ffs inj. 601 dextrose normal saline 500 ml pps inj. 602 diacerein 50 mg + glucaramine tablet 603 diacerein 50 mg + glucosamine sulphate 500 mg tablet 604 diacerein 50 mg +methylsulphonylmethane 250 mg + glucosamine sulphate 750 mg tab. 605 diacerein capsules ip 50mg 606 diazepam 2 mg tab 607 diazepam 2 ml inj. 608 diazepam 5 mg tabs 609 diclofenac na 75mg / ml 1ml inj. 610 diclofenac 1.16 w / w + linceed oil 3% w / w + methyl salicylate 10% w / w + menthol 5% w / w gel 611 diclofenac di + menthol 5%+ oleum 3% + methyl salicylate 612 diclofenac diethylamine bp 1.116% ( equivalent to diclofenac sodium 1.0%, linseed oil bp 3.0% + methyl salicylate ip 10.0%, capsiacin usp 0.025%, menthol ip 0.025%, benzyl alcohol ip 1.0% ( as preservative ) in a gel base q.s. 613 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) 614 diclofenac gel 615 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 616 diclofenac potassium bp 50 mg + paracetamol 325 mg + serratiopeptidase 10 mg tablet 617 diclofenac sodium ( sr ) 100 mg tab 618 diclofenac sodium + misoprostol tablet 619 diclofenac sodium + serratiopeptidase ( 50mg + 10mg ) tab 620 diclofenac sodium 25mg per ml inj. 621 diclofenac sodium 30 ml inj. 622 diclofenac sodium 50 mg tab 623 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 624 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 625 diclofence prolonged release tablet ip 100 mg 626 dicloxacillin capsule 627 dicyclomine + mefenamic acid tabs 628 dicyclomine + paracetamol tabs 629 dicyclomine 10 mg tabs 630 dicyclomine 10mg + dimethicone 40mg / 5ml suspension 631 dicyclomine 10mg + mefenamic acid 250mg tab 632 dicyclomine drop 633 dicyclomine hcl ( dicycloverine ) injection ip 10mg / ml 634 dicyclomine hcl. 20mg + paracetamol 325 mg tabs 635 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 636 dicyclomine hydrochloride oral solution ip 10mg / 5ml 637 dicyclomine inj ip 10 mg / ml 638 dicyclomine tab ip 10 mg 639 diethylcarbamazine 50mg tab 640 digoxin 250mg ( 0.25mg ) tab 641 digoxin inj ip 0.25 mg / ml 642 digoxin inj. 643 diltiazem 30 mg tabs 644 diltiazem 60 mg tabs 645 diltiazem 90mg tab 646 dimercaprol inj. 647 dinoprostone gel 648 diphenhydramine + ammonium chl. + sodium cit. 100 ml syrup 649 diphenhydramine + ammonium chl. + sodium cit. 50 ml syrup 650 diphenhydramine 25 mg tabs 651 diphenoxylate + atropine inj. 652 diphenoxylate tabs 653 disodium hydrogen citrate ( alkalyser ) 1.4 mg / 5ml syrup 654 distilled water 5ml ffs 655 disulfiram 250 mg tabs 656 disulfiram ip 500 mg tabs 657 dobutamine 250 mg / 20ml inj. 658 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) 659 domperidone + esomeprazole ( 30 / 40mg ) capsule 660 domperidone + paracetamol tabs 661 domperidone 10 mg tabs 662 domperidone 30mg + pantoprazole 40mg caps 663 domperidone 5 mg. / 5 ml susp 664 domperidone oral drops 10mg / ml ( 10ml ) 665 domperidone suspension ip 5mg / 5ml 666 domperidone tab ip 10 mg 667 dopamine hcl 200 mg / 5ml inj. 668 dopamine hydrochloride inj ip 40 mg / ml 669 doxofylline + montelukast tabs 670 doxofylline 400mg tab 671 doxorubicin 10 mg inj. 672 doxorubicin 50 mg inj. 673 doxycycline cap ip 100 mg 674 doxylamine 20 mg. + pyridoxine 20 mg + folic acid 5mg. tab 675 doxylamine 20 mg. + pyridoxine 20 mg. tab 676 doxylamine succinate + pyridoxine + folic acid ( 10 mg + 10 mg + 2.5 mg ) tabs 677 doxylamine succinate 10mg + pyridoxine hcl 10mg tab 678 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 679 doxylamine tabs 680 dried aluminium hydroxide 250mg + magnesium hydroxide 250mg / 5ml susp + activated dimethicone 50mg 681 drotaverin 40mg / 2ml inj. 682 drotaverine + nimesulide tabs 683 drotaverine + paracetamol tabs 684 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 685 drotaverine hcl 80mg, mefenamic acid 250mg tab 686 drotaverine hcl tablets ip 40mg tabs 687 drotaverine hydrochloride inj 40 mg / 2 ml 688 drotaverine tab ip 40 mg 689 duloxetine 20mg tabs 690 duloxetine 30mg tabs 691 duloxetine 40mg tabs 692 duloxetine 60mg tabs 693 dusting powder ( povidone 5% powder 694 dutasteride + tamsulosin hydrochloride caps 695 dutasteride caps 696 dydrogesterone tab. i.p. 10mg 697 ear drops ( paradichlorobenzene 2%+benzocaine 2.7%+chlorbutol 5%+turpentine oil15% 698 ebastine film coated tablets 10mg 699 efavirenz 200 mg caps 700 efavirenz 600 mg + emtricitabine 200 mg + tenofovir disoproxil fumarate 300 mg tabs 701 efavirenz tablets ip 600mg 702 electrolyte g iv 500 ml ffs inj. 703 electrolyte g iv 500 ml pps inj. 704 electrolyte p iv 500 ml pps inj. 705 electrolyte m iv 500 ml ffs inj. 706 electrolyte m iv 500 ml pps inj. 707 electrolyte p iv 500 ml ffs inj. 708 elemental calcium tabs 709 elemental iron 50 mg tabs 710 enalapril 2.5 mg tabs 711 enalapril + amlodipine tabs 712 enalapril maleate + felodipine tab 713 enalapril maleate + hydrochlorothiazide tab 714 enalapril maleate tablets ip 10 mg 715 enalaprilat injection 716 enalpril 5mg tabs 717 enoxaparin 40 mg / 0.4 ml inj. ip 718 enoxaparin 60 mg / 0.6 ml inj. 719 enoxaparin sodium inj ip 60 mg 720 entecavir 0.5 mg tabs 721 entecavir 1mg tabs 722 enyme syrup mix fruit flavour pepsin 7.5 mg + fungal diastase 12.5 mg / 5 ml 723 enzyme drops pepsin ( 1:3000 ) 5 mg + fungal diastase ( 1:1200 ) 33.33 mg / ml 724 ephidrine inj. 725 epinephrine hydrochloride inj. 726 eplerenone tabs 727 ergotamine tartrate + caffeine tabs 728 erythromycin 250 mg tabs 729 erythromycin 500 mg tabs 730 erythropoietin 10 k inj. 731 erythropoietin 2 k inj. 732 erythropoietin 4 k inj. 733 erythropoietin 40 k inj. 734 escitalopram 10 mg tabs 735 escitalopram 10mg with clonazepam 0.5mg tabs 736 escitalopram 20 mg tabs 737 esmolol infusion 738 esmolol hydrochloride injection 10mg / ml 10ml size 739 esomeprazole 20 mg caps 740 esomeprazole 40 mg caps 741 esomeprazole + domperidone caps 742 estradiol tabs 743 estradiol + levonorgestrel transdermal tabs 744 estradiol + norethindrone acetate tabs 745 estradiol cypionate inj. 746 estradiol transdermal system 747 estradiol vaginal ring 748 estradiol vaginal tablets 749 estradiol valerate + estradiol valerate dienogest tabs 750 estradiol valerate inj. 751 estradiol, norethindrone acetate transdermal system tabs 752 estradiol, norgestimate tabs 753 estrogens + ethinyl oestradial tabs 754 etanercept inj. 755 ethacrynic acid tabs 756 ethambutol 800mg tab 757 ethamsylate tabs 758 ethamsylate b.p 250 mg. inj. 759 ethamsylate b.p 500 mg. inj. 760 ethamsylate inj 250 mg / 2ml ( im / iv ) 761 ethinyl estradiol tabs 762 ethinyl estradiol + ethynodiol diacetate tabs 763 ethinyloestradiol tabs ip 50 mcg 764 etizolam tablet 0.5mg 765 etophyllin +theophylline ( 77 mg + 23 mg ) tabs 766 etophylline + theophylline 100 mg tabs 767 etophylline + theophylline 150 mg srtabs 768 etophylline + theophylline 2 ml inj. 769 etophylline + theophylline 300 mg sr tabs 770 etophylline + theophylline 300 mg tabs 771 etophylline ip 115mg + theophylline 35mg tablet 772 etoposide 100 mg / 5ml inj. 773 etoricoxib 60mg tabs 774 etoricoxib tab ip 120mg 775 etoricoxib tablet 90 mg 776 etoricoxilb 120mg tab 777 etoricoxilb 90mg tab 778 evening primrose oil 779 everolimus tabs 780 ezetimibe + simvastatin tabs 781 ezetimibe 10mg tabs 782 fabrazyme inj. 783 factor vlll sdh 1000 iu inj. 784 factor vlll sdh 250 iu inj. 785 factor vlll sdh 500 iu inj. 786 famotidine 20 mg tabs 787 famotidine 40 mg tabs 788 faropenem sodium 200 mg tabs 789 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 790 febuxostat tablets 40mg 791 febuxostat tablets 80mg 792 felodipine tabs 793 fenofibrate 145 mg tabs 794 fenofibrate 160 mg tabs 795 fentanyl citrate inj. 796 fentanyl citrate injection 50mcg / ml 797 fentanyl citrate injection ip 2 ml 798 fentanyl skin patches 799 feracrylam 1% 100ml solution 800 feracrylam 1% 50ml solution 801 feracrylam 3% 100ml solution 802 feracrylam 3% 50ml solution 803 feracrylam gell 30 gm 804 feracrylam gell 50 gm 805 feracrylum 1% w / v sterile solution 100 ml 806 ferric carboxymaltose 1000 mg. ( inj. ) ( brand name ferium 1k ) 807 ferrous ammonium citrate 160mg + cyano cobalamine 7.5mcg+folic acid 0.5mg / 15ml syrup 808 ferrous ascorbate 100mg with folic acid 1.5mg tab 809 ferrous salt + folic acid tabs 810 ferrous salt + folic acid+ cyanocobalamin tabs 811 ferrous sucrose inj. 812 ferrous sulfate – iron tabs 813 fexofenadine 120 mg tabs 814 fexofenadine 180 mg tabs 815 fexofenadine 60ml syp 816 fibrinogen concentrate ( human ) solution 817 filgrastim 300mcg / 1ml prefilled syringe 818 finaestride 5 mg tabs 819 finasteride 1 mg tabs 820 flavoxate tabs 821 flubiprofen sodium eye drop 822 flucona zole 100 ml inj. 823 fluconazole 0 .5 % 15gm cream 824 fluconazole 200 mg / 100ml inj. 825 fluconazole + azithromycin + ornidazole kit 826 fluconazole 10 mg / ml inj. 827 fluconazole 150 mg tabs 828 fluconazole tablets ip 150mg 829 flucticasone propionate 50mcg per puff nasal spray 830 flucticasone propionate respule 0.5mg / 2ml 831 fludrocortisone tabs 832 flumazenil tabs 833 flunarizine tab 5 mg 834 flunarzine 10mg tabs 835 flunarzine 5mg tabs 836 fluoxetine + alprazolam tabs 837 fluoxetine hydrochloride 20 mg caps 838 flurbiprofen sodium eye drop 839 fluticasone propionate and salmeterol nasal spray 840 fluticasone propionate nasal spray 841 folic acid 5mg tabs 842 fondaparinux sodium prefilled syringe 843 formoterol caps 844 formoterol fumarate + budesonide caps 845 formoterol fumarate 6 mcg + futicasone caps 846 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 847 fosinopril 600 mg tabs 848 fosinopril sodium + hydrochlorothiazide tabs 849 fosphenytoin 75 mg / 10ml inj. 850 fosphenytoin 75 mg / 2ml inj. 851 framycetin sulphate cream 1 o / o 100 gm pack 852 framycetin sulphate cream 1 o / o 30gm pack 853 frusemide ( 10 mg / ml ) inj. 854 frusemide 40 mg tabs 855 frusemide tab ip 40 mg 856 fungal diastase + pepsin 100 ml syp 857 fungal diastase + pepsin 200 ml syp 858 furazolidone + metronidazole + dicyclomine syp 859 furazolidone + metronidazole syp 860 furazolidone 100 mg tabs 861 furosemide inj. 862 furosemide injection ip 10mg / ml ( im and iv use ) 863 fusidic acid + beclomethasone dipropionate cream 864 fusidic acid 2 % w / v cream 865 fusidic acid cream ip 2% 866 gabapentin 100 mg tabs 867 gabapentin 400 mg tabs 868 gabapentin 600 mg tabs 869 gabapentin 800 mg tabs 870 gabapentin + methylcobalamin tabs 871 gabapentin capsules usp 300mg tabs 872 gabapentin+nortriptyline ( 400 / 10mg ) tablets 873 ganciclovir 500 mg inj. 874 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) 875 gatifloxacin ophthalmic solution, 876 gdw 10% 500 ml inj. 877 gefitinib 250 mg tabs 878 gemcitabine 1000 mg inj. 879 gemcitabine 200 mg inj. 880 gemfibrozil tabs 881 gemifloxacin mesylate 320 mg tabs 882 genevac b 10mg ( 10 ml vial ) inj. 883 gentamicin + dexamethasone inj. 884 gentamicin + prednisolone acetate inj. 885 gentamicin 10ml inj. 886 gentamicin 20ml inj. 887 gentamicin 30ml inj 888 gentamicin eye drop 889 gentamycin injection ip 80mg / 2ml ( im / iv use ) 890 gentamycin sulphate 80 mg / 2ml inj. 891 ginkgo biloba capsule 892 ginseng extract 42.5 mg, vitamin a 2500 iu, vitamin b1 1 mg, vitamin b2 1.5 mg, vitamin b6 1 mg, vitamin b12 1 mcg, vitamin c 50 mg, vitamin e 5 mg, vitamin d 200 iu, nicotinamide 10 mg, carbohydrates 0.1 g, folic acid 0.15 mg, ferrous fumarate 30 mg, copper 0.5 mg, potassium sulphate 2 mg, manganese 0.5 mg, magnesium sulphate 3 mg, zinc oxide 10 mg, calcium 75 mg, phosphate 58 mg, iodine 0.1 mg, protein 0.2 g, fat 0.38 g inj. 893 glargine 100 iu / ml inj 894 glibenclamide + metformin + rosiglitazone tabs 895 glibenclamide 2.5 mg tabs ( scored oval ) 896 glibenclamide 5 mg tabs ( scored oval ) 897 glibenclamide 5mg + metforminhcl 500mg tab 898 glibenclamide tab ip 5 mg 899 gliclazide + metformin hcl tabs 900 gliclazide 40 mg tabs 901 gliclazide 60mg tab 902 gliclazide 80 mg tabs 903 gliclazide 80mg + metformin hydrochloride 500mg tab 904 gliclazide tab ip 40 mg 905 glimeperide 1mg tabs 906 glimeperide 2mg tabs 907 glimepiride 1 mg + pioglitazone + metformin tabs 908 glimepiride 1mg metformin 500mg tab 909 glimepiride 2 mg + pioglitazone + metformin tabs 910 glimepiride 2mg, metformin hydrochloride 1g tablets 911 glimepiride tab ip 1mg 912 glimepiride tab ip 2 mg 913 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 914 glimipride 3mg tab 915 glimipride 4mg tab 916 glimperide 2mg + metformnin hydrochloride 500mg tab 917 glipizide 10 mg tabs 918 glipizide 2.5 mg tabs 919 glipizide 5 mg tabs 920 glipizide 5mg + metformin hydrochloride 500mg tab 921 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 922 glipizide tab ip 5mg 923 glucagon 1 mg / vail inj. 924 glucosamine powder 925 glucosamine sulphate + chondroitin powder 926 glyburide + metformin tab 927 glyburide tab 928 glycerin ip 100 ml 929 glycerin ip 400 gm 930 glycerin ip 98%w / w liquid 931 glycerine 100 ml 932 glycerine 3000 ml 933 glycerine 400 ml 934 glyceryl trinitrate injection 935 glycopyrrolate inj 936 glycopyrrolate inj ip 0.2 mg / ml 937 gnrh analogue inj 938 gns 0.45% 100 ml iv 939 gns 0.45% 500 ml iv 940 gns 0.90% 500 ml iv 941 granisetron 1 mg tab 942 granisetron 3 mg tab 943 griseofulvin tab ip 125 mg 944 guaifenesin 100mg + terbutaline 2.5mg + bromhexine 8mg / 10ml syrup 945 h. pylori kit 1x 6 946 haemaccel 500 ml inj. 947 halobetasol propionate cream 948 haloperidol 5ml inj 949 halothane 250 ml inj 950 halothane bp 951 hamycin suspension 952 hemin injection 953 heparin + benzyl nicotinate 20 gm powder 954 heparin 25 k inj 955 heparin inj. 956 heparin sodium 1000iu / ml inj. 957 heparin sodium 5000iu / ml inj. 958 heparin sodium inj ip 5000 iu / ml ( im / iv use ) 959 hepatitis b immunoglobulin 100 iu inj. 960 hepatitis b immunoglubin for intravenous 2000 iu 40ml inj. 961 hepatitis b immunoglubin 200 iu 1ml inj. 962 homatropine eye drop 963 human albumin solution ip 20% 964 human anti d immunoglobulin inj 300 mcg 965 human chorionic ganadotropin 2000 iu inj 966 human chorionic ganadotropin 5000 iu inj 967 human chorionic gonadotropin injection ip 5000 i.u. 968 human immune globulin subcutaneous inj 969 human insulin r inj 970 human milk fortifier ( hmf sachets ) 971 hyaluronidase inj 972 hydralazine + hydrochlorothiazide tab 973 hydralazine tab 974 hydrochlorothiazide 12.5mg tab 975 hydrochlorothiazide 25mg tab 976 hydrochlorothiazide + triamterene tab 977 hydrochlorthiazide tab ip 12.5 mg 978 hydrochlorthiazide tab ip 25mg 979 hydrocortisone 100 ml inj. 980 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 981 hydrocortisone sodium succinate injection ip 100mg 982 hydrocortisone, neomycin, polymyxin b 5gm susp. 983 hydrogen peroxide 100 ml liquid 984 hydrogen peroxide 400 ml liquid 985 hydroquinone 2% + mometasone 0.1% + tretinoin 0.025 % cream 986 hydroquinone 2% cream 987 hydroquinone 2.0% w / w + tretinoin 0.025% w / w + mometasone furoate 0.1% w / w in a cream base q.s cream 988 hydroxychloroquine 400 mg tab 989 hydroxychloroquine 200mg tab 990 hydroxychloroquine sulphate tablets 200mg 991 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 992 hydroxyethyl starch in sodium chloride injection 3 % 993 hydroxyethyl starch in sodium chloride injection 6 % 994 hydroxyprogesterone 250 mg inj 995 hydroxyprogesterone 500 mg inj 996 hydroxyprogesterone inj ip 250mg / ml 997 hydroxyurea 500mg cap 998 hydroxyzine 25 mg tab 999 hydroxyzine hcl tablets ip 10mg 1000 hydroxyzine tab ip 25 mg 1001 hyoscine 2 ml inj 1002 hyoscine butyl bromide tablets ip 10mg 1003 hyoscine butylbromide + paracetamol tab 1004 hyoscine butylbromide inj ip 20 mg / ml 1005 hyoscine tab 1006 hypertonic saline ophthalmic solution 1007 hypromellose ( isopto tears ) ophthalmic solution 1008 i v i g inj. 1009 ibuprofen 400 mg tab 1010 ibuprofen + paracetamol + caffeine tab 1011 ibuprofen 400mg + paracetamol 325 mg tab 1012 ibuprofen 600 mg tab 1013 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 1014 ibuprofen film coated tablets ip 200mg 1015 ibuprofen oral suspension bp / usp 100 mg / 5 ml 1016 ibuprofen tab ip 200 mg ( coated ) 1017 ibuprofen tab ip 400 mg ( coated ) 1018 ibutilide fumarate inj 1019 imatinib mesylate 100 mg tab 1020 imatinib mesylate tablets ip 400mg 1021 imipenem + cilastatin injection 500mg / 500mg ip powder for solution 1022 imipenem 250 mg + cilastatin 250 mg inj 1023 imipenem 500mg and cilastatin 500mg inj 1024 imipramine 25 mg tab 1025 imipramine 75 mg tab 1026 imipramine + diazepam tab 1027 immune globulin intravenous infusion 5 mg 100 ml 1028 indapamide 1.5mg tab 1029 indomethacin 1 mg inj. 1030 indomethacin 25 mg cap 1031 indomethacin cap ip 25 mg 1032 indomethacin inj. 1033 infant milk formula lactogen & nanpro 1 400mg 1034 infliximab inj 1035 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1036 inj. pilocarpine 1037 inj. trypham. blue ( dyc ) 1038 insulin 30 / 70 ( human mistard ) inj 1039 insulin aspart inj 1040 insulin detemir inj 1041 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 1042 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 1043 insulin glargine inj 1044 insulin injection ( human ) ( 40iu / ml ) 1045 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 1046 insulin injection r 1047 insulin lispro inj 1048 intravenous fat emulsion infusion 1049 iohexol solution 300mg. 1050 ipratropium 20mcg + levosalbutamol 50 mcg inhaler 1051 ipratropium 20mcg, inhaler 1052 ipratropium 500mcg + levosalbutamol 1.25mg / 2.5 ml neb. 1053 ipratropium bromide + albuterol sulfate neb. 1054 ipratropium bromide inhalation 1055 ipratropium bromide nasal spray 1056 ipratropium bromide nebulizer solution 250 mcg / ml 1057 ipratropium powder for inhalation ip 40 mcg 1058 iron & zinc tab ( carbonyl iron 50 mg+ zinc sulphate monohydrate usp 61.8 mg equivalent to elemental zinc 22.5 mg + folic acid ip 0.5mg ) 1059 iron + folic acid + vitamin b12 tab 1060 iron + folic acid syrup 1061 iron dextran inj 1062 iron polymaltose complex + folic acid tab 1063 iron sorbitol inj 1064 iron sucrose 2 ml inj 1065 isabgol husk powder 1066 isoflurane 250mg inj 1067 isoflurane usp 1068 isolyte p 500 ml 10% inj 1069 isolyte p 500 ml ffs inj 1070 isolyte p 5% 500 ml inj. 1071 isoniazid inj 1072 isophane insulin inj ip 40 iu / ml 1073 isoprenaline inj 1074 isoprenaline injection ip 2mg / ml 1075 isoproterenol inj 1076 isosorbide 5 mononitrate 30 mg tab 1077 isosorbide dinitrate 10 mg tabs 1078 isosorbide dinitrate 5mg tab 1079 isosorbide dinitrate tab ip 5 mg 1080 isosorbide mononitrate tablets ip 20mg 1081 isosorbide mononitrate tabs ip 20 mg 1082 isotretinoin cap 20 mg 1083 isoxsuprine inj 1084 isoxsuprine inj ip 5 mg / ml 1085 isoxsuprine tab 10 mg 1086 isoxsuprine tab ip 20 mg 1087 itopride 20 mg tab 1088 itopride 10 mg tab 1089 itopride 50mg tab 1090 itraconazole 200 mg cap 1091 itraconazole 100mg caps 1092 itraconazole cap 100 mg 1093 ivermectin + albendazole tab 1094 ivermectin 6 mg tab 1095 ivermectin 12mg tab 1096 kabilyte 500 ml bottle ( balance fluid replenishment ) 1097 kanamycin inj 75 mg / 2 ml 1098 ketamine hydrochloride +amitriptyline 15gm inj 1099 ketamine hydrochloride 10 ml inj 1100 ketamine hydrochloride 2 ml inj 1101 ketamine inj ip 50 mg / ml 1102 ketoconazole shampoo 100 ml 1103 ketoconazole soap 1104 ketoconazole 200mg tab 1105 ketoconazole cream 2%w / w 1106 ketorolac dt 10mg tab 1107 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 1108 ketotifen ophthalmic solution 1109 kit of mifepristone 200mg ( 1 tab ) + misoprostol 200mcg ( 4 tabs ) 1110 labetalol 20 mg 2 ml inj 1111 labetalol 100mg tab 1112 labetalol 5mg / ml inj 1113 labetalol hcl inj ip 20mg / 4ml 1114 labetalol tab ip 100mg 1115 lactated ringers and 5% dextrose injection ffs 1116 lactated ringers and 5% dextrose injection pps 1117 lactic acid + nicotinamide + folic acid oral susp. 1118 lactic acid bacillus tab 60 million spores 1119 lactitol sachet 1120 lactobacillus sporogenes 60 million spores tabs 1121 lactose face furmula milk sol 1122 lactulose enema 250 ml oral sol. 1123 lactulose 10 g / 15 ml syrup 1124 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml 1125 lamivudine + nevirapine + stavudine tab 1126 lamivudine + stavudine tab 1127 lamivudine + zidovudine + nevirapine tab 1128 lamivudine 100 mg tab 1129 lamivudine 150 mg + zidovudine 300 mg tab 1130 lamotrigine 100 mg dt tab 1131 lamotrigine 25 mg dt tab 1132 lamotrigine 50 mg tab 1133 lanreotide inj 1134 lansoprazole 15 mg inj 1135 lansoprazole 30 mg inj 1136 lansoprazole + amoxicillin + clarithromycin cap 1137 laxative suspension liqid paraffin 3.75ml+milk of magnesia 11.25ml ) 1138 lbw formula milk 1139 leflunomide 10 mg tab 1140 leflunomide tablets ip 10mg ( film coated ) 1141 leflunomide tablets ip 20mg 1142 lenalidomide capsules 10mg 1143 letrozole tablets 2.5mg 1144 leucovorin calcium 15 mg tab 1145 leucovorin calcium 50 mg tab 1146 levamisole adult 1147 levamisole paed 1148 levetiracetam 500mg tab 1149 levetiracetam inj. 1150 levetiracetam syrup 100mg / 5ml 1151 levocarnitine 250 mg 1152 levoceitrizine tablet 5mg 1153 levocetirizine 30 ml inj 1154 levocetirizine 60 ml inj 1155 levocetirizine + montelukast tab 1156 levocetrizine 5 mg tabs 1157 levocetrizine hcl 5mg, phenylephrine hcl 5mg, ambroxol hcl 30mg, paracetamol 325mg tab 1158 levodopa + carbidopa + entacapone tab 1159 levodopa and carbidopa tab 1160 levodopa tab 1161 levodropropizine oral susp 1162 levofloxacin 750 mg tab 1163 levofloxacin 250 mg tabs 1164 levofloxacin 500 mg infusion 1165 levofloxacin 500 mg infusion / iv 1166 levofloxacin 500 mg tabs 1167 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 1168 levofloxacin tablets ip 250 mg 1169 levoleucovorin inj 1170 levonorgestrel + ethinyl estradiol tab 1171 levonorgestrel tab 1172 levosalbutamol + ipratopium neb 1173 levosalbutamol 100ml syp 1174 levosalbutamol 1mg tab 1175 levosalbutamol 2mg tab 1176 levosulpiride 50 mg tab 1177 levosulpiride 75mg + esomeprazole 40mg caps 1178 levosulpiride 75mg + pantoprazole 40mg caps 1179 levosulpiride tablets 25mg 1180 levosulpiride ( sr ) 75mg + rabeprazole ( ec ) 20mg caps 1181 levo thyroxine sodium 100mcg tab 1182 levo thyroxine tablets ip 50 mcg ip 1183 lignocaine ( lidocaine ) hydrochloride gel ip 2% w / v 1184 lignocaine + adrenaline ( 1% + 2% ) w / v inj. 1185 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 1186 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg 1187 lignocaine gel ip 2% 1188 lignocaine heavy 5% inj 1189 lignocaine inj ip 2 o / o 1190 lignocaine ointment 5 o / o 1191 lincomycin 2 mg tab 1192 lincomycin 2 ml inj 1193 linezolid 100 mg tab 1194 linezolid 200 mg / 100 ml infusion 1195 linezolid 200 mg / 300 ml infusion 1196 linezolid 300 mg tab 1197 linezolid 20 lid 100 ml inj. 1198 linezolid 600 mg tab 1199 linezolid infusion 600mg / 300ml 1200 linezolid inj 200mg / 100ml 1201 linezolid tablets ip 600 mg 1202 lipid complex inj. 1203 liposomal amphotericin b inj. 1204 liposomol amphotericine b injection 10 mg 1205 liquid medical oxygen ( lmo ) 1206 liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg / 5ml emulsion sol 1207 liquid paraffin ip 100 ml 1208 liquid paraffin ip 400 ml 1209 liquid parafin 100 ml syp 1210 lisinopril 2.5 mg tab 1211 lisinopril + amlodipine ( 5 mg + 5mg ) tabs 1212 lisinopril + hydrochlorothiazide tab 1213 lisinopril 5mg tabs 1214 lisinopril tab ip 2.5 mg 1215 lisinopril tab ip 5 mg 1216 lisinopril tablets ip 10 mg 1217 lithium carbonate tab 1218 l lysine + multivitamins ( vit b1, b2, b3, b5, b6 ) syrup 1219 l methylfolate calcium 7.5mg tablet 1220 loperamide tab 1221 loperamide tab ip 2 mg 1222 loratadine + ambroxol tab 1223 loratadine + pseudoephedrine tab 1224 loratidine 10mg tab 1225 lorazepam 0.5 mg tab 1226 lorazepam 0 .25 mg tab 1227 lorazepam tablets ip 1mg 1228 lorazepam tablets ip 2mg 1229 losartan + h.ch. thaizide ( 50 mg + 12.5mg ) tabs 1230 losartan 25mg tabs 1231 losartan 50mg + amlodipine 5mg tab 1232 losartan potassium 50 mg tabs 1233 losartan tab ip 25 mg 1234 losartan tab ip 50 mg 1235 lotion betamethasone 0.05% 1236 low lactose formula nanlolac 200mg 1237 lsosartan potassium 50 mg tab 1238 lumafantrine + artesunate tab 1239 lumefantrine tab 1240 lycopene antioxidant + multi vitamin cap 1241 lymphocyte immune globulin inj 1242 magaldrate + simethicone + oxetacaine syp 1243 magaldrate 400 mg + simethiocone 20 mg syp 1244 magensium sulphate inj. 1245 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 1246 mannitol 350 ml ffs inj 1247 mannitol ( 10% ) with glycerin inj 1248 mannitol + glycerine iv inj 1249 mannitol inj ip 20% w / v 1250 measles, mumps, and rubella ( mmr ) vaccine inj 1251 meclizine tab 1252 mecobalamin 10 ml inj 1253 mecobalamin 1500 mcg tab 1254 mecobalamin 500 mcg tab 1255 mecobalamin + lipoic acid + folic acid + pyridoxine tab / cap 1256 mecobalamin + pregabalin cap 1257 mecobalamin + thiamine + pyridoxine + l0lysine + d 0 panthenol tab / cap 1258 mecobalamin 500 mcg 1 ml inj 1259 medium chain triglyceride ( mct oil ) 50 ml 1260 medroxyprogesterone 10 mg tab 1261 mefenamic acid 250 mg tab 1262 mefenamic acid 500 mg tab 1263 mefenamic acid + dicyclomine tab 1264 mefenamic acid 500mg + paracetamol 325mg tab 1265 mefenamic acid 50mg, paracetamol 125mg / 5ml suspension 1266 mefenamic acid suspension 100mg / 5ml 1267 mefenamic acid tablets bp 500 mg 1268 mefloquine + artesunate tab 1269 mefloquine tab 1270 melatonin supplement 1271 melphalan inj 1272 mephentermine inj 1273 meropenem 125 mg inj 1274 meropenem 250 mg inj 1275 meropenem inj ip 500 mg 1276 meropenem inj. ip 1gm 1277 meropenem injection ip 250 mg 1278 metformin 1000mg sr + glimipride 2mg tablet 1279 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 1280 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 1281 metformin hydrochloride 1000 mg sr tabs 1282 metformin hydrochloride 500mg tabs 1283 metformin hydrochloride prolong release 500mg tab 1284 metformin hydrochloride ( sustained release tablets ip 1000 mg 1285 metformin sr tablets ip 850mg 1286 metformin tab ip 500 mg ( film coated ) 1287 methacholine chloride inj 1288 methamphetamine hydrochloride tab 1289 methlprednisolone iv inj. 1290 methotrexate 1 gm inj 1291 methotrexate 15 gm inj 1292 methotrexate 2.5mg tab 1293 methotrexate 500mg inj 1294 methoxsalen inj 1295 methyl ergometrine 0.125mg tabs 1296 methyl ergometrine inj 1297 methyl prednisolone sodium succinate 1000mg inj 1298 methyl prednisolone sodium succinate for injection usp 500 mg 1299 methylcobalamin + nicotinamide tab 1300 methylcobalamin 1500mcg tab 1301 methylcobalamin 500 mcg + vitamin tab 1302 methylcobalamin + pyridoxine + folic acid tab 1303 methylcobalamin 200 ml bottle syp 1304 methylcobalamin 5 ml / 500 mg syp 1305 methylcobalamin 500mcg inj 1306 methyldopa 250 mg cap 1307 methyldopa + hydrochlorothiazide cap 1308 methyldopa tab ip 250mg film coated 1309 methylergometrine inj ip 0.2 mg / ml 1310 methylergometrine tab ip 0.125 mg 1311 methylphenidate hydrochloride tab 1312 methylprednisolone 4 mg tab 1313 methylprednisolone 8 mg tab 1314 methylprednisolone 1 gm inj 1315 methylprednisolone 16 mg tab 1316 metoclopramide hydrochloride syrup ip 5 mg / 5ml 1317 metoclopramide inj ip 10mg / 2ml 1318 metoclopramide injections ip 5mg / ml 1319 metoclopramide tab ip 10 mg 1320 metolazone tab 1321 metoprolol 100mg tab 1322 metoprolol 25 mg tabs 1323 metoprolol 50 mg tabs 1324 metoprolol 50mg + amlodipine 5mg tab 1325 metoprolol succinate 25 mg extended release tab 1326 metoprolol succinate 50 mg extended release tab 1327 metoprolol succinate extended release tablets ip 50 mg 1328 metoprolol tablets ip 25 mg 1329 metoprolol tartrate and hydochlorothiazide tab 1330 metrogyl 100 ml inj. 1331 metronidazole 400 mg tabs 1332 metronidazole 5 mg / ml infusion 1333 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 1334 metronidazole film coated tablets ip 200mg 1335 metronidazole inj ip 500 mg / 100ml 1336 metronidazole tablets ip 200 mg ( film coated ) 1337 metronidazole tablets ip 400 mg ( film coated ) 1338 miconazole 15gm cream 1339 miconazole + flucinolone 15gm cream 1340 miconazole nitrate cream ip 2% 1341 micronisid progesterone 200 mg cap 1342 midazolam 10 ml inj 1343 midazolam 1mg / ml 5 ml inj 1344 midazolam inj ip 1 mg / ml 1345 midodrine hydrochloride tab 1346 mifepristone 200 mg tabs 1347 mifepristone tab ip 200mg 1348 miglitol 25 mg tab 1349 miglitol 50 mg tab 1350 milk formula for lbw 100ml 1351 milk formula for lbw 340ml 1352 milrinone inj 1353 minocycline hydrochloride cap 1354 minoxidil 10% topical solution 1355 minoxidil 2% topical solution 1356 minoxidil 5% topical solution 1357 mirabegron er 50 mg. tablets 1358 mirtazapine 30mg tab 1359 mirtazapine 7.5mg tab 1360 misoprostol 200mcg film coated tabs 1361 misoprostol tab ip 200 mcg 1362 mometasone + nadifloxacin + miconazole cream 1363 mometasone furoate + hydroquinone + tretinoin 15gm cream 1364 mometasone furoate 0.1 % w / w cream 1365 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 1366 montelukast 10mg + fexofenadine hcl 120mg tab 1367 montelukast 4 mg tab 1368 montelukast sodium + levocetrizine ( 10 mg + 5mg ) tab 1369 montelukast sodium 10 mg tab 1370 montelukast sodium 5 mg tab 1371 morphine sulfate + naltrexone hydrochloride inj 1372 morphine sulfate inj 1373 morphine sulphate inj ip 10mg / ml 1374 mosapride sol. 1375 mouth ulcer gel ( choline salicylate sodium 9% w / v, benzalkonium chloride 0.01% w / w ) 1376 moxifloxacin 400mg tab 1377 moxifloxacin hcl+ dexamethasone + benzalkonium chloride solution 0.02% v / v sterile opthelmic sol 1378 moxifloxacin inj 1379 mucodilator expectorant terbutaline sulphate 1.25 mg, bromhexine 4 mg, guaiphenesin 50 mg, menthol 2.5 mg per 5 ml syp 1380 multiple electrolytes & dextrose inj. 10% 500ml i.v. bottle ( e.g.: isolyte p rorte 10% ) 1381 multiple electrolytes and dextrose injection ffs 1382 multistix plt. 1383 multivitamin syp 1384 multivitamins ( b complex ) tab 1385 mupirocin ointment 2% w / w 1386 n acetyl cysteine neb. 1387 nalidixic acid oral syp 1388 naloxone inj 1389 naltrexone tab 1390 nandralone decanoate 100mg inj 1391 nandralone decanoate 50mg inj 1392 nandrolone decanoate 25mg / ml inj 1393 naproxen 275 mg tab 1394 naproxen 550 mg tab 1395 naproxen + esomeprazole magnesium tab 1396 naproxen tablet ip 250mg 1397 naproxen tablet ip 500mg 1398 naratriptan tab 1399 nateglinide tab 1400 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 1401 nebivolol 2.5 mg tab 1402 nebivolol 5 mg tab 1403 nebivolol + amlodipine tab 1404 nebivolol + valsartan tab 1405 nebivolol 5 mg, hydrochlorothiazide 12.5 mg tab. 1406 nebivolol tablets ip 10mg 1407 neomycin 0.5% +fluocinalone0.025%+clotrimazole 1% 15gm cream 1408 neomycin and dexamethasone ophthalmic ointment 1409 neomycin and polymyxin b sulfates and hydrocortisone otic solution 1410 neomycin and polymyxin b sulfates, bacitracin zinc, and hydrocortisone oint 5 gm 1411 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 1412 neomycin powder 1413 neomycin, polymyxin and bacitracin zinc ophthalmic ointment 20 gm 1414 neomycin, polymyxin and bacitracin zinc ophthalmic powder 10gm oint 1415 neomycin, polymyxin b and dexamethasone ophthalmic otic solution 1416 neomycin, polymyxin b and hydrocortisone 5gm oint 1417 neomycin, sulphacetamide sodium, bacitracin zinc powder 1418 neostigmine 1 ml inj 1419 neostigmine 5 ml inj 1420 neostigmine tab ip 15 mg 1421 nepafenac 0.1% w / v eye drop 1422 nesiritide inj 1423 netilmicin 10 mg inj 1424 netilmicin 20 mg inj 1425 netilmicin 25 mg inj 1426 netilmicin 50 mg inj 1427 nevirapine 200 mg tab 1428 niacin + lovastatin tab 1429 niacin tab 1430 nicardipine hydrochloride infusion solution 20mg / 200ml 1431 nicorandil 10mg tab 1432 nicorandil 5 mg tab 1433 nicotine gum 1434 nicotine inhalation system inhaler 1435 nicotine nasal spray 1436 nifedipine 10mg cap 1437 nifedipine cap ip 5mg 1438 nifedipine prolonged release 20mg tab 1439 nifedipine tablets ip 10 mg ( sustained release ) 1440 nimesulide + dicyclomine tab 1441 nimesulide + paracetamol + chlorozoxone tab 1442 nimesulide + paracetamol tab 1443 nimesulide + pcm+ cet+pph+caffine tab 1444 nimesulide + serratiopeptidase tab 1445 nimesulide + tizanidine tab 1446 nimesulide 1% w / w gel 1447 nimesulide 100 mg tab 1448 nimodipine cap 1449 nitrofurantoin tablets i.p 100mg 1450 nitroglycerin 2.6 mg tab 1451 nitroglycerin inj 5 mg / ml 1452 nitroglycerin ointment 1453 nitroglycerine injection 5mg / ml 1454 nitroprusside sodium inj 1455 noradrenaline injection ip 2 mg / ml 1456 norepinephrine bitartrate inj 1457 norethindrone acetate and ethinyl estradiol tab 1458 norethisterone 5mg tab 1459 norethisterone tab ip 5 mg 1460 norfloxacin 400 mg tab 1461 norfloxacin + metronidazole 30 ml tab 1462 norfloxacin 400mg + tinidazole 600 mg tabs 1463 norfloxacin tab ip 400mg film coated 1464 norgestimate and ethinyl estradiol tablets 1465 normal saline 500 ml inj. 1466 nortriptyline tablet 25mg tablet 1467 octreotide inj 1468 octreotide injection 50 mcg / ml 1469 ofloxacin 100 mg tab 1470 ofloxacin 50mg tab 1471 ofloxacin + dexamethasone infusion 1472 ofloxacin + metronidazole infusion 1473 ofloxacin + tinidazole infusion 1474 ofloxacin 200 mg tabs 1475 ofloxacin 200mg + ornidazole 500 mg tab 1476 ofloxacin 200mg+ornidazole500mg infusion 1477 ofloxacin 400 mg tabs 1478 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 1479 ofloxacin eye drops 0.3%w / v 1480 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) 1481 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 1482 ofloxacin oral suspension ip 50mg / 5ml 1483 ofloxacin tab ip 200 mg 1484 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 1485 oitment mupirocin ip 2% 1486 olanzapine and fluoxetine cap 1487 olanzapine tablets i.p 10mg 1488 olanzapine tablets i.p 5mg 1489 olmesartan 20 mg tab 1490 olmesartan 20mg + amlodipine 5mg tab 1491 olmesartan 40mg tab 1492 olmesartan medoxomil 20 mg+ hydrochlorothiazide 12.5 mg tab 1493 olmesartan medoxomil 40mg + hydroclorthiazide 12.5mg tab 1494 olmesartan tablets 20mg 1495 olmesatan medoxomil & metoproloi succinate er tablet 25 mg 1496 olmesatan medoxomil tablet 20 mg 1497 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 1498 olopattadine eye drops 1499 omalizumab inj 1500 omega 3 acid ethyl esters cap 1501 omeprazole 40 mg cap 1502 omeprazole + domperidone ( 20 mg + 10 mg ) caps 1503 omeprazole 20 mg tabs 1504 ondansetron 8 mg tab 1505 ondansetron 10 ml inj 1506 ondansetron 2 mg / ml inj. 1507 ondansetron 4 mg tabs 1508 ondansetron oral solution i.p 2 mg / 5ml 1509 ondansetron orally disintegrating tablets ip 4mg 1510 oral rehydration salts citrate ip 21 gm ( who formula ) sachet 1511 orciprenaline syp 1512 orlistat 120 mg cap 1513 orlistat 60 mg cap 1514 ornidazole 500 mg tabs 1515 ors powder 21.2 gm 1516 ors powder 4.21 gm 1517 oseltamivir 75 mg cap 1518 oxaliplatin 100 mg inj 1519 oxaliplatin injections 50mg 1520 oxazepam cap 1521 oxcarbazepine 150 mg tab 1522 oxcarbazepine tablets i.p 300mg 1523 oxetacaine 10mg + aluminium 0.291mg + magnesium 98mg / 5ml gel 1524 oxymetazoline 0.5mg / ml nasal drops 1525 oxytocin 5 iu / ml inj. 1526 oxytocin inj ip 5 iu / ml 1527 paclitaxel 260 mg vial inj 1528 paclitaxel 30 mg vial inj 1529 paclitaxel injection 100mg 1530 pamidronate inj 1531 pancreatin 150 mg tab 1532 pancrelipase delayed release cap 1533 pancuronium bromide inj 1534 pantoprazole + domperidone dsr cap 1535 pantoprazole 40 mg tabs 1536 pantoprazole 40 mg / 10ml inj. 1537 pantoprazole 40mg + itopride 150mg s.r. tab 1538 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 1539 paracetamol 100 ml ffs infusion 1540 paracetamol 125 mg / 5 ml syrup 1541 paracetamol 125mg+ cpm 1 mg + sodium citrate 60mg in a flavour syrup base 1542 paracetamol 325mg + diclofenac sodium 50 mg tab 1543 paracetamol 325mg + tramadol 37.5mg tab 1544 paracetamol 500mg + phenylephrine 10mg + chlorpheniramine 2mg tab 1545 paracetamol 500mg tab 1546 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 1547 paracetamol ds syrup / 250 mg 1548 paracetamol infusion ip 1% w / v 100ml size 1549 paracetamol inj. 150 mg / ml 1550 paracetamol ip 125mg, promethazine hcl 5mg suspension 1551 paracetamol ip…125 mg., mefanamic acid ip…50 mg., in a flavoured syrup base…q.s. 1552 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 1553 paracetamol tab ip 500 mg 1554 paracetomal 650mg tab 1555 paroxetine 12.5 mg tab 1556 paroxetine 25 mg tab 1557 paroxetine 37.5 mg tab 1558 pc enema 1559 pefloxacin tab 1560 peg ( alprastadil ) ( prostaglandin e1 500 mcg inj. 1561 penicillamine cap 1562 penicillin g benzathine and penicillin g procaine inj 1563 penicillin g potassium inj 1564 penicillin g potassium or sodium injection 1565 penicillin procaine inj 1566 penicillin v potassium oral syp 1567 pentamidine isethionate inj 1568 pentazocine + acetaminophen tab 1569 pentazocine + aspirin tab 1570 pentazocine + naloxone tab 1571 pentazocine inj ip 30mg / ml ( im / iv use ) 1572 pentobarbital inj 1573 pentoprazole inj 40 mg 1574 pentoxifylline inj 1575 pepsin 10mg + diastase 50mg oral liquid / 5 ml 1576 perindopril + indapamide tab 1577 perindopril 4 mg tab 1578 permethrin cream 5% w / w 1579 pheniramine inj ip 22.75mg / ml 1580 pheniramine maleate 25 mg tabs 1581 pheniramine maleate i.p. 22.75mg, methyl paraben ( as preservative ) i.p. 0.135% w / v, propyl paraben ( as preservative ) i.p. 0.015% w / v, water for injection i.p. q.s. inj 1582 phenobarbitone 60 mg tab 1583 phenobarbitone inj 1584 phenobarbitone tablets i.p 30mg 1585 phenoxybenzamine cap 1586 phentermine cap 1587 phentolamine mesylate inj 1588 phenylbutazone cap 1589 phenylephrine inj 1590 phenylephrine hydrochloride 5.00mg chlorpheniranmine maleate 2.00mg eye drops 1591 phenytoin 200 ml inj 1592 phenytoin 50 mg tab 1593 phenytoin 50 mg / ml, 2 ml inj 1594 phenytoin sodium 100 mg tabs 1595 physostigmine inj. 1596 pilocarpine tab 1597 pimecrolimus cream 1598 pioglitazone 30 mg tab 1599 pioglitazone 7.5 mg tab 1600 pioglitazone 15 mg tabs 1601 pioglitazone 15 mg tabs + metformin 500mg tab 1602 pioglitazone 30 mg tabs 1603 pioglitazone hydrochloride + glimepiride tab 1604 pioglitazone tab ip 15 mg 1605 piperacillin + tazobactum for injection ip 4gm+500mg 1606 piperacillin 1 mg and tazobactam 125 mg inj 1607 piperacillin 2 mg and tazobactam 250 mg inj 1608 piperacillin 4gm + tazobactum 0.5 mg inj. 1609 piperacillin injection 2 gm + tazobactom 250mg ip 1610 piperacillin sodium inj 1611 piracetam 100ml inj 1612 piracetam 200ml inj 1613 piracetam 800mg tab 1614 piracetam syrup 500mg / 5ml 1615 piracetam tablets 400mg 1616 piroxicam cap 1617 piroxicam 20 mg tablets 1618 piroxicam 20 mg with bezyl alcohol injection 1619 piroxicam 20mg caps 1620 piroxicam 40 mg with bezyl alcohol injection 1621 polymixin sulphate b injection usp 5 lac i.u. 1622 polymyxin b inj. 1623 polyvitamin ( prophylactic ) nfi tabs 1624 potassium chloride 200 ml inj 1625 potassium nitrate + sodium fluoride mouthwash 1626 povidone iodine 100 ml sol 1627 povidone iodine 2 litre 1628 povidone iodine + metronidazole 15 gm tube 1629 povidone iodine 10 % solution ip 1630 povidone iodine 250 gm jar 1631 povidone iodine 5 % solution 1632 povidone iodine 5% w / w ointment 1633 povidone iodine 500 gm 1634 povidone iodine 7.5% scrub solution 1635 povidone iodine ointment 5% 15 gm 1636 povidone mouthwash 50 ml 1637 povidone vaginal cream 1638 powder clotrimazole 1% w / w 30 gm 1639 pralidoxime chloride ( pam ) inj 1640 praziquantel tab 1641 prazosin 5mg tab 1642 pre biotic sachet ( 1 gm sachet ) 1643 pre probiotics sachet 1644 prednisolone tab ip 20 mg 1645 prednisolone tablet ip 10 mg 1646 prednisolone tablets ip 5 mg 1647 prednisolone, neomycin and polymyxin b ophthalmic suspension 1648 pregabalin 150 mg cap 1649 pregabalin + methylcobalamine + alphalipoic acid + folic acid + pyridoxine cap 1650 pregabalin 75mg + methylcobalamin 750 mcg tab 1651 pregabalin 75mg tab 1652 pregabalin capsules 75mg 1653 preterm / l.b.w. formula milk powder ( packaging 400 gm ) 1654 primaquine 15 mg tabs 1655 primaquine tab ip 2.5 mg 1656 primaquine tab ip 7.5 mg 1657 pro biotic sachet 1658 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1659 prochlorperazine 5 mg tabs 1660 prochlorperazine maleate tablets i.p 5mg 1661 prochlorperazine mesylate injection 12.5mg / ml 5ml size 1662 progesterone 100 mg cap 1663 progesterone 200 mg 1 ml inj 1664 progesterone 200 mg cap 1665 progesterone inj 200 mg / 2ml 1666 promethazine + pcm tab 1667 promethazine ( 5 mg / 5ml ) syrup 1668 promethazine 25mg tab 1669 promethazine hcl + dextromethorphan hydrobromide syp 1670 promethazine hcl + phenylephrine hcl syrup 1671 promethazine inj ip 25mg / ml 1672 promethazine syrup ip 5 mg / 5ml 1673 promethazine tab ip 25 mg 1674 propofol 1 % 20 ml inj 1675 propofol inj ip 10 mg / ml 1676 propoxyphene tab 1677 propoxyphene napsylate and acetaminophen cap 1678 propoxyphene, aspirin, and caffeine tab 1679 propranolol hydrochloride + hydrochlorothiazide tab 1680 propranolol tab ip 40 mg 1681 propranolol tablets ip 10mg 1682 prostadine inj. 1683 protamine sulphate iv solution 1684 protein supplement 1685 psoralen inj 1686 pyrantal pamoate tab 1687 pyrazinamide 750 mg tab 1688 pyrazinamide tablets i.p 1000mg 1689 pyridostigmine inj 1690 pyridoxine 40 mg tab 1691 pyridoxine + folic acid sustained release tab 1692 quetiapine fumarate tablets i.p 200mg 1693 quetiapine tablets i.p 100mg 1694 quinine 300 mg / 2ml inj 1695 quinine sulphate 300mg tab 1696 rabeprazole + domperidone sr ( 20 mg + 30 mg ) tabs 1697 rabeprazole 20 mg tabs 1698 rabeprazole 20mg + domperidone 10mg cap 1699 rabies immune globulin ( human ) inj 1700 racecadotril 10 mg tab 1701 racecadotril 100 mg tab 1702 racecadotril 30 mg tab 1703 racecadotril sachet 1 gm 1704 ramipril 10 mg tab 1705 ramipril + telmisartan tab 1706 ramipril 2.5 mg tabs 1707 ramipril 5 mg tabs 1708 ramipril 5mg + hydroclorthiazide 12.5mg tab 1709 ranitidine ( 50 mg / 2ml ) inj. 1710 ranitidine + domperidone tab 1711 ranitidine hcl. 150 mg tabs 1712 ranitidine hcl. 300 mg tabs 1713 ranolazine tab 1714 rattle snake antivenin polyvalent inj 1715 ravlon solution ( chlorhexidine + cetramide ) ( 1.5 % w / v + 3% w / v ) solution 1716 recombinant hpv bivalent vaccine inj 1717 recombinant hpv quadrivalent vaccine inj 1718 recombinant interferon inj 1719 rectified spirit 1720 repaglinide tab 1721 repaglinide + metformin hcl tab 1722 resp. levosalbutamol 2.5ml for 5 resp. 1723 reteplase inj 1724 rho ( d ) immune globulin human inj 1725 ribavirin tab 1726 ribavirin, interferon alfa 2b, recombinant inj 1727 rifabutin oral solution 1728 rifampicin 150 mg tab 1729 rifampicin 300 mg tab 1730 rifampicin 450 mg tab 1731 rifampicin 600 mg tab 1732 rifampicin and isoniazide tablets ip ( 450 mg+300 mg ) 1733 rifampin + isoniazid + ethambutol tab 1734 rifampin + isoniazid + pyrazinamide kid tab 1735 rifapentine tab 1736 ringer lactate inj 1737 ringer lactate iv 500 ml glass inj 1738 ringer lactate iv 500 ml pps inj 1739 risperidone 1 mg tab 1740 risperidone 2mg tab 1741 risperidone 3mg tab 1742 risperidone tablets 4mg 1743 ritodrine tab 1744 ritonavir 100 mg tab 1745 rituximab inj 1746 rivastigmine cap 1747 rizatriptan wafer 10 mg cap 1748 rocuronium 50 mg inj 1749 rofecoxib tab 1750 rosiglitazone maleate + glimepiride tab 1751 rosiglitazone maleate + metformin hcl tab 1752 rosiglitazone maleate tab 1753 rosuvastatin 10mg + asprin 75mg tab 1754 rosuvastatin 40mg tab 1755 rosuvastatin 10mg + fenofibrates 160mg tab 1756 rosuvastatin 20mg tab 1757 rosuvastatin tablet 10 mg 1758 rosuvastatin tablet i.p 5mg 1759 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 1760 roxithromycin 50 mg tab 1761 roxithromycin ( 50 mg / 5ml ) susp. 1762 roxithromycin + ambroxol tab 1763 roxithromycin 150 mg tabs 1764 roxithromycin ip 300 mg tabs 1765 rucoranium inj 1766 salbutamol 100 mcg neb 1767 salbutamol 2.5 mg / 2.5 ml syrup 1768 salbutamol 200 mcg inhaler 1769 salbutamol + ambroxyl 100 ml syp 1770 salbutamol + bromhexine+ guiphenesin+menthol 100 ml syp 1771 salbutamol + bromhexine+ guiphenesin+menthol 60 ml syp 1772 salbutamol + theophylline 100 ml syp 1773 salbutamol 2 mg tabs 1774 salbutamol inhalation 100 mcg / dose 1775 salbutamol nebuliser solution bp 5 mg / ml 1776 salbutamol syrup ip 2mg / 5ml 1777 salbutamol tab ip 2 mg 1778 salbutamol tablet ip 4 mg 1779 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 1780 salmeterol inhalation powder 1781 salmeterol xinafoate + fluticasone powder for inhalation 1782 s amlodipine 2.5mg tab 1783 saxagliptin tab 1784 sclerosol intrapleural aerosol ( talc ) powder 1785 scopolamine transdermal patch 1786 scorpion vaccine 1787 secnidazole oral granules 1788 selegiline tab 1789 selenium inj 1790 serratiopeptidase 5 mg tab 1791 serratiopeptidase + diclofenac + pcm tab 1792 serratiopeptidase + diclofenac tab 1793 serratiopeptidase 10 mg tab 1794 sertraline tablets 50mg 1795 sertraline tablets i.p 100mg 1796 sertraline tablets i.p 25mg 1797 sevoflurane 1798 sildenafil 10 mg inj. 1799 sildenafil 50mg tab 1800 sildenafil citrarte inj. 10mg / 12.5 ml for iv use 1801 sildenafil tablets 100 mg 1802 silver sulfadiazine 10 gm cream 1803 silver sulfadiazine 15 gm cream 1804 silver sulfadiazine 500 gm cream 1805 silver sulphadiazine cream ip 1% 50gm tube 1806 simvastatin 10 mg tabs 1807 simvastatin 20 mg tabs 1808 sitagliptin + metformin hcl tab 1809 sitagliptin tab 1810 sodium bi carbonate 10ml inj. 1811 sodium bicarbonate 7.5 ( sbc ) inj 1812 sodium chloride 0.65% w / v nasal drops 1813 sodium chloride 100 ml inj 1814 sodium chloride 500 ml ffs inj 1815 sodium chloride 500 ml pps inj 1816 sodium cromoglycate oral concentrate 1817 sodium hyaluronate intra articular injection 1818 sodium nitroprusside inj 1819 sodium phosphate enema 100 ml 1820 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 1821 sodium picosulphate 10mg tab 1822 sodium polystyrene sulfonate oral syp 1823 sodium sulfacetamide lotion 1824 sodium sulphacetamide 10 % ophthalmic solution 1825 sodium valproate + valproic acid tab 1826 sodium valproate 100 mg / 5ml vial inj. 1827 sodium valproate 1ml 100 mg inj. 1828 sodium valproate 500 mg tab 1829 sodium valproate ec tablets i.p 200mg 1830 sodium valproate tablets 300mg 1831 somatostatin cap 1832 somatropin injection 1833 sotalol inj 1834 sparfloxacin 200 mg tab 1835 spectinomycin inj 1836 spiramycin inj 1837 spironolactone 100 mg tab 1838 spironolactone 50 mg tab 1839 spironolactone + hydrochlorothiazide tab 1840 spironolactone 25mg tab 1841 spironolactone tab ip 25mg 1842 spironolactone tablets ip 50 mg 1843 stavudine 30 mg cap 1844 stavudine 40 mg cap 1845 sterilized umbilical cotton tape width 3 mm , length 75 cm 1846 sterlium hand wash 1847 streptokinase 1500000 iu inj 1848 streptokinase injection 15 lac units ip 1849 streptomycin 1 gm inj 1850 succinylcholine inj 1851 succinylcholine inj. ip 50 mg / ml ( iv use ) 1852 sucralfate + metronidazole + lignocain cream 1853 sucralfate 1gm with oxetacain 10mg / 10ml suspension 1854 sucralfate suspension 500mg / 5ml 1855 sulfacetamide eye drop 10 % 1856 sulfacetamide eye drop 20 % 1857 sulfadoxine + pyrimethamine eye oint 1858 sulfamethoxazole + trimethoprim tab 1859 sulfamethoxazole inj 1860 sulfamethoxazole, trimethoprim, phenazopyridine tab 1861 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 1862 sulfasalazine tab ec bp 500mg 1863 sumatriptan and naproxen sodium tab 1864 sumatriptan inj 1865 sumatriptan succinate 50mg tab 1866 sumatriptan succinate25mg tab 1867 surfactant 3ml inj 1868 surfactant 4ml inj 1869 surfactant 5ml inj 1870 surfactant 8ml inj 1871 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 1872 surgical spirit 5lt. 1873 synthetic conjugated estrogens 1874 syrup vitamin d3 200 iu + vitamin b12 2.5 mcg + calcium phosphate eq. to elemental calcium 82 mg / 5 ml 1875 tacrolimus 0.03% oint 1876 tacrolimus 0.1% oint 1877 tadalafil 10 mg tab 1878 tadalafil 20mg tab 1879 tamoxifen citrate 10 mg tab 1880 tamoxifen citrate 20 mg tab 1881 tamsulosin 0.2 mg tab 1882 tamsulosin 0.4mg + dutasteride 0.5mg tab 1883 tamsulosin hydrochloride 0.4mg + finasteride 5 mg tab 1884 tamsulosin modified release capsules 0.4 mg 1885 tegaserod maleate 6 mg 1886 teicoplanin 200 mg inj 1887 teicoplanin 400 mg inj 1888 telmisartan 80 mg tab 1889 telmisartan + hydrochlorthiazide ( 40 mg + 12.5 mg ) tabs 1890 telmisartan 20 mg tabs 1891 telmisartan 40 mg tabs 1892 telmisartan 40mg + amlodipine 5mg tab 1893 telmisartan 40mg + chlorthalidone 12.5mg tab 1894 telmisartan 80mg, hydroclorthiazide 12.5mg tablets 1895 telmisartan tablets ip 40 mg 1896 telmisartan+metoprolol ( 50 / 40 mg ) tablets 1897 tenaligliptin tablet ip 20mg 1898 tenecteplase inj 1899 teneligliptin film coated tablets 20mg 1900 tenofovir 300 mg tab 1901 tenofovir disoproxil fumarate + emtricitabine tab 1902 terazosin cap 1903 terbinafine 250mg tab 1904 terbinafine cream 1%w / w ( 10 gm tube ) 1905 terbinafine hydrochloride tablet 250 mg 1906 terbutaline 2.5 mg tab 1907 terbutaline 5 mg tab 1908 terbutaline 2.5mg + bromhexine 8mg / 10 ml syrup 1909 terbutaline sulfate + brom + guiphenesin 100 ml syrup 1910 terbutaline sulfate + brom + guiphenesin 50 ml syrup 1911 terbutaline tablets ip 2.5 mg 1912 terlipressin tab 1913 testosterone inj 1914 tetanus and diphtheria toxoids adsorbed inj 1915 tetanus immune globulin ( human ) inj 1916 tetanus toxoid inj 1917 tetracycline 250 mg cap 1918 tetracycline 500 mg cap 1919 theophylline 25.3 mg+ etophylline 84.7mg / 2ml injections 1920 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 1921 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 1922 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 1923 thiamine 2 ml inj 1924 thiamine 30 ml inj 1925 thiocokhicoside 4 mg tab 1926 thiocokhicoside 8 mg tab 1927 thiocolchicoside + aceclofenac + pcm tab 1928 thiocolchicoside 4mg + aceclofenac 100mg tab 1929 thiopental sodium 1 gm inj 1930 thiopental sodium 500 mg inj 1931 thiopentone inj ip 0.5 g 1932 thyroxine 100mcg tab 1933 thyroxine 25mcg tab 1934 thyroxine 75mcg tab 1935 thyroxine 12.5mcg tab 1936 thyroxine sodium 50 mcg tabs 1937 thyroxine sodium tablets ip 100mcg 1938 thyroxine tablets ip 50 mcg 1939 ticarcillin disodium + clavulanate potassium inj 1940 ticarcillin iv inj 1941 tigecycline 50 mg inj. 1942 timolol maeleate 0.5 % eye drops 1943 timolol maleate + hydrochlorothiazide oint 1944 tinidazole 400 ml iv inj 1945 tinidazole tab ip 300 mg ( film coated ) 1946 tinidazole tab ip 500 mg ( film coated ) 1947 tiotropium bromide cap 1948 tobramycin and dexamethasone eye drop 1949 tobramycin eye drops 1950 torasemide 10 mg + spirolactone 100 mg tab 1951 torasemide 10 mg + spirolactone 50 mg tab 1952 torasemide 5 mg tab 1953 torasemide 10mg tab 1954 torasemide 20mg tab 1955 torsemide 10 mg / ml inj. 1956 torsemide 10mg / ml 2ml amp. inj. 1957 torsemide tab 10 ip mg 1958 tramadol 100 mg inj. 1959 tramadol 100mg tab 1960 tramadol 50 mg inj. 1961 tramadol 50 mg tab 1962 tramadol cap ip 50 mg 1963 tramadol hcl + pcm + domperidone tab 1964 tramadol hcl + pcm tab 1965 tramadol inj 50 mg / ml 1966 tranexamic acid + ethamsylate tab 1967 tranexamic acid 100 mg / 5ml inj. 1968 tranexamic acid 500 mg tabs 1969 tranexamic acid 500mg + mefenamic acid 250mg tab 1970 tranexamic acid injection ip 100mg / ml 5ml size 1971 tranexamic acid tablets ip 500 mg 1972 tretenoin cream usp 0.025% 1973 tretinoin cream 1974 triamcinolone acetomide 40 mg tab 1975 tricholine citrate 550 mg + sorbitol 7.15 gm syrup / 10 ml 1976 trihexyphenidyl 2 mg tab 1977 trimcelone acetonide 0.1 % mouth ulcer gel 1978 trimethoprim + sulfamethoxazole tab 1979 trimethoprim + sulfamethoxazole ds tab 1980 trimethoprim + sulfamethoxazole ss tab 1981 trimethoprim tab 1982 trop t kit 1983 troylase ( haemocougalase ) 1ml ( like botrapase ) inj. 1984 trypsin chymotrypsin cap 1985 turpentine oil 100 ml 1986 typhoid vaccine, live 1987 urea ip 1 % + salicylic acid ip 1% w / w zinc sulphate 0.1 % w / w cream 1988 urokinase 250000 inj 1989 urokinase 500000 inj 1990 urokinase injection 5 lac unit ( lyophilized ) 1991 ursodeoxycholic acid 300mg tab 1992 ursodeoxycholic acid 450 mg tab 1993 ursodiol 150 mg tab 1994 ursodiol 300 mg tab 1995 vaccine h. influenzae b inj 1996 vaccine hepatitis a inj 1997 vaccine hepatitis b ( recombinant ) 1 ml inj 1998 vaccine adenovirus inj 1999 vaccine chicken pox inj 2000 vaccine hepatitis b ( recombinant ) 0.5 ml inj 2001 vaccine hpv bivalent, recombinant inj 2002 vaccine human papilloma virus inj 2003 vaccine immune globulin intravenous inj 2004 vaccine influenza inj 2005 vaccine influenza virus inj 2006 vaccine mmr inj 2007 vaccine oral rota virus 2008 vaccine rabies 2.5 iu inj ( intramuscular ) 2009 vaccine rabies 2.5 iu inj ( intradermal ) ) 2010 vaccine typhoid 2011 vaccine yellow fever 2012 vaccinehpv quadrivalent , recombinant 2013 valacyclovir 1 gm inj 2014 valacyclovir 500 mg tab 2015 valdecoxib + paracetamol cap 2016 valdecoxib cap 2017 valethamate bromide inj 8mg / ml 2018 valganciclovir tablet 450 mg 2019 valproate sodium 333 mg + valporic acid 145mg cap 2020 valproate sodium 134 mg + valporic acid 58mg cap 2021 valproate sodium 200mg + valporic acid 87mg cap 2022 valsartan + hydrochlorothiazide tab 2023 valsartan tab ip 80mg tab 2024 valthamate bromide 8 mg inj 2025 vancomycin 250 mg. inj 2026 vancomycin for intravenous infusion ip 1 gm 2027 vancomycin for intravenous infusion ip 500 mg 2028 vancomycin intravenous infusion 500 mg inj 2029 vasopressin inj 2030 vecuronium 10 mg tab 2031 vecuronium bromide injection 2mg / ml ; 10mg 2032 vecuronium bromide injection i.p 4mg 2033 venlafaxine 100 mg tab 2034 verapamil 40 mg tab 2035 verapamil 5 mg / 2ml amp. inj. 2036 vidagliptin 50 mg tab 2037 vinblastine 10 mg 10 ml inj 2038 vincristine 1 mg inj 2039 vitamin a syp 2040 vitamin + iron tonic syrup 2041 vitamin b complex with vitamin c & zinc ( cebexin z ) caps 2042 vitamin b6 50mg tab 2043 vitamin b complex ( prophylactic ) tabs 2044 vitamin b complex nfi syrup 2045 vitamin d cholecalciferol 60000 iu / 1gm sachet 2046 vitamin d3 drop 2047 vitamin e 600 mg cap 2048 vitamin e + levocarnitine cap 2049 vitamin e 200 mg cap 2050 vitamin e capsule 400 mg 2051 vitamin e softgel capsules 400 mg 2052 vitamin k 3 inj 2053 vitamin k inj. 2054 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 2055 vitamins a, c, d, e and b complex and minerals syrup 2056 vitimin c tab 2057 vitneurin b1 b6 b12 3ml amp. inj. 2058 voglibose 0.2mg tab 2059 voglibose 0.2mg, metformin 500mg tablets 2060 voglibose 0.3 mg, metformin 500mg tablets 2061 voglibose 0.3mg tab 2062 voriconazole 200 mg 2063 voriconazole injection 200mg / vial 2064 warfarin 5mg tab 2065 water for injection amp polypack 2066 xylocard 2% 50ml inj. 2067 xylometazoline 0.1 % w / v nasal drop 2068 xylometazoline nasal drops ip 0.1% 2069 zaleplon cap 2070 zidovudine inj 2071 zinc 100 ml syp 2072 zinc sulphate 20mg / ml oral solution 2073 zoledronic acid inj 2074 zolpidem 5 mg tab 2075 zolpidem tablets i.p 10mg...

Sawai Man Singh Medical College - Rajasthan

26799327 tender for medicine supply in pddu hospital gangori bazar jaipur 1 0.45 n.s. 500 ml n / 2 inj. 2 3% n.s. 100 ml inj. 3 abciximab inj 4 acarbose 25mg tab 5 acarbose 50mg tab 6 acebrophylline 100mg caps 7 acebrophylline tablet / capsule 100 mg 8 aceclofenac + paracetamol ( 100 mg + 325mg ) tab 9 aceclofenac + serratiopeptidase tab 10 aceclofenac 100 mg + paracetamol 325 mg + chorzoxazone 250 mg film coated tab. 11 aceclofenac 100 mg tab 12 aceclofenac 100mg + paracetamol 325mg + serratiopeptidase 15mg tab 13 aceclofenac 200mg sr / cr tab 14 acenocoumarol tab 2mg ip 15 acetaminophen 325mg+ tramadol hydrochloride 37.5 mg tab 16 acetaminophen tab 650 mg 17 acetazolamide tab ip 250mg 18 acetazolamide tablets i.p 250mg 19 acetyl salicylic acid ( aspirin ) tablet i.p 325mg 20 acetylcysteine 600mg tab 21 aceytyl cysteine ( 2 ml amp. ) inj. 22 aciclovir intravenous infusion 500mg / vial 23 activated charcoal suspension 24 acyclovir 200 mg tab 25 acyclovir 250 mg inj. 26 acyclovir 400 mg tab 27 acyclovir and hydrocortisone cream 28 acyclovir cream 5% 29 acyclovir dispersible 800mg tab 30 acyclovir eye ointment 31 acyclovir inj 25 / ml 32 acyclovir intravenous infusion ip 250mg 33 acyclovir intravenous infusion ip 500mg 34 acyclovir oral suspension ip 400mg / 5ml 35 acyclovir tab ip 200 mg 36 acyclovir tab ip 800 mg 37 adapalene +clindamycin gel 38 adapalene 0.1 % w / v ointment 39 adapalene and benzoyl peroxide gel 40 adapalene lotion 41 adenosine injection 3mg / ml 42 adenosine injection ip 6 mg / 2ml 43 aderaline 1mg / ml inj. 44 adrenaline bitartrate injection 45 adrenaline injection ip 1mg / ml im / iv use 46 albendazole ( 200 mg / 5ml ) syrup 47 albendazole + ivermectin ( 400 mg + 6mg ) tab 48 albendazole 400mg tabs 49 albendazole oral suspension ip 400 mg / 10ml 50 albendazole tablets ip 400 mg ( detail in rc ) 51 albumin 20% 100ml inj. 52 albuterol inhalation 53 alemtuzumab inj 54 alendronate 10 mg tab 55 alendronate 35 mg tab 56 alendronate 70 mg tab 57 alendronate tab 58 alfacalcidol soft gelatin 0.25mcg caps 59 alfuzosin 10mg tab 60 allopurinol 100 mg tabs 61 allopurinol 300mg tab 62 allopurinol tablets ip 100 mg 63 alprazolam 0.25 + propranolol 40 mg tab 64 alprazolam 0.25 + sertraline 50 mg tab 65 alprazolam 0.25 mg tabs 66 alprazolam 0.5 mg tabs 67 alprazolam 1 mg tab 68 alprazolam 0.25mg, fluoxetine 20mg tab 69 alteplase inj 2 mg 70 aluminium hydroxide 250mg + mg hydroxide 250mg tabs 71 aluminum hydroxide and magnesium hydroxide syp 72 ambroxol + levocetrazin tab 73 ambroxol 15 mg / 2ml syp 74 ambroxol hcl + desloratadine syp 75 ambroxol hcl + terbutaline + guaphenasin 100 ml syp 76 ambroxol hcl + terbutaline + guaphenasin 50 ml syp 77 ambroxol tab 78 amikacin 100mg inj. 79 amikacin 250mg inj. 80 amikacin 500mg inj. 81 amino acid 10% injection 100ml size 82 amino acid 5% 250ml pack inj. 83 amino acid injection 100 ml 84 amino acids + electrolytes 200 ml inj 85 amino acids + electrolytes 500 ml inj 86 aminolevulinic acid solution 87 aminophylline 10 ml inj. 88 aminophylline inj ip 25 mg / ml 89 amiodarone 150 mg / 3ml amp. inj. 90 amiodarone 200mg tab 91 amisulpride 100 mg tab 92 amisulpride 200 mg tab 93 amisulpride tablets i.p 50mg 94 amitriptyline 25 mg tab 95 amitriptyline hydrochloride 10mg tablets i.p 96 amlodipine + atenolol ( 5 mg + 50 mg ) tabs 97 amlodipine + atorvastatin tab 98 amlodipine + benazepril hcl tab 99 amlodipine + bisoprolol tab 100 amlodipine + lisonopril tab 101 amlodipine + losartan tab 102 amlodipine + olmesartan medoxomil tab 103 amlodipine + ramipril tab 104 amlodipine + valsartan tab 105 amlodipine 10 mg tab 106 amlodipine 2.5 mg tab 107 amlodipine 5mg tabs 108 amoxy & pota. clavulana 300mg inj. 109 amoxy & pota. clavulana 600mg inj. 110 amoxy 250 mg + clav 50 mg ( =300 mg vial ) inj. 111 amoxycillin + clavulanate 228.5 mg syp 112 amoxycillin + clavulanate 250 mg inj. 113 amoxycillin + clavulanate 375 mg inj. 114 amoxycillin + clavulanate 600 mg inj. 115 amoxycillin + cloxacillin 30ml syp 116 amoxycillin + dicloxacillin 250 mg cap 117 amoxycillin 1000mg + clavulanic acid 200mg inj. 118 amoxycillin 125 mg + clavulanate 25 mg syp 119 amoxycillin 125 mg kid tabs 120 amoxycillin 125mg / 5ml powder for suspension ip 121 amoxycillin 200mg + clavulanic acid 28.5 mg / 5ml dry syrup 122 amoxycillin 250 mg + dicloxacillin 250 mg cap 123 amoxycillin 250 mg caps 124 amoxycillin 250 mg dt tab 125 amoxycillin 250mg + clavulanic acid 50 mg inj. 126 amoxycillin 250mg + cloxacillin 250mg caps 127 amoxycillin 250mg with potassium clavulanate 125mg tab 128 amoxycillin 500 mg + dicloxacillin 500 mg cap 129 amoxycillin 500 mg caps 130 amoxycillin 500mg + clavulanic acid 100mg inj. 131 amoxycillin 500mg + clavulanic acid 125 mg tabs 132 amoxycillin 875mg + potassium clavulanate 125mg tab 133 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 134 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) 135 amoxycillin cap ip 250mg 136 amoxycillin cap ip 500mg 137 amoxycillin dispersible tablets ip 125 mg 138 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 139 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 140 amphotericin b 10 mg + lyphosomal inj 141 amphotericin b 25 mg + lyphosomal inj 142 amphotericin b 50 mg + lyphosomal inj 143 amphotericin b inj ip 50 mg 144 ampi 250mg + cloxy 250 mg cap 145 ampicillin + cloxacillin cap 146 ampicillin +sulbactam 250 mg inj. 147 ampicillin 1 gm inj 148 ampicillin 250 mg inj. 149 ampicillin 500mg inj. 150 ampicillin cap ip 500mg 151 ampicillin injection ip 500 mg 152 amrinone inj 153 anastrozole tablets ip 1mg 154 antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 155 antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 156 antacids syp 157 anti a blood grouping serum ip ( anti a monoclonal serum ) 158 anti b blood grouping serum ip ( anti b mono clonal serum ) 159 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 160 anti human papillomavirus type 16 inj 161 anti snake venon inj polyvalent injection ( asv ) 162 anti acne gel adapalene bp…0.1 % w / w, clindamycin phosphate usp equivalent to clindamycin…1% w / w, methyl paraben ip…0.1 % w / w, phenoxyethanol bp…0.25 % w / w 163 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 164 antihemophilic factor recombinant inj 165 antihemophillic factor ix inj 166 antihemophillic factor viii inj 167 antioxidant cap 168 antitetnus human immunoglobulin injection 250mg 169 antitetnus human immunoglobulin injection 500mg 170 antithrombin inj 500 171 antithymocyte immunoglobulin ( atg ) inj 172 appetite enhancer ( peptone, minerals, vitamins ) syrup 173 application benzyl benzoate 25 % w / w lotion 174 aqueous colloidal solution of vitamin k1 inj 175 arteether 150mg inj 176 artemether + lumefantrine 20mg tab 177 artemether + lumefantrine 40mg tab 178 artemether + lumefantrine 80mg tab 179 artemether + lumefantrine tab 180 artemether 80mg + lumefantrine ( banflumetol ) 480mg tab 181 artemether tab 182 artesunate 60mg inj. 183 artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) 184 artether 50 mg tab 185 ascorbic acid 500 mg.tab. 186 ascorbic acid tablets ip 100 mg ( vitamin c chewable tablet ip 100mg ) 187 aspirin + dipyridamole cap 188 aspirin 150 mg tab 189 aspirin 75 mg + clopidogrel 150 mg tab 190 aspirin 75 mg + clopidogrel 75 mg tab 191 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 192 aspirin enteric coated tablets i.p.75mg 193 atenolol + chlorthalidone tab 194 atenolol + hydrochlorothiazide tab 195 atenolol 25 mg tab 196 atenolol 25 mg, amlodipine 5 mg tablets 197 atenolol 50 mg tabs 198 atenolol tab ip 25 mg 199 atorvastatin + clopidogrel ( 10 / 75mg ) capsules 200 atorvastatin + ezetimibe tab 201 atorvastatin + niacin tab 202 atorvastatin 10mg + fenofibrates 160mg tab 203 atorvastatin 10mg tabs 204 atorvastatin 20 mg tabs 205 atorvastatin 40mg tab 206 atorvastatin i.p 10mg, aspirin i.p ( ec ) 75mg capsules 207 atracurim 10 mg / ml ( 2.5 ml amp. ) inj. 208 atracurium 5 ml inj 209 atracurium besilate injection i.p 25mg / 2.5ml 210 atracurium inj 10 mg / ml 211 atropine ( 0.6mg / ml ) inj. 212 atropine sulphate injection 0.6mg / ml 213 azathioprine inj 214 azithromycin ( 100mg / 5ml ) syrup 215 azithromycin 100 mg dt tab 216 azithromycin 200 mg 15 ml oral syp 217 azithromycin 500 mg inj. 218 azithromycin tab ip 500 mg 219 azithromycin tablets ip 250mg 220 aztreonam inj. 221 aztreonam injection 1gm 222 aztreonam injection usp 500 mg 223 bacitracin ( neomycin / polymyxin b ) ophthalmic oint. 224 bacitracin oint. 225 bacitracin zinc 250 iu neomycin 5 mg, sulphacetamide sodium 60mg per 1gm powder 226 baclofen 10mg tab 227 beclamethasone dipropionate..0.025% w / , neomycin sxulphate..0.5% w / w ( 3500 unit / g ) chlorocresol 0.1% w / w cream 228 beclomethasone 229 beclomethasone 0.025% + clotrimazole 1.0% + gentamycin 0.1% w / w cream 230 beclomethasone dipropionate + levosalbutamol inhaler 231 beclomethasone inhalation ip 200 mcg / dose 232 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 233 benzathine benzylpenicillin inj ip 12 lac units 234 benzathine benzylpenicillin inj ip 6 lac units 235 benzene hexachloride lotion 236 benzoyl peroxide 20 gm cream 237 benzyl penecillin inj 238 betahistidine 16 mg tab 239 betahistidine 24 mg tab 240 betahistine 8 mg tabs 241 betamethasone 0.05% w / w + salicylic acid 3% w / w cream 242 betamethasone 0.5mg lotion 243 betamethasone dipropionate cream ip 0.05% 244 betamethasone inj. i.p 4 mg / ml 245 betamethasone lotion ip 0.05 o / o 246 betamethasone sod phos inj ip 4mg / ml 247 betamethasone tab ip 0.5mg 248 betamethasone valerat 0.1% w / w + neomycin sulfate 0.5% w / w cream 249 bicalutamide tab i.p 50mg 250 biphasic isophane insulin inj 40iu / ml ( 50:50 ) 251 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 252 biphasic isophane insulin injection i.p 100 iu / ml ( 30:70 ) ( 30% soluble insulin and 70% isophane insulin ) 253 bisacodyl 5mg tabs 254 bisacodyl tab ip 5 mg 255 bismuth subcitrate potassium cap 256 bisoprolol + amlodipine tan 257 bisoprolol + hydrochlorothiazide tab 258 bisoprolol 2.5 mg tab 259 bisoprolol 5mg tab 260 bleomycin 15 mg inj. 261 bortezomib injection 3.5 mg 262 bosentan 125 mg tab 263 bosentan 62.5 mg tab 264 botrapase inj. 265 bromfenac sodium eye drop 0.09% 266 bromhexine + dexrometharphan + ammonium chloride + menthol syp 267 bromhexine + terbutalin + guiphenesin 100 ml syp 268 bromhexine + terbutalin + guiphenesin 50 ml syp 269 bromhexine 100 ml sol 270 bromocriptine 0.8mg tab 271 budesonide 0.5 mg / ml respule 272 budesonide 100 micro gram and formoterol fumarate 6 mg dihydrate inhaler 273 budesonide 100 micro gram inhaler 274 budesonide 200 micro gram and formoterol fumarate 6 mg dihydrate inhaler 275 budesonide 400 micro gram and formoterol fumarate 6 mg dihydrate inhaler 276 budesonide nebulizer suspension 0.25mg / ml 277 budesonide powder for inhalation 200 mcg 278 bupivacaine hci injections 20ml 279 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 280 bupivacaine hydrochloride and epinephrine injection 281 bupivacaine hydrochloride heavy 0.5% w / w inj. 4 ml 282 bupivacaine inj ip 0.5% 283 buprenorphin + naloxone tab 284 buprenorphine inj. 285 butorphanol tartrate injection usp 1mg / ml 1ml size 286 cabergoline 0.5 mg tab 287 cabergoline 1 mg tab 288 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 289 caffeine citrate 20 mg / 1ml inj. 290 caffeine citrate 20 mg / 2ml inj. 291 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 292 calamine lotion sol. 293 calcimax+p syp. 294 calcitriol capsules i.p 0.25mcg 295 calcium + vitamin d3 syp 200 ml 296 calcium + vitamin d3 250iu tabs 297 calcium + vitamin d3 500iu tabs 298 calcium 500mg + calcitriol 0.25mg tab 299 calcium carbonate 500mg + calcitriol 0.25mcg + zinc 7.5mg tab 300 calcium chloride injection 301 calcium dobesilate tab 302 calcium folinate 15mg tab 303 calcium folinate 50mg tab 304 calcium gluconate + vitamin d3 + cyanacobalamin 15 ml syp 305 calcium gluconate inj. 306 calcium laevulinate powder 307 calcium phosphorus 200 ml syp. 308 capecitabine tab i.p 500 mg 309 captopril and hydrochlorothiazide tab 310 captopril tab 311 carbachol intraocular solution 312 carbamazepine 100mg tabs 313 carbamazepine 200mg tabs 314 carbamazepine 300 mg cr tabs 315 carbenicillin tab 316 carbidopa levodopa tab 317 carbidopa, levodopa and entacapone tab 318 carbimazole 10mg tab 319 carbimazole 5mg tab 320 carbonyl iron tab 321 carboprost tromethamine injection ip 250 mcg / ml 322 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 323 carboxymethyl cellulose 0.5 % w / v eye drop 324 carvedilol 12.5 mg tab 325 carvedilol 25 mg tab 326 carvedilol 3.125mg tab 327 carvedilol tablets ip 6.25mg 328 caspofingin 50 mg inj. 329 caspofungin 70 mg inj. 330 cefaclor cap 331 cefadroxil 125 mg 30 ml syp 332 cefadroxil 250mg + clavulanate 62.5mg tab 333 cefadroxil 500mg tab 334 cefadroxil 500mg+ clavulanate 125mg tab 335 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 336 cefadroxil film coated tablets ip 250mg 337 cefazolin 1gm inj 338 cefdinir 125 dt tab 339 cefdinir 300 mg tab 340 cefdinir inj 341 cefepime 0.5 gm inj 342 cefepime 1gm inj 343 cefepime hydrochloride + tazobactum inj 344 cefepime hydrochloride 1000 mg + salbactum 500 mg inj 345 cefepime hydrochloride 500 mg + salbactum 250 mg inj 346 cefepime injection ip 500 mg 347 cefixime 200 mg tab 348 cefixime ( 50 mg / 5ml ) dry syrup 349 cefixime 100 mg + clavulanate 125 mg syp 350 cefixime 100mg tab. 351 cefixime 200mg + clavulanic acid 125mg ( as pot. clavulanate ) tab 352 cefixime 200mg + ofloxacin 200mg tab 353 cefixime 200mg tab. 354 cefixime 50 mg+ clavulanate 31.25 mg syp 355 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 356 cefixime tab ip 100 mg 357 cefixime tab ip 200 mg 358 cefoperazone 1 gm + sulbactam 500 mg inj 359 cefoperazone 1 gm inj. 360 cefoperazone 1gm + sulbactam 1gm inj. 361 cefoperazone 2000 gm + sulbactam 1000 mg inj 362 cefoperazone 500mg + sulbactam 500 mg inj. 363 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) 364 cefotaxim 1g inj. 365 cefotaxim 250 mg inj. 366 cefotaxime inj ip 250 mg 367 cefotaxime injection ip 1 g 368 cefotaxime sodium 1000mg inj. 369 cefotaxime sodium 1gm + sulbactam sodium 500 mg inj. 370 cefotaxime sodium 250mg + sulbactam sodium 125 mg inj. 371 cefotaxime sodium 500mg + sulbactam sodium 250 mg inj. 372 cefotaxime sodium injections ip 250 mg 373 cefoxitime 1 gm inj 374 cefoxitime 250 mg inj 375 cefoxitime 500 mg inj 376 cefpirome inj 377 cefpodoxime 100 mg dt tab 378 cefpodoxime 200 mg tabs 379 cefpodoxime dispersible tab 50 mg 380 cefpodoxime proxetil 50 mg ds dry syrup 381 cefpodoxime proxetil dispersible 50mg tab 382 cefpodxime 200mg + clavulanic acid 125mg tab 383 ceftazadime 1000 mg inj. 384 ceftazidime inj ip 1g 385 ceftazidime inj ip 250 mg 386 ceftazidime inj ip 500 mg 387 ceftazidine + salbactum inj 388 ceftriaxone + sulbactam 375 mg inj 389 ceftriaxone 1 g inj. 390 ceftriaxone 1000mg + sulbactam 500 mg inj. 391 ceftriaxone 1000mg + tazobactum 125 mg inj. 392 ceftriaxone 250 gm + tazobactum 31.25 mg inj 393 ceftriaxone 250 mg inj. 394 ceftriaxone 250mg + sulbactam 125 mg inj. 395 ceftriaxone 500 gm + tazobactum 62.50 mg inj 396 ceftriaxone 500 mg inj. 397 ceftriaxone 500mg + sulbactam 250 mg inj. 398 ceftriaxone inj ip 1g / vial 399 ceftriaxone inj ip 250 mg / vial 400 ceftriaxone inj ip 500mg / vial 401 ceftriaxone injection 1 gm + tazobactum 1.25 gm 402 cefuroxime 250 mg tab 403 cefuroxime 750 mg inj 404 cefuroxime 125mg tab 405 cefuroxime 500mg + clavulanic acid 125mg ( as pot. clavulanate ) tab 406 cefuroxime axetil 250 mg tabs 407 cefuroxime axetil 500mg tabs 408 cefuroxime axetil tab ip 250 mg 409 cefuroxime injection 1500 mg 410 cephalexin 100 mg tab 411 cephalexin 250 dt tab 412 cephalexin 125 mg dt tab 413 cephalexin 125mg / 5ml dry syrup 414 cephalexin 250 mg caps 415 cephalexin 500 mg caps 416 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 417 cephalexin tablets 125 mg ( dispersible tablets ) 418 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 419 cerviprine gel 420 cetirizine syp 60 ml 421 cetirizine dihydrochloride ip 5 mg, phenylephrine hydrochloride ip 10 mg, paracetamol ip 325 mg tab 422 cetirizine syrup ip 5mg / 5 ml 423 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 424 cetrizine ( 5 mg / 5 ml ) syrup 425 cetrizine + ambroxol 100 ml syp 426 cetrizine + ambroxol tab 427 cetrizine 10mg tabs 428 chlolecalciferol sachet 429 chloramphenicol 250 mg inj 430 chloramphenicol 500 mg inj 431 chloramphenicol + beclomethasone dipropionate + clotrimazole + lignocaine + glycerine & propylene glycol ip base gel 432 chloramphenicol 1000 inj 433 chloramphenicol eye drop 0.4 %, 5ml 434 chlordiazepoxide 10mg tab 435 chlordiazepoxide 25mg tab 436 chlordiazepoxide + amitriptyline tab 437 chlordiazepoxide and clidinium bromide tab 438 chlorhexidine gluconate 0.2% mouth wash 439 chlorhexidine gluconate 0.3% v / v + cetrimide 0.6% w / v sol. 440 chloroquine phosphate 250 mg tabs 441 chloroquine phosphate 500 mg tab 442 chloroquine phosphate syp 125 mg / 60 ml 443 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 444 chlorothiazide tab 445 chlorpheniramine maleate tab 446 chlorpheniramine maleate tab ip 4mg 447 chlorpromazine tab 448 chlorthalidone tablets 12.5mg 449 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 450 chlorzoxazone 500mg+ diclofenac 50mg + paracetamol 325mg tab 451 cholecalciferol granules 452 cholera vaccine 453 cholestyramine susp. 454 chorionic gonadotropin inj 455 chymotrypsin + trypsin ( 1:5 ) enteric cated 120k au tab 456 cidex solution ( gluteraldehyde ) 457 cilnidipine 10mg tab 458 cilnidipine 10mg+ metoprolol 50mg tab 459 cilnidipine 10mg+ telmisartan 40mg tab 460 cilnidipine tablets 20mg 461 cilostazol 100 mg tab 462 cilostazol tablets ip 50mg 463 cimetidine tab 464 cinnarizine + domperidonetab 465 cinnarizine tablets 25mg 466 ciprofloxacin ( 2mg / ml ) infusion 467 ciprofloxacin + dexamethasone eye drop 468 ciprofloxacin + flucanazole eye drop 469 ciprofloxacin 0.3% w / v eye drop 470 ciprofloxacin 100 ml inj. 471 ciprofloxacin 250 mg tabs 472 ciprofloxacin 250mg + tinidazole 300 mg tabs 473 ciprofloxacin 500 mg tabs 474 ciprofloxacin 500mg + tinidazole 600 mg tabs 475 ciprofloxacin tablet ip 500 mg film coated 476 ciprofloxacin tablets ip 250 mg film coated 477 cis atracurium besylate injection 2 mg / ml in 5 ml vial 478 cisatracurium besylate 2 mg / ml ; 10 ml inj 479 cisatracurium besylate 2 mg / ml ; 5 ml inj 480 cisplatin 10 mg inj. 481 cisplatin 50 mg inj. 482 citalopram 10 mg tabs 483 citicoline sodium 250 mg / 2ml inj. 484 citicoline sodium 250 mg / 4ml inj. 485 citicoline tablets 500mg inj. 486 clarithromycin 250mg tab 487 clarithromycin 500mg tab 488 clarithromycin gel 20 gm 1% 489 clidinium bromide 2.5mg + chlordiazepoxide 5mg tab 490 clindamycin 150mg / 2 ml inj. 491 clindamycin 150mg / 4 ml inj. 492 clindamycin 20 gm inj. 493 clindamycin 30 gm inj. 494 clindamycin 300mg caps 495 clindamycin 300mg / 2 ml inj 496 clindamycin 600 mg tab 497 clindamycin 600mg 4 ml inj. 498 clindamycin and benzoyl peroxide gel 499 clindamycin capsule ip 150mg 500 clindamycin hcl 150 mg caps 501 clindamycin phosphate gel usp 1 o / o 502 clindamycin phosphate injection ip 300 mg 503 clobazam 10mg tabs 504 clobazam tablet 5mg 505 clobetasol propinate +miconazole nitrate+ ofloxacin cream 506 clobetasol propinate + salicylic acid cream 507 clobetasol propinate 10 gm cream 508 clobetasol propionate + miconazole + gentamycin cream 509 clobetasol propionate bp…0.05 % w / w, neomycin sulphate ip…0.50 % w / w., miconazole nitrate ip…2.00 % w / w, chlorocresol ip ( as preservative ) 0.10 % w / w cream / ointment 510 clobetasol propionate cream ip 0.05 o / o 511 clofazimine 100mg capsule 512 clofazimine 50 mg capsule 513 clofibrate 514 clomifene tab ip 25 mg 515 clomiphene 25mg tabs 516 clomiphene citrate 50 mg tabs 517 clomiphene tab ip 50 mg 518 clonazepam 0.25 mg tabs 519 clonazepam 0.5 mg tabs 520 clonazepam tablets ip 1mg 521 clonidine 100 mcg inj. 522 clonidine inj. 523 clopidogrel 75mg tabs 524 clopidogrel 75mg tabs + aspirin 75 mg tabs 525 clotrimazole + beclomethasone cream 526 clotrimazole eye drop 527 clotrimazole vaginal gel 30 gm 528 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 529 clotrimazole 1% 100gm powder 530 clotrimazole 1% w / w 0int. 531 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w cream 15 gm tube 532 clotrimazole 1% w / w, beclometasone dipropionate 0.025% w / w 15ml lotion 533 clotrimazole 100 mg vaginal tab 534 clotrimazole cream ip 2% w / w 535 clotrimazole mouth paint 536 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) 537 clotrimazole vaginal tab ip 500mg 538 coagulation factor ix human 539 coagulation factor ix recombinant 540 coagulation factor viia recombinant 541 codeine phosphate tablets bp 30mg 542 codeine sulfate 543 colchicine 0.6 mg capsules 544 cold suspn.n / f ( paracetamol 125 mg+ phenylephrine hydrocloride ip 5mg + 545 colistil inj. 546 colistimethate injection ip 1m iu powder for solution 547 colistin iv 548 colistin sulfate + neomycin + hydrocortisone suspension 549 collagenase ointment 550 colostrum powder 551 conjugated estrogens tabs 552 conjugated estrogens, medroxyprogesterone acetate tabs 553 cotrimoxazole tabs 554 cotrimoxazole oral suspension 555 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 556 cough syrup / expectorant ( 50 ) ml 557 cromolyn sodium nebulization solution 558 cyproheptadine 4mg tab 559 cyproheptadine hcl 2mg + tricholine citrate 275 mg syrup 560 cyproheptadine, hydrochloride ( anhydrous ) ip..2 mg.in a flavoured syrup base..q.s. 561 cyproterone + ethinyloestradiol coated tablets 562 cytomegalovirus immune globulin intravenous human 563 danazol 100 mg caps 564 danazol 200 mg caps 565 danazol 50 mg caps 566 dandruf shampoo ketoconazole ip shampoo 2%w / v 567 dantrolene sodium inj. 568 dapsone tabs 569 deferasirox 250mg tabs 570 deferasirox 500mg tabs 571 deferoxamine inj. 572 deflazacort 1 mg tabs 573 deflazacort 30 mg tabs 574 deflazacort 6mg tab 575 dehydroepiandrosterone 25 mg capsule 576 demeclocycline tabs 577 desferrioxamine inj. 578 desipramine hydrochloride tabs 579 desmopressin tabs 580 dethylamine bp…1.16 %, linseed oil bp…3 % w / w, methyl salicylate ip…10 % w / w, menthol ip…5 % w / w, excipients and propellant q.s. to…100 % w / w spray 581 dexamethasone 0.5 mg tabs 582 dexamethasone 4 mg inj. 583 dexamethasone inj ip 8mg / 2ml 584 dexona 2 ml inj. 585 dextran 0 40, 500 ml 586 dextromethorphan + guiphenesin + brom + cpm 100 ml oral liquid 587 dextromethorphan + guiphenesin + brom + cpm tabs 588 dextromethorphan hbr syrup ip 13.5mg / 5ml 589 dextropropoxyphene + acetaminophen + dicyclomine 590 dextropropoxyphene + paracetamol + dicyclomine tabs 591 dextropropoxyphene + paracetamol capsule 592 dextropropoxyphene oral 593 dextrose ( 10% ) with paediatric maintenance solution 594 dextrose + fructose infusion 595 dextrose 10% iv 500 ml ffs inj. 596 dextrose 25% 100 ml inj. 597 dextrose 25% iv 100 ml ffs inj. 598 dextrose 5% iv 500 ml ffs inj. 599 dextrose 5% + ringer lactate iv inj. 600 dextrose normal saline 500 ml ffs inj. 601 dextrose normal saline 500 ml pps inj. 602 diacerein 50 mg + glucaramine tablet 603 diacerein 50 mg + glucosamine sulphate 500 mg tablet 604 diacerein 50 mg +methylsulphonylmethane 250 mg + glucosamine sulphate 750 mg tab. 605 diacerein capsules ip 50mg 606 diazepam 2 mg tab 607 diazepam 2 ml inj. 608 diazepam 5 mg tabs 609 diclofenac na 75mg / ml 1ml inj. 610 diclofenac 1.16 w / w + linceed oil 3% w / w + methyl salicylate 10% w / w + menthol 5% w / w gel 611 diclofenac di + menthol 5%+ oleum 3% + methyl salicylate 612 diclofenac diethylamine bp 1.116% ( equivalent to diclofenac sodium 1.0%, linseed oil bp 3.0% + methyl salicylate ip 10.0%, capsiacin usp 0.025%, menthol ip 0.025%, benzyl alcohol ip 1.0% ( as preservative ) in a gel base q.s. 613 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) 614 diclofenac gel 615 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 616 diclofenac potassium bp 50 mg + paracetamol 325 mg + serratiopeptidase 10 mg tablet 617 diclofenac sodium ( sr ) 100 mg tab 618 diclofenac sodium + misoprostol tablet 619 diclofenac sodium + serratiopeptidase ( 50mg + 10mg ) tab 620 diclofenac sodium 25mg per ml inj. 621 diclofenac sodium 30 ml inj. 622 diclofenac sodium 50 mg tab 623 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 624 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 625 diclofence prolonged release tablet ip 100 mg 626 dicloxacillin capsule 627 dicyclomine + mefenamic acid tabs 628 dicyclomine + paracetamol tabs 629 dicyclomine 10 mg tabs 630 dicyclomine 10mg + dimethicone 40mg / 5ml suspension 631 dicyclomine 10mg + mefenamic acid 250mg tab 632 dicyclomine drop 633 dicyclomine hcl ( dicycloverine ) injection ip 10mg / ml 634 dicyclomine hcl. 20mg + paracetamol 325 mg tabs 635 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 636 dicyclomine hydrochloride oral solution ip 10mg / 5ml 637 dicyclomine inj ip 10 mg / ml 638 dicyclomine tab ip 10 mg 639 diethylcarbamazine 50mg tab 640 digoxin 250mg ( 0.25mg ) tab 641 digoxin inj ip 0.25 mg / ml 642 digoxin inj. 643 diltiazem 30 mg tabs 644 diltiazem 60 mg tabs 645 diltiazem 90mg tab 646 dimercaprol inj. 647 dinoprostone gel 648 diphenhydramine + ammonium chl. + sodium cit. 100 ml syrup 649 diphenhydramine + ammonium chl. + sodium cit. 50 ml syrup 650 diphenhydramine 25 mg tabs 651 diphenoxylate + atropine inj. 652 diphenoxylate tabs 653 disodium hydrogen citrate ( alkalyser ) 1.4 mg / 5ml syrup 654 distilled water 5ml ffs 655 disulfiram 250 mg tabs 656 disulfiram ip 500 mg tabs 657 dobutamine 250 mg / 20ml inj. 658 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) 659 domperidone + esomeprazole ( 30 / 40mg ) capsule 660 domperidone + paracetamol tabs 661 domperidone 10 mg tabs 662 domperidone 30mg + pantoprazole 40mg caps 663 domperidone 5 mg. / 5 ml susp 664 domperidone oral drops 10mg / ml ( 10ml ) 665 domperidone suspension ip 5mg / 5ml 666 domperidone tab ip 10 mg 667 dopamine hcl 200 mg / 5ml inj. 668 dopamine hydrochloride inj ip 40 mg / ml 669 doxofylline + montelukast tabs 670 doxofylline 400mg tab 671 doxorubicin 10 mg inj. 672 doxorubicin 50 mg inj. 673 doxycycline cap ip 100 mg 674 doxylamine 20 mg. + pyridoxine 20 mg + folic acid 5mg. tab 675 doxylamine 20 mg. + pyridoxine 20 mg. tab 676 doxylamine succinate + pyridoxine + folic acid ( 10 mg + 10 mg + 2.5 mg ) tabs 677 doxylamine succinate 10mg + pyridoxine hcl 10mg tab 678 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 679 doxylamine tabs 680 dried aluminium hydroxide 250mg + magnesium hydroxide 250mg / 5ml susp + activated dimethicone 50mg 681 drotaverin 40mg / 2ml inj. 682 drotaverine + nimesulide tabs 683 drotaverine + paracetamol tabs 684 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 685 drotaverine hcl 80mg, mefenamic acid 250mg tab 686 drotaverine hcl tablets ip 40mg tabs 687 drotaverine hydrochloride inj 40 mg / 2 ml 688 drotaverine tab ip 40 mg 689 duloxetine 20mg tabs 690 duloxetine 30mg tabs 691 duloxetine 40mg tabs 692 duloxetine 60mg tabs 693 dusting powder ( povidone 5% powder 694 dutasteride + tamsulosin hydrochloride caps 695 dutasteride caps 696 dydrogesterone tab. i.p. 10mg 697 ear drops ( paradichlorobenzene 2%+benzocaine 2.7%+chlorbutol 5%+turpentine oil15% 698 ebastine film coated tablets 10mg 699 efavirenz 200 mg caps 700 efavirenz 600 mg + emtricitabine 200 mg + tenofovir disoproxil fumarate 300 mg tabs 701 efavirenz tablets ip 600mg 702 electrolyte g iv 500 ml ffs inj. 703 electrolyte g iv 500 ml pps inj. 704 electrolyte p iv 500 ml pps inj. 705 electrolyte m iv 500 ml ffs inj. 706 electrolyte m iv 500 ml pps inj. 707 electrolyte p iv 500 ml ffs inj. 708 elemental calcium tabs 709 elemental iron 50 mg tabs 710 enalapril 2.5 mg tabs 711 enalapril + amlodipine tabs 712 enalapril maleate + felodipine tab 713 enalapril maleate + hydrochlorothiazide tab 714 enalapril maleate tablets ip 10 mg 715 enalaprilat injection 716 enalpril 5mg tabs 717 enoxaparin 40 mg / 0.4 ml inj. ip 718 enoxaparin 60 mg / 0.6 ml inj. 719 enoxaparin sodium inj ip 60 mg 720 entecavir 0.5 mg tabs 721 entecavir 1mg tabs 722 enyme syrup mix fruit flavour pepsin 7.5 mg + fungal diastase 12.5 mg / 5 ml 723 enzyme drops pepsin ( 1:3000 ) 5 mg + fungal diastase ( 1:1200 ) 33.33 mg / ml 724 ephidrine inj. 725 epinephrine hydrochloride inj. 726 eplerenone tabs 727 ergotamine tartrate + caffeine tabs 728 erythromycin 250 mg tabs 729 erythromycin 500 mg tabs 730 erythropoietin 10 k inj. 731 erythropoietin 2 k inj. 732 erythropoietin 4 k inj. 733 erythropoietin 40 k inj. 734 escitalopram 10 mg tabs 735 escitalopram 10mg with clonazepam 0.5mg tabs 736 escitalopram 20 mg tabs 737 esmolol infusion 738 esmolol hydrochloride injection 10mg / ml 10ml size 739 esomeprazole 20 mg caps 740 esomeprazole 40 mg caps 741 esomeprazole + domperidone caps 742 estradiol tabs 743 estradiol + levonorgestrel transdermal tabs 744 estradiol + norethindrone acetate tabs 745 estradiol cypionate inj. 746 estradiol transdermal system 747 estradiol vaginal ring 748 estradiol vaginal tablets 749 estradiol valerate + estradiol valerate dienogest tabs 750 estradiol valerate inj. 751 estradiol, norethindrone acetate transdermal system tabs 752 estradiol, norgestimate tabs 753 estrogens + ethinyl oestradial tabs 754 etanercept inj. 755 ethacrynic acid tabs 756 ethambutol 800mg tab 757 ethamsylate tabs 758 ethamsylate b.p 250 mg. inj. 759 ethamsylate b.p 500 mg. inj. 760 ethamsylate inj 250 mg / 2ml ( im / iv ) 761 ethinyl estradiol tabs 762 ethinyl estradiol + ethynodiol diacetate tabs 763 ethinyloestradiol tabs ip 50 mcg 764 etizolam tablet 0.5mg 765 etophyllin +theophylline ( 77 mg + 23 mg ) tabs 766 etophylline + theophylline 100 mg tabs 767 etophylline + theophylline 150 mg srtabs 768 etophylline + theophylline 2 ml inj. 769 etophylline + theophylline 300 mg sr tabs 770 etophylline + theophylline 300 mg tabs 771 etophylline ip 115mg + theophylline 35mg tablet 772 etoposide 100 mg / 5ml inj. 773 etoricoxib 60mg tabs 774 etoricoxib tab ip 120mg 775 etoricoxib tablet 90 mg 776 etoricoxilb 120mg tab 777 etoricoxilb 90mg tab 778 evening primrose oil 779 everolimus tabs 780 ezetimibe + simvastatin tabs 781 ezetimibe 10mg tabs 782 fabrazyme inj. 783 factor vlll sdh 1000 iu inj. 784 factor vlll sdh 250 iu inj. 785 factor vlll sdh 500 iu inj. 786 famotidine 20 mg tabs 787 famotidine 40 mg tabs 788 faropenem sodium 200 mg tabs 789 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 790 febuxostat tablets 40mg 791 febuxostat tablets 80mg 792 felodipine tabs 793 fenofibrate 145 mg tabs 794 fenofibrate 160 mg tabs 795 fentanyl citrate inj. 796 fentanyl citrate injection 50mcg / ml 797 fentanyl citrate injection ip 2 ml 798 fentanyl skin patches 799 feracrylam 1% 100ml solution 800 feracrylam 1% 50ml solution 801 feracrylam 3% 100ml solution 802 feracrylam 3% 50ml solution 803 feracrylam gell 30 gm 804 feracrylam gell 50 gm 805 feracrylum 1% w / v sterile solution 100 ml 806 ferric carboxymaltose 1000 mg. ( inj. ) ( brand name ferium 1k ) 807 ferrous ammonium citrate 160mg + cyano cobalamine 7.5mcg+folic acid 0.5mg / 15ml syrup 808 ferrous ascorbate 100mg with folic acid 1.5mg tab 809 ferrous salt + folic acid tabs 810 ferrous salt + folic acid+ cyanocobalamin tabs 811 ferrous sucrose inj. 812 ferrous sulfate – iron tabs 813 fexofenadine 120 mg tabs 814 fexofenadine 180 mg tabs 815 fexofenadine 60ml syp 816 fibrinogen concentrate ( human ) solution 817 filgrastim 300mcg / 1ml prefilled syringe 818 finaestride 5 mg tabs 819 finasteride 1 mg tabs 820 flavoxate tabs 821 flubiprofen sodium eye drop 822 flucona zole 100 ml inj. 823 fluconazole 0 .5 % 15gm cream 824 fluconazole 200 mg / 100ml inj. 825 fluconazole + azithromycin + ornidazole kit 826 fluconazole 10 mg / ml inj. 827 fluconazole 150 mg tabs 828 fluconazole tablets ip 150mg 829 flucticasone propionate 50mcg per puff nasal spray 830 flucticasone propionate respule 0.5mg / 2ml 831 fludrocortisone tabs 832 flumazenil tabs 833 flunarizine tab 5 mg 834 flunarzine 10mg tabs 835 flunarzine 5mg tabs 836 fluoxetine + alprazolam tabs 837 fluoxetine hydrochloride 20 mg caps 838 flurbiprofen sodium eye drop 839 fluticasone propionate and salmeterol nasal spray 840 fluticasone propionate nasal spray 841 folic acid 5mg tabs 842 fondaparinux sodium prefilled syringe 843 formoterol caps 844 formoterol fumarate + budesonide caps 845 formoterol fumarate 6 mcg + futicasone caps 846 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 847 fosinopril 600 mg tabs 848 fosinopril sodium + hydrochlorothiazide tabs 849 fosphenytoin 75 mg / 10ml inj. 850 fosphenytoin 75 mg / 2ml inj. 851 framycetin sulphate cream 1 o / o 100 gm pack 852 framycetin sulphate cream 1 o / o 30gm pack 853 frusemide ( 10 mg / ml ) inj. 854 frusemide 40 mg tabs 855 frusemide tab ip 40 mg 856 fungal diastase + pepsin 100 ml syp 857 fungal diastase + pepsin 200 ml syp 858 furazolidone + metronidazole + dicyclomine syp 859 furazolidone + metronidazole syp 860 furazolidone 100 mg tabs 861 furosemide inj. 862 furosemide injection ip 10mg / ml ( im and iv use ) 863 fusidic acid + beclomethasone dipropionate cream 864 fusidic acid 2 % w / v cream 865 fusidic acid cream ip 2% 866 gabapentin 100 mg tabs 867 gabapentin 400 mg tabs 868 gabapentin 600 mg tabs 869 gabapentin 800 mg tabs 870 gabapentin + methylcobalamin tabs 871 gabapentin capsules usp 300mg tabs 872 gabapentin+nortriptyline ( 400 / 10mg ) tablets 873 ganciclovir 500 mg inj. 874 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) 875 gatifloxacin ophthalmic solution, 876 gdw 10% 500 ml inj. 877 gefitinib 250 mg tabs 878 gemcitabine 1000 mg inj. 879 gemcitabine 200 mg inj. 880 gemfibrozil tabs 881 gemifloxacin mesylate 320 mg tabs 882 genevac b 10mg ( 10 ml vial ) inj. 883 gentamicin + dexamethasone inj. 884 gentamicin + prednisolone acetate inj. 885 gentamicin 10ml inj. 886 gentamicin 20ml inj. 887 gentamicin 30ml inj 888 gentamicin eye drop 889 gentamycin injection ip 80mg / 2ml ( im / iv use ) 890 gentamycin sulphate 80 mg / 2ml inj. 891 ginkgo biloba capsule 892 ginseng extract 42.5 mg, vitamin a 2500 iu, vitamin b1 1 mg, vitamin b2 1.5 mg, vitamin b6 1 mg, vitamin b12 1 mcg, vitamin c 50 mg, vitamin e 5 mg, vitamin d 200 iu, nicotinamide 10 mg, carbohydrates 0.1 g, folic acid 0.15 mg, ferrous fumarate 30 mg, copper 0.5 mg, potassium sulphate 2 mg, manganese 0.5 mg, magnesium sulphate 3 mg, zinc oxide 10 mg, calcium 75 mg, phosphate 58 mg, iodine 0.1 mg, protein 0.2 g, fat 0.38 g inj. 893 glargine 100 iu / ml inj 894 glibenclamide + metformin + rosiglitazone tabs 895 glibenclamide 2.5 mg tabs ( scored oval ) 896 glibenclamide 5 mg tabs ( scored oval ) 897 glibenclamide 5mg + metforminhcl 500mg tab 898 glibenclamide tab ip 5 mg 899 gliclazide + metformin hcl tabs 900 gliclazide 40 mg tabs 901 gliclazide 60mg tab 902 gliclazide 80 mg tabs 903 gliclazide 80mg + metformin hydrochloride 500mg tab 904 gliclazide tab ip 40 mg 905 glimeperide 1mg tabs 906 glimeperide 2mg tabs 907 glimepiride 1 mg + pioglitazone + metformin tabs 908 glimepiride 1mg metformin 500mg tab 909 glimepiride 2 mg + pioglitazone + metformin tabs 910 glimepiride 2mg, metformin hydrochloride 1g tablets 911 glimepiride tab ip 1mg 912 glimepiride tab ip 2 mg 913 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 914 glimipride 3mg tab 915 glimipride 4mg tab 916 glimperide 2mg + metformnin hydrochloride 500mg tab 917 glipizide 10 mg tabs 918 glipizide 2.5 mg tabs 919 glipizide 5 mg tabs 920 glipizide 5mg + metformin hydrochloride 500mg tab 921 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 922 glipizide tab ip 5mg 923 glucagon 1 mg / vail inj. 924 glucosamine powder 925 glucosamine sulphate + chondroitin powder 926 glyburide + metformin tab 927 glyburide tab 928 glycerin ip 100 ml 929 glycerin ip 400 gm 930 glycerin ip 98%w / w liquid 931 glycerine 100 ml 932 glycerine 3000 ml 933 glycerine 400 ml 934 glyceryl trinitrate injection 935 glycopyrrolate inj 936 glycopyrrolate inj ip 0.2 mg / ml 937 gnrh analogue inj 938 gns 0.45% 100 ml iv 939 gns 0.45% 500 ml iv 940 gns 0.90% 500 ml iv 941 granisetron 1 mg tab 942 granisetron 3 mg tab 943 griseofulvin tab ip 125 mg 944 guaifenesin 100mg + terbutaline 2.5mg + bromhexine 8mg / 10ml syrup 945 h. pylori kit 1x 6 946 haemaccel 500 ml inj. 947 halobetasol propionate cream 948 haloperidol 5ml inj 949 halothane 250 ml inj 950 halothane bp 951 hamycin suspension 952 hemin injection 953 heparin + benzyl nicotinate 20 gm powder 954 heparin 25 k inj 955 heparin inj. 956 heparin sodium 1000iu / ml inj. 957 heparin sodium 5000iu / ml inj. 958 heparin sodium inj ip 5000 iu / ml ( im / iv use ) 959 hepatitis b immunoglobulin 100 iu inj. 960 hepatitis b immunoglubin for intravenous 2000 iu 40ml inj. 961 hepatitis b immunoglubin 200 iu 1ml inj. 962 homatropine eye drop 963 human albumin solution ip 20% 964 human anti d immunoglobulin inj 300 mcg 965 human chorionic ganadotropin 2000 iu inj 966 human chorionic ganadotropin 5000 iu inj 967 human chorionic gonadotropin injection ip 5000 i.u. 968 human immune globulin subcutaneous inj 969 human insulin r inj 970 human milk fortifier ( hmf sachets ) 971 hyaluronidase inj 972 hydralazine + hydrochlorothiazide tab 973 hydralazine tab 974 hydrochlorothiazide 12.5mg tab 975 hydrochlorothiazide 25mg tab 976 hydrochlorothiazide + triamterene tab 977 hydrochlorthiazide tab ip 12.5 mg 978 hydrochlorthiazide tab ip 25mg 979 hydrocortisone 100 ml inj. 980 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 981 hydrocortisone sodium succinate injection ip 100mg 982 hydrocortisone, neomycin, polymyxin b 5gm susp. 983 hydrogen peroxide 100 ml liquid 984 hydrogen peroxide 400 ml liquid 985 hydroquinone 2% + mometasone 0.1% + tretinoin 0.025 % cream 986 hydroquinone 2% cream 987 hydroquinone 2.0% w / w + tretinoin 0.025% w / w + mometasone furoate 0.1% w / w in a cream base q.s cream 988 hydroxychloroquine 400 mg tab 989 hydroxychloroquine 200mg tab 990 hydroxychloroquine sulphate tablets 200mg 991 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 992 hydroxyethyl starch in sodium chloride injection 3 % 993 hydroxyethyl starch in sodium chloride injection 6 % 994 hydroxyprogesterone 250 mg inj 995 hydroxyprogesterone 500 mg inj 996 hydroxyprogesterone inj ip 250mg / ml 997 hydroxyurea 500mg cap 998 hydroxyzine 25 mg tab 999 hydroxyzine hcl tablets ip 10mg 1000 hydroxyzine tab ip 25 mg 1001 hyoscine 2 ml inj 1002 hyoscine butyl bromide tablets ip 10mg 1003 hyoscine butylbromide + paracetamol tab 1004 hyoscine butylbromide inj ip 20 mg / ml 1005 hyoscine tab 1006 hypertonic saline ophthalmic solution 1007 hypromellose ( isopto tears ) ophthalmic solution 1008 i v i g inj. 1009 ibuprofen 400 mg tab 1010 ibuprofen + paracetamol + caffeine tab 1011 ibuprofen 400mg + paracetamol 325 mg tab 1012 ibuprofen 600 mg tab 1013 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 1014 ibuprofen film coated tablets ip 200mg 1015 ibuprofen oral suspension bp / usp 100 mg / 5 ml 1016 ibuprofen tab ip 200 mg ( coated ) 1017 ibuprofen tab ip 400 mg ( coated ) 1018 ibutilide fumarate inj 1019 imatinib mesylate 100 mg tab 1020 imatinib mesylate tablets ip 400mg 1021 imipenem + cilastatin injection 500mg / 500mg ip powder for solution 1022 imipenem 250 mg + cilastatin 250 mg inj 1023 imipenem 500mg and cilastatin 500mg inj 1024 imipramine 25 mg tab 1025 imipramine 75 mg tab 1026 imipramine + diazepam tab 1027 immune globulin intravenous infusion 5 mg 100 ml 1028 indapamide 1.5mg tab 1029 indomethacin 1 mg inj. 1030 indomethacin 25 mg cap 1031 indomethacin cap ip 25 mg 1032 indomethacin inj. 1033 infant milk formula lactogen & nanpro 1 400mg 1034 infliximab inj 1035 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1036 inj. pilocarpine 1037 inj. trypham. blue ( dyc ) 1038 insulin 30 / 70 ( human mistard ) inj 1039 insulin aspart inj 1040 insulin detemir inj 1041 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 1042 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 1043 insulin glargine inj 1044 insulin injection ( human ) ( 40iu / ml ) 1045 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 1046 insulin injection r 1047 insulin lispro inj 1048 intravenous fat emulsion infusion 1049 iohexol solution 300mg. 1050 ipratropium 20mcg + levosalbutamol 50 mcg inhaler 1051 ipratropium 20mcg, inhaler 1052 ipratropium 500mcg + levosalbutamol 1.25mg / 2.5 ml neb. 1053 ipratropium bromide + albuterol sulfate neb. 1054 ipratropium bromide inhalation 1055 ipratropium bromide nasal spray 1056 ipratropium bromide nebulizer solution 250 mcg / ml 1057 ipratropium powder for inhalation ip 40 mcg 1058 iron & zinc tab ( carbonyl iron 50 mg+ zinc sulphate monohydrate usp 61.8 mg equivalent to elemental zinc 22.5 mg + folic acid ip 0.5mg ) 1059 iron + folic acid + vitamin b12 tab 1060 iron + folic acid syrup 1061 iron dextran inj 1062 iron polymaltose complex + folic acid tab 1063 iron sorbitol inj 1064 iron sucrose 2 ml inj 1065 isabgol husk powder 1066 isoflurane 250mg inj 1067 isoflurane usp 1068 isolyte p 500 ml 10% inj 1069 isolyte p 500 ml ffs inj 1070 isolyte p 5% 500 ml inj. 1071 isoniazid inj 1072 isophane insulin inj ip 40 iu / ml 1073 isoprenaline inj 1074 isoprenaline injection ip 2mg / ml 1075 isoproterenol inj 1076 isosorbide 5 mononitrate 30 mg tab 1077 isosorbide dinitrate 10 mg tabs 1078 isosorbide dinitrate 5mg tab 1079 isosorbide dinitrate tab ip 5 mg 1080 isosorbide mononitrate tablets ip 20mg 1081 isosorbide mononitrate tabs ip 20 mg 1082 isotretinoin cap 20 mg 1083 isoxsuprine inj 1084 isoxsuprine inj ip 5 mg / ml 1085 isoxsuprine tab 10 mg 1086 isoxsuprine tab ip 20 mg 1087 itopride 20 mg tab 1088 itopride 10 mg tab 1089 itopride 50mg tab 1090 itraconazole 200 mg cap 1091 itraconazole 100mg caps 1092 itraconazole cap 100 mg 1093 ivermectin + albendazole tab 1094 ivermectin 6 mg tab 1095 ivermectin 12mg tab 1096 kabilyte 500 ml bottle ( balance fluid replenishment ) 1097 kanamycin inj 75 mg / 2 ml 1098 ketamine hydrochloride +amitriptyline 15gm inj 1099 ketamine hydrochloride 10 ml inj 1100 ketamine hydrochloride 2 ml inj 1101 ketamine inj ip 50 mg / ml 1102 ketoconazole shampoo 100 ml 1103 ketoconazole soap 1104 ketoconazole 200mg tab 1105 ketoconazole cream 2%w / w 1106 ketorolac dt 10mg tab 1107 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 1108 ketotifen ophthalmic solution 1109 kit of mifepristone 200mg ( 1 tab ) + misoprostol 200mcg ( 4 tabs ) 1110 labetalol 20 mg 2 ml inj 1111 labetalol 100mg tab 1112 labetalol 5mg / ml inj 1113 labetalol hcl inj ip 20mg / 4ml 1114 labetalol tab ip 100mg 1115 lactated ringers and 5% dextrose injection ffs 1116 lactated ringers and 5% dextrose injection pps 1117 lactic acid + nicotinamide + folic acid oral susp. 1118 lactic acid bacillus tab 60 million spores 1119 lactitol sachet 1120 lactobacillus sporogenes 60 million spores tabs 1121 lactose face furmula milk sol 1122 lactulose enema 250 ml oral sol. 1123 lactulose 10 g / 15 ml syrup 1124 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml 1125 lamivudine + nevirapine + stavudine tab 1126 lamivudine + stavudine tab 1127 lamivudine + zidovudine + nevirapine tab 1128 lamivudine 100 mg tab 1129 lamivudine 150 mg + zidovudine 300 mg tab 1130 lamotrigine 100 mg dt tab 1131 lamotrigine 25 mg dt tab 1132 lamotrigine 50 mg tab 1133 lanreotide inj 1134 lansoprazole 15 mg inj 1135 lansoprazole 30 mg inj 1136 lansoprazole + amoxicillin + clarithromycin cap 1137 laxative suspension liqid paraffin 3.75ml+milk of magnesia 11.25ml ) 1138 lbw formula milk 1139 leflunomide 10 mg tab 1140 leflunomide tablets ip 10mg ( film coated ) 1141 leflunomide tablets ip 20mg 1142 lenalidomide capsules 10mg 1143 letrozole tablets 2.5mg 1144 leucovorin calcium 15 mg tab 1145 leucovorin calcium 50 mg tab 1146 levamisole adult 1147 levamisole paed 1148 levetiracetam 500mg tab 1149 levetiracetam inj. 1150 levetiracetam syrup 100mg / 5ml 1151 levocarnitine 250 mg 1152 levoceitrizine tablet 5mg 1153 levocetirizine 30 ml inj 1154 levocetirizine 60 ml inj 1155 levocetirizine + montelukast tab 1156 levocetrizine 5 mg tabs 1157 levocetrizine hcl 5mg, phenylephrine hcl 5mg, ambroxol hcl 30mg, paracetamol 325mg tab 1158 levodopa + carbidopa + entacapone tab 1159 levodopa and carbidopa tab 1160 levodopa tab 1161 levodropropizine oral susp 1162 levofloxacin 750 mg tab 1163 levofloxacin 250 mg tabs 1164 levofloxacin 500 mg infusion 1165 levofloxacin 500 mg infusion / iv 1166 levofloxacin 500 mg tabs 1167 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 1168 levofloxacin tablets ip 250 mg 1169 levoleucovorin inj 1170 levonorgestrel + ethinyl estradiol tab 1171 levonorgestrel tab 1172 levosalbutamol + ipratopium neb 1173 levosalbutamol 100ml syp 1174 levosalbutamol 1mg tab 1175 levosalbutamol 2mg tab 1176 levosulpiride 50 mg tab 1177 levosulpiride 75mg + esomeprazole 40mg caps 1178 levosulpiride 75mg + pantoprazole 40mg caps 1179 levosulpiride tablets 25mg 1180 levosulpiride ( sr ) 75mg + rabeprazole ( ec ) 20mg caps 1181 levo thyroxine sodium 100mcg tab 1182 levo thyroxine tablets ip 50 mcg ip 1183 lignocaine ( lidocaine ) hydrochloride gel ip 2% w / v 1184 lignocaine + adrenaline ( 1% + 2% ) w / v inj. 1185 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 1186 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg 1187 lignocaine gel ip 2% 1188 lignocaine heavy 5% inj 1189 lignocaine inj ip 2 o / o 1190 lignocaine ointment 5 o / o 1191 lincomycin 2 mg tab 1192 lincomycin 2 ml inj 1193 linezolid 100 mg tab 1194 linezolid 200 mg / 100 ml infusion 1195 linezolid 200 mg / 300 ml infusion 1196 linezolid 300 mg tab 1197 linezolid 20 lid 100 ml inj. 1198 linezolid 600 mg tab 1199 linezolid infusion 600mg / 300ml 1200 linezolid inj 200mg / 100ml 1201 linezolid tablets ip 600 mg 1202 lipid complex inj. 1203 liposomal amphotericin b inj. 1204 liposomol amphotericine b injection 10 mg 1205 liquid medical oxygen ( lmo ) 1206 liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg / 5ml emulsion sol 1207 liquid paraffin ip 100 ml 1208 liquid paraffin ip 400 ml 1209 liquid parafin 100 ml syp 1210 lisinopril 2.5 mg tab 1211 lisinopril + amlodipine ( 5 mg + 5mg ) tabs 1212 lisinopril + hydrochlorothiazide tab 1213 lisinopril 5mg tabs 1214 lisinopril tab ip 2.5 mg 1215 lisinopril tab ip 5 mg 1216 lisinopril tablets ip 10 mg 1217 lithium carbonate tab 1218 l lysine + multivitamins ( vit b1, b2, b3, b5, b6 ) syrup 1219 l methylfolate calcium 7.5mg tablet 1220 loperamide tab 1221 loperamide tab ip 2 mg 1222 loratadine + ambroxol tab 1223 loratadine + pseudoephedrine tab 1224 loratidine 10mg tab 1225 lorazepam 0.5 mg tab 1226 lorazepam 0 .25 mg tab 1227 lorazepam tablets ip 1mg 1228 lorazepam tablets ip 2mg 1229 losartan + h.ch. thaizide ( 50 mg + 12.5mg ) tabs 1230 losartan 25mg tabs 1231 losartan 50mg + amlodipine 5mg tab 1232 losartan potassium 50 mg tabs 1233 losartan tab ip 25 mg 1234 losartan tab ip 50 mg 1235 lotion betamethasone 0.05% 1236 low lactose formula nanlolac 200mg 1237 lsosartan potassium 50 mg tab 1238 lumafantrine + artesunate tab 1239 lumefantrine tab 1240 lycopene antioxidant + multi vitamin cap 1241 lymphocyte immune globulin inj 1242 magaldrate + simethicone + oxetacaine syp 1243 magaldrate 400 mg + simethiocone 20 mg syp 1244 magensium sulphate inj. 1245 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 1246 mannitol 350 ml ffs inj 1247 mannitol ( 10% ) with glycerin inj 1248 mannitol + glycerine iv inj 1249 mannitol inj ip 20% w / v 1250 measles, mumps, and rubella ( mmr ) vaccine inj 1251 meclizine tab 1252 mecobalamin 10 ml inj 1253 mecobalamin 1500 mcg tab 1254 mecobalamin 500 mcg tab 1255 mecobalamin + lipoic acid + folic acid + pyridoxine tab / cap 1256 mecobalamin + pregabalin cap 1257 mecobalamin + thiamine + pyridoxine + l0lysine + d 0 panthenol tab / cap 1258 mecobalamin 500 mcg 1 ml inj 1259 medium chain triglyceride ( mct oil ) 50 ml 1260 medroxyprogesterone 10 mg tab 1261 mefenamic acid 250 mg tab 1262 mefenamic acid 500 mg tab 1263 mefenamic acid + dicyclomine tab 1264 mefenamic acid 500mg + paracetamol 325mg tab 1265 mefenamic acid 50mg, paracetamol 125mg / 5ml suspension 1266 mefenamic acid suspension 100mg / 5ml 1267 mefenamic acid tablets bp 500 mg 1268 mefloquine + artesunate tab 1269 mefloquine tab 1270 melatonin supplement 1271 melphalan inj 1272 mephentermine inj 1273 meropenem 125 mg inj 1274 meropenem 250 mg inj 1275 meropenem inj ip 500 mg 1276 meropenem inj. ip 1gm 1277 meropenem injection ip 250 mg 1278 metformin 1000mg sr + glimipride 2mg tablet 1279 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 1280 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 1281 metformin hydrochloride 1000 mg sr tabs 1282 metformin hydrochloride 500mg tabs 1283 metformin hydrochloride prolong release 500mg tab 1284 metformin hydrochloride ( sustained release tablets ip 1000 mg 1285 metformin sr tablets ip 850mg 1286 metformin tab ip 500 mg ( film coated ) 1287 methacholine chloride inj 1288 methamphetamine hydrochloride tab 1289 methlprednisolone iv inj. 1290 methotrexate 1 gm inj 1291 methotrexate 15 gm inj 1292 methotrexate 2.5mg tab 1293 methotrexate 500mg inj 1294 methoxsalen inj 1295 methyl ergometrine 0.125mg tabs 1296 methyl ergometrine inj 1297 methyl prednisolone sodium succinate 1000mg inj 1298 methyl prednisolone sodium succinate for injection usp 500 mg 1299 methylcobalamin + nicotinamide tab 1300 methylcobalamin 1500mcg tab 1301 methylcobalamin 500 mcg + vitamin tab 1302 methylcobalamin + pyridoxine + folic acid tab 1303 methylcobalamin 200 ml bottle syp 1304 methylcobalamin 5 ml / 500 mg syp 1305 methylcobalamin 500mcg inj 1306 methyldopa 250 mg cap 1307 methyldopa + hydrochlorothiazide cap 1308 methyldopa tab ip 250mg film coated 1309 methylergometrine inj ip 0.2 mg / ml 1310 methylergometrine tab ip 0.125 mg 1311 methylphenidate hydrochloride tab 1312 methylprednisolone 4 mg tab 1313 methylprednisolone 8 mg tab 1314 methylprednisolone 1 gm inj 1315 methylprednisolone 16 mg tab 1316 metoclopramide hydrochloride syrup ip 5 mg / 5ml 1317 metoclopramide inj ip 10mg / 2ml 1318 metoclopramide injections ip 5mg / ml 1319 metoclopramide tab ip 10 mg 1320 metolazone tab 1321 metoprolol 100mg tab 1322 metoprolol 25 mg tabs 1323 metoprolol 50 mg tabs 1324 metoprolol 50mg + amlodipine 5mg tab 1325 metoprolol succinate 25 mg extended release tab 1326 metoprolol succinate 50 mg extended release tab 1327 metoprolol succinate extended release tablets ip 50 mg 1328 metoprolol tablets ip 25 mg 1329 metoprolol tartrate and hydochlorothiazide tab 1330 metrogyl 100 ml inj. 1331 metronidazole 400 mg tabs 1332 metronidazole 5 mg / ml infusion 1333 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 1334 metronidazole film coated tablets ip 200mg 1335 metronidazole inj ip 500 mg / 100ml 1336 metronidazole tablets ip 200 mg ( film coated ) 1337 metronidazole tablets ip 400 mg ( film coated ) 1338 miconazole 15gm cream 1339 miconazole + flucinolone 15gm cream 1340 miconazole nitrate cream ip 2% 1341 micronisid progesterone 200 mg cap 1342 midazolam 10 ml inj 1343 midazolam 1mg / ml 5 ml inj 1344 midazolam inj ip 1 mg / ml 1345 midodrine hydrochloride tab 1346 mifepristone 200 mg tabs 1347 mifepristone tab ip 200mg 1348 miglitol 25 mg tab 1349 miglitol 50 mg tab 1350 milk formula for lbw 100ml 1351 milk formula for lbw 340ml 1352 milrinone inj 1353 minocycline hydrochloride cap 1354 minoxidil 10% topical solution 1355 minoxidil 2% topical solution 1356 minoxidil 5% topical solution 1357 mirabegron er 50 mg. tablets 1358 mirtazapine 30mg tab 1359 mirtazapine 7.5mg tab 1360 misoprostol 200mcg film coated tabs 1361 misoprostol tab ip 200 mcg 1362 mometasone + nadifloxacin + miconazole cream 1363 mometasone furoate + hydroquinone + tretinoin 15gm cream 1364 mometasone furoate 0.1 % w / w cream 1365 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 1366 montelukast 10mg + fexofenadine hcl 120mg tab 1367 montelukast 4 mg tab 1368 montelukast sodium + levocetrizine ( 10 mg + 5mg ) tab 1369 montelukast sodium 10 mg tab 1370 montelukast sodium 5 mg tab 1371 morphine sulfate + naltrexone hydrochloride inj 1372 morphine sulfate inj 1373 morphine sulphate inj ip 10mg / ml 1374 mosapride sol. 1375 mouth ulcer gel ( choline salicylate sodium 9% w / v, benzalkonium chloride 0.01% w / w ) 1376 moxifloxacin 400mg tab 1377 moxifloxacin hcl+ dexamethasone + benzalkonium chloride solution 0.02% v / v sterile opthelmic sol 1378 moxifloxacin inj 1379 mucodilator expectorant terbutaline sulphate 1.25 mg, bromhexine 4 mg, guaiphenesin 50 mg, menthol 2.5 mg per 5 ml syp 1380 multiple electrolytes & dextrose inj. 10% 500ml i.v. bottle ( e.g.: isolyte p rorte 10% ) 1381 multiple electrolytes and dextrose injection ffs 1382 multistix plt. 1383 multivitamin syp 1384 multivitamins ( b complex ) tab 1385 mupirocin ointment 2% w / w 1386 n acetyl cysteine neb. 1387 nalidixic acid oral syp 1388 naloxone inj 1389 naltrexone tab 1390 nandralone decanoate 100mg inj 1391 nandralone decanoate 50mg inj 1392 nandrolone decanoate 25mg / ml inj 1393 naproxen 275 mg tab 1394 naproxen 550 mg tab 1395 naproxen + esomeprazole magnesium tab 1396 naproxen tablet ip 250mg 1397 naproxen tablet ip 500mg 1398 naratriptan tab 1399 nateglinide tab 1400 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 1401 nebivolol 2.5 mg tab 1402 nebivolol 5 mg tab 1403 nebivolol + amlodipine tab 1404 nebivolol + valsartan tab 1405 nebivolol 5 mg, hydrochlorothiazide 12.5 mg tab. 1406 nebivolol tablets ip 10mg 1407 neomycin 0.5% +fluocinalone0.025%+clotrimazole 1% 15gm cream 1408 neomycin and dexamethasone ophthalmic ointment 1409 neomycin and polymyxin b sulfates and hydrocortisone otic solution 1410 neomycin and polymyxin b sulfates, bacitracin zinc, and hydrocortisone oint 5 gm 1411 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 1412 neomycin powder 1413 neomycin, polymyxin and bacitracin zinc ophthalmic ointment 20 gm 1414 neomycin, polymyxin and bacitracin zinc ophthalmic powder 10gm oint 1415 neomycin, polymyxin b and dexamethasone ophthalmic otic solution 1416 neomycin, polymyxin b and hydrocortisone 5gm oint 1417 neomycin, sulphacetamide sodium, bacitracin zinc powder 1418 neostigmine 1 ml inj 1419 neostigmine 5 ml inj 1420 neostigmine tab ip 15 mg 1421 nepafenac 0.1% w / v eye drop 1422 nesiritide inj 1423 netilmicin 10 mg inj 1424 netilmicin 20 mg inj 1425 netilmicin 25 mg inj 1426 netilmicin 50 mg inj 1427 nevirapine 200 mg tab 1428 niacin + lovastatin tab 1429 niacin tab 1430 nicardipine hydrochloride infusion solution 20mg / 200ml 1431 nicorandil 10mg tab 1432 nicorandil 5 mg tab 1433 nicotine gum 1434 nicotine inhalation system inhaler 1435 nicotine nasal spray 1436 nifedipine 10mg cap 1437 nifedipine cap ip 5mg 1438 nifedipine prolonged release 20mg tab 1439 nifedipine tablets ip 10 mg ( sustained release ) 1440 nimesulide + dicyclomine tab 1441 nimesulide + paracetamol + chlorozoxone tab 1442 nimesulide + paracetamol tab 1443 nimesulide + pcm+ cet+pph+caffine tab 1444 nimesulide + serratiopeptidase tab 1445 nimesulide + tizanidine tab 1446 nimesulide 1% w / w gel 1447 nimesulide 100 mg tab 1448 nimodipine cap 1449 nitrofurantoin tablets i.p 100mg 1450 nitroglycerin 2.6 mg tab 1451 nitroglycerin inj 5 mg / ml 1452 nitroglycerin ointment 1453 nitroglycerine injection 5mg / ml 1454 nitroprusside sodium inj 1455 noradrenaline injection ip 2 mg / ml 1456 norepinephrine bitartrate inj 1457 norethindrone acetate and ethinyl estradiol tab 1458 norethisterone 5mg tab 1459 norethisterone tab ip 5 mg 1460 norfloxacin 400 mg tab 1461 norfloxacin + metronidazole 30 ml tab 1462 norfloxacin 400mg + tinidazole 600 mg tabs 1463 norfloxacin tab ip 400mg film coated 1464 norgestimate and ethinyl estradiol tablets 1465 normal saline 500 ml inj. 1466 nortriptyline tablet 25mg tablet 1467 octreotide inj 1468 octreotide injection 50 mcg / ml 1469 ofloxacin 100 mg tab 1470 ofloxacin 50mg tab 1471 ofloxacin + dexamethasone infusion 1472 ofloxacin + metronidazole infusion 1473 ofloxacin + tinidazole infusion 1474 ofloxacin 200 mg tabs 1475 ofloxacin 200mg + ornidazole 500 mg tab 1476 ofloxacin 200mg+ornidazole500mg infusion 1477 ofloxacin 400 mg tabs 1478 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 1479 ofloxacin eye drops 0.3%w / v 1480 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) 1481 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 1482 ofloxacin oral suspension ip 50mg / 5ml 1483 ofloxacin tab ip 200 mg 1484 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 1485 oitment mupirocin ip 2% 1486 olanzapine and fluoxetine cap 1487 olanzapine tablets i.p 10mg 1488 olanzapine tablets i.p 5mg 1489 olmesartan 20 mg tab 1490 olmesartan 20mg + amlodipine 5mg tab 1491 olmesartan 40mg tab 1492 olmesartan medoxomil 20 mg+ hydrochlorothiazide 12.5 mg tab 1493 olmesartan medoxomil 40mg + hydroclorthiazide 12.5mg tab 1494 olmesartan tablets 20mg 1495 olmesatan medoxomil & metoproloi succinate er tablet 25 mg 1496 olmesatan medoxomil tablet 20 mg 1497 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 1498 olopattadine eye drops 1499 omalizumab inj 1500 omega 3 acid ethyl esters cap 1501 omeprazole 40 mg cap 1502 omeprazole + domperidone ( 20 mg + 10 mg ) caps 1503 omeprazole 20 mg tabs 1504 ondansetron 8 mg tab 1505 ondansetron 10 ml inj 1506 ondansetron 2 mg / ml inj. 1507 ondansetron 4 mg tabs 1508 ondansetron oral solution i.p 2 mg / 5ml 1509 ondansetron orally disintegrating tablets ip 4mg 1510 oral rehydration salts citrate ip 21 gm ( who formula ) sachet 1511 orciprenaline syp 1512 orlistat 120 mg cap 1513 orlistat 60 mg cap 1514 ornidazole 500 mg tabs 1515 ors powder 21.2 gm 1516 ors powder 4.21 gm 1517 oseltamivir 75 mg cap 1518 oxaliplatin 100 mg inj 1519 oxaliplatin injections 50mg 1520 oxazepam cap 1521 oxcarbazepine 150 mg tab 1522 oxcarbazepine tablets i.p 300mg 1523 oxetacaine 10mg + aluminium 0.291mg + magnesium 98mg / 5ml gel 1524 oxymetazoline 0.5mg / ml nasal drops 1525 oxytocin 5 iu / ml inj. 1526 oxytocin inj ip 5 iu / ml 1527 paclitaxel 260 mg vial inj 1528 paclitaxel 30 mg vial inj 1529 paclitaxel injection 100mg 1530 pamidronate inj 1531 pancreatin 150 mg tab 1532 pancrelipase delayed release cap 1533 pancuronium bromide inj 1534 pantoprazole + domperidone dsr cap 1535 pantoprazole 40 mg tabs 1536 pantoprazole 40 mg / 10ml inj. 1537 pantoprazole 40mg + itopride 150mg s.r. tab 1538 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 1539 paracetamol 100 ml ffs infusion 1540 paracetamol 125 mg / 5 ml syrup 1541 paracetamol 125mg+ cpm 1 mg + sodium citrate 60mg in a flavour syrup base 1542 paracetamol 325mg + diclofenac sodium 50 mg tab 1543 paracetamol 325mg + tramadol 37.5mg tab 1544 paracetamol 500mg + phenylephrine 10mg + chlorpheniramine 2mg tab 1545 paracetamol 500mg tab 1546 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 1547 paracetamol ds syrup / 250 mg 1548 paracetamol infusion ip 1% w / v 100ml size 1549 paracetamol inj. 150 mg / ml 1550 paracetamol ip 125mg, promethazine hcl 5mg suspension 1551 paracetamol ip…125 mg., mefanamic acid ip…50 mg., in a flavoured syrup base…q.s. 1552 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 1553 paracetamol tab ip 500 mg 1554 paracetomal 650mg tab 1555 paroxetine 12.5 mg tab 1556 paroxetine 25 mg tab 1557 paroxetine 37.5 mg tab 1558 pc enema 1559 pefloxacin tab 1560 peg ( alprastadil ) ( prostaglandin e1 500 mcg inj. 1561 penicillamine cap 1562 penicillin g benzathine and penicillin g procaine inj 1563 penicillin g potassium inj 1564 penicillin g potassium or sodium injection 1565 penicillin procaine inj 1566 penicillin v potassium oral syp 1567 pentamidine isethionate inj 1568 pentazocine + acetaminophen tab 1569 pentazocine + aspirin tab 1570 pentazocine + naloxone tab 1571 pentazocine inj ip 30mg / ml ( im / iv use ) 1572 pentobarbital inj 1573 pentoprazole inj 40 mg 1574 pentoxifylline inj 1575 pepsin 10mg + diastase 50mg oral liquid / 5 ml 1576 perindopril + indapamide tab 1577 perindopril 4 mg tab 1578 permethrin cream 5% w / w 1579 pheniramine inj ip 22.75mg / ml 1580 pheniramine maleate 25 mg tabs 1581 pheniramine maleate i.p. 22.75mg, methyl paraben ( as preservative ) i.p. 0.135% w / v, propyl paraben ( as preservative ) i.p. 0.015% w / v, water for injection i.p. q.s. inj 1582 phenobarbitone 60 mg tab 1583 phenobarbitone inj 1584 phenobarbitone tablets i.p 30mg 1585 phenoxybenzamine cap 1586 phentermine cap 1587 phentolamine mesylate inj 1588 phenylbutazone cap 1589 phenylephrine inj 1590 phenylephrine hydrochloride 5.00mg chlorpheniranmine maleate 2.00mg eye drops 1591 phenytoin 200 ml inj 1592 phenytoin 50 mg tab 1593 phenytoin 50 mg / ml, 2 ml inj 1594 phenytoin sodium 100 mg tabs 1595 physostigmine inj. 1596 pilocarpine tab 1597 pimecrolimus cream 1598 pioglitazone 30 mg tab 1599 pioglitazone 7.5 mg tab 1600 pioglitazone 15 mg tabs 1601 pioglitazone 15 mg tabs + metformin 500mg tab 1602 pioglitazone 30 mg tabs 1603 pioglitazone hydrochloride + glimepiride tab 1604 pioglitazone tab ip 15 mg 1605 piperacillin + tazobactum for injection ip 4gm+500mg 1606 piperacillin 1 mg and tazobactam 125 mg inj 1607 piperacillin 2 mg and tazobactam 250 mg inj 1608 piperacillin 4gm + tazobactum 0.5 mg inj. 1609 piperacillin injection 2 gm + tazobactom 250mg ip 1610 piperacillin sodium inj 1611 piracetam 100ml inj 1612 piracetam 200ml inj 1613 piracetam 800mg tab 1614 piracetam syrup 500mg / 5ml 1615 piracetam tablets 400mg 1616 piroxicam cap 1617 piroxicam 20 mg tablets 1618 piroxicam 20 mg with bezyl alcohol injection 1619 piroxicam 20mg caps 1620 piroxicam 40 mg with bezyl alcohol injection 1621 polymixin sulphate b injection usp 5 lac i.u. 1622 polymyxin b inj. 1623 polyvitamin ( prophylactic ) nfi tabs 1624 potassium chloride 200 ml inj 1625 potassium nitrate + sodium fluoride mouthwash 1626 povidone iodine 100 ml sol 1627 povidone iodine 2 litre 1628 povidone iodine + metronidazole 15 gm tube 1629 povidone iodine 10 % solution ip 1630 povidone iodine 250 gm jar 1631 povidone iodine 5 % solution 1632 povidone iodine 5% w / w ointment 1633 povidone iodine 500 gm 1634 povidone iodine 7.5% scrub solution 1635 povidone iodine ointment 5% 15 gm 1636 povidone mouthwash 50 ml 1637 povidone vaginal cream 1638 powder clotrimazole 1% w / w 30 gm 1639 pralidoxime chloride ( pam ) inj 1640 praziquantel tab 1641 prazosin 5mg tab 1642 pre biotic sachet ( 1 gm sachet ) 1643 pre probiotics sachet 1644 prednisolone tab ip 20 mg 1645 prednisolone tablet ip 10 mg 1646 prednisolone tablets ip 5 mg 1647 prednisolone, neomycin and polymyxin b ophthalmic suspension 1648 pregabalin 150 mg cap 1649 pregabalin + methylcobalamine + alphalipoic acid + folic acid + pyridoxine cap 1650 pregabalin 75mg + methylcobalamin 750 mcg tab 1651 pregabalin 75mg tab 1652 pregabalin capsules 75mg 1653 preterm / l.b.w. formula milk powder ( packaging 400 gm ) 1654 primaquine 15 mg tabs 1655 primaquine tab ip 2.5 mg 1656 primaquine tab ip 7.5 mg 1657 pro biotic sachet 1658 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1659 prochlorperazine 5 mg tabs 1660 prochlorperazine maleate tablets i.p 5mg 1661 prochlorperazine mesylate injection 12.5mg / ml 5ml size 1662 progesterone 100 mg cap 1663 progesterone 200 mg 1 ml inj 1664 progesterone 200 mg cap 1665 progesterone inj 200 mg / 2ml 1666 promethazine + pcm tab 1667 promethazine ( 5 mg / 5ml ) syrup 1668 promethazine 25mg tab 1669 promethazine hcl + dextromethorphan hydrobromide syp 1670 promethazine hcl + phenylephrine hcl syrup 1671 promethazine inj ip 25mg / ml 1672 promethazine syrup ip 5 mg / 5ml 1673 promethazine tab ip 25 mg 1674 propofol 1 % 20 ml inj 1675 propofol inj ip 10 mg / ml 1676 propoxyphene tab 1677 propoxyphene napsylate and acetaminophen cap 1678 propoxyphene, aspirin, and caffeine tab 1679 propranolol hydrochloride + hydrochlorothiazide tab 1680 propranolol tab ip 40 mg 1681 propranolol tablets ip 10mg 1682 prostadine inj. 1683 protamine sulphate iv solution 1684 protein supplement 1685 psoralen inj 1686 pyrantal pamoate tab 1687 pyrazinamide 750 mg tab 1688 pyrazinamide tablets i.p 1000mg 1689 pyridostigmine inj 1690 pyridoxine 40 mg tab 1691 pyridoxine + folic acid sustained release tab 1692 quetiapine fumarate tablets i.p 200mg 1693 quetiapine tablets i.p 100mg 1694 quinine 300 mg / 2ml inj 1695 quinine sulphate 300mg tab 1696 rabeprazole + domperidone sr ( 20 mg + 30 mg ) tabs 1697 rabeprazole 20 mg tabs 1698 rabeprazole 20mg + domperidone 10mg cap 1699 rabies immune globulin ( human ) inj 1700 racecadotril 10 mg tab 1701 racecadotril 100 mg tab 1702 racecadotril 30 mg tab 1703 racecadotril sachet 1 gm 1704 ramipril 10 mg tab 1705 ramipril + telmisartan tab 1706 ramipril 2.5 mg tabs 1707 ramipril 5 mg tabs 1708 ramipril 5mg + hydroclorthiazide 12.5mg tab 1709 ranitidine ( 50 mg / 2ml ) inj. 1710 ranitidine + domperidone tab 1711 ranitidine hcl. 150 mg tabs 1712 ranitidine hcl. 300 mg tabs 1713 ranolazine tab 1714 rattle snake antivenin polyvalent inj 1715 ravlon solution ( chlorhexidine + cetramide ) ( 1.5 % w / v + 3% w / v ) solution 1716 recombinant hpv bivalent vaccine inj 1717 recombinant hpv quadrivalent vaccine inj 1718 recombinant interferon inj 1719 rectified spirit 1720 repaglinide tab 1721 repaglinide + metformin hcl tab 1722 resp. levosalbutamol 2.5ml for 5 resp. 1723 reteplase inj 1724 rho ( d ) immune globulin human inj 1725 ribavirin tab 1726 ribavirin, interferon alfa 2b, recombinant inj 1727 rifabutin oral solution 1728 rifampicin 150 mg tab 1729 rifampicin 300 mg tab 1730 rifampicin 450 mg tab 1731 rifampicin 600 mg tab 1732 rifampicin and isoniazide tablets ip ( 450 mg+300 mg ) 1733 rifampin + isoniazid + ethambutol tab 1734 rifampin + isoniazid + pyrazinamide kid tab 1735 rifapentine tab 1736 ringer lactate inj 1737 ringer lactate iv 500 ml glass inj 1738 ringer lactate iv 500 ml pps inj 1739 risperidone 1 mg tab 1740 risperidone 2mg tab 1741 risperidone 3mg tab 1742 risperidone tablets 4mg 1743 ritodrine tab 1744 ritonavir 100 mg tab 1745 rituximab inj 1746 rivastigmine cap 1747 rizatriptan wafer 10 mg cap 1748 rocuronium 50 mg inj 1749 rofecoxib tab 1750 rosiglitazone maleate + glimepiride tab 1751 rosiglitazone maleate + metformin hcl tab 1752 rosiglitazone maleate tab 1753 rosuvastatin 10mg + asprin 75mg tab 1754 rosuvastatin 40mg tab 1755 rosuvastatin 10mg + fenofibrates 160mg tab 1756 rosuvastatin 20mg tab 1757 rosuvastatin tablet 10 mg 1758 rosuvastatin tablet i.p 5mg 1759 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 1760 roxithromycin 50 mg tab 1761 roxithromycin ( 50 mg / 5ml ) susp. 1762 roxithromycin + ambroxol tab 1763 roxithromycin 150 mg tabs 1764 roxithromycin ip 300 mg tabs 1765 rucoranium inj 1766 salbutamol 100 mcg neb 1767 salbutamol 2.5 mg / 2.5 ml syrup 1768 salbutamol 200 mcg inhaler 1769 salbutamol + ambroxyl 100 ml syp 1770 salbutamol + bromhexine+ guiphenesin+menthol 100 ml syp 1771 salbutamol + bromhexine+ guiphenesin+menthol 60 ml syp 1772 salbutamol + theophylline 100 ml syp 1773 salbutamol 2 mg tabs 1774 salbutamol inhalation 100 mcg / dose 1775 salbutamol nebuliser solution bp 5 mg / ml 1776 salbutamol syrup ip 2mg / 5ml 1777 salbutamol tab ip 2 mg 1778 salbutamol tablet ip 4 mg 1779 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 1780 salmeterol inhalation powder 1781 salmeterol xinafoate + fluticasone powder for inhalation 1782 s amlodipine 2.5mg tab 1783 saxagliptin tab 1784 sclerosol intrapleural aerosol ( talc ) powder 1785 scopolamine transdermal patch 1786 scorpion vaccine 1787 secnidazole oral granules 1788 selegiline tab 1789 selenium inj 1790 serratiopeptidase 5 mg tab 1791 serratiopeptidase + diclofenac + pcm tab 1792 serratiopeptidase + diclofenac tab 1793 serratiopeptidase 10 mg tab 1794 sertraline tablets 50mg 1795 sertraline tablets i.p 100mg 1796 sertraline tablets i.p 25mg 1797 sevoflurane 1798 sildenafil 10 mg inj. 1799 sildenafil 50mg tab 1800 sildenafil citrarte inj. 10mg / 12.5 ml for iv use 1801 sildenafil tablets 100 mg 1802 silver sulfadiazine 10 gm cream 1803 silver sulfadiazine 15 gm cream 1804 silver sulfadiazine 500 gm cream 1805 silver sulphadiazine cream ip 1% 50gm tube 1806 simvastatin 10 mg tabs 1807 simvastatin 20 mg tabs 1808 sitagliptin + metformin hcl tab 1809 sitagliptin tab 1810 sodium bi carbonate 10ml inj. 1811 sodium bicarbonate 7.5 ( sbc ) inj 1812 sodium chloride 0.65% w / v nasal drops 1813 sodium chloride 100 ml inj 1814 sodium chloride 500 ml ffs inj 1815 sodium chloride 500 ml pps inj 1816 sodium cromoglycate oral concentrate 1817 sodium hyaluronate intra articular injection 1818 sodium nitroprusside inj 1819 sodium phosphate enema 100 ml 1820 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 1821 sodium picosulphate 10mg tab 1822 sodium polystyrene sulfonate oral syp 1823 sodium sulfacetamide lotion 1824 sodium sulphacetamide 10 % ophthalmic solution 1825 sodium valproate + valproic acid tab 1826 sodium valproate 100 mg / 5ml vial inj. 1827 sodium valproate 1ml 100 mg inj. 1828 sodium valproate 500 mg tab 1829 sodium valproate ec tablets i.p 200mg 1830 sodium valproate tablets 300mg 1831 somatostatin cap 1832 somatropin injection 1833 sotalol inj 1834 sparfloxacin 200 mg tab 1835 spectinomycin inj 1836 spiramycin inj 1837 spironolactone 100 mg tab 1838 spironolactone 50 mg tab 1839 spironolactone + hydrochlorothiazide tab 1840 spironolactone 25mg tab 1841 spironolactone tab ip 25mg 1842 spironolactone tablets ip 50 mg 1843 stavudine 30 mg cap 1844 stavudine 40 mg cap 1845 sterilized umbilical cotton tape width 3 mm , length 75 cm 1846 sterlium hand wash 1847 streptokinase 1500000 iu inj 1848 streptokinase injection 15 lac units ip 1849 streptomycin 1 gm inj 1850 succinylcholine inj 1851 succinylcholine inj. ip 50 mg / ml ( iv use ) 1852 sucralfate + metronidazole + lignocain cream 1853 sucralfate 1gm with oxetacain 10mg / 10ml suspension 1854 sucralfate suspension 500mg / 5ml 1855 sulfacetamide eye drop 10 % 1856 sulfacetamide eye drop 20 % 1857 sulfadoxine + pyrimethamine eye oint 1858 sulfamethoxazole + trimethoprim tab 1859 sulfamethoxazole inj 1860 sulfamethoxazole, trimethoprim, phenazopyridine tab 1861 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 1862 sulfasalazine tab ec bp 500mg 1863 sumatriptan and naproxen sodium tab 1864 sumatriptan inj 1865 sumatriptan succinate 50mg tab 1866 sumatriptan succinate25mg tab 1867 surfactant 3ml inj 1868 surfactant 4ml inj 1869 surfactant 5ml inj 1870 surfactant 8ml inj 1871 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 1872 surgical spirit 5lt. 1873 synthetic conjugated estrogens 1874 syrup vitamin d3 200 iu + vitamin b12 2.5 mcg + calcium phosphate eq. to elemental calcium 82 mg / 5 ml 1875 tacrolimus 0.03% oint 1876 tacrolimus 0.1% oint 1877 tadalafil 10 mg tab 1878 tadalafil 20mg tab 1879 tamoxifen citrate 10 mg tab 1880 tamoxifen citrate 20 mg tab 1881 tamsulosin 0.2 mg tab 1882 tamsulosin 0.4mg + dutasteride 0.5mg tab 1883 tamsulosin hydrochloride 0.4mg + finasteride 5 mg tab 1884 tamsulosin modified release capsules 0.4 mg 1885 tegaserod maleate 6 mg 1886 teicoplanin 200 mg inj 1887 teicoplanin 400 mg inj 1888 telmisartan 80 mg tab 1889 telmisartan + hydrochlorthiazide ( 40 mg + 12.5 mg ) tabs 1890 telmisartan 20 mg tabs 1891 telmisartan 40 mg tabs 1892 telmisartan 40mg + amlodipine 5mg tab 1893 telmisartan 40mg + chlorthalidone 12.5mg tab 1894 telmisartan 80mg, hydroclorthiazide 12.5mg tablets 1895 telmisartan tablets ip 40 mg 1896 telmisartan+metoprolol ( 50 / 40 mg ) tablets 1897 tenaligliptin tablet ip 20mg 1898 tenecteplase inj 1899 teneligliptin film coated tablets 20mg 1900 tenofovir 300 mg tab 1901 tenofovir disoproxil fumarate + emtricitabine tab 1902 terazosin cap 1903 terbinafine 250mg tab 1904 terbinafine cream 1%w / w ( 10 gm tube ) 1905 terbinafine hydrochloride tablet 250 mg 1906 terbutaline 2.5 mg tab 1907 terbutaline 5 mg tab 1908 terbutaline 2.5mg + bromhexine 8mg / 10 ml syrup 1909 terbutaline sulfate + brom + guiphenesin 100 ml syrup 1910 terbutaline sulfate + brom + guiphenesin 50 ml syrup 1911 terbutaline tablets ip 2.5 mg 1912 terlipressin tab 1913 testosterone inj 1914 tetanus and diphtheria toxoids adsorbed inj 1915 tetanus immune globulin ( human ) inj 1916 tetanus toxoid inj 1917 tetracycline 250 mg cap 1918 tetracycline 500 mg cap 1919 theophylline 25.3 mg+ etophylline 84.7mg / 2ml injections 1920 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 1921 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 1922 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 1923 thiamine 2 ml inj 1924 thiamine 30 ml inj 1925 thiocokhicoside 4 mg tab 1926 thiocokhicoside 8 mg tab 1927 thiocolchicoside + aceclofenac + pcm tab 1928 thiocolchicoside 4mg + aceclofenac 100mg tab 1929 thiopental sodium 1 gm inj 1930 thiopental sodium 500 mg inj 1931 thiopentone inj ip 0.5 g 1932 thyroxine 100mcg tab 1933 thyroxine 25mcg tab 1934 thyroxine 75mcg tab 1935 thyroxine 12.5mcg tab 1936 thyroxine sodium 50 mcg tabs 1937 thyroxine sodium tablets ip 100mcg 1938 thyroxine tablets ip 50 mcg 1939 ticarcillin disodium + clavulanate potassium inj 1940 ticarcillin iv inj 1941 tigecycline 50 mg inj. 1942 timolol maeleate 0.5 % eye drops 1943 timolol maleate + hydrochlorothiazide oint 1944 tinidazole 400 ml iv inj 1945 tinidazole tab ip 300 mg ( film coated ) 1946 tinidazole tab ip 500 mg ( film coated ) 1947 tiotropium bromide cap 1948 tobramycin and dexamethasone eye drop 1949 tobramycin eye drops 1950 torasemide 10 mg + spirolactone 100 mg tab 1951 torasemide 10 mg + spirolactone 50 mg tab 1952 torasemide 5 mg tab 1953 torasemide 10mg tab 1954 torasemide 20mg tab 1955 torsemide 10 mg / ml inj. 1956 torsemide 10mg / ml 2ml amp. inj. 1957 torsemide tab 10 ip mg 1958 tramadol 100 mg inj. 1959 tramadol 100mg tab 1960 tramadol 50 mg inj. 1961 tramadol 50 mg tab 1962 tramadol cap ip 50 mg 1963 tramadol hcl + pcm + domperidone tab 1964 tramadol hcl + pcm tab 1965 tramadol inj 50 mg / ml 1966 tranexamic acid + ethamsylate tab 1967 tranexamic acid 100 mg / 5ml inj. 1968 tranexamic acid 500 mg tabs 1969 tranexamic acid 500mg + mefenamic acid 250mg tab 1970 tranexamic acid injection ip 100mg / ml 5ml size 1971 tranexamic acid tablets ip 500 mg 1972 tretenoin cream usp 0.025% 1973 tretinoin cream 1974 triamcinolone acetomide 40 mg tab 1975 tricholine citrate 550 mg + sorbitol 7.15 gm syrup / 10 ml 1976 trihexyphenidyl 2 mg tab 1977 trimcelone acetonide 0.1 % mouth ulcer gel 1978 trimethoprim + sulfamethoxazole tab 1979 trimethoprim + sulfamethoxazole ds tab 1980 trimethoprim + sulfamethoxazole ss tab 1981 trimethoprim tab 1982 trop t kit 1983 troylase ( haemocougalase ) 1ml ( like botrapase ) inj. 1984 trypsin chymotrypsin cap 1985 turpentine oil 100 ml 1986 typhoid vaccine, live 1987 urea ip 1 % + salicylic acid ip 1% w / w zinc sulphate 0.1 % w / w cream 1988 urokinase 250000 inj 1989 urokinase 500000 inj 1990 urokinase injection 5 lac unit ( lyophilized ) 1991 ursodeoxycholic acid 300mg tab 1992 ursodeoxycholic acid 450 mg tab 1993 ursodiol 150 mg tab 1994 ursodiol 300 mg tab 1995 vaccine h. influenzae b inj 1996 vaccine hepatitis a inj 1997 vaccine hepatitis b ( recombinant ) 1 ml inj 1998 vaccine adenovirus inj 1999 vaccine chicken pox inj 2000 vaccine hepatitis b ( recombinant ) 0.5 ml inj 2001 vaccine hpv bivalent, recombinant inj 2002 vaccine human papilloma virus inj 2003 vaccine immune globulin intravenous inj 2004 vaccine influenza inj 2005 vaccine influenza virus inj 2006 vaccine mmr inj 2007 vaccine oral rota virus 2008 vaccine rabies 2.5 iu inj ( intramuscular ) 2009 vaccine rabies 2.5 iu inj ( intradermal ) ) 2010 vaccine typhoid 2011 vaccine yellow fever 2012 vaccinehpv quadrivalent , recombinant 2013 valacyclovir 1 gm inj 2014 valacyclovir 500 mg tab 2015 valdecoxib + paracetamol cap 2016 valdecoxib cap 2017 valethamate bromide inj 8mg / ml 2018 valganciclovir tablet 450 mg 2019 valproate sodium 333 mg + valporic acid 145mg cap 2020 valproate sodium 134 mg + valporic acid 58mg cap 2021 valproate sodium 200mg + valporic acid 87mg cap 2022 valsartan + hydrochlorothiazide tab 2023 valsartan tab ip 80mg tab 2024 valthamate bromide 8 mg inj 2025 vancomycin 250 mg. inj 2026 vancomycin for intravenous infusion ip 1 gm 2027 vancomycin for intravenous infusion ip 500 mg 2028 vancomycin intravenous infusion 500 mg inj 2029 vasopressin inj 2030 vecuronium 10 mg tab 2031 vecuronium bromide injection 2mg / ml ; 10mg 2032 vecuronium bromide injection i.p 4mg 2033 venlafaxine 100 mg tab 2034 verapamil 40 mg tab 2035 verapamil 5 mg / 2ml amp. inj. 2036 vidagliptin 50 mg tab 2037 vinblastine 10 mg 10 ml inj 2038 vincristine 1 mg inj 2039 vitamin a syp 2040 vitamin + iron tonic syrup 2041 vitamin b complex with vitamin c & zinc ( cebexin z ) caps 2042 vitamin b6 50mg tab 2043 vitamin b complex ( prophylactic ) tabs 2044 vitamin b complex nfi syrup 2045 vitamin d cholecalciferol 60000 iu / 1gm sachet 2046 vitamin d3 drop 2047 vitamin e 600 mg cap 2048 vitamin e + levocarnitine cap 2049 vitamin e 200 mg cap 2050 vitamin e capsule 400 mg 2051 vitamin e softgel capsules 400 mg 2052 vitamin k 3 inj 2053 vitamin k inj. 2054 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 2055 vitamins a, c, d, e and b complex and minerals syrup 2056 vitimin c tab 2057 vitneurin b1 b6 b12 3ml amp. inj. 2058 voglibose 0.2mg tab 2059 voglibose 0.2mg, metformin 500mg tablets 2060 voglibose 0.3 mg, metformin 500mg tablets 2061 voglibose 0.3mg tab 2062 voriconazole 200 mg 2063 voriconazole injection 200mg / vial 2064 warfarin 5mg tab 2065 water for injection amp polypack 2066 xylocard 2% 50ml inj. 2067 xylometazoline 0.1 % w / v nasal drop 2068 xylometazoline nasal drops ip 0.1% 2069 zaleplon cap 2070 zidovudine inj 2071 zinc 100 ml syp 2072 zinc sulphate 20mg / ml oral solution 2073 zoledronic acid inj 2074 zolpidem 5 mg tab 2075 zolpidem tablets i.p 10mg...

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Government Medical College - Rajasthan

25696328 supply of chemical test kits , reagents , media and glass ware items for microbiology 2 acetamide 3 acetic acid glacial 4 acetone ar 5 acridine orange 6 aerogas pack ( accessories for anaerobic system ) 7 albert stain –kit 8 ammonia 9 ammonium oxalate ar 10 andrade indicator 11 aniline 12 b. sterothermophilus spore strips 13 basic fuchsin 14 benzamide 15 calcofluor white m2r 16 carbamide 17 carbol fuchsin 18 catalase peroxidase kit for mycobacterium 19 catalase test kit for mycobacterium 20 catechol 21 cedar wood oil 22 charcoal powder 23 chlorazole black e 24 chromotrope zr 25 conc. hydrochloric acid ar 26 conc. sulphuric acid ar 27 coper ii chloride dihydrate 28 crystal violet 29 cycloheximide ( actidione ) 30 cynogen bromide 31 deionised water ( dw ) 32 di sodium hydrogen phosphate anhydrous 33 dpx mount 34 edta ar 35 eosin 2% 36 ethyl acetate ar 37 ethyl alcohol 38 fast green 39 ferric chloride ar 40 field stain a 41 field stain b 42 formaldehide 43 formalin tablets 44 formamide 45 gelatin 46 giemsa stain 47 glycerol ar 48 hcl 30% 49 hydrogen peroxide 30% ar 50 iodine crystals ar 51 iso amyl alcohol 52 koh 53 kovac indole reagent 54 lactophenol cotton blue 55 leishman stain 56 light green sf 57 liquid paraffin heavy 58 liquid paraffin light 59 loeffler methylene blue 60 lugol iodine 61 malachite gtreen 1% w / v 62 mangnese sulphate ar 63 mercurous chloride ( mgcl2 ) 64 methyl alcohol 65 methyl red indicator 66 methylated sprit 67 methylene blue pure 68 n.n. dimethyl formamide 69 neutral red 70 niacin detection kit w / syringe k047 kt 71 niacin strip 72 nigrosine 73 nitrate reduction test kit for mycobacterium 74 normal saline 75 omeara reagent 76 p nitrobenzoic acid 77 paraffin wax 78 periodic acid schiff ( pas ) 79 ph paper 0 – 13 80 phenol crystals ar 81 phenol red certified 82 phosphotungestic acid 83 polyivinyl alcohal a cold water soluble 84 b hot water soluble 85 potassium di hydrogen phosphate anhydrous 86 potassium dichromate ar 87 potassium iodide ar 88 potassium nitrate 89 potassium permangnate – ar 90 pyrazinamidase test kit for mycobacterium 91 pyrazinamide 92 saffranine crystal 93 schaeffer & fulton’s spore stain kit 94 schiffs fuchsin sulph reagent 95 sodium acetate 96 sodium chloride ar 97 sodium dihydrogen phosphate 98 sodium hydroxide – ar 99 sodium hypochlorite 4% 100 sodium hypochlorite 10% 101 sodium polyanetholsulphonate ( sps ) 102 sodium taurocholate 103 sulphanilic acid ar 104 sulphuric acid 105 teepol 106 tetramethyl p phenylene diamine dihydrochloride ( oxidase reagent ) 107 thiomersmal 108 thiophene carboxylic hybrazide test kit mycobacterium 109 toluidine blue 110 tripotassium phenophthlin di sulphate 111 twine 80 112 urea powder ar 113 xylene ar 114 zinc dust 115 zinc sulphate heptahydrate 116 ? nephthol ar 117 ? nephthylamine ar 118 antibiotic sensitivity disc 119 amikacin ( 30μg ) 120 amoxicillin + clavulanic acid ( 20 / 10μg ) 121 ampicillin ( 10 μg ) 122 ampicillin + sulbactam ( 10 / 10μg ) 123 azithromycin ( 15μg ) 124 aztreonam ( 30μg ) 125 bacitracin ( 10 unit ) 126 carbenicillin ( 100μg ) 127 cefaclor ( 30μg ) 128 cefadroxyl ( 30μg ) 129 cefepime ( 30μg ) 130 cefixime ( 5μg ) 131 cefoperazone ( 75μg ) 132 cefoperazone + sulbactam ( 75μg ) 133 cefotaxime ( 30μg ) 134 cefotaxime / clavulanic acid ( 30 / 10μg ) 135 cefotaxime + sulbactum 136 cefotetan ( 30μg ) 137 cefoxitin ( 30μg ) 138 cefpodoxime ( 10μg ) 139 ceftazidime ( 30μg ) 140 ceftazidime / clavulanic acid ( 30 / 10μg ) 141 ceftizoxime ( 30μg ) 142 ceftriaxone ( 30μg ) 143 cefuroxime ( 30μg ) 144 cephalexin 145 cephalothin ( 30μg ) 146 chloramphenicol ( 30μg ) 147 ciprofloxacin ( 10μg ) 148 clarithromylin 149 clindamycin ( 2μg ) 150 co trimoxazol ( 25μg ) 151 colistin ( 10 mcg ) 152 cefepime + tazobactam ( 30 / 10μg ) 153 cefalexin 30μg 154 cefazolin 30μg 155 cefprozil 30μg 156 cefixime + clavulanic acid ( 5 / 10μg ) 157 ceftrixone + sulbactam 30 / 15μg 158 ceftrixone + tazobactam 30μg 159 doxycyline ( 10μg ) 160 dicloxacilline ( 1μg ) 161 gemifloxacin ( 5μg ) 162 ertapenem ( 10μg ) 163 erythromycin ( 15μg ) 164 furazolidone ( 50μg ) 165 gentamicin ( 10μg ) 166 imipenam ( 10μg ) 167 imipenam + cilastin ( 10 / 10μg ) 168 lincomycin ( 15μg ) 169 levofloxacin ( 5μg ) 170 lincomycin 171 linezolid ( 30μg ) 172 meropenam ( 10μg ) 173 methicillin 174 moxifloxacin ( 5μg ) 175 nalidixic acid ( 30μg ) 176 netilmicin ( 30μg ) 177 nitrofurantoin ( 200μg ) 178 norfloxacin ( 10μg ) 179 novobiocin ( 5μg ) 180 ofloxacin ( 2μg ) 181 onpg 182 optochin ( 5μg ) 183 oxacillin ( 5μg ) 184 piperacillin ( 100μg ) 185 piperacillin +tazobactam ( 100 / 10μg ) 186 polymyxin b ( 10 unit ) 187 polymyxin b ( 300 unit ) 188 pristinomycin ( 15μg ) 189 prulifloxacin ( 5μg ) 190 rifampicin ( 5μg ) 191 roxithromycin ( 30μg ) 192 sisomicin ( 10μg ) 193 tetracycline ( 30μg ) 194 teicoplanin ( 30μg ) 195 tobramycin ( 10μg ) 196 ticarcillin ( 75μg ) 197 ticarcillin + clavulanic acid ( 75 / 10μg ) 198 tigecycline 199 voriconazole ( 1μg ) 200 vancomycin 201 anti fungal 202 fluconazole ( 10μg ) 203 ketoconazole ( 10μg ) 204 itraconazole ( 10μg ) 205 amphotericin b ( 100 unit / disk ) 206 nystatin ( 100 unit / disk ) 207 clotrimazole ( 10μg ) 208 miconazole ( 30μg ) 209 sugar 210 adonitol 211 arabinose 212 cellobiose 213 dextrose 214 dulcitol 215 fructose 216 galactose 217 inositol 218 inulin 219 lactose 220 maltose 221 mannitol 222 mannose 223 melibiose 224 raffinose 225 rhamnose 226 salicin 227 sorbitol 228 sucrose 229 trehalose 230 xylose 231 culture media 232 alkaline peptone water 233 agar powder bacteriological 234 air sampler agar strip n ( a ) tsa agar for toral count sd 235 ( b ) sabourund dextrose agar sb 236 andrade peptone water 237 arginine dihydrolase broth 238 bacttec myco / f lytic 239 bacttec peds plus / f 240 bacttec plus + anaerobic 241 bacttec plus aerobic / f+ 242 bacttec standard 10 aerobic / f 243 bacttec standard 10 aerobic / f 244 balamuths aqueous egg yolk medium 245 bbl mgit tubes 7 ml 246 bcttec lytic / 10anaerobic / f 247 beef extract agar 248 beef extract broth 249 bile esculin agar 250 bile salt agar 251 bird seed agar 252 diphenyl supplement 253 blood agar base 254 boek and dr. bohlavs 255 brain heart infusion broth 256 cary blair medium 257 cetrimide agar 258 cled media 259 congo red agar 260 cooked meat medium ( r.c. medium ) 261 corn meal agar 262 decarboxylase base without amino acids 263 deoxycholate citrate agar 264 dermatophyte test agar base dermato supplement 265 emb agar levine 266 glucose broth 267 glucose phosphate broth 268 hichrome improved salmonella agar 269 hichrome salmonella shigella agar 270 hicrome candida differential agar 271 lactose monohydrate bacteriological grade 272 locke egg serum ( les ) medium 273 loeffler serum medium base 274 lowenstein – jensen media base 275 lysine decarboxylase broth 276 lysine iron agar 277 mac conkey agar 278 mueller hinton agar 279 nnn medium 280 nutrient agar 281 nutrient broth 282 of basal medium 283 ornithine decarboxylase broth 284 peptone bacteriological 285 peptone water 286 phenolphthalein phosphate agar 287 phenyl alanine agar 288 potassium tellurite agar 289 potato dextrose agar 290 rpmi 1640 agar w / mops & 2% glucose w / o sodium carbonet ( twin pack ) 291 sabouraud chloramphenicol agar 292 sabouraud dextrose agar 293 sda with cycloheximide & chloramphenicol 294 selenite f broth twin pack ( medium 11 ) 295 simmons citrate agar 296 sulphide lndole motility ( sim ) medium 297 tcbs agar 298 tetra thionate broth 299 thioglycollate medium fluid 300 thioglycollate agar ( anaerobic ) 301 trichophyton agar 1 302 triple sugar iron agar 303 trypticase soy broth 304 tyi s 33 medium ( trypaticase, yeast ) 305 urea agar base christensen base urea 40% ( 5 ml / vial ) 306 uti chrome agar 307 wilson & blair’s bbs agar medium 9 308 xld agar 309 yeast carbon base agar 310 yeast nitrogen base agar 311 brain heart cc agar 312 c zapek dox agar 313 sabouraud dextrose agar base ( emmons ) 314 general item 315 aluminium foil 316 carbon paper 317 cellophane tap 33x22mm 318 cotton roll ( non absorbent ) 319 cotton roll ( absorbent ) 320 diamond pencil 321 disinfectant solution lysol / labolene 322 disposable bags larg size ( yellow, black, blue, red ) 323 disposable gloves 7 324 disposable gloves 7.5 325 disposable mask 326 dustbin 327 filter paper sheets 328 gauze pads 329 glass marking pencil ( white, blue, red ) 330 hand disinfectants 331 kling films 332 match box 333 nicrome loop wire d 4 ( hendal with 10 loop ) 334 nicrome straight wire ( hendal with 10 wire ) 335 permanent marker pen 336 plastic dropper 337 reagent droping bottels 338 reagent pipetts bulb 339 rubber teats 340 screw capped bottles 100ml 341 self adhesive autoclave tapes 342 self adhesive dry heat la 412 343 slide staining stand 344 soap 345 stainless steel forceps blunt 8inch 346 stainless steel forceps pointed 347 sterile container 35 ml. 348 sterile disposable swab stick with container 349 sterile disposable petri plates 120mm 350 sterile disposable petri plates 150mm 351 sterile scalpal blade no. 20 352 surf ( washing powder ) 353 syringes 2ml, disposable 354 syringes 5ml, disposable 355 syringes 10ml disposable 356 teasing needles 357 test tube holder 358 test tube rack ( 12 holes ) for medium sized tubes 359 thumbpress dropper 360 tissue rolls 361 uncoated micro titre plates ( 96 wells ) 362 hiv 363 vidas hiv duo ultra sensitive ( cat. no. 30117 ) 364 hepatitis 365 vidas anti hav total cat. no. 30312 ) 366 vidas hbs ag ultra cat. no. 30317 ) 367 antigen detection 368 vidas chlamydia ( cat. no. 30101 ) 369 serology 370 vidas h. pylori ig g ( cat. no. 30192 ) 371 vidas rub ig g ii ( cat. no. 30221 ) 372 vidas rub ig m ( cat. no. 30214 ) 373 vidas toxo ig g ii ( cat. no. 30210 ) 374 vidas toxo ig m ( cat. no. 30202 ) 375 serology 376 crp – latex kit ( latex agglutination method ) 377 ra – factor kit ( latex agglutination method ) 378 widal test kit ( a ) tube method 379 ( b ) slide method 380 aslo titre kit ( latex agglutination method ) 381 hbs ag card test ( dipstick method ) 382 rpr test for syphilis 383 m.test 384 antiseras 385 shigella dysenteriae polyvalent 386 shigella flexneri polyvalent 387 shigella boydii polyvalent 388 shigella sonnei polyvalent 389 shigella dysenteriae type i ( shiga ) 390 vibrio cholera : 01 antiserum polyvalent 391 subtype b ( ogawa ) , c ( inaba ) , 0:139 392 salmonella o antiserum polyvalent ( a z & vi ) 393 o factor antiserum 0:2 ( a ) , 0:4 ( b ) , 0:7 ( c1 ) , 0:9 ( d ) , 0:13 ( g ) , vi 394 h factor antiserum h:a, h:b, h:i, h:g, h:m, h:z 395 polyvalent o antiserum for enterotoxigenic strains of e.coli 396 miscellaneous items slide of dog’s brain showing negri bodies. 397 lyophilized culture of standard stain bacteria 398 salmonella typhi 399 salmonella paratyphi a 400 salmonella paratyphi b 401 shigella 402 s. dysenteriae 403 s. flexneri 404 s. boyedii 405 s. sonnie 406 vibrio, classical 407 swine flu laboratory kits 408 1 step real time rt pcr kit for sw h1n1 2009 including cdc validated. primers probes. enzyme mix, nuclease free water, master mix etc.with rt pcr reaction strips with cap for real time pcr kit completes. 409 viral rna extraction kit complete ( qiagen only ) as per cdc protocol of real time rtpcr for detection & characterization to extract sw h1n1version2009 viral rna also. 410 viral tranaport media 411 micro pipettes ( variable ) 0.5 10μl, 412 10 100μl, 413 100 1000μl 414 micro amp fast 48 well tray ( aplied bio system ) 415 powder free gloves medium size 416 powder free gloves large size 417 other items 418 ethanol of anhydrous denaturated biotechnically grade of mw 46.07 compatable for rna extraction of including sw h1n1 ( 2009 ) 419 iso propanol molecular grade 420 water, diacetyle dimethyl chloride, fatty amine oxide, alkyl dimethyl ammonium chloride, edta sodium, ethyl alcohol 421 silverised h2o2 ( h2o2 11% w / v with silver nitrate sol. 0.01 % w / v compatible for fumigation with aerosol generator fogger machine ) 422 liquid soap with dispenser 423 sodium hypochlorite 4 % 424 lysol 5 % 425 hand – sanitizer 426 lonza 427 ecoshield 428 formaline 429 amonia liquid 430 ethanol 431 nuclease eliminators for rna / dnase 432 consumable aerosol free tips 433 0 – 10 ul 434 0 – 100 ul 435 100 – 1000 ul 436 micro centrifuge tube 1.5 ml 437 micro centrifuge tube 1.5 ml 438 autoclavable 20 um thickness, plastic bags for b.m.w. management approval by pollution control board ( yellow& red color with biosafety symbols ) 439 screw cap serum storage vials with “o” rings ( 3 ml capacity ) 440 plastic tubes rack with 96 holes 441 cotton rolls 442 tissue paper rolls absorbent 443 o.h.p. marker pen blue, red, green 444 glass beaker borrosilicate 2000 ml 445 measuring glass cylinder ( rim ) ( 500 ml capacity ) 446 paper a4 size 447 jump suit with head over & shoe cover disposable 448 goggles disposable 449 n – 95 mask 450 glassware 451 petri dish diameter 90mm 452 petri dish diameter 75mm 453 conical flask 2000ml 454 conical flask 1000 ml 455 conical flask 500ml 456 conical flask 250ml 457 dark bottel 250ml 458 conical flask 100ml 459 test tube ( without rim ) 460 10 x 75 x 1.0mm 461 12 x 100 x1.2mm 462 15 x 75 x 1.2mm 463 8 x 100 x 1.0mm 464 mac – cartney bottle 30 ml with aluminum cap 465 mac – cartney bottle 30 ml with black plastic cap 466 glass funnel 4” 467 glass funnel 02’’ 468 glass beaker 500 ml 469 widal tube ( 75x4m ) 470 round bottom 471 conical bottom 472 measuring cylinder 500 ml 473 reagents bottles with dropper rubber teats 125 ml 474 reagents bottles with dropper rubber teats 250 ml 475 durham’s tube 476 micro glass slides ( dimension 75 x 25 mm 1.35 mm thick ) 477 micro cover slip ( small ) ( 22mm square 10 gram each ) 478 glass beaker 1000 ml 479 glass beaker 2000 ml 480 test tube ( with rim ) 18 x 150 x 1.2 mm 481 mac – cartney bottle 100 ml with aluminum cap 482 thermometer mercury 20o to 50o c 483 thermometer mercury 30o to 250o c 484 thermometer mercury 4 0o to 0o c 485 thermometer mercury 20o to 0o c 486 glass rods 10mm x 60cm length 487 glass rods ( for dropping oil on slides ) 488 glass peppette 2 ml 489 glass peppette 5 ml 490 glass peppett 10 ml 491 glass sprit lamp 492 staining jar ( coupling jar horizontal ) 493 oil bottle with glass rods ( canada blossom ) 494 candle jar ( bottle 60 ml 495 kits items 496 elisa kit scrub typhus lgm ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 497 elisa kit_ dengue lgm ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 498 elisa kit dengue ns 1 ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 499 hbsag elisa test kit ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 500 anti hcv rapid test ( ) 501 vdrl rapid test ( dip stick ) 502 hiv rapid card ( ) 503 hiv tri dot test ( ) 504 sterile swab stick with tube ( ) 505 sterile specimen container ( plastic transparent 50 ml capacity ) 506 vaccutainer vial plain ( 4 ml capacity ) 507 viral transport media ( ( i ) 1 3 of viral transport media in 8 10 ml tube containing protein stabilizer, antibiotic to discourage bacterial and fungal growth and buffer solution. ( ii ) single sterile sweb with synthetic tip such as polyste of decron and aluminium or plastic shaft with break point ) 508 viral transport media ( i ) 1 3 ml of viral transport media in 8 10 ml tube containing protein stabilizer, antibiotic to discourage bacterial and fungal growth and buffer solution. ( ii ) double sterile swab with synathetic tip such as polyster of dacron and aluminium or plastic shaft with break point. 509 elisa kits / ha test 510 elisa kit toxoplasme lgg 511 elisa kit tosoplasma igm 512 elisa kit rubella igg 513 elisa kit igm 514 elisa kit cytomegalovirus igm 515 elisa kit cytomegalovirus igg 516 elisa kit herpes simplex1 igg 517 elisa kit herpes simplex 1 igm 518 elisa kit herpes simplex2 igm 519 elisa kit herpes simplex2 igg 520 elisa kit brucella igg 521 elisa kit brucella igm 522 elisa kit ttg igm 523 elisa kit chilungunya igm 524 elisa kit hav igm 525 elisa kit hev igm 526 elisa kit japanese encephalitis igm 527 elisa kit rotaa virus antigen 528 tpha ( syphilis ) ...

Medical Health And Family Welfare - Rajasthan

25536669 tender for drug and medicine purchase 2 1.1 acyclovir 250mg / 5ml injection ( 10ml ) item1 1 per inj. 3 2 acyclovir 500mg / 10ml injection ( 10ml ) item2 1 per inj. 4 3 adrenaline injection 1 mg / ml ( 1 ml amp ) item3 1 per amp. 5 4 amikacin 100 mg injection 2ml vial item4 1 per vial 6 5 amikacin 250 mg inj 2ml vial item5 1 per vial 7 6 amikacin 500 mg injection 2ml vial item6 1 per vial 8 7 aminophylline 25 mg / ml injection 10 ml amp item7 1 per amp. 9 8 amino caproic acid 5gm / 20ml item8 1 per inj. 10 9 amiodarone 150mg / 3ml injection ( 3ml ) item9 1 per inj. 11 10 amoxicillin and clavulanic acid 1.2gm injection with diluent item10 1 per vial 12 11 amoxicillin and clavulanic acid 150mg injection ( 5ml ) with diluent item11 1 per vial 13 12 amoxicillin and clavulanic acid 600mg injection with diluent item12 1 per vial 14 13 ampicillin 125mg with diluent ( 5ml ) item13 1 per inj. 15 14 ampicillin 250mg with diluent ( 5ml ) item14 1 per inj. 16 15 ampicillin 500 mg injection with diluent ( 5ml ) item15 1 per vial 17 16 arteether ( ? ? ) 150mg / 2ml injection ( 2ml ) item16 1 per inj. 18 17 artisunate 60 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml item17 1 per inj. 19 18 artisunate 120 mg with diluent sodium bicarbonate 5% sodium chloride 0.9w / w 5ml item18 1 per inj. 20 19 atracurium besilate 10 mg / ml injection ( 2.5ml ) item19 1 per inj. 21 20 atracurium besilate 10 mg / ml injection ( 10ml ) item20 1 per inj. 22 21 atropine sulphate 0.6 mg / ml injection ( 1 ml amp ) item21 1 per amp. 23 22 atropine sulphate 100 ml injection ( 100ml ) item22 1 per vial 24 23 adenosine 3mg / ml 2ml injection item23 1 per amp. 25 24 acetylcystine 200mg / ml injection 2ml item24 1 per amp. 26 25 azetronam 500mg ( 10ml ) item25 1 per vial 27 26 azetronam 1000mg ( 20ml ) item26 1 per vial 28 27 benzathine benzylpenicillin 12 lac units injection ( vial ) item27 1 per vial 29 28 benzathine benzylpenicillin 6 lac units injection ( vial ) item28 1 per vial 30 29 benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) item29 1 per vial 31 30 betamethasone sodium phosphate 4 mg / ml injection ( 1 ml vial ) item30 1 per vial 32 31 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin & 70% isophane insulin ) 40 iu / ml ( 10 ml vial ) item31 1 per vial 33 32 botrophage injection ( haemocagulase enzyme ) ( 1ml ) item32 1 per inj. 34 33 bupivacaine hydrochloride in dextrose 5mg+80mg per ml ( 4 ml amp ) item33 1 per amp. 35 34 bupivacaine injection 0.25% ( 20 ml vial ) item34 1 per vial 36 35 bupivacaine injection 0.5% ( 20ml vial ) item35 1 per inj. 37 36 bleomycin 15mg injection item36 1 per vial 38 37 butrophanol tartrate 1mg / ml injection ( 1ml ) item37 1 per amp. 39 38 butrophanol tartrate 2mg / ml injection ( 1ml ) item38 1 per amp. 40 39 bupernorphine transdermal patch 5mcg / hr item39 1 per pcs 41 40 bupernorphine injection item40 1 per inj. 42 41 calcium gluconate 10% injection ( 10 ml amp ) item41 1 per amp. 43 42 carboplatin 450mg / 45ml injection item42 1 per inj. 44 43 carboprost tromethamine 250 mcg / ml injection ( 1ml ) item43 1 per inj. 45 44 cefepime 500 mg injection with diluent item44 1 per inj. 46 45 cefoperazone and sulbactum 1 g + 0.5 g injection with diluent item45 1 per vial 47 46 cefotaxime 1 gm injection +dw ( 30ml ) item46 1 per vial 48 47 cefotaxime 250 mg injection with diluent item47 1 per vial 49 48 cefotaxime with sulbactum ( 250+125 ) mg injection with diluent item48 1 per inj. 50 49 ceftazidime 1 gm injection with diluent item49 1 per vial 51 50 ceftazidime 250 mg injection with diluent item50 1 per vial 52 51 ceftazidime 500 mg injection with diluent item51 1 per vial 53 52 ceftriaxone 1 gm injection ( vial ) with dw item52 1 per vial 54 53 ceftriaxone 1 gm with tazobactum 125 mg injection with diluent item53 1 per inj. 55 54 ceftriaxone 125 mg injection ( vial ) with dw item54 1 per vial 56 55 ceftriaxone 2 gm with tazobactum 250 mg injection with diluent item55 1 per inj. 57 56 ceftriaxone 250 mg injection ( vial ) with dw item56 1 per vial 58 57 ceftriaxone 500 mg injection ( vial ) with dw item57 1 per vial 59 58 ceftriaxone with sulbactam 1.5 gm injection with diluent item58 1 per inj. 60 59 ceftriaxone with sulbactam 375 gm injection with diluent item59 1 per inj. 61 60 cefuroxime 250 mg with dw injection item60 1 per inj. 62 61 cefuroxime 750 mg with dw injection item61 1 per inj. 63 62 cefuroxime 1500 mg with dw injection item62 1 per inj. 64 63 chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) item63 1 per amp. 65 64 ciprofloxacin 200mg / 100ml injection ( 100 ml bottle ) item64 1 per bottle 66 65 cloxacillin sodium 500 mg injection with diluent item65 1 per vial 67 66 compound sodium lactate 500 ml injection ( 500 ml glass bottle ) item66 1 per bottle 68 67 compound sodium lactate injection ( pp bottle ) ( 500ml bottle ) item67 1 per bottle 69 68 compound sodium lactate injection ( pp bottle ) 1000ml item68 1 per bottle 70 69 cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) item69 1 per amp. 71 70 cisplatin 50mg / 50ml injection item70 1 per vial 72 71 cyclophosphamide 200mg injection item71 1 per vial 73 72 cyclophosphamide 500mg injection item72 1 per vial 74 73 cytarabine 500mg injection item73 1 per vial 75 74 caffein citrate 2ml injection item74 1 per amp. 76 75 caffein citrate 1ml injection item75 1 per amp. 77 76 clarithromycin infusion 500ml injection item76 1 per inj. 78 77 chlorpromazine 25mg / ml injection item77 1 per inj. 79 78 clindamycin phosphate 150mg / ml injection ( 4ml ) item78 1 per inj. 80 79 camylofin hcl 25mg / ml injection ( 2ml ) item79 1 per inj. 81 80 cholecalciferol 60000 iu / ml injection ( 1ml ) item80 1 per inj. 82 81 citicoline 250mg / ml injection ( 2ml ) item81 1 per inj. 83 82 colistimethate 2million iu / ml injection item82 1 per inj. 84 83 colistimethate 1million iu / ml injection item83 1 per inj. 85 84 dexamethasone 8 mg / 2ml injection ( 2 ml vial ) item84 1 per vial 86 85 dextrose 10% 1000 ml ( pp bottle ) injection item85 1 per bottle 87 86 dextrose 10% 500 ml ( glass bottle ) injection item86 1 per bottle 88 87 dextrose 10% 500 ml ( pp bottle ) injection item87 1 per bottle 89 88 dextrose 5% ( pp bottle ) 1000 ml injection item88 1 per bottle 90 89 dextrose 5% 500 ml ( pp bottle ) injection item89 1 per bottle 91 90 dextrose 5% 500 ml ( glass bottle ) injection item90 1 per bottle 92 91 dextrose injection 25% ( pp bottle ) ( 100 ml bottle ) item91 1 per bottle 93 92 dextrose injection 25% ( glass bottle ) ( 100 ml bottle ) item92 1 per bottle 94 93 dexmedetomidine hcl 100mcg / ml ( 1ml ) item93 1 per inj. 95 94 dexmedetomidine hcl 100mcg / ml ( 2ml ) item94 1 per inj. 96 95 diazepam 10 mg / 2ml injection ( 2ml amp ) item95 1 per amp. 97 96 diclofenac sodium 25 mg / ml injection ( 3 ml amp ) item96 1 per amp. 98 97 diclofenac aqua 75mg / ml injection ( 1ml ) item97 1 per amp. 99 98 dicyclomine 10 mg / ml injection ( 2 ml amp ) item98 1 per amp. 100 99 diltiazem 5 mg / ml injection item99 1 per inj. 101 100 dobutamine 50mg / ml ( 5ml injection ) item100 1 per inj. 102 101 dopamine injection 40mg / ml ( 5ml ) item101 1 5 ml amp 103 102 doxorubicin 50 mg / 25ml injection item102 1 per inj. 104 103 daunorubicin 20 mg inj ip item103 1 per inj. 105 104 drotaverine hydrochloride 40 mg / 2ml injection ( 2 ml amp ) item104 1 per amp. 106 105 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) item105 1 per inj. 107 106 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) item106 1 per inj. 108 107 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) item107 1 per inj. 109 108 digoxin 0.25mg / ml injection item108 1 per amp. 110 109 diptheria antitoxin 10000 iu injection item109 1 per inj. 111 110 dinoprostone 0.5mg gel item110 1 per pcs 112 111 ethamsylate 250 mg / 2ml injection ( 2 ml amp ) item111 1 per amp. 113 112 etophylline 84.7mg +theophylline 25.3 mg / ml. ( 2ml. injection ) item112 1 per inj. 114 113 etoposide 100mg injection item113 1 per inj. 115 114 ephedrine 30mg / ml injection ( 1ml ) item114 1 per inj. 116 115 esmolol hcl injection 10ml item115 1 per inj. 117 116 fosphenytion 2ml injection item116 1 per inj. 118 117 fentanyl citrate 50mcg / ml injection 2ml item117 1 per inj. 119 118 filgrastim 300 mcg / ml injection item118 1 per vial 120 119 fluorouracil 250mg / 5ml injection item119 1 per inj. 121 120 fluorouracil 500mg / 5ml injection item120 1 per inj. 122 121 furosemide 10 mg / ml injection ( 2 ml amp ) item121 1 per amp. 123 122 factor ix concentrate 600 iu injection item122 1 per inj. 124 123 ferric carboxymaltose 50mg / ml injection ( 10ml ) item123 1 per inj. 125 124 fluconazole 100ml injection item124 1 per inj. 126 125 gemcitabin 200mg injection item125 1 per vial 127 126 gemcitabin 1000mg injection item126 1 per vial 128 127 gentamicin 80 mg / 2ml injection ( 2 ml amp ) item127 1 per amp. 129 128 glycopyrrolate 0.2 mg / ml injection ( 1 ml amp ) item128 1 per amp. 130 129 glycopyrrolate 0.2 mg / ml injection ( 10 ml ) item129 1 per inj. 131 130 granisetron injection 1mg. / ml. 3ml. amp. item130 1 per inj. 132 131 glycine 3ltr injection item131 1 per inj. 133 132 haloperidol 5 mg / ml injection ( 2ml ) item132 1 per inj. 134 133 hcg 2000 i.u. injection item133 1 per inj. 135 134 hcg 5000 i.u. injection item134 1 per inj. 136 135 heparin sodium 1000 i.u. / ml injection item135 1 per inj. 137 136 heparin sodium 5000 i.u. / ml injection item136 1 per inj. 138 137 human albumin solution 20% ( 100 ml bottle ) item137 1 per bottle 139 138 human anti d immunoglobulin 150 mcg injection item138 1 per vial 140 139 human anti d immunoglobulin 300 mcg injection ( im use ) ( prefilled syringe / vial ) item139 1 per inj. 141 140 human rabies immunoglobulin 150 iu / ml injection item140 1 per inj. 142 141 hyaluronidase 1500 iu injection item141 1 per inj. 143 142 hydrocortisone sod. succinate 100 mg injection item142 1 per vial 144 143 hydrocortisone sod. succinate 200 mg injection item143 1 per vial 145 144 hydrocortisone sod. succinate 400 mg injection item144 1 per vial 146 145 hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) item145 1 each 147 146 hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) item146 1 per bottle 148 147 hydroxyprogesterone 250 mg / ml injection ( 1 ml amp ) item147 1 per amp. 149 148 hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) item148 1 per amp. 150 149 halothane 50ml item149 1 each 151 150 hepatitis b immunologlobin injection ip 100 i.u item150 1 per inj. 152 151 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml item151 1 each 153 152 iron sucrose 20mg / ml injection ( 5ml ) item152 1 per inj. 154 153 isoflurane liquid for inhalation ( 100ml ) item153 1 per vial 155 154 isoflurane liquid for inhalation ( 30ml ) item154 1 per vial 156 155 isoflurane liquid for inhalation ( 250ml ) item155 1 per vial 157 156 isolyte g ( each 100ml contains: sodium chloride usp 0.53 g; sodium gluconate usp 0.5 g sodium acetate trihydrate usp 0.37 g; potassium chloride usp 0.037 ) injection ( 500ml ) item156 1 per inj. 158 157 isophane insulin 40 iu / ml injection ( 10ml vial ) item157 1 per vial 159 158 isoxsuprine 5 mg / ml injection ( 2ml amp ) item158 1 per amp. 160 159 ninsulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) ( 10ml ) item159 1 per inj. 161 160 insulin glargine 10 ml vial ( 100 iu / ml ) item160 1 per inj. 162 161 insulin glargine 3 ml vial ( 100 iu / ml ) item161 1 per inj. 163 162 imipenem + cilastatin injection 500mg / 500mg ip powder for solution item162 1 per inj. 164 163 ketamine injection 50 mg / ml ( 10 ml vial ) item163 1 per vial 165 164 labetalol hydrochloride 20 mg / 4ml injection ( 4 ml amp ) item164 1 per amp. 166 165 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg ( 30ml ) item165 1 per inj. 167 166 lignocaine 2% injection ( 30 ml vial ) item166 1 per vial 168 167 lignocaine hcl 2% injection ( 50ml i.v. ) item167 1 per vial 169 168 lincomycin 600mg / 2ml injection item168 1 per inj. 170 169 linezolid inj 200mg / 100ml ( 300ml ) item169 1 per inj. 171 170 low mol. wt. heparin 60mg / 0.6ml injection ( enoxaparin ) item170 1 per inj. 172 171 l asparaginase inj 10000 iu item171 1 per inj. 173 172 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml item172 1 per inj. 174 173 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg item173 1 per inj. 175 174 levetiracetam injection 500mg / 5ml item174 1 per inj. 176 175 lorazepam inj ip 2 mg / ml ( 2ml ) item175 1 per amp. 177 176 levobupivacaine 5mg / ml ( 20ml ) item176 1 per vial 178 177 lignocaine hcl and dextrose injection ( 2ml ) item177 1 per inj. 179 178 magnesium sulphate 500mg / ml injection ( 50% ) ( 2 ml amp ) item178 1 per amp. 180 179 mannitol 20% injection ( 350 ml bottle ) item179 1 per bottle 181 180 mannitol inj ip 20% w / v 100 ml item180 1 per inj. 182 181 mannitol 10% w / v glycerin 10% w / v injection item181 1 per inj. 183 182 mecobalamin 500 mcg / ml injection item182 1 per inj. 184 183 mephentermine 30 mg / ml injection ( 10ml ) item183 1 per inj. 185 184 meropenem 125 mg injection item184 1 per inj. 186 185 meropenem 1gm injection item185 1 per vial 187 186 meropenem 500 mg injection item186 1 per vial 188 187 methylcobalamin 1500 mcg injection item187 1 per inj. 189 188 methylcobalamin 1000 mcg vit.b 6 100mg nicotinamide 100mg injection ( 2ml ) item188 1 per inj. 190 189 methylergometrine 0.2 mg / ml injection ( 1ml amp ) item189 1 per amp. 191 190 methylprednisolone sodium succinate 500 mg ( vial ) item190 1 per vial 192 191 metoclopramide injection 10 mg / 2ml ( 2 ml amp ) item191 1 per amp. 193 192 metronidazole injection 500 mg / 100ml ( 100ml bottle ) item192 1 per bottle 194 193 midazolam 1 mg / ml injection ( 5 ml vial ) item193 1 per vial 195 194 midazolam 1 mg / ml injection ( 10 ml vial ) item194 1 per vial 196 195 morphine sulphate 10mg / ml injection item195 1 per inj. 197 196 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) ( pp bottle ) ( 500ml bottle ) item196 1 per bottle 198 197 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) glass bottle ( 500ml bottle ) item197 1 per bottle 199 198 multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) ( pp bottle ) ( 500ml bottle ) item198 1 per bottle 200 199 multiple electrolytes and dextrose injection type iii ip ( electrolyte m injection ) glass bottle ( 500ml bottle ) item199 1 per bottle 201 200 multivitamin 10 ml injection item200 1 per inj. 202 201 methotrexate inj ip 50 mg / 2 ml item201 1 per inj. 203 202 nandrolone decanoate 25 mg injection item202 1 per inj. 204 203 nandrolone decanoate 50 mg injection item203 1 per inj. 205 204 neostigmine inj ip 0.5 mg / ml ( 1ml amp ) item204 1 per inj. 206 205 neostigmine inj ip 0.5 mg / ml ( 5ml amp ) item205 1 per inj. 207 206 nitroglycerin inj 5 mg / ml ( 1ml amp ) item206 1 per inj. 208 207 nitroglycerin inj 5 mg / ml ( 5ml amp ) item207 1 per inj. 209 208 noradrenaline injection ip 2 mg / ml ( 5mlamp ) item208 1 per inj. 210 209 normal saline ( sodium chloride ) 0.9% 100ml ( pp bottle ) item209 1 per bottle 211 210 normal saline ( sodium chloride ) 0.9% 100ml glass bottle item210 1 per bottle 212 211 naloxone inj ip 0.4mg / ml ( 1ml ) item211 1 per inj. 213 212 normal saline ( sodium chloride ) 0.9% 3ltr item212 1 each 214 213 normal saline ( sodium chloride ) 3% 100ml glass bottle item213 1 per bottle 215 214 normal saline ( sodium chloride ) 0.9% 10ml injection item214 1 per inj. 216 215 netilmicin sulphate 300mg injection item215 1 per inj. 217 216 netilmicin sulphate 50mg injection item216 1 per inj. 218 217 ofloxacin inj 200 mg / 100 ml item217 1 per inj. 219 218 ondansetron 2 mg / ml injection ( 2 ml amp ) item218 1 per amp. 220 219 oxytocin 5 iu / ml injection ( 1ml amp ) item219 1 per amp. 221 220 paclitaxel 260mg injection item220 1 per inj. 222 221 paclitaxel 100mg injection item221 1 per inj. 223 222 pantoprazole 40 mg injection ( vial ) item222 1 per vial 224 223 paracetamol 150 mg / ml injection ( 2 ml amps ) item223 1 per amp. 225 224 paracetamol infusion ip 1% w / v 100ml item224 1 per inj. 226 225 pentazocine 30 mg / ml injection ( 1 ml amp ) item225 1 per amp. 227 226 pheniramine 22.75 mg / ml injection ( 2ml amp ) item226 1 per amp. 228 227 phenobarbitone 200 mg / ml injection ( 1ml ampoule / vial ) item227 1 per inj. 229 228 phenytoin sodium 50 mg / ml injection ( 2ml amp ) item228 1 per inj. 230 229 pilocarpine injection 0.5% mg / ml ( 1 ml injection ) item229 1 per inj. 231 230 piperacillin and tazobactam 4 gm + 500 mg for injection ( vial ) with diluent item230 1 per vial 232 231 piperacillin with tazobactam 1gm + 125 mg injection with diluent item231 1 per inj. 233 232 potassium chloride injection 0.15 gm / ml ( 10ml amp ) item232 1 per amp. 234 233 pralidoxime chloride 25mg / ml ( 20ml injection ) item233 1 per inj. 235 234 pralidoxime iodide 25mg / ml ( 20 ml lnjection ) item234 1 per inj. 236 235 procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) item235 1 per vial 237 236 progesterone 200 mg / 2ml injection ( 2 ml amp ) item236 1 per amp. 238 237 promethazine 25 mg / ml injection ( 2 ml amp ) item237 1 per amp. 239 238 propofol 10mg / ml injection ( 10ml ) item238 1 per vial 240 239 propofol 10mg / ml injection ( 20ml ) item239 1 per vial 241 240 phenylephrine hcl 10mg / ml injection ( 1ml ) item240 1 per inj. 242 241 pottasium phosphate 15ml injection item241 1 per inj. 243 242 prochlorperazine mesylate injection 12.5mg / ml 5ml item242 1 per inj. 244 243 polygeline 3.5% solution with electrolytes for i.v. infusion item243 1 per inj. 245 244 polymixin b 500000iu injection item244 1 per inj. 246 245 prostaglandin e1 500mcg / ml injection item245 1 per inj. 247 246 prostaglandin e2 0.5mg / 2.5ml injection item246 1 per inj. 248 247 protamine sulphate 50mg / 5ml injection item247 1 per inj. 249 248 quinine dihydrochloride 300 mg / ml injection ( 2ml amp ) item248 1 per amp. 250 249 rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) item249 1 each 251 250 rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) item250 1 each 252 251 ranitidine hcl 50 mg / 2ml injection ( 2 ml amp ) item251 1 per inj. 253 252 rh erythropoitin injection 2000 iu item252 1 per inj. 254 253 rh erythropoitin injection 4000 iu item253 1 per inj. 255 254 rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments item254 1 per inj. 256 255 ringer acetate infusion 500 ml item255 1 per inj. 257 256 swine flu vaccine injection item256 1 per inj. 258 257 snake venom antiserum ( polyvalent anti snake venum ) ( 10ml vial ) item257 1 per vial 259 258 sodium bicarbonate 7.5% injection ( 10 ml amp ) item258 1 per amp. 260 259 sodium chloride 1000 ml ( pp bottle ) injection item259 1 per bottle 261 260 sodium chloride 500 ml ( glass bottle ) injection item260 1 per bottle 262 261 sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 500ml bottle ) item261 1 per bottle 263 262 sodium chloride and dextrose 0.9 % + 5 % injection ( pp bottle ) ( 1000ml bottle ) item262 1 per bottle 264 263 sodium chloride and dextrose 0.9 % + 5 % injection ( glass bottle ) ( 500ml bottle ) item263 1 per bottle 265 264 sodium chloride injection ( 500ml pp bottle ) item264 1 per bottle 266 265 sodium valproate 100 mg / ml injection ( 5 ml vial ) item265 1 per vial 267 266 soluble insulin 40 iu / ml injection ( 10 ml vial ) item266 1 per vial 268 267 streptokinase 15 lac units injection item267 1 per inj. 269 268 streptomycin 1 gm injection with diluent item268 1 per inj. 270 269 streptomycin 0.75 gm injection with diluent item269 1 per vial 271 270 succinylcholine 50 mg / ml injection ( 10 ml vial ) item270 1 per vial 272 271 sodium chloride 0.45% w / v polypack 500 ml item271 1 per inj. 273 272 sevoflurane for inhalation 250ml item272 1 per pcs 274 273 sevoflurane for inhalation 50ml item273 1 per pcs 275 274 sodium nitropruside 50mg injection item274 1 per inj. 276 275 thiopentone inj ip 0.5 gm item275 1 per inj. 277 276 thiopentone inj ip 1 gm item276 1 per inj. 278 277 tetanus immunoglobulin 250 iu injection item277 1 per inj. 279 278 tetanus vaccine ( adsorbed ) ip 5 ml vial item278 1 per vial 280 279 tetanus vaccine 0.5 ml ( adsorbed ) ip amp item279 1 per amp. 281 280 teicoplanin 200mg injection item280 1 per inj. 282 281 teicoplanin 400mg injection item281 1 per inj. 283 282 torsemide 10 mg / ml injection ( 2 ml amp ) item282 1 per amp. 284 283 tramadol 50 mg / ml injection ( 2 ml amp ) item283 1 per amp. 285 284 thiamine injection item284 1 per amp. 286 285 triamcinolone 40mg / ml injection ( 1ml ) item285 1 per inj. 287 286 tranexamic acid injection ip 100mg / ml 5ml item286 1 per inj. 288 287 urokinase injection 5 lac unit ( lyophilized ) item287 1 per inj. 289 288 valethamate bromide 8 mg / ml injection ( 1 ml amp ) item288 1 per amp. 290 289 vancomycin 1 gm injection ( vial ) item289 1 per vial 291 290 vancomycin 500mg injection ( vial ) item290 1 per vial 292 291 vecuronium bromide 4 mg for injection ( freeze dried ) ( 2ml ) item291 1 per vial / ampoule 293 292 vitamin b complex injection ( 10 ml vial ) item292 1 per vial 294 293 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione item293 1 per amp. 295 294 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection item294 1 per inj. 296 295 water for injection ip ( 10 ml amp ) item295 1 per amp. 297 296 water for injection ip ( 5 ml amp ) item296 1 per amp. 298 297 zoledronic acid injection ip 4mg / 100ml 100ml item297 1 5ml vial 299 298 acyclovir cream 5 % ( 5 gm tube ) item298 1 each 300 299 beclomethasone, neomycin and clotrimazole cream 0.025%+0.5%+1% ( 10g tube ) item299 1 each 301 300 betamethasone dipropionate cream 0.05% ( 10gm ) item300 1 each 302 301 betamethasone with salicylic acid ( 15 gm ointment ) item301 1 each 303 302 betamethasone lotion 0.05% ( 50ml ) item302 1 each 304 303 calamine lotion ip ( 100ml bottle ) item303 1 each 305 304 cetrimide cream ip 15gm item304 1 each 306 305 cetrimide tincture 0.5% ( 200ml bottle ) item305 1 each 307 306 clindamycin phosphate gel 1% ( 20 gm ) item306 1 each 308 307 clobetasol pro pionate 0.05 % cream ( 15gm ) item307 1 each 309 308 clotrimazole 1% mouth paint ( 15ml ) item308 1 each 310 309 clotrimazole cream ip 2% w / w ( 15gm ) item309 1 each 311 310 coal tar 6% & salicylic acid 3% ointment ( 20gm ) item310 1 each 312 311 compound benzoic acid ointment ip 6%+ salicylic 3% ( 15gm tube ) item311 1 each 313 312 compound benzoin tincture ( 500ml bottle ) item312 1 each 314 313 chlorhexidine mouthwash 0.2% ( 50 ml ) item313 1 each 315 314 clotrimazole beclomethsone lotion 50ml item314 1 each 316 315 powder clotrimazole 1% w / w 100gm item315 1 each 317 316 calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) item316 1 each 318 317 dental gel: choline salicylate 8.75% + benzalkonium chloride 0.01% + lignocaine hcl 2% ( 10gm ) item317 1 each 319 318 desensitizing tooth gel with sodium mono fluoro phosphate 0.7% & pot. nitrate 5 % ( 50gm ) item318 1 each 320 319 diclofenac 1% gel ( 30 gm ) item319 1 each 321 320 diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil 3% menthol 5% ( 15 gm ) item320 1 each 322 321 diclofenac gel: diclofenac, methyl salicylate 10% , linseed oil 3%, menthol 5% ( 30 gm ) item321 1 each 323 322 dinoprostone 0.5 mg ( 3gm cream ) item322 1 each 324 323 framycetin sulphate 1% cream ( 30gm tube ) item323 1 each 325 324 fusidic acid cream bp 2% 10gm tube ( 10 gm tube ) item324 1 each 326 325 fusidic acid ointment 2% ( 10 gm. packing ) item325 1 each 327 326 gamma benzene hexachloride 2% lotion ( lindane lotion usp ) ( 100 ml bottle ) item326 1 each 328 327 gentian violet paint 1% ( 200 ml bottle ) item327 1 each 329 328 glycerin ( 100ml ) item328 1 each 330 329 glycerin ip ( 400 ml ) item329 1 each 331 330 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% ( 10ml ) item330 1 each 332 331 itraconazole 1%w / w gel 15gm item331 1 each 333 332 itraconazole 1%w / w powder 75gm item332 1 each 334 333 ketoconazole 2% cream ( 20gm ) item333 1 each 335 334 ketoconazole 2% lotion ( 50ml ) item334 1 each 336 335 ketoconazole 2% cetrimide 1% soap 75gm item335 1 each 337 336 ketoconazole 2% soap 75gm item336 1 each 338 337 ketoconazole 2% zpto 1% shampoo 100ml item337 1 each 339 338 lignocaine 2% gel ( 30gm ) item338 1 each 340 339 lignocaine 5% ointment ( 10gm ) item339 1 each 341 340 liquid paraffin 100 ml pack item340 1 each 342 341 liquid paraffin ip ( 400ml bottle ) item341 1 per bottle 343 342 soln. each 15ml ( liquid paraffin 3.75 ml milk of magensia 11.25ml ) ( 170ml ) item342 1 per bottle 344 343 luliconazole 1% 10gm cream item343 1 each 345 344 luliconazole 1% 20gm cream item344 1 each 346 345 luliconazole 1% lotion 20ml item345 1 each 347 346 luliconazole 1% gel 10gm item346 1 each 348 347 monosulfran soap 5% 75gm item347 1 each 349 348 metronidazole 1% and chlorhexidine 0.25% gel ( 10gm ) item348 1 each 350 349 miconazole nitrate 2% cream ip ( 15g tube ) item349 1 each 351 350 mupirocin 2% ointment ( 5 gm ) item350 1 each 352 351 momatosone 0.1% cream / ointment 15gm item351 1 each 353 352 momatosone 0.1% treatinoin 0.025% hydroquinone 2% cream 15gm item352 1 each 354 353 neomycin sulphate 5 mg and bacitracin 500 iu / gm ointment ( 10gm ) item353 1 each 355 354 ointment containing : lidocaine 3% , zinc oxide 5%, hydrocortisone 0.25% , allantoin 0.5% ( 15 g tube ) item354 1 each 356 355 permethrin cream 5% ( 30 gm pack ) item355 1 each 357 356 permethrin lotion 5% ( 50ml pack ) item356 1 each 358 357 permethrin soap 5% 75gm item357 1 each 359 358 povidone iodine ointment 5% ( 15 gm tube ) item358 1 each 360 359 povidone iodine ointment 5% ( 250 gm pack ) item359 1 each 361 360 povidone iodine ointment 5% ( 500 gm pack ) item360 1 each 362 361 silver sulfadiazine 1% cream ( 50 gm tube ) item361 1 each 363 362 silver sulfadiazine cream 1% 500 g pack ( each ) item362 1 each 364 363 tobramycin ophthalmic 0.3% ( 5gm ointment ) item363 1 each 365 364 tretenoin cream 0.025% ( 20 gm ) item364 1 each 366 365 terbinafine 1% w / w ( 10 gm ) cream item365 1 each 367 366 terbinafine 1% w / w ( 75 gm ) powder item366 1 each 368 367 terbinafine, ornidazole, neomycin, ofloxacin 15gm cream item367 1 each 369 368 acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) item368 1 each 370 369 albendazole oral suspension 400 mg / 10ml ( 10 ml bottle ) item369 1 each 371 370 albendazole 200mg / 5ml, ivermectin 1.5mg / 5ml ( 10ml ) item370 1 each 372 371 aceclofenac 50mg / 5ml, paracetamol 125mg / 5m syrup ( 60ml ) item371 1 each 373 372 alkalizer disodium hydrogen citrate 1.25 gm / 5ml ( 100 ml ) item372 1 each 374 373 amoxicillin 200 mg & clavulanic acid syrup 28.5 mg / 5 ml ( 30ml ) item373 1 per vial 375 374 amoxicillin oral suspension 125 mg / 5ml ( dry syrup ) ( 30ml bottle ) item374 1 each 376 375 amoxicillin 100mg / ml drop ( 15ml ) item375 1 each 377 376 amoxy and clavulanic acid 80 mg+11.4 mg / ml ( 10 ml drop ) item376 1 each 378 377 antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, simethicone 20mg ) ( 170 ml ) item377 1 each 379 378 antacid liquid ( dried al hydroxide 250 mg, magnesium hydroxide 250 mg, polydimethylsiloxane ( 100 ml ) item378 1 each 380 379 anti cold syrup: phenylephrine hcl , cetirizine and paracetamol ( 60 ml bottle ) item379 1 each 381 380 anti cold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5mg+1mg+125mg / 5ml ( 60 ml bottle ) item380 1 each 382 381 azithromycin syrup 100 mg / 5ml ( 15ml ) item381 1 each 383 382 azithromycin syrup 200 mg / 5ml ( 15ml ) item382 1 each 384 383 azithromycin syrup 200 mg / 5ml ( 30ml ) item383 1 each 385 384 calcium carbonate 250mg & vitamin d3 125iu suspension ( 100 ml bottle ) item384 1 each 386 385 carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) item385 1 each 387 386 carboxymethylcellulose sodium lubricant eye drops 0.5% item386 1 each 388 387 cefaclor 125mg / 5ml ( 15 ml drop ) with diluent item387 1 each 389 388 cefaclor 187mg / 5ml ( 30 ml syrup ) with diluent item388 1 each 390 389 cefixime 25mg / ml drop ( 10ml ) with diluent item389 1 each 391 390 cefixime 50mg / 5ml suspension ( 30ml ) with diluent item390 1 each 392 391 cefixime 100mg / 5ml suspension ( 30ml ) with diluent item391 1 each 393 392 cefpodoxime 25mg / ml ( 10 ml drop ) with diluent item392 1 each 394 393 cefpodoxime and clavulanic 50 mg+31.5 mg / 5ml ( 30 ml syrup ) with diluent item393 1 30 ml 395 394 cefpodoxime syrup 100 mg / 5ml ( 30 ml ) with diluent item394 1 each 396 395 cefpodoxime syrup 50 mg / 5ml ( 30 ml ) with diluent item395 1 each 397 396 cephalexin 100mg / ml ( 15ml drop ) with diluent item396 1 each 398 397 cephalexin oral suspension 125 mg / 5ml ( 30 ml ) with diluent item397 1 each 399 398 cefadroxil 125mg / 5ml susp. 30ml with diluent item398 1 each 400 399 cefadroxil 100mg / ml drop 15ml with diluent item399 1 each 401 400 cefuroxime 125mg / 5ml susp. 30ml item400 1 each 402 401 cetirizine syrup 5mg / ml ( 30ml ) item401 1 each 403 402 chloroquine 50 mg / 5ml syrup ( 60ml ) item402 1 each 404 403 chloroquine suspension 50 mg / 5ml ( 60ml ) item403 1 each 405 404 chlorpheniramine oral solution 2.5 mg / 5ml ( 50 ml ) item404 1 each 406 405 co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) item405 1 each 407 406 cough syrup [ terbutaline 2.5mg bromhexine 2mg ambroxol 15mg ] ( 100ml ) item406 1 each 408 407 cough syrup [ terbutaline 2.5mg guaiphensin 50mg ambroxol 15mg ] ( 100ml ) item407 1 each 409 408 cough syrup [ levosalbutamol 1mg guaiphensin 50mg ambroxol 15mg ] ( 100ml ) item408 1 each 410 409 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup ( 100ml ) item409 1 each 411 410 cough syrup each 5 ml contains chloropheniramine maleate ip 2 mg, phenylepherin hcl 5mg dextromethorphan hbr 10mg ( 100ml ) item410 1 each 412 411 cyanocobalamin 35mcg / 5ml syrup 200ml item411 1 each 413 412 cyproheptadine tricholine citrate 200ml syrup item412 1 each 414 413 dextromethorphan hydrobromide 13.5mg / 5ml syrup ( 100 ml ) item413 1 each 415 414 dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml ( 10 ml bottle with dropper ) item414 1 each 416 415 domperidone oral drops 10mg / ml ( 10ml ) item415 1 each 417 416 dicyclomine oral solution 10mg / 5ml ( 30ml ) item416 1 each 418 417 domperidone suspension 5 mg / 5ml ( 30 ml bottle ) item417 1 each 419 418 drop anti cold ( paracetamol 125mg / ml, phenyephrine 2.5mg / ml & chlorpheniramine maleate 1mg / ml ( 15 ml drop ) item418 1 each 420 419 lactase enzyme ( 15 ml drop ) item419 1 each 421 420 fungal diastase with pepsin enzyme drop 15ml item420 1 each 422 421 enzyme drop each ml contains ( alpha emylase 20mg + papain 10mg + dill oil 2mg + anise oil 2mg + caraway oil 2mg ) ( 15ml ) item421 1 each 423 422 enzyme 200ml ( diastase & pepsin ) syrup item422 1 each 424 423 erythromycin estolate 125 mg / 5ml oral suspension ( 30ml bottle ) item423 1 each 425 424 fexofenadine 30mg / 5ml syrup ( 60ml ) item424 1 each 426 425 grandsetron 1mg / ml. ( 10 ml.drop ) item425 1 each 427 426 ibuprofen 100 mg+paracetamol 162.5 mg syrup ( 60 ml bottle ) item426 1 each 428 427 ibuprofen 100 mg / 5ml oral suspension ( 60 ml bottle ) item427 1 each 429 428 ferrous fumerate 100mg and folic acid 500mcg syrup ( 100ml bottle ) item428 1 each 430 429 ferric amonium citrate folic acid & vitamin b 12 syrup 200ml item429 1 each 431 430 ferrous ascorbate 30mg / 5ml & folic acid 0.5mg / 5ml syrup 150ml item430 1 each 432 431 lactulose solution 10gm / 15ml ( 100ml ) item431 1 each 433 432 lidocaine hydrochloride topical solution 4% item432 1 each 434 433 syrup levocetirizine with montelukast 2.5mg+4mg / 5ml ( 60 ml ) item433 1 each 435 434 levocetrizine 2.5mg / 5ml syrup ( 60ml ) item434 1 each 436 435 levocetrizine 2.5mg / 5ml, ambroxol 30mg / 5ml syrup ( 60ml ) item435 1 each 437 436 multivitamin 200 ml ( folic acid, copper, methylcobalamin, vitamin a, vitamin b1, vitamin b2, b3, b5, b6, vitamin c, vitamin e, zinc ) syrup item436 1 each 438 437 multivitamin drop ( vitamin a, thiamine 0.4mg, riboflavin 0.8mg, pyridoxine hydrochloride 0.8mg, nicotinamide 8mg, ascorbic acid 40mg ( 15ml ) item437 1 each 439 438 metronidazole 100 mg and norfloxacin 100 mg / 5ml suspension ( 30 ml bottle ) item438 1 each 440 439 metronidazole benzoate 100 mg / 5ml oral suspension ( 60 ml bottle ) item439 1 each 441 440 metochlopramide hcl 5mg / 5ml ( 30ml syrup ) item440 1 each 442 441 mefanimic acid, paracetamol syrup 60ml item441 1 each 443 442 ofloxacin & ornidazole 50mg+125mg / 5ml ( 60ml syrup ) item442 1 each 444 443 ofloxacin & metronidazole 50mg+120mg / 5ml ( 60ml syrup ) item443 1 each 445 444 ondansetron 2mg / 5ml ( 30ml syrup ) item444 1 each 446 445 ondansetron 4mg / 5ml ( 30ml syrup ) item445 1 each 447 446 oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) item446 1 each 448 447 ofloxacin suspension 50 mg / 5ml ( 30 ml bottle ) item447 1 each 449 448 ofloxacin suspension 100 mg / 5ml ( 30 ml bottle ) item448 1 each 450 449 orthotolidine solution ( 500ml ) item449 1 each 451 450 paracetamol 150 mg / ml drops ( 15ml bottle ) item450 1 each 452 451 peritoneal dialysis solution ip ( 1000ml pack ) item451 1 each 453 452 potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) item452 1 each 454 453 povidone iodine scrub solution 7.5% ( 500 ml bottle ) item453 1 each 455 454 povidone iodine solution 10 % ( 100 ml bottle ) item454 1 each 456 455 povidone iodine solution 5% ( 100 ml bottle ) item455 1 each 457 456 povidone iodine solution 5% ( 500 ml bottle ) item456 1 each 458 457 promethazine 5 mg / 5ml syrup ( 60 ml bottle ) item457 1 each 459 458 paracetamol 125 mg / 5ml syrup ( 60ml bottle ) item458 1 each 460 459 paracetamol 250 mg / 5ml syrup ( 60 ml bottle ) item459 1 each 461 460 phenobarbitone 20mg / 5ml ( 60 mlsyrup ) item460 1 each 462 461 phenytoin 25 mg / ml oral suspension ( 100ml bottle ) item461 1 each 463 462 pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) item462 1 each 464 464 sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) item464 1 each 465 465 sodium picosulphate 5mg / 5ml soln. ( 100ml ) item465 1 each 466 466 syrup camylofin dihydrochloride 25 mg / 5ml, paracetamol 125mg / 5ml ( 60ml ) item466 1 each 467 467 surgical spirit ( 70 % alcohol ) ( 450 ml bottle ) item467 1 each 468 468 surgical spirit ( 70% alcohol ) ( 100 ml bottle ) item468 1 each 469 469 salbutamol syrup 2 mg / 5ml ( 100 ml bottle ) item469 1 each 470 470 terbutaline 0.25mg / ml with ambroxol 7.5mg / ml guaiphenesin 12.5mg / ml ( 15ml drop ) item470 1 each 471 471 turpentine oil ( 100 ml ) item471 1 each 472 472 vitamin d3 oral solution 60000 i.u. item472 1 each 473 473 vitamin a solution 1 lac iu / ml ( 100ml bottle ) item473 1 each 474 474 zinc sulphate 60 ml syrup item474 1 60 ml 475 475 beclomethasone inhalation 200 mcg / dose ( 200 metered doses container ) item475 1 each 476 476 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg rotocap ( 30 capsule ) item476 1 each 477 477 betamethasone with clotrimazole with lignocaine 5ml ear drop item477 1 each 478 478 atropine eye ointment ip 1% item478 1 each 479 479 atropine sulphate ophthalmic solution usp 1% item479 1 each 480 480 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5ml item480 1 each 481 481 betaxolol eye drops 0.5 o / o ( 5ml ) item481 1 each 482 482 betamethasone 0.01% w / v, neomycin 0.5% w / v eye drop ( 10ml ) item482 1 each 483 483 budesonide nebulizer suspension 0.25 mg / ml ( 2ml amp ) item483 1 each 484 484 budesonide powder for inhalation 200 mcg ( rotocap 30 capsul ) item484 1 each 485 485 chloramphenicol 0.05% ( 10ml ) eyedrop item485 1 each 486 486 chloramphenicol 0.05% + betamethasone 0.01% ( 10ml ) eyedrop item486 1 each 487 487 chloramphenicol 0.05% + dexamethasone 0.1% ( 10ml ) eyedrop item487 1 each 488 488 chlorhexidine gluconate solution 2% ( 250ml ) item488 1 each 489 489 chlorhexidine gluconate solution 2% ( 100ml ) item489 1 each 490 490 chlorhexidine gluconate 2%, cetrimide solution ( 100ml ) item490 1 each 491 491 cholecalciferol granules 60000 iu / 1gm ( 1 gm sachet ) item491 1 each 492 492 ciprofloxacin 0.3% and dexamethasone 0.1% ear drops 10ml item492 1 each 493 493 ciprofloxacin 0.3% and dexamethasone 0.1% eye drops 10ml item493 1 each 494 494 ciprofloxacin 0.3% eye drops ( 10ml ) item494 1 each 495 495 ciprofloxacin ophthalmic ointment usp 0.3% 5gm item495 1 each 496 496 chloramphenicol 1% w / w eye ointment ip, 3gm size item496 1 each 497 497 clotrimazole 1% with beclomethasone 0.02% drops ( 5 ml drop ) item497 1 each 498 498 clotrimazole 1% with lignocaine 1% ear drops ( 5 ml drop ) item498 1 each 499 499 concentrated haemodialysis fluid b.p acetate concentrate in 10 litre cans. each 1000ml after 1:34 dilutions should provide sodium chloride 135 to 140 meq ( 10 litres plastic can ) item499 1 each 500 500 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans item500 1 each 501 501 black disinfectant fluid ( phenyl ) as per schedule o grade iii item501 1 each 502 502 fluconazole 0.3% eye drops ( 5 ml drop ) item502 1 each 503 503 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5ml item503 1 each 504 504 nformaldehyde solution ( 34.5 per. 38 per. ) item504 1 each 505 505 glutaraldehyde 2% solution ( 5 ltrs can ) item505 1 each 506 506 gentamicin 0.3% w / v eye drop 10ml item506 1 each 507 507 gatifloxacin 0.3% eye drop 10ml item507 1 each 508 508 gatifloxacin 0.3%, dexamethasone 0.1% eye drop 10ml item508 1 each 509 509 homatropine eye drop ( 2% ) 5 ml item509 1 each 510 510 hydrogen peroxide solution 6% ( 400 ml bottle ) item510 1 each 511 511 hydrogen peroxide solution 6% ( 100 ml bottle ) item511 1 each 512 512 ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) item512 1 each 513 513 nipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) item513 1 each 514 514 ketorolac tromethamine 0.5% w / v eye drop 5ml item514 1 each 515 515 lactilol granules powder sachet 10gm item515 1 each 516 516 lactilol, isabghula powder 100gm item516 1 each 517 517 liquid soap ( 1000 ml ) item517 1 each 518 518 liquid soap ( 500 ml ) item518 1 each 519 519 liquid soap ( 5000 ml ) item519 1 each 520 520 nlysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 5 ltrs can ) item520 1 each 521 521 miconazole 1% eye drops item521 1 each 522 522 moxifloxacin + ketorolac eye drop 10ml item522 1 each 523 523 moxifloxacin 0.5% + dexamethasone 0.05% eye drop 10ml item523 1 each 524 524 moxifloxacin ( 0.5% w / v ) eye drop 10ml item524 1 each 525 525 norfloxacin 0.3% eye drop 10ml item525 1 each 526 526 nepafenac 0.1% w / v eye drop 5ml item526 1 each 527 527 nasal spray azelastine 140 mcg with fluticasone 50 mcg item527 1 each 528 528 neomycin, hydrocortisone and polymyxin b ear drops item528 1 each 529 529 ors powder item529 1 each 530 530 ofloxacin 0.3% w / v eye drop 10ml item530 1 each 531 531 ofloxacin 0.3% w / v + dexamethasone 0.05% w / v eye drop 10ml item531 1 each 532 532 polymixin b, chloramphenicol, dexamethasone ear drop 5ml item532 1 each 533 533 phenylephrine opthalmic drops 5% ( 5 ml drop ) item533 1 each 534 534 pilocarpine hydrochloride 2% 5 ml vial item534 1 each 535 535 pilocarpine hydrochloride 4% 5 ml vial item535 1 each 536 536 powder neomycin, bacitracin with sulfacetamide 5mg+250units+60mg ( 10 gm plastic bottle ) item536 1 each 537 537 powder povidone iodine 10gm item537 1 each 538 538 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) item538 1 each 539 539 respules ambroxol 15mg / 2ml item539 1 each 540 540 salbutamol inhalation 100 mcg / dose ( 200 metered dose container ) item540 1 each 541 541 salbutamol nebuliser solution 5 mg / ml ( 10 ml vial ) item541 1 each 542 542 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) ( 10ml bottle with dropper / squeeze bottle ) item542 1 each 543 543 sodium chloride 5%w / v opthalmic soln. 10ml item543 1 each 544 544 savlon / dettol soap ( 100 gm ) item544 1 each 545 545 savlon / dettol soap ( 75 gm ) item545 1 each 546 546 sodium phosphates enema bp ( 100 ml polypropylene pack ) item546 1 each 547 547 sulfacetamide 20% eye drops ( 10 ml drop ) item547 1 each 548 548 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) item548 1 each 549 549 timolol eye drops ip 0.5 o / o w / v 5 ml item549 1 each 550 550 tobramycin 0.3% eye drops 5ml item550 1 each 551 551 tobramycin and dexamethasone 0.3%+0.1% ophthalmic suspension ( 5ml ) item551 1 each 552 552 tropicamide eye drop 1% 5 ml item552 1 each 553 553 travoprost eye drops ip 0.004 o / o 5ml item553 1 each 554 554 wax dissolving ear drops: paradichlorobenzene 2%, benzocaine 2.7%, chlorobutanol 5%, turpentine oil 15% item554 1 each 555 555 xylometazoline nasal drops 0.1% ( 10 ml drop ) item555 1 each 556 556 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) item556 1 each 557 557 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) item557 1 each 558 558 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) item558 1 each 559 559 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) item559 1 each 560 560 acamprosate calcium 333 mg tablet item560 1 10 tablets 561 561 acarbose 25mg tablet item561 1 10 tablets 562 562 aceclofenac & thiocolchicoside 100 mg+4mg tablet item562 1 10 tablets 563 563 aceclofenac 100 mg and paracetamol 325 mg tab item563 1 10 tablets 564 564 aceclofenac 100 mg, paracetamol 325 mg, chlorzoxazone 250mg tab item564 1 10 tablets 565 565 aceclofenac 100 mg, paracetamol 325 mg, serratiopeptidase 10mg tab item565 1 10 tablets 566 566 acebrophylline tablet 100 mg item566 1 10 tablets 567 567 acebrophylline tablet 200 mg item567 1 10 tablets 568 568 acenocoumarol 1 mg tablet item568 1 10 tablets 569 569 acenocoumarol 2 mg tablet item569 1 10 tablets 570 570 acetazolamide 250 mg tablets item570 1 10 tablets 571 571 acyclovir 200 mg tablets item571 1 10 tablets 572 572 acyclovir 400 mg tablets item572 1 10 tablets 573 573 acyclovir 800 mg tablets item573 1 10 tablets 574 574 acetyl cystein 600mg tablet item574 1 10 tablets 575 575 albendazole 400 mg tablets item575 1 10 tablets 576 576 albendazole 400 mg, ivermectin 6mg tablets item576 1 10 tablets 577 577 alprazolam 0.25 mgtablets item577 1 10 tablets 578 578 alprazolam 0.5 mg tablets item578 1 10 tablets 579 579 amitriptyline hcl 25 mg tablet item579 1 10 tablets 580 580 amitriptyline hydrochloride 50 mg tablet item580 1 10 tablets 581 581 amlodipine & lisinopril 5mg+10mg tablet item581 1 10 tablets 582 582 amlodipine 2.5 mg tablets ip ( 10 tab blister ) item582 1 10 tablets 583 583 amlodipine 5 mg tablets ( 10 tab blister ) item583 1 10 tablets 584 584 amlodipine and atenolol 5 mg +50mg tablet item584 1 10 tablets 585 585 amlodipine and enalapril maleate 5 mg +5mg tablets item585 1 10 tablets 586 586 amoxycillin and potassium clavulanate 500mg + 125mg tablet item586 1 10 tablets 587 587 amoxycillin trihydrate 125 mg dispersible tablets item587 1 10 tablets 588 588 antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil item588 1 10 tablets 589 589 artemether & lumefantrine tab artemether 80mg + lumefantrine 480mg item589 1 6 tablets 590 590 artemether & lumefantrine tab artemether 40mg + lumefantrine 480mg item590 1 6 tablets 591 591 artemether and lumefantrine tab artemether 20mg+lumefantrine 120mg item591 1 6 tablets 592 592 ascorbic acid 500 mg tablets item592 1 10 tablets 593 593 aspirin 300 mg tablets item593 1 10 tablets 594 594 aspirin 150 mg tablets item594 1 10 tablets 595 595 amiodarone tab ip 100 mg item595 1 10 tablets 596 596 amisulpride 100 mg tablet item596 1 10 tablets 597 597 amisulpride 50 mg tablet item597 1 10 tablets 598 598 amiodarone tab ip 200 mg item598 1 10 tablets 599 599 allopurinol tablets ip 100 mg item599 1 10 tablets 600 600 allopurinol tablets ip 300 mg item600 1 10 tablets 601 601 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg item601 1 10 tablets 602 602 aspirin delayed release tablets 75 mg ( enteric coated gr tablet ) item602 1 14 tablets 603 603 atenolol 25 mg tablets item603 1 14 tablets 604 604 atenolol 50 mg tablets item604 1 14 tablets 605 605 atorvastatin 10 mg tablets item605 1 10 tablets 606 606 atorvastatin 20 mg tablets item606 1 10 tablets 607 607 atorvastatin 40 mgtablets item607 1 10 tablets 608 608 azithromycin 100 mg dt tablets item608 1 3 tablets 609 609 azithromycin 250 mg tablets item609 1 6 tablets 610 610 azithromycin 500 mg tablets item610 1 3 tablets 611 611 azathiopurine 50mg tablet item611 1 10 tablets 612 612 biotin 10mg tablet item612 1 10 tablets 613 613 biotin 10mg, acetylcystine 50mg, calcium pantothenate 100mg, selenium 65mcg, copper 3mg, zinc oxide 22.5mg tablet item613 1 10 tablets 614 614 betahistine 8mg tablet item614 1 10 tablets 615 615 betahistine 16mg tablet item615 1 10 tablets 616 616 betahistine 24mg tablet item616 1 10 tablets 617 617 baclofen 10mg tablet item617 1 10 tablets 618 618 baclofen 20mg tablet item618 1 10 tablets 619 619 baclofen 30mg tablet item619 1 10 tablets 620 620 betamethasone 0.5 mg tablets item620 1 14 tablets 621 621 bicalutamide 50 mg tablet item621 1 10 tablets 622 622 bisacodyl 5 mg tablets item622 1 10 tablets 623 623 bilastine 20mg, monteleukast 10mg tablet item623 1 10 tablets 624 624 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) item624 1 10 tablets 625 625 carbamazepine 100 mg tablets item625 1 10 tablets 626 626 carbamazepine 200 mg tablets item626 1 10 tablets 627 627 carbamazepine 400 mg tablets item627 1 10 tablets 628 628 carbimazole 10 mg tablets item628 1 10 tablets 629 629 carbimazole 5 mg tablets item629 1 10 tablets 630 630 camylofin hcl 25mg, paracetamol 325mg tablet item630 1 10 tablets 631 631 cholecalciferol 60000 iu tablet item631 1 4 tablets 632 632 cefixime 100 mg tablets item632 1 10 tablets 633 633 cefixime 200 mg tablets item633 1 10 tablets 634 634 cefpodoxime 200 mg & clav 125 mg tablet item634 1 10 tablets 635 635 cefpodoxime 200 mg tablets item635 1 10 tablets 636 636 cefpodoxime 50 mg + clav 28.5 mg tablet item636 1 10 tablets 637 637 cefpodoxime 50 mg dispersible tablets item637 1 10 tablets 638 638 cefpodoxime proxetil 100 mg tablet item638 1 10 tablets 639 639 cefuroxime 500 mg tablet item639 1 10 tablets 640 640 cefuroxime 250 mg tablet item640 1 10 tablets 641 641 cephalexin 125 mg tablets ( dt ) item641 1 10 tablets 642 642 cetirizine 10 mg tablet item642 1 10 tablets 643 643 cetirizine 5mg, phenylephrine 10mg & paracetamol 325 mg tablet item643 1 10 tablets 644 644 chlordiazepoxide + trifluoperazine 5mg+1mg tablet item644 1 10 tablets 645 645 chlordiazepoxide 10 mg tablets item645 1 10 tablets 646 646 chlordizepoxide 25 mg tablet item646 1 10 tablets 647 647 chlorine 500 mg tablet item647 1 per 100 tablets 648 648 chloroquine phosphate tablets 250mg item648 1 10 tablets 649 649 chlorpheniramine maleate 4 mg tablets item649 1 10 tablets 650 650 chlorpromazine 100 mg tablets item650 1 10 tablets 651 651 chlorpromazine 25 mg tablets item651 1 10 tablets 652 652 chlorpromazine 50 mg tablets item652 1 10 tablets 653 653 chlorpromazine 10 mg tablets item653 1 10 tablets 654 654 chlorpromazine+trihexyphenidyl 50 mg+ 2 mg tablet item654 1 10 tablets 655 655 chlorzoxazone 250 mg tablet item655 1 10 tablets 656 656 chlorzoxazone 250 mg, ibuprofen 400 mg & paracetamol 325 mg tablet item656 1 10 tablets 657 657 chlorzoxazone 250mg, diclofenac sodium 50mg & paracetamol 325 mg tablet item657 1 10 tablets 658 658 chymotrypsin 20 mg + trypsin 20mg + diclofenac 50mg tablet item658 1 10 tablets 659 659 chymotrypsin 20 mg + trypsin 20mg tablet item659 1 10 tablets 660 660 cinnarizine + domperidone 20 mg + 15 mg tablet item660 1 10 tablets 661 661 cinnarizine tab 25 mg tablet item661 1 10 tablets 662 662 cinnarizine tab 75 mg tablet item662 1 10 tablets 663 663 ciprofloxacin + tinidazole 500 mg + 600 mg tablets item663 1 10 tablets 664 664 ciprofloxacin 250 mg tablets item664 1 10 tablets 665 665 ciprofloxacin 500 mg tablets item665 1 10 tablets 666 666 clobazam 10 mg tablet item666 1 10 tablets 667 667 clobazam 5 mg tablet item667 1 10 tablets 668 668 clonazepam 0.25 mg tablets item668 1 10 tablets 669 669 clonazepam 0.5 mg tablets item669 1 10 tablets 670 670 clonazepam 1 mg tablets item670 1 10 tablets 671 671 clopidogrel 75 mg and aspirin 75 mg tablet item671 1 10 tablets 672 672 clopidogrel 75 mg tablets item672 1 10 tablets 673 673 clotrimazole vaginal 500 mg tablets ( single tablet ) item673 1 1 tablet 674 674 clozapine 50 mg tablet item674 1 10 tablets 675 675 clozapine 25 mg tablet item675 1 10 tablets 676 676 cloimpiramine 25mg tablet item676 1 10 tablets 677 677 co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet item677 1 10 tablets 678 678 co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet item678 1 10 tablets 679 679 co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet item679 1 10 tablets 680 680 co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet item680 1 10 tablets 681 681 cyproheptadine 4 mg tablet item681 1 10 tablets 682 682 citicoline 500mg tablet item682 1 10 tablets 683 683 conjugated estrogen 0.625mg tablet item683 1 10 tablets 684 684 clomifene 25mg tablet item684 1 10 tablets 685 685 clomifene 50mg tablet item685 1 10 tablets 686 686 carvedilol 3.125mg tablet item686 1 10 tablets 687 687 cefadroxil 250mg tablet item687 1 10 tablets 688 688 cefadroxil 500mg tablet item688 1 10 tablets 689 689 cabergoline 0.5mg tablet item689 1 10 tablets 690 690 calcitriol 0.25mg tablet / capsule item690 1 10 tablets / cap 691 691 cerebroprotein hydrolysate 90mg tablet item691 1 10 tablets 692 692 chlorambucil 5mg tablet item692 1 10 tablets 693 693 cyclosporin 50mg tablet / capsule item693 1 10 tablets / cap 694 694 capecitabine 500mg tablet item694 1 10 tablets 695 695 dapsone 100mg tablet item695 1 10 tablets 696 696 deflazacort 6 mg tablet item696 1 10 tablets 697 697 deflazacort 12 mg tablet item697 1 10 tablets 698 698 deflazacort 24 mg tablet item698 1 10 tablets 699 699 deflazacort 30 mg tablet item699 1 10 tablets 700 700 dexamethasone 0.5 mg tablet item700 1 10 tablets 701 701 dexamethasone 4 mg tablet item701 1 10 tablets 702 702 diazepam 5 mg tablet item702 1 10 tablets 703 703 diclofenac 100 mg ( sr ) tablets item703 1 10 tablets 704 704 diclofenac potassium 50mg + serratiopeptidase 15mg + paracetamol 325mg tablet item704 1 10 tablets 705 705 diclofenac sodium + paracetamol tab 50+325mg tablet item705 1 10 tablets 706 706 diclofenac sodium 50 mg tablets item706 1 10 tablets 707 707 dicyclomine 10 mg tablets item707 1 10 tablets 708 708 dicyclomine 20 mg + paracetamol 325 mg tablet item708 1 10 tablets 709 709 diethylcarbamazine 100 mg tablets item709 1 10 tablets 710 710 digoxin 0.25 mg tablet item710 1 10 tablets 711 711 diltiazem 30 mg tablet item711 1 10 tablets 712 712 diltiazem 60 mg tablet item712 1 10 tablets 713 713 diltiazem 90 mg tablet item713 1 10 tablets 714 714 divalproex sodium 500 mg tablet item714 1 10 tablets 715 715 divalproex sodium 250 mg tablet item715 1 10 tablets 716 716 divalproex sodium 750 mg tablet item716 1 10 tablets 717 717 disulfiram 500mg tablet item717 1 10 tablets 718 718 desloratadine 5mg tablet item718 1 10 tablets 719 719 doxofyline 400mg tablet item719 1 10 tablets 720 720 domperidone 10 mg tablets item720 1 10 tablets 721 721 doxylamine succinate 20mg + pyridoxine 20mg + folic acid 2.5 mg tablets item721 1 10 tablets 722 722 drotaverin 40mg tablet item722 1 10 tablets 723 723 drotaverine 80 mg & mefenamic acid 250 mg tab ( 10 tab strip ) item723 1 10 tablets 724 724 drotaverine 80 mg tablets item724 1 10 tablets 725 725 donepezil hcl 5mg tablet item725 1 10 tablets 726 726 donepezil hcl 10mg tablet item726 1 10 tablets 727 727 duloxetine 20mg tablet item727 1 10 tablets 728 728 duloxetine 30mg tablet item728 1 10 tablets 729 729 duloxetine 40mg tablet item729 1 10 tablets 730 730 dutasteride 0.5mg tablet item730 1 10 tablets 731 731 deferasirox tab 100 mg item731 1 10 tablets 732 732 deferasirox tab 500 mg item732 1 10 tablets 733 733 enalapril maleate 10 mg tablets item733 1 10 tablets 734 734 enalapril maleate 2.5 mg tablets item734 1 10 tablets 735 735 enalapril maleate 5 mg tablets item735 1 10 tablets 736 736 erythromycin stearate 250 mg tablets item736 1 10 tablets 737 737 erythromycin stearate 500 mg tablets item737 1 10 tablets 738 738 escitalopram 5 mg tablet item738 1 10 tablets 739 739 escitalopram 10 mg tablet item739 1 10 tablets 740 740 escitalopram 20 mg tablet item740 1 10 tablets 741 741 ethamsylate 250 mg tablet item741 1 10 tablets 742 742 ethamsylate 500 mg tablet item742 1 10 tablets 743 743 etoricoxib 90mg tablet item743 1 10 tablets 744 744 etoricoxib 120mg tablet item744 1 10 tablets 745 745 etoricoxib 60mg tablet item745 1 10 tablets 746 746 etoricoxib 60mg, thiocolchicoside 4mg tablet item746 1 10 tablets 747 747 ethinyloestradiol 50mcg tablet item747 1 10 tablets 748 748 etizolam 0.5mg tablet item748 1 10 tablets 749 749 etizolam 0.25mg tablet item749 1 10 tablets 750 750 famotidine 20 mg tablets item750 1 14 tablets 751 751 famotidine 40 mg tablets item751 1 14 tablets 752 752 flavoxate 200 mg tablet item752 1 10 tablets 753 753 fluconazole 150 mg tablets tablet item753 1 10 tablets 754 754 fluconazole 50 mg dt tablet item754 1 10 tablets 755 755 flunarazine 10 mg tablet item755 1 10 tablets 756 756 flunarazine 5 mg tablet item756 1 10 tablets 757 757 fluoxitine 20 mg tablet item757 1 10 capsules 758 758 fluoxitine 60 mg capsule item758 1 10 capsules 759 759 flupentixol 0.5 mg. tablet item759 1 10 tablets 760 760 flupentixol 1 mg. tablet item760 1 10 tablets 761 761 flupentixol 3 mg. tablet item761 1 10 tablets 762 762 flupentixol 0.5mg, melitracen 10mg tablet item762 1 10 tablets 763 763 fluvoxamine 100 mg tablet item763 1 10 tablets 764 764 folic acid tablets ip 5 mg tablet item764 1 10 tablets 765 765 formalin tablet item765 1 100 tablets bottle 766 766 furazolidone 100 mg tablets item766 1 10 tablets 767 767 furazolidone 100 mg, metronidazole 300mg tablets item767 1 10 tablets 768 768 furosemide 40 mg tablet item768 1 10 tablets 769 769 fexofenadine 180mg tablet item769 1 10 tablets 770 770 fexofenadine 120mg tablet item770 1 10 tablets 771 771 fexofenadine 120mg, monteleukast 10mg tablet item771 1 10 tablets 772 772 febuxostat 40mg tablet item772 1 10 tablets 773 773 febuxostat 80mg tablet item773 1 10 tablets 774 774 feropenum 200mg tablet item774 1 10 tablets 775 775 feropenum 300mg tablet item775 1 10 tablets 776 776 fenofibrate 200mg tablet item776 1 10 tablets 777 777 fenofibrate 160mg tablet item777 1 10 tablets 778 778 finasteride 5mg tablet item778 1 10 tablets 779 779 gabapentin+methylcobalamine 300mg+500 mcg tablet / cap item779 1 10 tab / cap 780 780 gabapentin 100mg, nortryptyline 10mg tablet / cap item780 1 10 tab / cap 781 781 gabapentin 100mg tablet item781 1 10 tablets 782 782 gabapentin 300mg tablet item782 1 10 tablets 783 783 griseofulvin 125mg tablet item783 1 10 tablets 784 784 glyceryltrinitrate 2.6mg tablet item784 1 10 tablets 785 785 glibenclamide 5 mg tablets item785 1 10 tablets 786 786 glibenclamide and metformin hydrochloride 5 mg + 500 mg ( sr ) tablets item786 1 10 tablets 787 787 gliclazide 40 mg tablets item787 1 10 tablets 788 788 gliclazide 80 and metformin 500 mg tablet item788 1 10 tablets 789 789 glimepiride 1 mg tablets item789 1 10 tablets 790 790 glimepiride 2 mg tablets item790 1 10 tablets 791 791 glimepiride, pioglitazone and metformin hydrochloride 2mg + 15mg + 500mg ( sr ) tablets item791 1 10 tablets 792 792 glipizide 5 mg tablets item792 1 10 tablets 793 793 glipizide and metformin hydrochloride 5 mg + 500 mg tablets item793 1 10 tablets 794 794 haloperidol 1.5 mg tablets item794 1 10 tablets 795 795 haloperidol 5 mg tablet item795 1 10 tablets 796 796 haloperidol 5mg tablets item796 1 10 tablets 797 797 hydrochlorothiazide 12.5 mg tablets item797 1 10 tablets 798 798 hydrochlorothiazide 25 mg tablets item798 1 10 tablets 799 799 hydroxychloroquine sulphate 200 mg item799 1 10 tablets 800 800 hydroxychloroquine sulphate 300 mg item800 1 10 tablets 801 801 hydroxychloroquine sulphate 400 mg item801 1 10 tablets 802 802 hydroxyzine 25 mg tablets item802 1 10 tablets 803 803 hyoscine butylbromide 10 mg tablets item803 1 10 tablets 804 804 ibuprofen 200 mg tablets item804 1 10 tablets 805 805 ibuprofen 400 mg tablets item805 1 10 tablets 806 806 ibuprofen and paracetamol 400 mg + 325 mg tablets item806 1 10 tablets 807 807 imiatinib 100mg tablet item807 1 10 tablets 808 808 imiatinib 400mg tablet item808 1 10 tablets 809 809 imipramine 25mg tablet item809 1 10 tablets 810 810 imipramine 75mg tablet item810 1 10 tablets 811 811 iron ( ferrous sulphate 100mg ) folic acid 0.5 mg tablet item811 1 10 tablets 812 812 iron ( ferrous sulphate 20mg ) folic acid 0.1 mg tablet item812 1 10 tablets 813 813 isosorbide dinitrate 5 mg tablets sl tab. item813 1 10 tablets 814 814 isosorbide mononitrate 20 mg tablets item814 1 10 tablets 815 815 isoxsuprine 20 mg tablets item815 1 10 tablets 816 816 ketorolac 10mg tablet item816 1 10 tablets 817 817 ketoconazole 200mg tablet item817 1 10 tablets 818 818 labetalol 100 mg tablets item818 1 10 tablets 819 819 lactic acid bacillus tab 60 million spores item819 1 10 tablets 820 820 levetiracetam 250 mg tablet item820 1 10 tablets 821 821 levetiracetam 500 mg tablet item821 1 10 tablets 822 822 levocetirizine 5mg with montelukast 10mg tab item822 1 10 tablets 823 823 levocetirizine 2.5mg with montelukast 4mg tab item823 1 10 tablets 824 824 levocetrizine 5mg tablet item824 1 10 tablets 825 825 levofloxacin 250 mg tablet item825 1 10 tablets 826 826 levofloxacin 500 mg tablet item826 1 10 tablets 827 827 levofloxacin 750 mg tablet item827 1 10 tablets 828 828 linezolid 600 mg tablet item828 1 10 tablets 829 829 lisinopril 10 mg tablets item829 1 10 tablets 830 830 lisinopril 2.5 mg tablet item830 1 10 tablets 831 831 lisinopril 5 mg tablet item831 1 10 tablets 832 832 lithium carbonate 300 mg tablet item832 1 10 tablets 833 833 loperamide 2 mg tablets item833 1 10 tablets 834 834 lorazepam 2 mg tablet item834 1 10 tablets 835 835 lorazepam 1 mg tablet item835 1 10 tablets 836 836 losartan 25 mg tablets item836 1 10 tablets 837 837 losartan 50 mg tablets item837 1 10 tablets 838 838 losartan potassium & amlodipine 50 mg + 5mg tablets item838 1 10 tablets 839 839 losartan potassium & hydrochlorothiazide 50 mg + 12.5mg tablets item839 1 10 tablets 840 840 lamotrigine 25mg tablet item840 1 10 tablets 841 841 lamotrigine 50mg tablet item841 1 10 tablets 842 842 lamotrigine 100mg tablet item842 1 10 tablets 843 843 levodopa 100mg + carbidopa 10mg tablet item843 1 10 tablets 844 844 levodopa 250mg + carbidopa 25mg tablet item844 1 10 tablets 845 845 levosulpiride 25mg tablet item845 1 10 tablets 846 846 letrozole 2.5mg tablet item846 1 10 tablets 847 847 loratidine 10mg tablet item847 1 10 tablets 848 848 leflunomide 10mg tablet item848 1 10 tablets 849 849 leflunomide 20mg tablet item849 1 10 tablets 850 850 melphalan 5mg tablet item850 1 10 tablets 851 851 mercaptopurine 50mg tablet item851 1 10 tablets 852 852 mefenamic acid 250 mg with dicyclomine 10 mg tablet item852 1 10 tablets 853 853 mefenamic acid 500 mg tablet item853 1 10 tablets 854 854 mefenamic acid 125 mg tablet item854 1 10 tablets 855 855 mefenamic acid 250 mg tablet item855 1 10 tablets 856 856 mefenamic acid 500 mg + paracetamol 325mg tablet item856 1 10 tablets 857 857 mefloquine 250 mg tablet item857 1 10 tablets 858 858 mesalamine 800 mg tablet item858 1 10 tablets 859 859 mesalamine 400 mg tablet item859 1 10 tablets 860 860 mesalamine 1.2gm tablet item860 1 10 tablets 861 861 medroxyprogestrone acetate 10mg tablet item861 1 10 tablets 862 862 metformin 500 mg tablets item862 1 10 tablets 863 863 metformin hydrochloride ( sr ) and glimepiride 500 mg + 1 mg tablets item863 1 10 tablets 864 864 metformin hydrochloride ( sustained release ) and glimepiride 500 mg + 2 mg tablets item864 1 10 tablets 865 865 metformin hydrochloride 1000 mg sr tablets item865 1 10 tablets 866 866 methotrexate 7.5 mg tablet item866 1 10 tablets 867 867 methotrexate 2.5 mg tablet item867 1 10 tablets 868 868 methotrexate 10 mg tablet item868 1 10 tablets 869 869 methyldopa 250 mg tablets item869 1 10 tablets 870 870 methylergometrine 0.125 mg tablets item870 1 10 tablets 871 871 methylprednisolone 4 mg tablets item871 1 10 tablets 872 872 methylprednisolone 8 mg tablets item872 1 10 tablets 873 873 methylprednisolone 16 mg tablets item873 1 10 tablets 874 874 metoclopramide 10 mg tablets item874 1 10 tablets 875 875 methyl cobalmine tablet 1500mcg item875 1 10 tablets 876 876 methyl cobalmine tablet 500mcg item876 1 10 tablets 877 877 metoprolol tablets ip 25 mg item877 1 10 tablets 878 878 metoprolol succinate extended release tablets ip 50 mg item878 1 10 tablets 879 879 metronidazole 200 mg tablets item879 1 10 tablets 880 880 metronidazole 400 mg tablets item880 1 10 tablets 881 881 misoprostol 200 mcg tablets item881 1 10 tablets 882 882 mifepristone tab ip 200mg item882 1 10 tablets 883 883 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg item883 1 10 tablets 884 884 mirabegron 50mg er tablet item884 1 10 tablets 885 885 mefanimic acid 250mg tablet item885 1 10 tablets 886 886 mefanimic acid 125mg tablet item886 1 10 tablets 887 887 nicotinamide 50mg tablet item887 1 10 tablets 888 888 nicoumalone 4mg tablet item888 1 30 tablets 889 889 nifedipine 10 mg ( sr ) tablets item889 1 10 tablets 890 890 nifedipine 5 mg ( sr ) tablets item890 1 10 tablets 891 891 naproxen tablet ip 250mg item891 1 10 tablets 892 892 naproxen tablet ip 500mg item892 1 10 tablets 893 893 neostigmine tab ip 15 mg item893 1 10 tablets 894 894 nimesulide and paracetamol 100 mg+325 mg tablet item894 1 10 tablets 895 895 nitrofurantoin 100 mg tablets item895 1 10 tablets 896 896 nitroglycerin controlled release 2.6mg tablets item896 1 25 tablets 897 897 norethisterone 5 mg tablets item897 1 10 tablets 898 898 nortryptyline 10mg tablet item898 1 10 tablets 899 899 norfloxacin 400 mg tablets item899 1 10 tablets 900 900 ofloxacin 200 mg and ornidazole 500 mg tablet item900 1 10 tablets 901 901 ofloxacin 200 mg tablets item901 1 10 tablets 902 902 ofloxacin 400 mg tablets item902 1 10 tablets 903 903 olanzapine 10 mg tablet item903 1 10 tablets 904 904 olanzapine 5 mg tablet item904 1 10 tablets 905 905 olamisartan 20mg tablet item905 1 10 tablets 906 906 olamisartan 40mg tablet item906 1 10 tablets 907 907 ondansetron 4 mg md tablet item907 1 10 tablets 908 908 oxcarbazepine 300 mg tablet item908 1 10 tablets 909 909 oxcarbazepine 150 mg tablet item909 1 10 tablets 910 910 pantoprazole 40mg tablet item910 1 10 tablets 911 911 paracetamol 500 mg tablets item911 1 10 tablets 912 912 paroxetine 12.5 mg tablet item912 1 10 tablets 913 913 phenobarbitone 30 mg tablets item913 1 10 tablets 914 914 phenobarbitone 60 mg tablets item914 1 10 tablets 915 915 phenoxymethylpenicillin potassium 125 mg tablets item915 1 10 tablets 916 916 phenoxymethylpenicillin potassium 250 mg tablets item916 1 10 tablets 917 917 phenytoin 100 mg tablets item917 1 10 tablets 918 918 pioglitazone 15 mg tablets item918 1 10 tablets 919 919 prazosin hcl 2.5 mg tablets item919 1 10 tablets 920 920 prednisolone 10 mg tablets item920 1 10 tablets 921 921 prednisolone 20 mg tablets item921 1 10 tablets 922 922 prednisolone 5 mg tablets item922 1 10 tablets 923 923 primaquine 2.5 mg tablets item923 1 10 tablets 924 924 primaquine 7.5 mg tablets item924 1 10 tablets 925 925 prochlorperazine 5 mg tablet item925 1 10 tablets 926 926 prochlorperazine 10 mg tablet item926 1 10 tablets 927 927 promethazine 25 mg tablet item927 1 10 tablets 928 928 propranolol 40 mg tablets item928 1 10 tablets 929 929 propranolol 10 mg tablets item929 1 10 tablets 930 930 pyridoxine 10 mg tablet item930 1 10 tablets 931 931 pyridoxine 40mg tablet item931 1 10 tablets 932 932 pyrimethamine 37.5 mg and sulphadoxine 750 mg tablet item932 1 10 tablets 933 933 phenazopyridine tablet 5 mg item933 1 10 tablets 934 934 piracetam 400mg tablet item934 1 10 tablets 935 935 piracetam 800mg tablet item935 1 10 tablets 936 936 pyridestigmine 60mg tablet item936 1 10 tablets 937 937 phenolphathaline 0.19gm tablet item937 1 10 tablets 938 938 quinine sulphate 300 mg tablets item938 1 10 tablets 939 939 quitiapine 100 mg tablet item939 1 10 tablets 940 940 racecadotril 100 mg tablet / capsules item940 1 10 tab / cap 941 941 ramipril 2.5 mg tablets item941 1 10 tablets 942 942 ramipril 5 mg tablets item942 1 10 tablets 943 943 ramigliflozin 100mg tablet item943 1 10 tablets 944 944 rifaximin 200mg tablet item944 1 10 tablets 945 945 rifaximin 400mg tablet item945 1 10 tablets 946 946 ranitidine 150 mg tablets item946 1 10 tablets 947 947 ranitidine 300 mg tablets item947 1 10 tablets 948 948 resperidone 2 mg tablet item948 1 10 tablets 949 949 resperidone 1 mg tablet item949 1 10 tablets 950 950 riboflavin 5 mg tablet item950 1 10 tablets 951 951 roxithromycin 150 mg tablet item951 1 10 tablets 952 952 rosuvastatin 10mg tablet item952 1 10 tablets 953 953 rosuvastatin 20mg tablet item953 1 10 tablets 954 954 rosuvastatin 40mg tablet item954 1 10 tablets 955 955 rabeprazole 20mg tablet item955 1 10 tablets 956 956 rabeprazole 20mg, domperidone 10mg tablet / capsule item956 1 10 tab / cap 957 957 rabeprazole 20mg, levosulpride 75mg tablet / capsule item957 1 10 tab / cap 958 958 rabeprazole 20mg, itopride 150mg tablet / capsule item958 1 10 tab / cap 959 959 slidenafil citrate 50mg tablet item959 1 10 tablet 960 960 slidenafil citrate 100mg tablet item960 1 10 tablet 961 961 silymarin 70mg tablet item961 1 10 tablet 962 962 silymarin 140mg tablet item962 1 10 tablet 963 963 silodosin 4mg tablet item963 1 10 tablet 964 964 silodosin 4mg, dutesteride 0.5mg tablet item964 1 10 tablet 965 965 silodosin 8mg tablet item965 1 10 tablet 966 966 silodosin 8mg, dutesteride 0.5mg tablet item966 1 10 tablet 967 967 salbutamol 2 mg tablets item967 1 10 tablets 968 968 salbutamol 4 mg tablets item968 1 10 tablets 969 969 sodium valporate 500 mg gr tablet item969 1 10 tablets 970 970 sodium valproate 200 mg tablets item970 1 10 tablets 971 971 sodium valproate 300 mg tablets ( sodium valproate 200+ valproic 87 mg, both corresponds 300 mg ) item971 1 10 tablets 972 972 sodium valproate 500 mg tablets item972 1 10 tablets 973 973 spironolactone 25 mg tablets item973 1 10 tablets 974 974 spironolactone 50 mg tablet item974 1 10 tablets 975 975 sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet item975 1 per kit 976 976 sodium picosulphate 2.5mg tablet item976 1 10 tablets 977 977 sodium picosulphate 5mg tablet item977 1 10 tablets 978 978 sertaline 50mg tablet item978 1 10 tablets 979 979 sotalol hcl 40mg tablet item979 1 10 tablets 980 980 sodiumbicarbonate 1gm tablet item980 1 10 tablets 981 981 tamoxifen 10 mg tablet item981 1 10 tablets 982 982 tamoxifen 20 mg tablet item982 1 10 tablets 983 983 tamsulosin hcl 0.4 mg tablet item983 1 10 tablets 984 984 tamsulosin with dutasteride 0.4mg+0.5mg tablet item984 1 10 tablets 985 985 tamsulosin with finasteride 0.4mg+5mg tablet item985 1 10 tablets 986 986 telmisartan 40 mg tablet item986 1 10 tablets 987 987 telmisartan 80 mg tablet item987 1 10 tablets 988 988 tenaligliptin 20 mg tablet item988 1 10 tablets 989 989 terbutaline sulphate 2.5mg tablet item989 1 10 tablets 990 990 theophylline 400 mg tablets ( sr ) item990 1 10 tablets 991 991 theophylline and etofylline 23mg + 77mg tablet item991 1 10 tablets 992 992 thiamine 100mg tablet item992 1 10 tablets 993 993 thyroxine sodium 100 mcg tablets item993 1 10 tablets 994 994 thyroxine sodium 50 mcg tablets item994 1 10 tablets 995 995 tinidazole 300 mg tablets item995 1 10 tablets 996 996 tinidazole 500 mg tablets item996 1 10 tablets 997 997 topiramate 50 mg tablet item997 1 10 tablets 998 998 topiramate 25 mg tablet item998 1 10 tablets 999 999 topiramate 100 mg tablet item999 1 10 tablets 1000 1000 torsemide 10 mg tablets item1000 1 10 tablets 1001 1001 tranexamic acid 500 mg tablet item1001 1 10 tablets 1002 1002 tranexamic acid 500 mg, mefanimic acid 250mg tablet item1002 1 10 tablets 1003 1003 tranexamic acid 250 mg, ethamsylate 250mg tablet item1003 1 10 tablets 1004 1004 trifluoperazine 5 mg tablet item1004 1 10 tablets 1005 1005 trihexyphenidyl 2 mg tablet item1005 1 10 tablets 1006 1006 temozolomide 100mg tablet / capsule item1006 1 10 tablets / cap 1007 1007 thalidomide 100mg tablet / capsule item1007 1 10 tablets / cap 1008 1008 6 thioguanine 40mg tablet item1008 1 10 tablets 1009 1009 tizanidine 2mg tablet item1009 1 10 tablets 1010 1010 terbinafine 250mg tablet / capsule item1010 1 10 tablets / cap 1011 1011 tapentadol 50mg tablet / capsule item1011 1 10 tablets / cap 1012 1012 tapentadol 100mg tablet / capsule item1012 1 10 tablets / cap 1013 1013 ursodeoxycholic acid 300 mg tablet item1013 1 10 tablets 1014 1014 ursodeoxycholic acid 150 mg tablet item1014 1 10 tablets 1015 1015 venlafaxine 37.5 mg tablet item1015 1 10 tablets 1016 1016 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg item1016 1 10 tablets 1017 1017 verapamil 40mg tablet item1017 1 10 tablets 1018 1018 voglibose 0.3mg tablet item1018 1 10 tablets 1019 1019 voglibose 0.2mg tablet item1019 1 10 tablets 1020 1020 warfarin sodium 5mg tablet item1020 1 10 tablets 1021 1021 warfarin sodium 2mg tablet item1021 1 10 tablets 1022 1022 zinc sulphate dispersible 10 mg tablets item1022 1 10 tablets 1023 1023 zinc sulphate dispersible 20 mg tablets item1023 1 10 tablets 1024 1024 zolpidem 5mg tablet item1024 1 10 tablets 1025 1025 zolpidem 10mg tablet item1025 1 10 tablets 1026 1026 amoxicillin 250 mg capsules item1026 1 10 capsules 1027 1027 amoxicillin 500 mg capsules item1027 1 10 capsules 1028 1028 amoxicillin and cloxacillin 250mg+250mg capsules item1028 1 10 capsules 1029 1029 ampicillin 500 mg capsules item1029 1 10 capsules 1030 1030 cephalexin 250 mg capsules item1030 1 10 capsules 1031 1031 cephalexin 500 mg capsule item1031 1 10 capsules 1032 1032 clindamycin 300 mg cap item1032 1 10 capsules 1033 1033 clindamycin150mg cap item1033 1 10 capsules 1034 1034 diacerin 50mg capsule item1034 1 10 capsules 1035 1035 diacerin 50mg, glucosamine 500mg capsule / tablet item1035 1 10 tab / cap 1036 1036 deferiprone 250mg capsule item1036 1 10 capsules 1037 1037 deferiprone 500mg capsule item1037 1 10 capsules 1038 1038 danazol 50 mg capsules item1038 1 10 capsules 1039 1039 doxycycline 100 mg capsules item1039 1 10 capsules 1040 1040 fluoxetine 20 mg capsules item1040 1 10 capsules 1041 1041 fluoxetine 60 mg capsules item1041 1 10 capsules 1042 1042 fenofibrate 150mg capsules item1042 1 10 capsules 1043 1043 indomethacin 25 mg capsules item1043 1 10 capsules 1044 1044 iron & zinc & folic acid capsule item1044 1 10 capsules 1045 1045 itraconazole 100 mg capsule item1045 1 10 capsules 1046 1046 itraconazole 200 mg capsule item1046 1 10 capsules 1047 1047 multivitamin tablet / capsules item1047 1 10 tab / cap 1048 1048 nifedipine 10 mg capsules item1048 1 10 capsules 1049 1049 nifedipine 5 mg capsules item1049 1 10 capsules 1050 1050 omeprazole 20 mg capsules item1050 1 10 capsules 1051 1051 omeprazole and domperidone 20mg+10mg ( capsule ) item1051 1 10 capsules 1052 1052 oseltamivir 30mg capsule item1052 1 10 capsules 1053 1053 oseltamivir 45 mg capsule item1053 1 10 capsules 1054 1054 oseltamivir 75 mg capsule item1054 1 10 capsules 1055 1055 orlistat 120mg capsule item1055 1 10 capsules 1056 1056 pantoprazole 40mg & domperidone 30mg sr capsule item1056 1 10 capsules 1057 1057 pantoprazole 40mg & levosulpride 75mg capsule item1057 1 10 capsules 1058 1058 pregabalin 75 mg + methylcobalamin 750 mcg capsule item1058 1 10 capsules 1059 1059 pregabalin 75mg capsule item1059 1 10 capsules 1060 1060 pregabalin 75mg, nortryptyline 10mg capsule / tablet item1060 1 10 tab / cap 1061 1061 preprobiotic capsule each capsule contains ( streptococcus faccalis 30million, clostridium butyricum 2million, bacillus mesntericus 1million, lactic acid bacillus 50million ) item1061 1 10 capsules 1062 1062 natural micronised progesterone 200 mg ( capsule ) item1062 1 10 capsules 1063 1063 tramadol 50 mg capsules item1063 1 10 capsules 1064 1064 thiocolchicoside 4mg tablet / capsule item1064 1 10 tab / cap 1065 1065 thiocolchicoside 8mg tablet / capsule item1065 1 10 tab / cap 1066 1066 vitamin b complex capsules item1066 1 10 capsules 1067 1067 vitamin a 10000iu capsules item1067 1 10 capsules 1068 1068 vitamin e 400 mg capsules item1068 1 10 capsules 1069 1069 vaginal capsule each capsule contains ( clindamycin 100mg, clotrimazole 100mg, tinidazole 100mg ) capsule item1069 1 10 capsules...

Medical Health And Family Welfare - Rajasthan

25367693 supply of medicine in various branches in govt hospital chittorgarh 2 tab. acelofenac 100mg 3 tab. acelofenac 100mg + serratiopeptidase 10mg 4 tab. acelofenac 100mg + thiocolchicoside 250 mg 5 tab. acyclovir 400 mg 6 tab. albendazole 400mg 7 tab. alprazolam 0.25mg 8 tab. alprazolam 0.5mg 9 tab. alprazolam 0.25mg + propranolol 20mg 10 tab. amlodipine 2.5mg 11 tab. amlodipine 5mg + atenolol 50mg 12 tab. amlodipine besilate 5mg 13 tab. amoxy 250mg + clav. acid 125mg 14 tab. amoxy 500mg + clavulanate 125 mg 15 tab. atenolol 25mg 16 tab. atenolol 50mg 17 tab. atorvastatin 10mg 18 tab. atorvastatin 40mg / 80 mg 19 azithromycin susp. 200mg / 5ml 20 tab. azithromycin 100mg dt 21 tab. azithromycin 250mg 22 tab. calcium 500mg + vit. d3 23 tab. carbamazepine 100mg 24 tab. carbamazepine 200mg 25 tab. cefixime 100mg disp. 26 tab. cefixime 200mg disp. 27 tab. cefpodoxime proxetil 200 mg 28 tab. cefuroxime axetil 250mg 29 tab. cefuroxime axetil 500mg 30 tab. cephalexin 250 mg dt 31 tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg 32 tab. cetrizine 10 mg ( oval ) 33 tab. cinnarizine 25 mg 34 tab. cinnarizine 20 mg + domperidone 15 mg 35 tab.clarithromycin 250 mg 36 tab.clonazepam 0.5mg 37 tab.clopidogrel 75 mg+ aspirin 75mg 38 tab.clopidogrel 75 mg 39 tab. clotrimazole vaginal 40 tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) 41 tab.diazepam 5 mg 42 tab.diclofenac 50mg + serratiopeptidase 10mg 43 tab. dicyclomine 10mg + mefenomic acid 250mg 44 tab. dicyclomine hci 10mg + pcm 500mg 45 tab. dothiepin 75 mg. 46 tab. ethamsylate 500mg 47 tab. ethamsylate inj. 2ml 48 tab. etophylline + theophylline 49 tab. ferrous salt + folic acid 50 tab. fexofenadine 120 mg 51 tab. fluconazole 50 mg 52 tab. fluconazole 150 mg / 200 mg 53 tab. fluoxetine 20 mg 54 tab. folic acid 5 mg 55 tab. frusemide 40 mg 56 tab. glimepiride 1 mg 57 tab. glimepiride 2 mg 58 tab. glimepiride 1 mg + metformin 500 mg 59 tab. glimepiride 2 mg + metformin 500 mg 60 tab. ibuprofen 100mg + pcm 125 mg 61 ibuprofen 400mg + pcm 500mg 62 tab. isosorbide mononitrate 20 mg 63 tab. levofloxacin 500mg 64 tab. lisinopril 5 mg 65 tab. lithium carbonate 300 mg 66 tab. loperamide 2 mg 67 tab. lorazepam 2 mg 68 tab. losartan 25 mg 69 tab. losartan patassium 50 mg 70 tab. losartan pota. 50 mg + amlodipine 5mg 71 tab. losartan potassium. 50 mg + hydroch.12.5mg 72 tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg 73 tab. metformin 500 mg 74 tab. metoclopromide 10 mg 75 tab. nimesulide 100 mg 76 tab. nimesulide 100mg + serratiopeptidase 10mg 77 tab. ofloxacin 200mg 78 tab. ofloxacin + ornidazole 500 mg 79 tab. olanzapine 5 mg 80 tab. ondansetron 4mg 81 tab. ondansetron 8mg 82 tab. ornidazole 500mg 83 tab. pantoprazole 20 mg 84 tab. pantoprazole 40 mg 85 tab. pantoprazole 40 mg + domperidone 10 mg 86 tab. mecobalamin 1500 mcg 87 tab. pheniramine maleate 25 mg 88 tab. phenobarbitone 30 mg 89 tab. phenobarbitone 60 mg 90 tab. pioglitazone 15 mg 91 tab. pioglitazone 30 mg 92 tab. piracetam 800 mg 93 tab. piroxicam disp. 20 mg 94 tab. prazosin 1 mg 95 tab. prazosin 2.5 mg 96 tab. prazosin 5 mg 97 tab. prednisolone 10 mg 98 tab. prochlorperazine 5 mg 99 tab. primaquine phosphate 7.5 mg 100 tab. primaquine phosphate 15 mg 101 tab. promethazine 25 mg 102 tab. quinine sulphate 300 mg 103 tab. rabeprazole 20 mg + domperidone 10 mg 104 tab. rabeprazole 20 mg 105 tab. ramipril 2.5 mg 106 tab. ramipril 5 mg 107 tab. ramipril 10 mg 108 tab. ranitidine 150 mg 109 tab. ranitidine 150 mg + domperidone 10 mg 110 tab. risperidone 2 mg 111 tab. sertaline 25 mg 112 tab. sertaline 50 mg 113 tab. sildenafil 50 mg 114 tab. tramadol hyd. 20 mg + pcm. 500 mg 115 tab. temsulofin 0.4mg 116 tab. sodium valporal 500 mg 117 tab. phenytoin 100 mg 118 tab. ursodil 300 mg 119 tab. thyroxine 100 mg 120 tab. citicolin 500 mg 121 tab. nicoran 5 mg 122 tab. n.t.g. sr 2.6 mg 123 tab. paracetamol 500 mg 124 tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg 125 tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg 126 tab. trypsin chymotrypsin 127 tab. zolpidem 10 mg 128 tab. l orthinh l asprite 129 tab. arither and lumethar ( 400mg ) 130 tab. linezolid 600mg 131 tab. cabergoline 132 tab. itraconazole 100mg / 200mg 133 tab. mefloc 100mg 134 cap. pantoprazole 40 mg + domperidone 30 mg dsr 135 cap. multivitamin + minerals + zinc 136 cap. indomethacin 25 mg 137 cap. indomethacin 75 mg sr 138 lincomycin 139 cap. gabapentin 300 mg + mecobalamine 500 mg 140 cap. aerocort rotacap 141 inj. dexamethasone 142 inj. daizepam 10mg / 2ml 143 inj. diclofenac 144 inj. clavulanate pot. + amoxycillin i 1.2gm 145 inj. dopamine 40mg / ml 146 inj. dobutamine 250mg / 5 ml 147 inj. enoxaparin sodium 60mg 148 inj. etophylline 84.7mg + theophylline 25.3mg / 2ml 149 inj. endoprost 250 mg. 150 inj. frusemide 10mg / 1ml 151 inj. gentamicin 80 mg 40 mg / 1 ml 152 inj. hydrocortisone 100mg 153 inj. hydroxyprogesterone 500 mg 154 inj. lincomycin 1ml 155 inj. lincomycin 2 ml 156 inj. lignocaine hydrochloride 2% vial 157 inj. mecobalamin 500 mcg 158 inj. metronidazole iv ( f.f.s. ) 159 inj. menadione sodium 1 ml 160 inj. metoclopromide 161 inj. multivitamin 10 ml. vial 162 inj. multivitamin 2 ml. amp. 163 inj. nandrolone decanoate 25mg 164 inj. nandrolone decanoate 50mg 165 inj. ondansetron 2 mg / 1ml 166 inj. ondansetron 2 mg / 1ml 167 inj. ornidazole iv 168 inj. oxytocin 5 i.u. / 1 ml 169 inj. pantoprazole 40 mg 170 inj. paracetamol 150 mg / 1 ml 171 inj. pentazocine 30 mg / 1 ml amp. 172 inj. ceftriaxone 1gm 173 inj. ceftriaxone 250mg 174 inj. ceftriaxone 500mg 175 inj. ceftriaxone 250mg. + sulbactum 125 gm 176 inj. ceftriaxone 500mg. + sulbactum 500 mg 177 inj. ceftriaxone 1gm. + sulbactum 500 mg 178 inj. ceftriaxone 1gm. + tazobactum 125 mg 179 inj. anti snake venum 180 inj. artesunate 60 mg 181 inj. ascorbic acid 150 mg. 182 inj. betamethasone 4 mg 183 inj. adrenaline 184 inj. alpha beta arteether 2 ml 185 inj. amikacin 100 mg 186 inj. amikacin 250 mg 187 inj. amikacin 500 mg 188 inj. pheniramine maleate 22.7 mg 189 inj. piperacillin 4 gm + tazobactum 500 mg 190 inj. piroxicam 40 mg 191 inj. ranitidine 192 inj. rabies vaccine ( human ) ( anti ) 193 inj. rabeprazole 20 mg 194 inj. quinine dihydrochloride 195 inj. promethazine 25 mg / ml amp. 196 inj. soda. bi carb 25 ml 197 inj. streptokinase 15 lakh iu 198 inj. tetanus toxoid 199 inj. tobramycin 40 mg 200 inj. tramadol hydrochloride 201 inj. tramadol hydrochloride 202 inj. tranexamic acid 500 mg 203 inj. triamcinolone 40 mg 204 inj. urokinase 5 lakh iu 205 inj. d 5% ( f.f.s. ) 206 inj. d 10% ( f.f.s. ) 207 inj. rl. ( f.f.s. ) 208 inj. d.n.s. ( f.f.s. ) 209 inj. n.s. ( f.f.s. ) 210 inj. alamin sn 211 inj. isolate p ( f.f.s. ) 212 inj. .livofloxacne 213 inj. mannitol 20% ( f.f.s. ) 214 inj. oflaxacin ( f.f.s. ) 215 inj. ornidazole ( f.f.s. ) 216 inj. tirofiban 5mg / 100ml 217 inj. botropase 218 inj. meg. sulf. ( 50% ) 219 inj. naloxone hcl 220 inj. meropannum 125 mg 221 inj. cordarone inj 222 resp. livolin 223 resp. duolin 224 inj. l orthinh l asprite 225 inj. n.t.g. 226 inj. levo sulphride 227 inj. hydrocoritison 200mg 228 inj. envas 229 inj. citicoline 230 inj. piracetam 231 inj. butrum 232 inj. butrum 233 inj. linezolid 234 inj. ceftroxone 235 inj. vitcofol 236 inj. heparin vial 237 inj. erythroptrin 4000 238 inj. pyridoxime 239 inj. pyridoxime 240 inj. anti d 241 inj. diclofenac+dicyclomine 242 inj. pip.+tazo. 243 inj. ct contrast 244 inj. ct contrast 245 inj. hcg 246 inj. hcg 247 syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg 248 syp. dextromethorphan 10 mg + phenyl hcl2 mg 1 2 249 syp. ferrous salt + folic acid 250 syp. ibuprofen 100mg + pcm 125 mg + / 5ml 251 syp. liq.paraffin + milk of magnesia 252 syp. levocetrizine 253 syp. lactulose 10gm / 15 ml 254 syp. magaldrate 480 mg + simeth. 20 mg 255 syp. ofloxacin oral 256 syp. ofloxacin + ornidazole 257 syp. paracetamol 125 mg 258 syp. paracetamol 250 mg 259 syp. pcm + cpm + sod. cit. + pph 260 syp. pcm + promehazine 261 syp. salbutamol 2 mg + ambroxol 30 mg 262 syp. roxithromycin 50 mg / 5 ml 263 syp. sucralfate 1 g / 10 ml 264 syp. terbutaline sul. + bromh. + guaip. 265 syp. disodium hydrogen citrate 266 syp. cotrimoxazole 267 syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg 268 syp. cyprohepatidine + tricholin citrate 269 syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml 270 syp. amoxycillin + clavulanate 271 syp. antacid ( mag.hy. + allum.hy. ) 272 syp. haematinic with vitamins 273 syp. albendazole + ivermectin 274 sup. m.v.+minerals 275 sup. potasium cloride 276 drops. paracetamol 100 mg 277 drops. phenylephrine hyd + cpm. maleate 278 drops. sulphacetamide eye 279 drops. tobramycin 0.3 % eye 280 drops. dexamethasone + chloramphenicol 281 drops. dexamethasone + gentamycin 282 drops. dexamethasone + ofloxacin 283 drops. chloprheniramine + pcm + phenyleph 284 drops. gentamicin eye / ear 285 drops. xylometazoline 0.05% nasal 286 drops. xylometazoline 0.01% nasal 287 lotion. povidone iodine 288 lotion. povidone iodine 289 oint. povidone 290 oint. silver sulphadiazine 291 oint. silver sulphadiazine + chlorhexidin 292 cream. mometasone furoate 293 pregnancy test card 294 protein powder 295 gel. diclofenac 296 gel. clindamycim 1% 297 gel. lignocaine hydrochloride 298 gel. piroxicam 299 gel. c.p. 300 clotrimazole 1 % talcum 301 cream. erythromycin + alov vera 302 cream. fusidic acid + beclometh. dipro. 303 lotion. gamma benzene hexachloride 1 % 304 lotion. calamine 305 lotion. ketoconazole 1 % 306 shampoo. ketoconazole 2 % 307 cream. beclomethasone 0.025% + clotrimazole 1% + 308 cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% 309 cream. acyclovir 310 oint. diclofenac + diethyla + met. sali. +menth + ol. 311 oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% 312 oint. clobetasol 0.05 % + gentamicin 0.1 % 313 oint. miconazole 314 pedia set 315 b.t. set 316 ped. blood doner set 317 blood doner set 318 foleys cathater no. 12 319 foleys cathater no. 14 320 foleys cathater no. 16 321 foleys cathater no. 18 322 urin collection beg 323 infent feeding tube all size 324 gloves all size 6.5, 7, 7.5 325 cord clamp 326 mucas extractor 327 micropore all size 328 proctoclys enema 329 sanitqry pad 1pkt ( 1x10 ) 330 spinal needle all size 331 e.c.g. electrode ( chest lid. ) 332 povidoneiodine solution 100 ml 333 suture silk with needle no. 1.0 length 76 cms 334 suture silk with needle no. 2.0 length 76 cms 335 suture silk with needle cutting 3.0 length 76 cms 336 suture silk with needle cutting 8.0 length 76 337 suture silk 3.0 roun body 338 corrugated drain sheet 339 malecot cathetor no. 28, 30, 32 340 romadrain under waetr seal bag 341 k 90, k 91 cathetor 342 prolin no. 1 length 70 cms 343 polyglyoclic / polyglaction suture no.1 length 90 cms 344 polyglyoclic / polyglaction suture no. 0.1 length90 cms 345 baby kit 346 delivary kit 347 catgut chromic with needle no. 1 length 76 cms 348 catgut chromic with needle no. 1.0 length 76 cms 349 catgut chromic with needle no. 2.0 length 76 cms 350 catgut chromic with needle no. 3.0 length 76 cms 351 polypropylene suture with needle no. 1.0 length 70 cms 352 fast adsorbing polygloctin suture with needle no. 1.0 length 90 cms 353 i.v. set 354 dispo mask 355 o.t. sheet 356 abdominal drain kit 357 flatus tube 358 ryles tube n0. 12, 14, 16, 18 359 suction tube for suction machine 360 i.v. canula 18 , 20 , 22 361 i.v. canula 24, 26 362 dispo syringe 2 ml 363 dispo syringe 3 ml 364 dispo syringe 5 ml 365 dispo syringe 10 ml 366 micro set 367 f.b.n.c. kit ( strelise iso certifyed ) 368 h.i.v. kit ( strelise iso certifyed ) 369 romodrin beg. 370 res. duolin 371 res. budecort 372 fast absorable poliglactin 910 373 vypro mesh 374 cotton roll 375 baby dipper 376 pv gloves 377 orthopaedic cotton roll 378 plaster of paris 379 knife blade 380 dispo 50 cc 381 neb. mask size 0 & 1 andaudlt 382 neonetal kit ( strelise iso certifyed ) 383 oxygen delivery tube with mask 384 nasal prongs for cpap size 0 & 1 385 dispo. e.t tube size 2.5 / 3.0 / 3.5 386 suction canula size 6 / 8 / 10 / 12 387 hand rub 500ml / 5ltr. 388 liquid shope 389 mt fog solution for fogger 390 hypochlorte soln. 391 soln. bacillcid 392 soln. 2% gluparaldehyde 393 cannula fixator 394 dispo syring 395 nebuliser mask child 396 nebuliser mask machine 397 spinal needle 23no. ( pricon ) 398 gallent blade 399 syrgical box 400 liquid o.r.s.packet 401 dispo. gown ( iso ) 402 ortho cotton roll 403 tab. linezolid 600 404 tab. napra d 405 tab.rabiprazole+domperidon d 406 tab. rabiprazole + itopride 407 ing. polybion 2 ml 408 ing. superspas / nobalspas 2ml 409 ing.dilzem 1 ml 410 ing.meropenam 1 gram 411 syp.digsestiv enzyme 200ml 412 tab. itraconzole 100 413 tab. itraconzole 200 414 tab. betahistadin 16 mg 415 tab. superspas / nobalspas 416 ing. xylocain 2% 30ml 417 ing. diclofanic 1ml ( aqua ) 418 ing.natuzam pragestoen 100mg ( 2ml ) 419 syp. mefanic+ peracitamol 60ml 420 syp. mefanic acid 60 ml 421 syp. zinc 60ml 422 powder dexolac 500 gram 423 drop hydroxyzime 15ml 424 syp. hydroxyzime 100 ml 425 drop dizestive+ enzyme 30ml 426 syp. lycopin 200ml 427 sachat vitamin d3 428 ing. b. complex 2ml 429 syp. liver tonice 200ml 430 ing.liycomicen 1 ml 431 ing. liycomicen 2 ml 432 cap. progeston 200 mg 433 cap. progeston 300 mg 434 tab. spiromicyn 500mg 435 cap.vitamin e 400 mg 436 tab. ursodeoxycholic 75 mg 437 tab. ursodeoxycholic 150 mg 438 drop. vitamin d 3 30ml 439 ing. hucog 5000 iu 440 ing. cefrin plus 375 mg 441 ing. cefrine plus 750 mg 442 ing. merasure 125 mg 443 syp. pre probiotic 60ml 444 oil vitamin ad 60ml 445 ing. drotavarin 2ml 446 syp. chery 200 ml 447 syp. polybion 100ml 448 syp. bpricilne 100ml 449 tab. normaxin 10 mg 450 syp. longifene 200ml 451 cervical color 452 venoline set 453 crepe bendage 6 inch 454 crepe bendage 8 inch 455 crepe bendage 10 inch 456 ing. velthamate 2ml 457 ing. buscogast 2ml 458 syp. racecortodil+ofloxacin 60ml 459 syp. multvitamin+antioxidant 200ml 460 syp.cefuroxime 60ml 461 syp. cepodoxim+clavonate 30 ml 462 syp. arthmether+lumither 30 ml 463 ing.montaz 250mg 464 ing.cefepime 500mg 465 drop.fungal distare+ papsine 15 ml 466 drop.chlolcicolchpherol 30ml 467 syp. levocetrizine + montelokast 60ml 468 drop. lactac enzyme 15 ml 469 ing. calcicem sandoz 10ml 470 malt protin +multi vitamin 250 gram 471 ing. netilmican 10mg 472 ing. netilmican 25mg 473 ing. netilmican 50mg 474 ing. amoxiclav 150mg ( amoxiclove ) 475 ing.c amoxiclav 300mg ( amoxiclove ) 476 tab. lycopin+multi vitamin 477 tab. tranexamic+etamcylate 478 tab. tranexamic+mefanic acid 479 sachet powder prebioatic+ lactic acid 1 gram 480 ing. ceftzoxon+tezbactm 281.25mg 481 ing. ceftzoxon+tezbactm562.50 mg 482 ing. pipzo 1.125 mg 483 tab. diclofenic+chymotripcin 484 powder arginine 5 gram 485 ing.ampoxin / megapain 250 mg 486 ing. ampoxin / megapain 500 mg 487 ing. ampoxin / megapain 1 gm 488 ing.oxytocin 1 mg 489 mop ped 490 syp. health ok 100ml 491 ing. mefentermin 10 ml 492 swine flue vaccine .5 ml 493 swine flue vaccine 5 ml 494 bp instrument ( mercury ) diamond / pagoda 495 n 95 mask 496 ppe kit iso certified 497 black googles for catractract operation 498 r.l. 500 ml ( glass bottle ) 499 n.s. 500 ml ( glass bottle ) 500 n.s. 100 ml 501 inj. tazar 4.5 mg 502 tab. l.n.z. 600 mg 503 tab. ferobact 200 mg 504 tab. ferobact 300 mg 505 drop. atarex 506 tab. nynes 507 inj. acuclav / agclav / mega cv 150 mg 508 inj. acuclav / agclav / mega cv 300 mg 509 tab. chymoral plus 510 tab. chymoral fort 511 syp. moxclav / mega cv 60 ml 512 syp. moxclav / mega cv 30 ml 513 drop. moxclav / mega cv 15 ml 514 tab. enzoflam 515 sachet agysee d 516 syp. piclin 100 ml 517 inj. clindmicin 2ml 518 inj. termin 519 syp. amrodil s / solvin ls / trendil x 60 ml 520 syp. solvin cold / reconite / sinerest 60 ml 521 ot gown 522 disposable ot gown 523 inj.methargin 2ml 524 b.p. cuff ( rubber & cloth ) 525 b.p. bulb 526 fetal doppler 527 needle cutter ( 1000 ml capacity ) 528 inj. glargine 529 inj. h.insulin 530 inj. human mixtard 30 / 70 531 inj. phenytion 532 inj. levi taretam 533 inj. nor adrenaline 534 inj. dopanine 535 inj. dobutamine 536 triple layer mask with nose pin 537 n 95 mask 538 sanitizer...

Rajasthan University Of Health Science - Rajasthan

24693213 annual rate contract for supply and installation of various chemicals and regents and consumable items for department of microbiology 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 albert’s stain (a+b each) 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbe ab elisa test 13 anti hbs antibody elisa test kit 14 antinuclear antibody (ana) elisa kit 15 autoclave indicator strip 16 biodegradable plasic bags (yellow, red, blue, black) 17 bleaching powder 18 blood agar base 19 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 20 brain heart infusion broth 21 chikungunya rapid test kit for igm 22 chlamydia trachomatis igm elisa kit 23 cled media 24 conc. h2so4 25 corn meal agar 26 cover slips 22 x 22 mm 27 crp test kit 28 cytomegalovirus (cmv) igg elisa kit 29 cytomegalovirus (cmv) igm elisa kit 30 deionized water 31 dengue ns1 antigen elisa kit 32 dengue rapid test card 33 dengue rapid test card along with ns1 antigen 34 deoxycholate citrate agar 35 di sodium hydrogen phosphate 36 discarding plastic buckets (yellow, red, blue, black) 20 litre 37 disposable individually packed centrifuge tube conical bottom capacity 50 ml 38 disposable polythene gloves 39 disposable sterile test tube with swab individually packed 40 dubos medium 41 ecoshield 42 edta powder 43 face mask 44 ferric chloride 45 filter paper box whartman no. 1, 12.5 cm circular 46 filter paper sheet whartman no. 1 47 fluid thioglycollate broth (anaerobic) with indicator 48 formalin pellets 49 glass marking pencils (red, white) 50 glass test tube 100 mm x 12 mm without rim 51 glass test tube 75 mm x 12 mm without rim 52 h2o2 (30%) 53 hav igm elisa kit 54 hcv igm elisa kit 55 hev igm elisa kit 56 koh pellets 57 kovcks indole reagents 58 l arginine 59 l lysine mono dihydrochloride 60 lactophenol cotton blue solution 61 liquid paraffin 62 loeffler serum medium base bovine serum 63 lowenstein jensen medium 64 macconkey agar 65 macconkey broth 66 malaria rapid test card (antigen) 67 maltose 68 mannitol 69 mannitol salt agar 70 mccartney bottle 71 methyl red powder 72 microcentrifuge tube with cap capacity 2 ml 73 mr vp medium (glucose phosphate broth) 74 muller hinton agar 75 n acetyl l cysteine 76 n naphthyl ethylene diamine dihydrochloride 77 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 78 nigrosin 10% 79 nutrient agar 80 oxacillin powder 81 oxidase disc 82 peptone water 83 perforated bucket (red, blue) 15 litre double bin 84 petridish glass 100 mm 85 petridish glass 75 mm 86 ph indicator strips 6.5 to 9 ph measurement 87 phenol 88 pottasium dihydrogen phosphate 89 pregnancy test card 90 ra factor kit 91 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 92 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 93 robertson cooked meat medium readymade 94 rpr rapid test card 95 sabraud’s dextrose agar 96 selenite f broth bacteriological 97 sim agar 98 simmons citrate agar 99 sodium chloride 100 sodium hydroxide pellets 101 sodium hypochlorite solution 102 sterile autoclavable skirted plate 96 wells x 0.3 ml 103 sterile readymade plates of blood agar (90 mm size) 104 sterile readymade plates of macconkey agar (90 mm size) 105 sterile readymade plates of nutrient agar (90 mm size) 106 sterile storage vial 2 ml capacity 107 sterile storage vial 5 ml capacity 108 sterile transport medium (stuart medium) with test tube and swab individually packed 109 stool container with spoon 110 sulphanilamide 111 tcbs 112 triple layer mask disposable 113 trypticase soya broth 114 tsi agar 115 urea agar base 116 viral transport medium with dacron swab (d/s 2 nos. each vtm tube 117 widal slide test 118 wilson and blair medium 119 xylene 120 xylose 121 ds dna elisa kit 122 gram stain kit 123 hbeag elisa kit 124 herpes simplex virus (hsv 1 & 2) igg elisa kit 125 herpes simplex virus (hsv 1 & 2) igm elisa kit 126 resazurin powder 127 rubella igg elisa kit 128 rubella igm elisa kit 129 sterile readymade plates of dca (90mm size) 130 sterile readymade plates of tcbs (90mm ) 131 toxoplasma igg elisa kit 132 scrb typhus igm elisa kit 133 toxoplasma igm elisa kit 134 vancomycin powder 135 vancomycin disc 136 amikacin 30 µg 137 amoxycillin 30 µg 138 amoxyclav 20/10 µg 139 amphotericin b 140 ampicillin + sulbactum 141 azithromycin 15 µg 142 aztreonam 30µg 143 bacitracin (0.04 unit) 144 bile esculin disc 145 cefepime 30 µg 146 cefixime 5 µg 147 cefoperazone + sulbactum 75/10 µg 148 cefoperazone 75 µg 149 cefotaxime 30 µg 150 cefotetan 151 cefoxitin 30 µg 152 cefpirome 153 cefpodoxime 10 µg 154 ceftazidime + clavulanic acid 30/10µg 155 ceftazidime 30 µg 156 ceftriaxone 30 µg 157 cefuroxime 30 µg 158 cephalexin 30 µg 159 chloramphenicol 30 µg 160 ciprofloxacin 5 µg 161 clarithromycin 15 µg 162 clindamycin 2 µg 163 clotrimazole 164 colistin 165 cotrimoxazole 25 µg 166 cyclopirox 50 µg 167 dalfopristine 168 daptomycin 169 doripenam 10µg 170 doxycycline 30 µg 171 e strip for esbl detection 172 e strip for mbl detection 173 e strip oxacillin 174 ertapenam 10µg 175 erythromycin 10 µg 176 faropenam 177 fluconazole 25 µg 178 fosfomycin 200 µg 179 furazolidone 50 µg 180 fusidic acid 181 gentamicin 120µg 182 gentamicin 30µg 183 gentamycin 10 µg 184 griseofulvin 10 µg 185 hippurate 186 imipenam 10 µg 187 itraconazole 8 µg 188 kanamycin 189 ketoconazole 15 µg 190 levofloxacin 5µg 191 lincomycin 10 µg 192 linezolid 30 µg 193 meropenam 10 µg 194 miconazole 10 µg 195 moxalactum 196 nalidixic acid 30µg 197 netilmycin 30 µg 198 nitrofurantoin 300 µg 199 norfloxacin 10 µg 200 novobiocin 201 nystatin 202 ofloxacin 5 µg 203 onpg 204 optochin 205 oxacillin 1 µg 206 piperacillin + tazobactum 100/10 µg 207 piperacillin 100 µg 208 polymyxin b 30 units 209 pristinomycin 15µg 210 quinopristin 211 teicoplanin 30 µg 212 terbinafine 1 µg 213 tetracycline 30 µg 214 ticarcillin+clavulanic acid 75/10 µg 215 ticarcillin75µg 216 tigecyclin 15µg 217 tobramycin 10 µg 218 v factor 219 vancomycin 30 µg 220 voriconazole 1 µg 221 x + v factor 222 x factor 223 immersion oil 224 occuet blood on stool kit hemoccult sensa aninophezone test 225 hcv igm rapid card 226 micro pipette tips 200 micro liter 227 micro pipette tips 1000 micro liter 228 micro pipette tips 10 micro liter ...

Medical And Health Services - Rajasthan

24641667 supply of medicines, iv fluids & surgical item tab acclofenac sust, tab acyclovir, cream acyclovir , inj adrenalne, albendazol, inj alpha beta, cap. alphalipoic acid, tab alprazolam, syp ambroxol, inj amikacin, tab amlodipine, cap amoxicillin, inj antisnake venum, tab artsunate, tab. atrovastatin, sustp. azithromycin, syp b complex, cap b.com+vit c+ mecobala, beclomethasone, tabl betathistidine dihyrocloride, lotion calamine, syp calcium gluco, tav calcium, syp celixime, disp tab cefixino, inj cefirixone, tav cetrizine, tap centrizine, cap chloromphenco, syp chlorphe, tap ciprofloxacin, eye drop ciprofoxcin, gel clindamycim, tab clanazepam, talcum chlotrimazol, tab dicyclomine, syp domperidone, syp levocetrizine, tab levofloxacin, lignocaine hydrochloride gel, cap lincomycin, tab losartan potassium, tab mettromin, tab nifedipe, inj oxytocin, drop paracetamol, syp paracetamol, tap pantopnazole, cap pantopnazole, tap phenobarbitone, inj piperacillin, tab piroxicicam, lotion povidone iodine, tab nifedipine, inj vitamin, inj human anti d immunoglobulin, nij atropin, inj ketamine, inj bupivacaine, cap doxycllin, i.v fluid inj ciprofloxacin, inj dgw, inj dextrose,inj levofloxacin, inj mannitol, inj ns, inj amino cid, inj hydralazine, inj. hemocele, surgical item abdominal belt, blood transfusion set, breast pup, cord clamp, cotton, crape bandage, dispo syringle, foleyes catheter, iv set, micro iv se, mucus, sucker, needle, paper tape, pedia set, polythene gloves, pop bandage, procto glysis, k 90 catherter, remo drain bag, ryles tubs, sv set, sanitary pad, sodium bycarb, spinal needle, suction set, surgical gloves, urine bag, povidon iodine solution, cap/mask, cervical coller, g dress, urine pot, surgical spirit, crape bandage, rib belt, ortho roll, ng tube, suction tube, knee cap large, endotrachial tube, nebulization mask, pouch arm sling, mesh, baby kit, bad pan, walker, dyper large, cervical brass, wrist support, thumb support, hammer, hommans retractor, bone holdng forceps, paterlla, clamp, drill bit, t handle, bone marreo neddle, water tube for plaster, implants small dcp, locking bolt, narrow dcp, screw, locking screw, wire, dyna plast c arm immager machine, screw driver, connecting rodes, shanzs pin, oliv, wire, universal clamps,. spanner, ioban, suction tube, mouth mirror tops, gic resto, temp restoative, dental x ray films, oil spray, h file, burs diamond, burs, hand protaper files, suction tip, etchent, boinding agent, matrix band, composite, zno euginal etc ...

Government Medical College - Rajasthan

24594110 supply of drug medicine 1 1 3rd generation recombinant f viii 250 iu with diluent item1 1 nos 2 2 3rd generation recombinant f viii 1000 iu with diluent item2 1 nos 3 3 aceclofenac and paracetamol tablet 100 mg + 325 mg item3 1 nos 4 4 acenocoumarol tablet 2 mg item4 1 nos 5 5 acetazolamide tablet 250 mg item5 1 nos 6 6 act kit containing 3 tablet of artesunate (100 mg each) and 1 tablet of sulphadoxine pyremethamine (750 + 37.5) mg item6 1 nos 7 7 act kit containing 3 tablet of artesunate (50mg each) and 1tablet of sulphadoxine pyremethamine (500+25) mg item7 1 nos 8 8 act kit containing 3 tablet of artesunate (each 200 mg) and 2 tablet of sulphadoxine pyremethamine (750 + 37.5) mg each or 3 tablet sulphadoxine pyremethamine (500+25) mg each item8 1 nos 9 9 act kit containing 3 tablet of artesunate (each tablet of artesunate 25mg strength) and 1 tablet of sulphadoxine pyremethamine (250 mg+ 12.5 mg) item9 1 nos 10 10 act kit containing 3 tablet of artesunate 150 mg and 2 tablet of sulphadoxine pyremethamine (500 mg+ 25 mg) item10 1 nos 11 11 acyclovir cream 5% item11 1 nos 12 12 acyclovir eye ointment ip 3% w/w 5gm size item12 1 nos 13 13 acyclovir injection 250 mg item13 1 nos 14 14 acyclovir injection 500 mg item14 1 nos 15 15 acyclovir suspension 400 mg/ 5ml item15 1 nos 16 16 acyclovir tablet 200 mg item16 1 nos 17 17 acyclovir tablet 800 mg item17 1 nos 18 18 adenosine injection 6 mg/2ml item18 1 nos 19 19 adrenaline injection 1 mg/ml item19 1 nos 20 20 albendazole oral suspension 400 mg/ 10 ml item20 1 nos 21 21 albendazole tablet ip 400 mg item21 1 nos 22 22 alendronate sodium tablets usp/bp 35 mg item22 1 nos 23 23 allopurinol tablet 100 mg item23 1 nos 24 24 alpha interferon injection 3 million unit item24 1 nos 25 25 alprazolam tablet 0.25 mg item25 1 nos 26 26 alprazolam tablet 0.5 mg item26 1 nos 27 27 amikacin injection 100 mg item27 1 nos 28 28 amikacin injection 500 mg item28 1 nos 29 29 amikacin injection 250 mg item29 1 nos 30 30 aminophylline injection 25 mg/ml item30 1 nos 31 31 amiodarone tablet 100 mg item31 1 nos 32 32 amiodarone tablet 200 mg item32 1 nos 33 33 amiodarone hydrochloride injection 50 mg/ml item33 1 nos 34 34 amitriptyline tablets ip 25 mg item34 1 nos 35 35 amlodipine and atenolol tablet 5 mg +50 mg item35 1 nos 36 36 amlodipine and enalapril maleate tablet 5 mg +5mg item36 1 nos 37 37 amlodipine and lisinopril tablet 5mg +5 mg item37 1 nos 38 38 amlodipine tablet ip 2.5 mg item38 1 nos 39 39 amlodipine tablet 5 mg item39 1 nos 40 40 amoxicillin and clavulanic acid injection 600 mg item40 1 nos 41 41 amoxicillin and potassium clavulanate injection 1.2 gm item41 1 nos 42 42 amoxycillin & clavulanic acid syrup 200 mg + 28.5 mg / 5 ml item42 1 nos 43 43 amoxycillin and cloxacillin capsule 250 mg + 250 mg item43 1 nos 44 44 amoxycillin and potassium clavulanate tabs 500 mg + 125 mg item44 1 nos 45 45 amoxycillin capsule 250 mg item45 1 nos 46 46 amoxycillin capsule 500 mg item46 1 nos 47 47 amoxycillin oral suspension (dry syrup) 125 mg/5ml item47 1 nos 48 48 amoxycillin trihydrate dispersible tablet 125 mg item48 1 nos 49 49 amphotericin b injection 50 mg item49 1 nos 50 50 ampicillin capsule 500 mg item50 1 nos 51 51 ampicillin injection ip 500 mg item51 1 nos 52 52 antacid liquid item52 1 nos 53 53 antacid tablet item53 1 nos 54 54 anti a blood grouping serum (anti a monoclonal serum ip) item54 1 nos 55 55 anti b blood grouping serum item55 1 nos 56 56 anti drh blood grouping serum item56 1 nos 57 57 anti inhibitor coagulation complex [human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per nvial 500 iu] item57 1 nos 58 58 anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml item58 1 nos 59 59 artemether + leumefantrine tablet (40 mg and 240 mg) item59 1 nos 60 60 artemether + leumefantrine tablet (80 mg and 480 mg) item60 1 nos 61 61 artisunate injection 60 mg (combo pack with 1 ml ampoule ofn5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection) item61 1 nos 62 62 ascorbic acid tablet 500 mg item62 1 nos 63 63 aspirin tablet ip (gastro resistant) 150 mg item63 1 nos 64 64 aspirin delayed release tablet (enteric coated) 75 mg item64 1 nos 65 65 atenolol tablet 25 mg item65 1 nos 66 66 atenolol tablet 50 mg item66 1 nos 67 67 atorvastatin tablet 10 mg item67 1 nos 68 68 atorvastatin tablet 40 mg item68 1 nos 69 69 atracurium injection 10 mg/ml item69 1 nos 70 70 atropine eye ointment 1% item70 1 nos 71 71 atropine sulphate injection 0.6 mg/ml item71 1 nos 72 72 atropine sulphate ophthalmic solution usp 1% item72 1 nos 73 73 azathioprine tablet ip 50 mg item73 1 nos 74 74 azithromycin tablet (dt) 100 mg item74 1 nos 75 75 azithromycin tablet 500 mg item75 1 nos 76 76 azithromycin tablet ip 250 mg item76 1 nos 77 77 aztreonam 1gm injection item77 1 nos 78 78 aztreonam injection 500 mg item78 1 nos 79 79 beclomethasone inhalation 200 mcg/ dose item79 1 nos 80 80 beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% item80 1 nos 81 81 benzathine benzylpenicillin injection 6 lac units item81 1 nos 82 82 benzathine benzylpenicillin injection ip12 lac units item82 1 nos 83 83 betahistine tablet ip 8 mg item83 1 nos 84 84 betahistine tablet ip 16 mg item84 1 nos 85 85 betamethasone dipropionate cream 0.05% item85 1 nos 86 86 betamethasone lotion 0.05% item86 1 nos 87 87 betamethasone sodium phosphate injection 4 mg/ml item87 1 nos 88 88 betamethasone tablet 0.5 mg item88 1 nos 89 89 betaxolol eye drops 0.50% item89 1 nos 90 90 biphasic isophane insulin injection 30 / 70 (30% soluble insulin & 70% isophane insulin) 40 iu / ml item90 1 nos 91 91 bisacodyl tablet 5 mg item91 1 nos 92 92 black disinfectant fluid (phenyl)n(as per schedule o grade iii item92 1 nos 93 93 bleomycin injection 15 units item93 1 nos 94 94 brimonidine tartrate and timolol eye drops 0.15% + 0.5% item94 1 nos 95 95 bromocriptine mesylate tablet 2.5 mg item95 1 nos 96 96 budesonide nebulizer suspension 0.25 mg/ml item96 1 nos 97 97 budesonide rotacap 200 mcg item97 1 nos 98 98 bupivacaine hydrochloride in dextrose injection 5mg + 80 mg per ml item98 1 nos 99 99 bupivacaine injection 0.50% item99 1 nos 100 100 calamine lotion ip item100 1 nos 101 101 calcitriol capsule 0.25 mcg item101 1 nos 102 102 calcium & vitamin d3 tablet 500 mg + 250 iu item102 1 nos 103 103 calcium & vitamin d3 suspensionn (each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu) item103 1 nos 104 104 calcium gluconate injection 10% item104 1 nos 105 105 cap thalidomide usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) item105 1 nos 106 106 cap. vitamin e 400 mg item106 1 nos 107 107 capsule procarbazine hydrochloride usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) item107 1 nos 108 108 capsule lomustine ip 40 mg (each capsule contains lomustine ip 40 mg) item108 1 nos 109 109 capsule mycophenolate mofetil usp 250 mg (each capsule conatin mycophenolate mofetil usp 250 mg) item109 1 nos 110 110 capsule tacrolimus ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) item110 1 nos 111 111 capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) item111 1 nos 112 112 carbamazepine tablet 200 mg item112 1 nos 113 113 carbamazepine tablet ip 100 mg item113 1 nos 114 114 carbamazepine oral suspension usp 100 mg/5 ml item114 1 nos 115 115 carbimazole tablet 5 mg item115 1 nos 116 116 carboplatin injection 150mg item116 1 nos 117 117 carboplatin injection 450mg item117 1 nos 118 118 carboprost tromethamine injection 0.25 mg/ml item118 1 nos 119 119 carboxymethylcellulose sodium lubricant eye drops 0.50% item119 1 nos 120 120 cefepime injection 500 mg item120 1 nos 121 121 cefixime oral susp (drops) 25 mg/ml item121 1 nos 122 122 cefixime tablet 100 mg item122 1 nos 123 123 cefixime tablet 200 mg item123 1 nos 124 124 cefoperazone and sulbactum for injection 1 g + 0.5 g item124 1 nos 125 125 cefotaxime injection 1 g item125 1 nos 126 126 cefotaxime injection 250 mg item126 1 nos 127 127 cefpodoxime dispersible tablet 50 mg item127 1 nos 128 128 ceftazidime injection 1 g item128 1 nos 129 129 ceftazidime injection 250 mg item129 1 nos 130 130 ceftazidime injection 500 mg item130 1 nos 131 131 ceftriaxone injection 250 mg item131 1 nos 132 132 ceftriaxone injection ip 1 g/vial item132 1 nos 133 133 ceftriaxone injection ip 500 mg/vial item133 1 nos 134 134 cefuroxime tablet 250 mg item134 1 nos 135 135 cephalexin capsule 250 mg item135 1 nos 136 136 cephalexin capsule ip 500 mg item136 1 nos 137 137 cephalexin oral suspension ( cephalexin dry syrup) 125 mg/ 5ml item137 1 nos 138 138 cephalexin tablet (dt) 125 mg item138 1 nos 139 139 cetirizine syrup 5 mg/ml item139 1 nos 140 140 cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg item140 1 nos 141 141 cetrimide cream ip 0.50% item141 1 nos 142 142 chlorambucil tablet 5 mg item142 1 nos 143 143 chloramphenicol 1% w/w eye ointment ip, 3gm size item143 1 nos 144 144 chloramphenicol eye drops 0.05% item144 1 nos 145 145 chlorhexidine gluconate solution 5% item145 1 nos 146 146 chlorhexidine mouthwash bp 0.20% item146 1 nos 147 147 chloridazepoxide tablets ip 10 mg item147 1 nos 148 148 chloroquine phosphate injection 40 mg/ml item148 1 nos 149 149 chloroquine phosphate suspension 50 mg/ 5ml item149 1 nos 150 150 chloroquine phosphate tablet 250mg n(=155 mg of chloroquine base) item150 1 nos 151 151 chlorpheniramine maleate tablet 4 mg item151 1 nos 152 152 chlorpromazine injection ip 25 mg/ml item152 1 nos 153 153 chlorpromazine tablets ip 100 mg item153 1 nos 154 154 chlorpromazine tablets ip 50 mg item154 1 nos 155 155 chlorpromazine tablets ip 25 mg item155 1 nos 156 156 chlorzoxazone, diclofenac sodium & paracetamol tablet 250mg+50mg+325 mg item156 1 nos 157 157 cholecalciferol granules 60,000 iu /1gm item157 1 nos 158 158 cinnarizine tablet ip 25 mg item158 1 nos 159 159 cinnarizine tablet ip 75 mg item159 1 nos 160 160 ciprofloxacin and dexamethasone ear drops 0.3% + 0.1% item160 1 nos 161 161 ciprofloxacin eye drops 0.30% item161 1 nos 162 162 ciprofloxacin injection 200 mg/ 100 ml item162 1 nos 163 163 ciprofloxacin ophthalmic ointment 0.30% item163 1 nos 164 164 ciprofloxacin tablet 250 mg item164 1 nos 165 165 ciprofloxacin tablet 500 mg item165 1 nos 166 166 cisplatin injection 10 mg/10 ml item166 1 nos 167 167 cisplatin injection 50 mg/ 50 ml item167 1 nos 168 168 clindamycin capsule 150 mg item168 1 nos 169 169 clindamycin capsule 300 mg item169 1 nos 170 170 clindamycin phosphate gel usp 1% item170 1 nos 171 171 clobazam tablet/capsule 10 mg item171 1 nos 172 172 clobazam tablet/capsule 5 mg item172 1 nos 173 173 clobetasol cream 0.05% item173 1 nos 174 174 clomiphene tablet 50 mg item174 1 nos 175 175 clomiphene tablet ip 25 mg item175 1 nos 176 176 clonazepam tablet 0.5 mg item176 1 nos 177 177 clopidogrel and aspirin tablet 75 mg + 75 mg item177 1 nos 178 178 clopidogrel tablet ip 75 mg item178 1 nos 179 179 clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops item179 1 nos 180 180 clotrimazole cream ip 2% w/w item180 1 nos 181 181 clotrimazole mouth paint (clotrimazole 1% w/v) 1% item181 1 nos 182 182 clotrimazole vaginal tablet 500 mg item182 1 nos 183 183 cloxacillin sodium injection 500 mg item183 1 nos 184 184 coal tar 6% & salicylic acid 3% onitment item184 1 nos 185 185 compound benzoin tincture ip item185 1 nos 186 186 compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% item186 1 nos 187 187 compound sodium lactate injection item187 1 nos 188 188 concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans item188 1 nos 189 189 conjugated estrogen tablet 0.625 mg item189 1 nos 190 190 co trimoxazole oral suspension 40 mg + 200 mg per 5ml item190 1 nos 191 191 co trimoxazole tablet 160 mg + 800 mg item191 1 nos 192 192 co trimoxazole tablet 40 mg + 200 mg item192 1 nos 193 193 cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] item193 1 nos 194 194 cough syrup/ expectorant (ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg item194 1 nos 195 195 cream mupirocin usp 2% (each gram contains 21.5 mg n mupirocin calcium usp in a mineral oil cream base) 15 gm size item195 1 nos 196 196 cyclophosphamide injection 200 mg item196 1 nos 197 197 cyclophosphamide injection ip 500 mg item197 1 nos 198 198 cyclosporine capsule usp 50 mg item198 1 nos 199 199 cytarabine injection 100 mg/5 ml item199 1 nos 200 200 dacarbazine injection 500 mg item200 1 nos 201 201 danazol capsule ip 50 mg item201 1 nos 202 202 daunorubicin injection 20 mg item202 1 nos 203 203 deferasirox tablet 100 mg item203 1 nos 204 204 deferasirox tablet 500 mg item204 1 nos 205 205 deferiprone capsule 250 mg item205 1 nos 206 206 deferiprone capsule 500 mg item206 1 nos 207 207 dental gel: choline salicylate + benzalkonium + lignocaine 8.75% item207 1 nos 208 208 desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % item208 1 nos 209 209 desferrioxamine injection (for i.m. inj and i.v., s.c. infusion)n 500 mg item209 1 nos 210 210 dexamethasone injection 8 mg/2ml item210 1 nos 211 211 dexamethasone tablet 0.5 mg item211 1 nos 212 212 dextromethorphan hydrobromide syrup 13.5 mg/ 5ml item212 1 nos 213 213 dextrose injection 25% item213 1 nos 214 214 dextrose injection 10% item214 1 nos 215 215 dextrose injection 5% item215 1 nos 216 216 diagnostic sticks for multiple use strip (sugar, ketone, albumin) item216 1 nos 217 217 diagnostic stip for sugar, ketone item217 1 nos 218 218 diagnostic stip for sugar, protein item218 1 nos 219 219 diatrizoate meglumine and diatrizoate sodium inj usp 60% (iodine conc. 292 mg/ml) 60% item219 1 nos 220 220 diatrizoate meglumine and diatrizoate sodium inj uspn76%w/v (iodine conc. 370 mg/ml) 76% item220 1 nos 221 221 diazepam injection 10 mg/ 2ml item221 1 nos 222 222 diazepam tablet 5 mg item222 1 nos 223 223 diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% item223 1 nos 224 224 diclofenac sodium and paracetamol tablet 50 + 325 mg item224 1 nos 225 225 diclofenac sodium injection for im and iv 25 mg/ml item225 1 nos 226 226 diclofenac sodium tablet 50 mg item226 1 nos 227 227 diclofenac tablet (sr) 100 mg item227 1 nos 228 228 dicyclomine injection 10 mg/ml item228 1 nos 229 229 dicyclomine tablet 10 mg item229 1 nos 230 230 dicyclomine and paracetamol tablet 20mg + 325mg item230 1 nos 231 231 dicyclomine hydrochloride and activated dimethicone suspension n10mg + 40mg per ml item231 1 nos 232 232 dicyclomine hydrochloride oral solution ip10 mg/5ml item232 1 nos 233 233 diethylcarbamazine tablets ip 100 mg item233 1 nos 234 234 digoxin injection 0.25 mg/ml item234 1 nos 235 235 digoxin tablet 0.25 mg item235 1 nos 236 236 diltiazem tablet 30 mg item236 1 nos 237 237 dinoprostone cream 0.5 mg item237 1 nos 238 238 diphtheria antitoxin 10,000 iu item238 1 nos 239 239 dobutamine injection 50 mg/ml item239 1 nos 240 240 domperidone oral drops 10 mg/ ml item240 1 nos 241 241 domperidone suspension 5 mg/ 5ml item241 1 nos 242 242 domperidone tablet 10 mg item242 1 nos 243 243 dopamine hydrochloride injection 40 mg/ml item243 1 nos 244 244 doxorubicin injection 50 mg/ 25 ml item244 1 nos 245 245 doxycycline capsule 100 mg item245 1 nos 246 246 dried factor viii fraction (iv use) 1000 iu item246 1 nos 247 247 dried factor viii fraction (iv use) 250 iu item247 1 nos 248 248 dried factor viii fraction (iv use) 500 iu item248 1 nos 249 249 drotaverine & mefenamic acid tablet 80 mg + 250 mg item249 1 nos 250 250 drotaverine hydrochloride injection 40 mg/2ml item250 1 nos 251 251 drotaverine tablet 40 mg item251 1 nos 252 252 enalapril maleate tablet 10 mg item252 1 nos 253 253 enalapril maleate tablet 2.5 mg item253 1 nos 254 254 enalapril maleate tablet 5 mg item254 1 nos 255 255 enoxaparin sodium injection 60 mg item255 1 nos 256 256 escitalopram tablets ip 10 mg item256 1 nos 257 257 ethamsylate injection 250 mg/ 2ml item257 1 nos 258 258 ethinyloestradiol tablet ip 50 mcg item258 1 nos 259 259 etoposide injection 100 mg/ 5 ml item259 1 nos 260 260 etoricoxib tablet 90 mg item260 1 nos 261 261 etoricoxib tablet ip 120 mg item261 1 nos 262 262 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size item262 1 nos 263 263 factor – ix concentrate 600 iu item263 1 nos 264 264 fenofibrate capsule 200 mg item264 1 nos 265 265 fentanyl citrate injection 50 mcg/ml item265 1 nos 266 266 fentanyl citrate injection 50 mcg/ml item266 1 nos 267 267 feracrylum 1% w/w sterile solution 100 ml item267 1 nos 268 268 ferrous sulphate and folic acid tablet 100 mg + 0.5 mg item268 1 nos 269 269 ferrous sulphate with folic acid tab.(paediatric) 20 mg + 0.1 mg item269 1 nos 270 270 filgrastim injection 300mcg/ml item270 1 nos 271 271 finasteride tablet 5 mg item271 1 nos 272 272 flavoxate tablet 200 mg item272 1 nos 273 273 fluconazole eye drops 0.3% item273 1 nos 274 274 fluconazole tablet 150 mg item274 1 nos 275 275 flunarizine tablet 5 mg item275 1 nos 276 276 fluorouracil injection 250 mg/ 5 ml item276 1 nos 277 277 fluoxetine capsule ip 20 mg item277 1 nos 278 278 flurbiprofen sodium ophthalmic solution 0.03% item278 1 nos 279 279 folic acid tablet ip 5 mg item279 1 nos 280 280 formaldehyde solution (34.5% 38%) item280 1 nos 281 281 formoterol & budesonide rotacap 6 mcg+ 200 mcg item281 1 nos 282 282 framycetin sulphate cream 1% item282 1 nos 283 283 framycetin sulphate cream 1% item283 1 nos 284 284 furosemide injection 10 mg/ml item284 1 nos 285 285 furosemide tablet 40 mg item285 1 nos 286 286 fusidic acid cream 2% item286 1 nos 287 287 gabapentine tablet/capsule 100 mg item287 1 nos 288 288 gabapentine tablet/capsule 300 mg item288 1 nos 289 289 gadodiamide injection 0.5 mmol/ml item289 1 nos 290 290 gamma benzene hexachloride lotion(lindane lotion usp) 1% item290 1 nos 291 291 gemcitabine injection 1gm item291 1 nos 292 292 gemcitabine injection 200 mg item292 1 nos 293 293 gentamycin injection 80 mg/2ml item293 1 nos 294 294 gentian violet topical solution usp 1% item294 1 nos 295 295 glibenclamide and metformin hydrochloride (sr) tablet 5 mg + 500 mg item295 1 nos 296 296 glibenclamide tablet 5 mg item296 1 nos 297 297 gliclazide and metformin tablet 80 mg + 500 mg item297 1 nos 298 298 gliclazide tablets ip 40 mg item298 1 nos 299 299 glimepiride tablet 1 mg item299 1 nos 300 300 glimepiride tablet 2 mg item300 1 nos 301 301 glimepiride, pioglitazone and metformin hydrochloride (sr) tablet 2mg + 15mg + 500mg item301 1 nos 302 302 glipizide and metformin hydrochloride tablet 5 mg + 500 mg item302 1 nos 303 303 glipizide tablet ip 5 mg item303 1 nos 304 304 glucagon injection usp 1 mg/ml item304 1 nos 305 305 glutaraldehyde solution 2% item305 1 nos 306 306 glycerin ip 100 ml item306 1 nos 307 307 glycerin ip 400 gm item307 1 nos 308 308 glyceryl trinitrate tablet 2.6 mg item308 1 nos 309 309 glycopyrrolate injection 0.2 mg/ml item309 1 nos 310 310 griseofulvin tablets 125 mg item310 1 nos 311 311 gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% item311 1 nos 312 312 haloperidol injection 5 mg/ml item312 1 nos 313 313 haloperidol tablet 5 mg item313 1 nos 314 314 haloperidol tablet 1.5 mg item314 1 nos 315 315 halothane item315 1 nos 316 316 hameodialysis bicarbonate solution item316 1 nos 317 317 heparin sodium injection 5000 iu/ml item317 1 nos 318 318 homatropine eye drops 2% item318 1 nos 319 319 human albumin solution 20% item319 1 nos 320 320 human anti d immunoglobulin 150 mcg item320 1 nos 321 321 human anti d immunoglobulin injection (im use) 300 mcg item321 1 nos 322 322 human rabies immunoglobulin injection 150 iu/ml item322 1 nos 323 323 hyaluronidase injection 1500 iu item323 1 nos 324 324 hydrochlorthiazide tablet 12.5 mg item324 1 nos 325 325 hydrochlorthiazide tablet 25 mg item325 1 nos 326 326 hydrocortisone sodium succinate injection 100 mg base / vial item326 1 nos 327 327 hydrogen peroxide solution 6% item327 1 nos 328 328 hydroxychloroquine sulphate tablet 200 mg item328 1 nos 329 329 hydroxyethyl starch (130/4) 6% w/v with sodium chloride 0.9% w/v intravenous infusion item329 1 nos 330 330 hydroxyprogesterone injection 250 mg/ml item330 1 nos 331 331 hydroxypropylmethyl cellulose solution with prefilled glass syringe with cannula 20 mg/ml item331 1 nos 332 332 hydroxyzine tablet 25 mg item332 1 nos 333 333 hyoscine butylbromide injection ip 20 mg/ml item333 1 nos 334 334 hyoscine butylbromide tablet 10 mg item334 1 nos 335 335 ibuprofen and paracetamol tablet 400 mg + 325 mg item335 1 nos 336 336 ibuprofen oral suspension 100 mg/5ml item336 1 nos 337 337 ibuprofen tablet 200 mg item337 1 nos 338 338 ibuprofen tablet 400 mg item338 1 nos 339 339 ifosfamide injection 1gm item339 1 nos 340 340 imatinib tablet 400 mg item340 1 nos 341 341 imipramine tablet 25 mg item341 1 nos 342 342 imipramine tablet 75 mg item342 1 nos 343 343 indomethacin capsule 25 mg item343 1 nos 344 344 inj bendamustine 100 mg item344 1 nos 345 345 inj clindamycin phosphate ip 300 mg item345 1 nos 346 346 inj imipenem + cilastatin 500mg/500mg ip powder for solution item346 1 nos 347 347 inj colistimethate ip 1m iu powder for solution item347 1 nos 348 348 inj diclofenac sodium aqueous 75mg/ml 1ml size, iv & im use item348 1 nos 349 349 inj human chorionic gonadotropin ip 5000 i.u. item349 1 nos 350 350 inj meropenem ip 250 mg item350 1 nos 351 351 inj piperacillin 2 gm + tazobactom 250mg usp item351 1 nos 352 352 inj poractant alpha 80 mg/ml in pack of 1.5 ml item352 1 nos 353 353 inj prochlorperazine mesylate 12.5mg/ml 5ml size item353 1 nos 354 354 inj tranexamic acid ip 100mg/ml 5ml size item354 1 nos 355 355 inj zoledronic acid ip 4mg/100ml 100ml size item355 1 nos 356 356 inj. amino acid 10% 100ml size item356 1 nos 357 357 inj. bevacizumab 100 mg item357 1 nos 358 358 inj. bevacizumab 400 mg item358 1 nos 359 359 inj. bortezomib 2mg item359 1 nos 360 360 inj. butorphanol tartrate usp 1mg/ml 1ml size item360 1 nos 361 361 inj. caffeine citrate usp 20mg/ml (equivalent to 10 mgn caffeine base/ml) 3ml size item361 1 nos 362 362 inj. ceftriaxone 1 gm + tazobactum 1.25 gm item362 1 nos 363 363 inj. cis atracurium besylate 2 mg/ml in 5 ml vial item363 1 nos 364 364 inj. esmolol hydrochloride 10mg/ml 10ml size item364 1 nos 365 365 inj. ferric carboxymaltose 50 mg/ml 10 ml size item365 1 nos 366 366 inj. ganciclovir sodium 500mg (lyophilized powder forn reconstitution) item366 1 nos 367 367 inj. hepatitis b immunologlobin ip 100 i.u item367 1 nos 368 368 inj. liposomol amphotericine b 10 mg item368 1 nos 369 369 inj. n butyl alcohol 0.26mg/5ml, citric acid 2.5mg/5ml and nsod. chloride solution 5 ml size item369 1 nos 370 370 inj. polymixin sulphate b usp 5 lac i.u. item370 1 nos 371 371 inj. sodium nitroprusside 25mg/ml 2ml size item371 1 nos 372 372 inj. voriconazole 200mg/vial item372 1 nos 373 373 insulin glargine 100 iu/ml with 30 insulin syringes with needle item373 1 nos 374 374 insulin glargine 100 iu/ml with 15 insulin syringes and needles/cartridge 100 iu/ml with 15 needles and 1 pen per 20 cartridges item374 1 nos 375 375 intravenous fat emulsion 20% w/v (pl/tg ratio 0.06) 250ml item375 1 nos 376 376 iohexol ( non ionic contrast medium in sterile aqueous solution) n300 mg iodine/ml. item376 1 nos 377 377 iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. item377 1 nos 378 378 ipratropium bromide nebulizer solution 250 mcg/ml item378 1 nos 379 379 ipratropium rotacap 40 mcg item379 1 nos 380 380 iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg item380 1 nos 381 381 iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg item381 1 nos 382 382 isoflurane item382 1 nos 383 383 isophane insulin injection 40 iu / ml item383 1 nos 384 384 isoprenaline injection 2mg / ml item384 1 nos 385 385 isosorbide dinitrate tablet 5 mg item385 1 nos 386 386 isosorbide mononitrate tablet 20 mg item386 1 nos 387 387 isoxsuprine injection 5 mg/ml item387 1 nos 388 388 isoxsuprine tablet 20 mg item388 1 nos 389 389 itraconazole capsule 100 mg item389 1 nos 390 390 ketamine injection 50 mg/ml item390 1 nos 391 391 ketoconazole cream 2% item391 1 nos 392 392 labetalol hydrochloride injection 20 mg/ 4ml item392 1 nos 393 393 labetalol tablet 100 mg item393 1 nos 394 394 lactic acid bacillus tablet 60 million spores item394 1 nos 395 395 lactulose solution 10gm/15ml item395 1 nos 396 396 l asparaginase injection 10000 iu item396 1 nos 397 397 leflunomide phosphate tablet 10 mg item397 1 nos 398 398 leflunomide phosphate tablet 20 mg item398 1 nos 399 399 leucovorin calcium injection 10 mg/ml item399 1 nos 400 400 leurprolide acetate depot 11.25 mg item400 1 nos 401 401 leurprolide acetate depot 3.75 mg item401 1 nos 402 402 levetiracetam injection 500 mg/5ml item402 1 nos 403 403 levetiracetam oral solution suspension 100 mg/ml item403 1 nos 404 404 levetiracetam tablet 500 mg item404 1 nos 405 405 levoceitrizine tablet 5mg item405 1 nos 406 406 levodopa and carbidopa tablet 100 mg + 10 mg item406 1 nos 407 407 levodopa and carbidopa tablet 250 mg + 25mg item407 1 nos 408 408 levofloxacin tablet 250 mg item408 1 nos 409 409 lidocaine hydrochloride topical solution usp 4% item409 1 nos 410 410 lignocaine ointment 5% item410 1 nos 411 411 lignocaine and adrenaline injection 20mg + 0.01mg item411 1 nos 412 412 lignocaine and dextrose injection 50mg + 75mg per ml item412 1 nos 413 413 lignocaine gel ip 2% item413 1 nos 414 414 lignocaine injection 2% item414 1 nos 415 415 linezolid injection 200 mg/100 ml item415 1 nos 416 416 linezolid tablet ip 600 mg item416 1 nos 417 417 liquid paraffin ip item417 1 nos 418 418 liquid paraffin ip item418 1 nos 419 419 lisinopril tablet 10 mg item419 1 nos 420 420 lisinopril tablet 2.5 mg item420 1 nos 421 421 lisinopril tablet 5 mg item421 1 nos 422 422 lithium carbonate tablet 300 mg item422 1 nos 423 423 loperamide tablet ip 2 mg item423 1 nos 424 424 lorazepam injection 2 mg/ml item424 1 nos 425 425 losartan potassium & amlodipine tablet 50 mg + 5mg item425 1 nos 426 426 losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg item426 1 nos 427 427 losartan tablet 25 mg item427 1 nos 428 428 losartan tablet 50 mg item428 1 nos 429 429 lysol (cresol with soap solution) (cresol 50% + soap 50%) item429 1 nos 430 430 magnesium sulphate injection (50% ) 500 mg/ml item430 1 nos 431 431 mannitol with glycerin injection 10% + 10% item431 1 nos 432 432 mannitol injection 20% item432 1 nos 433 433 mecobalamin injection 500 mcg/ml item433 1 nos 434 434 medroxyprogesterone acetate tablet ip 10 mg item434 1 nos 435 435 mefenamic acid tablet 500 mg item435 1 nos 436 436 mefloquine tablet 250 mg item436 1 nos 437 437 melphalan tablet 5 mg item437 1 nos 438 438 mercaptopurine tablet ip 50 mg item438 1 nos 439 439 meropenem injection 1 g item439 1 nos 440 440 meropenem injection 500 mg item440 1 nos 441 441 metformin hydrochloride (sr) and glimepiride tablet 500 mg +n 1 mg item441 1 nos 442 442 metformin hydrochloride (sustained release) and glimepiride tablet 500 mg + 2 mg item442 1 nos 443 443 metformin hydrochloride sr tablet 1000 mg item443 1 nos 444 444 metformin tablet 500 mg item444 1 nos 445 445 methotrexate injection 50 mg/2 ml item445 1 nos 446 446 methotrexate tablet 2.5 mg item446 1 nos 447 447 methotrexate tablet ip 10 mg item447 1 nos 448 448 methyl prednisolone sodium succinate for injection 500 mg item448 1 nos 449 449 methylcobalmin tablet 1500 mcg item449 1 nos 450 450 methylcobalmin tablet 500 mcg item450 1 nos 451 451 methyldopa tablet 250 mg item451 1 nos 452 452 methylergometrine injection 0.2 mg/ml item452 1 nos 453 453 methylergometrine tablet ip 0.125 mg item453 1 nos 454 454 metoclopramide injection 10 mg/2ml item454 1 nos 455 455 metoclopramide syrup 5 mg/ 5ml item455 1 nos 456 456 metoclopramide tablet 10 mg item456 1 nos 457 457 metoprolol suscinate tablet (extended release) usp 50 mg item457 1 nos 458 458 metoprolol tablet ip 25 mg item458 1 nos 459 459 metronidazole injection 500 mg/ 100 ml item459 1 nos 460 460 metronidazole and chlorhexidine gel 1%+ 0.25% item460 1 nos 461 461 metronidazole benzoate oral suspension 100 mg/ 5 ml item461 1 nos 462 462 metronidazole tablet 200 mg item462 1 nos 463 463 metronidazole tablet 400 mg item463 1 nos 464 464 miconazole nitrate cream 2% item464 1 nos 465 465 midazolam injection ip 1 mg/ml item465 1 nos 466 466 mifepristone tablet 200 mg item466 1 nos 467 467 misoprostol tablet 200 mcg item467 1 nos 468 468 mitomycin c injection 10 mg item468 1 nos 469 469 montelukast 10 mg + levocetrizine 5mg tablet item469 1 nos 470 470 morphine sulphate injection ip 10 mg/ml item470 1 nos 471 471 multi vitamin syrup item471 1 nos 472 472 multiple electrolytes & dextrose injection type i ipn(electrolyte p injection ) item472 1 nos 473 473 multiple electrolytes & dextrose injection type iii ipn(electrolyte m injection) item473 1 nos 474 474 multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg item474 1 nos 475 475 multivitamin tablets nfi formula sugar coated.vit a 2500 iu item475 1 nos 476 476 n acetylcystine injection 200 mg/ml item476 1 nos 477 477 naloxone injection ip 0.4 mg/ml item477 1 nos 478 478 naproxen tablet ip 250 mg item478 1 nos 479 479 naproxen tablet ip 500 mg item479 1 nos 480 480 natural micronised progesteron soft gelatin capsule 200 mg n (each soft gelatin capsule contains progesteron ip 200 mg) item480 1 nos 481 481 neomycin, bacitracin with sulphacetamide powder 5mg + n250units + 60mg item481 1 nos 482 482 neomycin, polymixin b & hydrocortisone ear drops/otic solution usp (neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml) item482 1 nos 483 483 neostigmine injection 2.5 mg/5ml item483 1 nos 484 484 neostigmine injection ip 0.5 mg/ml item484 1 nos 485 485 neostigmine tablets ip 15 mg item485 1 nos 486 486 nifedipine capsule 5 mg item486 1 nos 487 487 nifedipine tablet (sustained release) 10 mg item487 1 nos 488 488 nitrofurantoin tablet 100 mg item488 1 nos 489 489 nitroglycerin injection 5 mg/ml item489 1 nos 490 490 noradrenaline injection 2 mg/ml item490 1 nos 491 491 norethisterone tablet 5 mg item491 1 nos 492 492 norfloxacin tablet 400 mg item492 1 nos 493 493 normal human intravenous immunoglobulin 5g/100ml item493 1 nos 494 494 octreotide injection 50 mcg/ml item494 1 nos 495 495 ofloxacin and ornidazole tablet n200 mg + 500 mg item495 1 nos 496 496 ofloxacin injection 200mg / 100 ml item496 1 nos 497 497 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size item497 1 nos 498 498 ofloxacin suspension 50 mg/5 ml item498 1 nos 499 499 ofloxacin tablet 200 mg item499 1 nos 500 500 oint. terbinafine 1%w/w (10 gm tube) item500 1 nos 501 501 ointment containing : lidocaine 3%, zinc oxide 5% , hydrocortisone 0.25%, allantoin 0.5% item501 1 nos 502 502 olanzapine tablet 5 mg item502 1 nos 503 503 olopatadine hydrochloride ophthalmic solution 0.1% w/v usp n(e/d) 5ml size item503 1 nos 504 504 omeprazole capsule 20 mg item504 1 nos 505 505 ondansetron injection 2 mg/ml item505 1 nos 506 506 ondansetron orally disintegrating md tablet 4 mg item506 1 nos 507 507 ors powder item507 1 nos 508 508 oseltamivir 30 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) item508 1 nos 509 509 oseltamivir 45 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) item509 1 nos 510 510 oseltamivir 75 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) item510 1 nos 511 511 oseltamivir phosphate oral suspension ip 12 mg/ml (each ml contains : 12 mg oseltamivir after reconstitution item511 1 nos 512 512 oseltamivir syrupnoseltamivir phosphate for oral suspension 12 mg/ml. (each ml contains 12 mg oseltamivir base after reconstitution) item512 1 nos 513 513 oxaliplatin injection 50 mg item513 1 nos 514 514 oxytocin injection 5 iu/ml item514 1 nos 515 515 paclitaxel injection 100 mg item515 1 nos 516 516 paclitaxel injection 260 mg item516 1 nos 517 517 pantoprazole & domperidone sr capsule 40 mg+ 30 mg item517 1 nos 518 518 pantoprazole injection 40 mg item518 1 nos 519 519 paracetamol drops 150 mg/ml item519 1 nos 520 520 paracetamol syrup ip 125 mg/5ml item520 1 nos 521 521 paracetamol tablet 500 mg item521 1 nos 522 522 paracetamol infusion ip 1% w/v 100ml size item522 1 nos 523 523 paracetamol injection 150 mg/ml item523 1 nos 524 524 pentazocine injection 30 mg/ml item524 1 nos 525 525 peritonial dialysis solution ip item525 1 nos 526 526 permethrin lotion 5% item526 1 nos 527 527 permethrin cream 5% item527 1 nos 528 528 pheniramine injection 22.75 mg/ml item528 1 nos 529 529 phenobarbitone injection ip 200 mg/ml item529 1 nos 530 530 phenobarbitone tablet 30 mg item530 1 nos 531 531 phenylephrine hydrochloride ophthalmic solution usp/ phenylephrine eye drops bp 5% item531 1 nos 532 532 phenytoin injection 50 mg/ml item532 1 nos 533 533 phenytoin oral suspension 25 mg/ml item533 1 nos 534 534 phenytoin tablet 100 mg item534 1 nos 535 535 pioglitazone tablet ip 15 mg item535 1 nos 536 536 piperacillin and tazobactum for injection 4 gm + 500 mg item536 1 nos 537 537 polygeline 3.5% solution with electrolytes for i.v. infusion item537 1 nos 538 538 potassium chloride injection 0.15 gm/ml item538 1 nos 539 539 potassium chloride oral solution usp 500 mg/ 5ml item539 1 nos 540 540 povidone iodine ointment 5% item540 1 nos 541 541 povidone iodine ointment 5% item541 1 nos 542 542 povidone iodine scrub solution / cleansing solution 7.5% w/v povidone iodine 7.5% item542 1 nos 543 543 povidone iodine solution 10% item543 1 nos 544 544 povidone iodine solution 5% item544 1 nos 545 545 povidone iodine solution 5% item545 1 nos 546 546 powder clotrimazole 1% w/w 30 gm item546 1 nos 547 547 pralidoxime chloride injection 25 mg/ml item547 1 nos 548 548 prazosin tablet (extended release) 2.5 mg item548 1 nos 549 549 prednisolone tablet 10 mg item549 1 nos 550 550 prednisolone tablet 20 mg item550 1 nos 551 551 prednisolone tablet 5 mg item551 1 nos 552 552 pregabalin capsule ip 75 mg item552 1 nos 553 553 primaquine tablet 2.5 mg item553 1 nos 554 554 primaquine tablet 7.5 mg item554 1 nos 555 555 probiotic sachets 1 gm size (each gram sachet contains nsaccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) item555 1 nos 556 556 progesterone injection 200 mg /2ml item556 1 nos 557 557 promethazine syrup ip 5 mg/ 5ml item557 1 nos 558 558 promethazine injection 25 mg/ml item558 1 nos 559 559 promethazine tablet 25 mg item559 1 nos 560 560 propofol injection 10 mg/ml item560 1 nos 561 561 propranolol tablet 40 mg item561 1 nos 562 562 pyridoxine tablet 40 mg item562 1 nos 563 563 pyridoxine tablet 10 mg item563 1 nos 564 564 quetiapine tablet ip 25 mg item564 1 nos 565 565 quetiapine tablet ip 50 mg item565 1 nos 566 566 quinine dihydrochloride injection 300 mg/ml item566 1 nos 567 567 quinine sulphate tablet 300 mg item567 1 nos 568 568 rabies antiserum ip (equine) (i.m./sc use) 300 units / ml item568 1 nos 569 569 rabies vaccine human (cell culture) (intradermal) 2.5 iu item569 1 nos 570 570 rabies vaccine human (cell culture) (intramuscular) 2.5 iu/ dose item570 1 nos 571 571 ramipril tablet / capsule 2.5 mg item571 1 nos 572 572 ranitidine hcl injection 50 mg/2ml item572 1 nos 573 573 ranitidine tablet 150 mg item573 1 nos 574 574 ranitidine tablet 300 mg item574 1 nos 575 575 recombinant coagulation factor viia 1 mgn item575 1 nos 576 576 recombinant coagulation factor viia 2 mg item576 1 nos 577 577 recombinant f ix 500 iu with diluent item577 1 nos 578 578 rh erythropoetin injection 10000 iu item578 1 nos 579 579 rh erythropoetin injection 2000 iu item579 1 nos 580 580 rh erythropoetin injection 4000 iu item580 1 nos 581 581 ringer acetate infusion 500 ml item581 1 nos 582 582 risperidone tablet 2 mg item582 1 nos 583 583 risperidone tablet 1 mg item583 1 nos 584 584 salbutamol tablet 4 mg item584 1 nos 585 585 salbutamol inhalation 100 mcg/ dose item585 1 nos 586 586 salbutamol nebuliser solution 5 mg/ml item586 1 nos 587 587 salbutamol syrup ip 2 mg/5ml item587 1 nos 588 588 salbutamol tablet 2 mg item588 1 nos 589 589 saline nasal solution (drops) 0.65% item589 1 nos 590 590 sertraline tablet 50 mg item590 1 nos 591 591 sevoflurane item591 1 nos 592 592 silver sulphadiazine cream 1% item592 1 nos 593 593 silver sulphadiazine cream ip 1% item593 1 nos 594 594 snake venom anti serum (polyvalent anti snake venom) lyophillized item594 1 nos 595 595 sodium bicarbonate injection ip 7.5% item595 1 nos 596 596 sodium chloride 0.45% w/v polypack 500 ml item596 1 nos 597 597 sodium chloride and dextrose injection 0.9 % + 5 % item597 1 nos 598 598 sodium chloride injection item598 1 nos 599 599 sodium chloride injection item599 1 nos 600 600 sodium phosphates enema bp item600 1 nos 601 601 sodium valproate tablet 200 mg item601 1 nos 602 602 sodium valproate ip injection 100 mg/ml item602 1 nos 603 603 sodium valproate oral solution ip 200 mg/ 5 ml item603 1 nos 604 604 sodium valproate(gastro resistant) ip tablet 500 mg item604 1 nos 605 605 soluble insulin injection 40 iu / ml item605 1 nos 606 606 spironolactone tablet 25 mg item606 1 nos 607 607 spironolactone tablet 50 mg item607 1 nos 608 608 streptokinase injection 15 lac units item608 1 nos 609 609 succinylcholine injection 50 mg/ml item609 1 nos 610 610 sulfasalazine delayed release tablet 500 mg item610 1 nos 611 611 surfactant for intratrecheal instillation(natural bovine lung surfactant) item611 1 nos 612 612 surgical spirit bp item612 1 nos 613 613 surgical spirit bp item613 1 nos 614 614 syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate)n item614 1 nos 615 615 tab abiraterone acetate ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) item615 1 nos 616 616 tab baclofen ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) item616 1 nos 617 617 tab cabergoline ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) item617 1 nos 618 618 tab capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) item618 1 nos 619 619 tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) item619 1 nos 620 620 tab dexamethasone ip 4 mg (each uncoated tablet contains n dexamethasone ip 4 mg) item620 1 nos 621 621 tab divalproex extended release ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) item621 1 nos 622 622 tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) item622 1 nos 623 623 tab ethamsylate bp 500 mg (each uncoated coated tablet ncontains ethamsylate bp 500 mg) item623 1 nos 624 624 tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) item624 1 nos 625 625 tab lacosamide 100 mg (each film coated tablet contains nlacosamide 100 mg) item625 1 nos 626 626 tab lamotrigine ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) item626 1 nos 627 627 tab letrozole usp 2.5 mg (each film coated tablet contains letrozole usp 2.5 mg) item627 1 nos 628 628 tab levamisol hydrochloride ip 50 mg (each uncoated tablet nconatin levamisol hydrochloride ip 50 mg) item628 1 nos 629 629 tab oxcarbazepine ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) item629 1 nos 630 630 tab pyridostigmine usp 60 mg (each tablet contains npyridostigmine usp 60 mg ) item630 1 nos 631 631 tab rosuvastatin 10 mg item631 1 nos 632 632 tab rosuvastatin ip 20 mg (each film coated tablet contains nrosuvastatin calcium ip equivalent to rosuvastatin 20 mg) item632 1 nos 633 633 tab savelamer carbonate 400 mg (each film coated tablet contains savelamer carbonate 400 mg) item633 1 nos 634 634 tab sodium bicarbonate usp 1 gm (each film coated tablet ncontains sodium bicarbonate usp 1 gm) item634 1 nos 635 635 tab tizanidine hydrochloride ip 2 mg (each uncoated tabletn contains tizanidine hydrochloride ip 2 mg) item635 1 nos 636 636 tab topiramate ip 25 mg (each film coated tablet contains ntopiramate ip 25 mg ) item636 1 nos 637 637 tab. 6 thioguanine usp 40 mg (each uncoated tablet contains n6 thioguanine usp 40 mg) item637 1 nos 638 638 tab. acebrophylline 100 mg item638 1 nos 639 639 tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film ncoated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg item639 1 nos 640 640 tab. bicalutamide usp 50 mg (each film tablet contains nbicalutamide usp 50 mg) item640 1 nos 641 641 tab. carvedilol 3.125 mgn item641 1 nos 642 642 tab. clonidine hydrochloride usp 0.1 mg (each tablet contains clonidine hydrochloride usp 0.1 mg) item642 1 nos 643 643 tab. dutasteride 0.5 mg item643 1 nos 644 644 tab. entecavir ip 0.5 mg (each film coated tablet conatinsn entecavir ip 0.5 mg) item644 1 nos 645 645 tab. faropenem sodium 200 mg (each film tablet contains nfaropenem sodium equivalent to faropenem sodium 200 mg) item645 1 nos 646 646 tab. ketorolac 10 mg item646 1 nos 647 647 tab. levofloxacin ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) item647 1 nos 648 648 tab. levosulpiride 25 mg (each uncoated tablet contains nlevosulpiride 25 mg) item648 1 nos 649 649 tab. lorazepam ip 2 mg (each uncoated tablet contains nlorazepam ip 2 mg ) item649 1 nos 650 650 tab. mesalamine usp 1.2 gm enteric coated n(each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) item650 1 nos 651 651 tab. mycophenolate sodium 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) item651 1 nos 652 652 tab. sacubitril 24 mg and valsartan 26 mg item652 1 nos 653 653 tab. sotalol hydrochloride usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) item653 1 nos 654 654 tab. terbinafine hydrochloride 250 mg item654 1 nos 655 655 tab. valganciclovir 450 mg item655 1 nos 656 656 tab. zolpidem 5 mg item656 1 nos 657 657 tab.cefadroxil 250 mg item657 1 nos 658 658 tab.cefadroxil 500 mg item658 1 nos 659 659 tab.phenazopyridine 5 mg item659 1 nos 660 660 tamoxifen tablet 10 mg item660 1 nos 661 661 tamsulosin hcl tablet 0.4 mg item661 1 nos 662 662 telmisartan tablet ip 40 mg item662 1 nos 663 663 tenaligliptin tablet 20 mg item663 1 nos 664 664 terbutaline sulphate tablet ip 2.5 mg item664 1 nos 665 665 tetanus immunoglobulin 250 iu item665 1 nos 666 666 tetanus vaccine (adsorbed) ip item666 1 nos 667 667 theophylline and etophylline injection 50.6mg + 169.4mg item667 1 nos 668 668 theophylline and etophylline tablet 23mg + 77mg item668 1 nos 669 669 theophylline tablet (sr) 400 mg item669 1 nos 670 670 thiamine tablet 100 mg item670 1 nos 671 671 thiopentone injection 0.5 g item671 1 nos 672 672 thyroxine sodium tablet 100 mcg item672 1 nos 673 673 thyroxine sodium tablets ip 50 mcg item673 1 nos 674 674 timolol eye drops 0.50% item674 1 nos 675 675 tinidazole tablet ip 300 mg (film coated) item675 1 nos 676 676 tinidazole tablet ip 500 mg (film coated) item676 1 nos 677 677 tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% item677 1 nos 678 678 tobramycin eye drops 0.30% item678 1 nos 679 679 tobramycin ophthalmic ointment 0.30% item679 1 nos 680 680 torsemide injection 10 mg/ml item680 1 nos 681 681 torsemide tablet 10 mg item681 1 nos 682 682 tramadol capsule 50 mg item682 1 nos 683 683 tramadol injection 50 mg/ml item683 1 nos 684 684 tranexamic acid tablet 500 mg item684 1 nos 685 685 travoprost ophthalmic solution 0.004% item685 1 nos 686 686 tretenoin cream 0.03% item686 1 nos 687 687 trifluperazine tablets ip 5 mg item687 1 nos 688 688 trihexyphenidyl hydrochloride tablet 2 mg item688 1 nos 689 689 tropicamide eye drops 1% item689 1 nos 690 690 urokinase injection 5 lac unit item690 1 nos 691 691 ursodeoxycholic acid tablet 300 mg item691 1 nos 692 692 valethamate bromide injection 8 mg/ml item692 1 nos 693 693 vancomycin for intravenous infusion ip 1 gm item693 1 nos 694 694 vancomycin injection 500 mg item694 1 nos 695 695 vdrl antigen (with +ve and ve control) / rpr slide kit item695 1 nos 696 696 vecuronium bromide for injection 4 mg (freeze dried) item696 1 nos 697 697 verapamil tablets ip 40 mg item697 1 nos 698 698 vinblastine injection 10 mg/10 ml item698 1 nos 699 699 vincristine injection 1 mg/ml item699 1 nos 700 700 vitamin a solution 1 lac iu/ml item700 1 nos 701 701 vitamin b complex injection nfi item701 1 nos 702 702 vitamin b complex tablet nfi (prophylactic) item702 1 nos 703 703 vitamin d3 oral solution 60000 iu item703 1 nos 704 704 vitamin k injection 10 mg/ml item704 1 nos 705 705 vitamin k 1 (phytomenadione) 1 mg/0.5ml injection item705 1 nos 706 706 warfarin sod. tablet 5 mg item706 1 nos 707 707 water for injection ip item707 1 nos 708 708 wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil 2% + 2.7% + 5% + 15% item708 1 nos 709 709 xylometazoline nasal drops 0.1% item709 1 nos 710 710 zinc sulphate dispersible ip elemental tablet 10 mg item710 1 nos 711 711 abiraterone 250mg tab item711 1 nos 712 712 abiraterone 500mg tab item712 1 nos 713 713 abobotulinum toxin 300 i.u. item713 1 nos 714 714 abobotulinum toxin 500 i.u. item714 1 nos 715 715 aceclofenac 200 mg sr tab. item715 1 nos 716 716 aceclofenec 100mg.+thiocolchicoside 4mg.tab. item716 1 nos 717 717 acenocoumarol tabs ip 1mg. item717 1 nos 718 718 acetylcysteine 200 mg tab item718 1 nos 719 719 acitretin 25mg cap item719 1 nos 720 720 actinomycin d 0.5 g in item720 1 nos 721 721 advanced liquid cleaner for instruments,endoscopes item721 1 nos 722 722 albumin inj. 20% . item722 1 nos 723 723 alfuzosin 10 mg. + dutasteride 0.5 mg tab item723 1 nos 724 724 alfuzosin tab. 10 mg. item724 1 nos 725 725 alphaketoanalogue tab. item725 1 nos 726 726 amantadine 100mg tab/cap item726 1 nos 727 727 ambrisentant 10 mg tab item727 1 nos 728 728 ambrisentant 5 mg + tadalafil 20 mg tab item728 1 nos 729 729 ambrisentant 5 mg tab item729 1 nos 730 730 amino acid 50 ml inj. item730 1 nos 731 731 amino acid infusion inj. 7%w/v item731 1 nos 732 732 amisulpride 50 mg. tab. item732 1 nos 733 733 amlodipine tabs 10mg. item733 1 nos 734 734 amoxicillin + clavulanic acid 150 mg.inj. item734 1 nos 735 735 amoxicillin + clavulanic acid 300 mg.inj. item735 1 nos 736 736 amoxycillin + clavulanate syp (457mg/5ml) item736 1 nos 737 737 ampicillin 250 mg. inj. item737 1 nos 738 738 ampicillin 250mg+cloxacillin 250mg inj. item738 1 nos 739 739 anastrozole 1 mg.tab. item739 1 nos 740 740 anti cold drop (cpm+pcm) item740 1 nos 741 741 anti tetanus immunoglobulin (human) inj.500iu item741 1 nos 742 742 antiseptic for mucous membranes ,wounds,skin & pre & post opreative scrub solution of 10% item742 1 nos 743 743 antiseptic for mucous membranes ,wounds,skin & pre & post opreative scrub solution of 5% item743 1 nos 744 744 aripiprazole tab 10 mg item744 1 nos 745 745 artemether+lumefantrine syp. item745 1 nos 746 746 artesunate 120mg inj item746 1 nos 747 747 artesunate tab 50 mg item747 1 nos 748 748 ascorbate and folic acid drop item748 1 nos 749 749 ascorbic acid tabs ip 100mg. item749 1 nos 750 750 atenolol tabs ip 100mg. item750 1 nos 751 751 atomoxetin tab.10mg. item751 1 nos 752 752 atracurium inj 10mg/ml item752 1 nos 753 753 azithromycin 100mg/5ml syp. item753 1 nos 754 754 azithromycin 500 mg.inj. item754 1 nos 755 755 balanced salt solution (opth.) inj. item755 1 nos 756 756 barium sulfate powder item756 1 nos 757 757 barium sulfate suspension item757 1 nos 758 758 benzathine benzylpenicillin inj. ip 24 lacs units item758 1 nos 759 759 betamethasone oral drop item759 1 nos 760 760 bethanechol chloride 25 mg tab item760 1 nos 761 761 bimetoprost eye drops 0.03% item761 1 nos 762 762 biotin 5 mg tab item762 1 nos 763 763 bisacodyl suppository ip 5mg. item763 1 nos 764 764 bovine lipid extract surfactant suspension 27 mg/ml item764 1 nos 765 765 bovine lipid extract surfactant suspension 27 mg/ml item765 1 nos 766 766 bromonidine 2% eye drops item766 1 nos 767 767 buprenorphine item767 1 nos 768 768 buprenorphine 1 ml inj item768 1 nos 769 769 buprenorphine dermal patch 10mcg item769 1 nos 770 770 bupropion tab.150 mg. item770 1 nos 771 771 caffeine citrate tablet item771 1 nos 772 772 calcitonin nasal spray item772 1 nos 773 773 calcitrol 1mcg inj item773 1 nos 774 774 calcium acetate tab 667mg item774 1 nos 775 775 calcium chloride inj. item775 1 nos 776 776 calcium dobusylate tab/cap item776 1 nos 777 777 calcium gluconate +calcium lactobionate inj. item777 1 nos 778 778 calcium phosphate syp. (ratio 2:1) item778 1 nos 779 779 calcium polystyrene sulfonate powder item779 1 nos 780 780 capecitabine 500 mg cap, item780 1 nos 781 781 carbolic acid (phenol) item781 1 nos 782 782 carvedilol 6.25 mg tab. item782 1 nos 783 783 cefepime 250 mg.inj item783 1 nos 784 784 cefepime +sulbactum inj. 1.125gm. item784 1 nos 785 785 cefepime 1 gm.inj. item785 1 nos 786 786 cefepime 125 mg.inj. item786 1 nos 787 787 cefixim 200mg+clavulanic acid 125 mg. tab item787 1 nos 788 788 cefixime syp (100mg/5ml) item788 1 nos 789 789 cefpodoxime 100mg./ 5ml. syp. item789 1 nos 790 790 cefpodoxime 200 mg.tab item790 1 nos 791 791 cefpodoxime drop 25mg/ml item791 1 nos 792 792 cefpodoxime proxetile 200 mg + ofloxacine 200 mg tab item792 1 nos 793 793 ceftriaxone + sulbactum 1.5 gm inj. item793 1 nos 794 794 cefuroxime 1.5 gm inj. item794 1 nos 795 795 cefuroxime 750 mg inj. item795 1 nos 796 796 cefuroxime axitil 500 mg tab. item796 1 nos 797 797 cefuroxime oral susp.syp. item797 1 nos 798 798 chlorpromazine oral solution bp 25mg/5ml. item798 1 nos 799 799 chlorthalidone tabs ip 25mg. item799 1 nos 800 800 cilnidipine 10 mg tab item800 1 nos 801 801 cilostazole 50mg tab item801 1 nos 802 802 ciproflox 500 mg. tinidazole 600 mg.tab. item802 1 nos 803 803 citicoline 500 mg inj item803 1 nos 804 804 citicoline syp 500 mg item804 1 nos 805 805 citicoline tab. 500 mg item805 1 nos 806 806 clarithromycin 250 mg cap/tab item806 1 nos 807 807 clarithromycin inj 500 mg item807 1 nos 808 808 clarithromycin suspension 250 mg item808 1 nos 809 809 clobazam 2.5mg tab item809 1 nos 810 810 clonazepam tab. 1 mg. item810 1 nos 811 811 clonidine 150mcg/ml inj. item811 1 nos 812 812 clonidine inj. 1000 mcg item812 1 nos 813 813 clostamine inj item813 1 nos 814 814 clozapine tab. 100 mg. item814 1 nos 815 815 clozapine tab. 50 mg. item815 1 nos 816 816 codeine phosphate 10mg + cpm 4mg syp. item816 1 nos 817 817 colistimethate sod inj. 1 million item817 1 nos 818 818 colistimethate sod inj. 2 million item818 1 nos 819 819 colistimethate sod inj. 3 million item819 1 nos 820 820 crystalline penicillin 10 lacs iu inj item820 1 nos 821 821 cyclopentolate1%eyedrops item821 1 nos 822 822 cyproheptadine oral drop item822 1 nos 823 823 cyproheptadine syp. item823 1 nos 824 824 dacarbazine 200 mg.inj. item824 1 nos 825 825 deferasirox 180 mg fct tab item825 1 nos 826 826 deferasirox 360 mg fct tab item826 1 nos 827 827 deferasirox 90 mg fct tab item827 1 nos 828 828 deflazacort tab. 6 mg. item828 1 nos 829 829 defrasirox 250 mg tab. item829 1 nos 830 830 derifenasin tab. 15 mg. item830 1 nos 831 831 derifenasin tab. 7.5 mg. item831 1 nos 832 832 desatinib 50mg tab item832 1 nos 833 833 dexmedetomidine 50mcg/ml inj. item833 1 nos 834 834 dextran 40 inj. ip 10% solution item834 1 nos 835 835 dextrose 5% 1000 ml item835 1 nos 836 836 dextrose inj 5% glass bottle item836 1 nos 837 837 dextrose inj 50% glass bottle item837 1 nos 838 838 diacerin+glucosamin 50 mg.tab/cap item838 1 nos 839 839 diclofenac 50mg.+ serrotiopeptidese 10 mg.tab. item839 1 nos 840 840 diethylcarbamazine tabs ip 50mg item840 1 nos 841 841 digoxin drop (50mcg/ml) item841 1 nos 842 842 diloxanide furoate tabs ip 500mg item842 1 nos 843 843 diltiazem inj. 5mg./ml. item843 1 nos 844 844 diltiazem tabs ip 60mg. item844 1 nos 845 845 dimethyl fumerate 120mg tab item845 1 nos 846 846 dimethyl fumerate 240mg tab item846 1 nos 847 847 distilled water item847 1 nos 848 848 donepezil 10mg tab item848 1 nos 849 849 donepezil 5mg tab item849 1 nos 850 850 dorzolamide eye drops 2% item850 1 nos 851 851 dry powder inhaler device (revlizer) item851 1 nos 852 852 duloxetine 20mg tab/cap item852 1 nos 853 853 ecg jelly 250 ml item853 1 nos 854 854 edravon inj. (1.5mg/1ml) 20ml item854 1 nos 855 855 eltrombopag olamine 25mg tab item855 1 nos 856 856 eltrombopag olamine 50mg tab item856 1 nos 857 857 emollient+aloevera+vit.e cream item857 1 nos 858 858 enoxaparin sodium inj ip 0.4 mg item858 1 nos 859 859 enzalutamide 40mg tab item859 1 nos 860 860 enzyme syp. item860 1 nos 861 861 ephedrine 30 mg./ml inj. item861 1 nos 862 862 epinephrine tartrate inj. ip 1mg/ml. item862 1 nos 863 863 epirubicin 10 mg.inj. item863 1 nos 864 864 epirubicin 50 mg. inj. item864 1 nos 865 865 erlotinib 150 mg.tab. item865 1 nos 866 866 ethamsylate 250 mg.tab. item866 1 nos 867 867 ethinylestradiol and levonorgestrel tabs ip 30mcg+150mcg item867 1 nos 868 868 ethionamide 250 mg. item868 1 nos 869 869 ethosuximide syp. 250mg/5ml item869 1 nos 870 870 etomidate inj. 10mg/ml item870 1 nos 871 871 fatiyacid inj item871 1 nos 872 872 febuxostat 40 mg.tab. item872 1 nos 873 873 fentanyl item873 1 nos 874 874 ferric citrate 210mg tab item874 1 nos 875 875 ferrous ascorbate 100 mg + folic acid 1.5 mg + cynocobalamine 15 mcg + zinc sulphate 22.5 mg tab item875 1 nos 876 876 ferrous ascorbate 30mg + folic acid 550 mcg suspension item876 1 nos 877 877 fibrain sealant 1 ml.inj. item877 1 nos 878 878 filgrasim 6 mg.(peg.)inj. item878 1 nos 879 879 fingolimod 0.5mg tab item879 1 nos 880 880 fingolimod 1.25mg tab item880 1 nos 881 881 fluconazole 200mg tab item881 1 nos 882 882 fluconazole 50mg tab item882 1 nos 883 883 fluconazole inj. 2mg/ml item883 1 nos 884 884 fludrocortisone 0.1 tab. item884 1 nos 885 885 flumazenil 0.5 mg/ 5 ml inj item885 1 nos 886 886 flupenthixole 0.5mg + melitracin 10mg tab item886 1 nos 887 887 flurometholone 1% eye drops item887 1 nos 888 888 fluticasone furoate +azilastin nasal spray item888 1 nos 889 889 fluticasone furoate inhaler item889 1 nos 890 890 fluticasone nasal spray item890 1 nos 891 891 fluticasone propionate 0.05% cream item891 1 nos 892 892 fluticasone propionate 0.05% cream item892 1 nos 893 893 fluvoxamine tab ip 100mg item893 1 nos 894 894 fluvoxamine tab ip 50mg item894 1 nos 895 895 formalin vaporiser tab. item895 1 nos 896 896 formeterol+fluticasone (6ug+250ug) item896 1 nos 897 897 formeterol+fluticasone 6ug / 100 ug item897 1 nos 898 898 formeterol+tiotropium ( 12ug+18 ug) item898 1 nos 899 899 fosphenytoin sodium 100 mg item899 1 nos 900 900 fosphenytoin sodium 500 mg item900 1 nos 901 901 frusimide+spironolactone tab. item901 1 nos 902 902 furosemide 10mg/ml drop item902 1 nos 903 903 gaucclovir 500 mg.tab. item903 1 nos 904 904 gentamycin inj. ip 10mg/ml item904 1 nos 905 905 ginkoba biloba tab. 40 mg. item905 1 nos 906 906 glatiramer acetate inj. item906 1 nos 907 907 glutathion 600 mg. inj. item907 1 nos 908 908 glycine irrigation solu. 1.5% item908 1 nos 909 909 haemacoel item909 1 nos 910 910 halothane liq for inhalation item910 1 nos 911 911 handrub solution (chlorhexidine gluconate + ethanol) item911 1 nos 912 912 hepatitis b vaccine item912 1 nos 913 913 hiparine benzyl nicotinate ointment item913 1 nos 914 914 hydralazine hydrochloride 20mg inj item914 1 nos 915 915 hydroxyprogesterone caproate 500mg inj. item915 1 nos 916 916 hydroxyurea 500 mg. tab. item916 1 nos 917 917 hydroxyzine syp item917 1 nos 918 918 hydroxyzine drop item918 1 nos 919 919 ibandronic acid 150 mg.tab. item919 1 nos 920 920 indomethacin 75 mg. cap item920 1 nos 921 921 infliximab inj. item921 1 nos 922 922 influenza vaccine inj. item922 1 nos 923 923 interferon b 1a item923 1 nos 924 924 iron dextran inj. ip 50mg iron/ml item924 1 nos 925 925 iron drop (10mg/ml) item925 1 nos 926 926 isolyte p 10% item926 1 nos 927 927 isotretinoin 20 mg. item927 1 nos 928 928 ketaconazole 2% lotion item928 1 nos 929 929 lamivudin 100mg tab item929 1 nos 930 930 lanthanum tab 250 mg. item930 1 nos 931 931 lenalidomide 10mg tab item931 1 nos 932 932 lenalidomide 25mg tab item932 1 nos 933 933 levetiracetam 250 mg.tab item933 1 nos 934 934 levo bupivacaine 0.5% inj. item934 1 nos 935 935 levo bupivacaine 0.5% inj. item935 1 nos 936 936 levocarnitine 1gm inj item936 1 nos 937 937 levocitrazine syp. item937 1 nos 938 938 levodopa 100mg + carbidopa 25mg + entacapone 200mg tab item938 1 nos 939 939 levodopa 50mg + carbidopa 12.5mg + entacadone 200mg tab item939 1 nos 940 940 levofloxacin 500 mg inj. item940 1 nos 941 941 levofloxacin syp. item941 1 nos 942 942 levofloxacin750 mg tab. item942 1 nos 943 943 levomisole tab 150 mg item943 1 nos 944 944 levosalbutamol syp. item944 1 nos 945 945 levosalbutamol+budesonide item945 1 nos 946 946 levosalbutamol+ipratropium (50ug + 20ug) inhaler item946 1 nos 947 947 levosulpiride 25 mg. tab. item947 1 nos 948 948 l glutamine powder item948 1 nos 949 949 lidocaine hcl oral topical solution 2% (viscous) item949 1 nos 950 950 lidocaine spray item950 1 nos 951 951 lignocaine 2% inj preseruvative free inj item951 1 nos 952 952 lignocaine 2% inj preseruvative free inj item952 1 nos 953 953 lignocaine hcl 2% (cardiac use) inj. item953 1 nos 954 954 lincomycin 300mg/ml inj item954 1 nos 955 955 linezolid 100 mg.tab. item955 1 nos 956 956 linezolid 100mg syp. item956 1 nos 957 957 linezolid 600 mg inj. item957 1 nos 958 958 lomodex bottle inj. item958 1 nos 959 959 l ornithine, l aspartate & pancreatin tab item959 1 nos 960 960 l ornithine, l aspartate inj item960 1 nos 961 961 loxicard inj item961 1 nos 962 962 lutein + zeaxamthin + vit e + zinc + vit c cap/tab item962 1 nos 963 963 meclizine 25 mg tab item963 1 nos 964 964 mefenemic syp item964 1 nos 965 965 mementine 10mg tab item965 1 nos 966 966 mementine 5mg tab item966 1 nos 967 967 meniagococci vaccine item967 1 nos 968 968 mephentamine 30 mg./ml.inj. item968 1 nos 969 969 meropenem & salbactum1.5 gm.inj. item969 1 nos 970 970 mesalamine 1.2 gm.tab. item970 1 nos 971 971 mesna inj. 200mg item971 1 nos 972 972 methotraxat 7.5 mg tab. item972 1 nos 973 973 methyleprednisolon 125mg inj. item973 1 nos 974 974 methyleprednisolon 16 mg tab item974 1 nos 975 975 methyleprednisolon 250mg inj. item975 1 nos 976 976 methyleprednisolon 40mg inj. item976 1 nos 977 977 midazolam 10 mg inj. item977 1 nos 978 978 midazolam nasal spray item978 1 nos 979 979 milk formula lbw powder item979 1 nos 980 980 milk formula low lactose powder item980 1 nos 981 981 milk formula zero lactose powder item981 1 nos 982 982 minoxidil 5% item982 1 nos 983 983 minoxidil 2% item983 1 nos 984 984 mirabegron 25mg tab item984 1 nos 985 985 mirabegron 50mg tab item985 1 nos 986 986 mirtazapin 15mg tab item986 1 nos 987 987 mirtazapine 7.5 item987 1 nos 988 988 modafinil 100mg tab item988 1 nos 989 989 mometasone furoate 0.1% w/w cream item989 1 nos 990 990 mometasone furoate 0.1% w/w cream item990 1 nos 991 991 montelucast + levocetrizine syp item991 1 nos 992 992 morphine sulphate 30mg tab item992 1 nos 993 993 moxifloxacine 400mg inj item993 1 nos 994 994 moxonidine 0.2 mg.tab item994 1 nos 995 995 moxonidine 0.3 mg.tab item995 1 nos 996 996 multivitamin iv use inj item996 1 nos 997 997 n acetyl cystine 600mg tab item997 1 nos 998 998 nelbuthine 20 mg/2ml item998 1 nos 999 999 nalbuphine item999 1 nos 1000 1000 nebivolol 2.5 mg tab item1000 1 nos 1001 1001 neostimine 2.5+ glycopyrolate 0.4 inj item1001 1 nos 1002 1002 netilmicin 10 mg inj. item1002 1 nos 1003 1003 netilmicin 25 mg inj. item1003 1 nos 1004 1004 nicomalone 4mg tab item1004 1 nos 1005 1005 nicorandil 5mg tab item1005 1 nos 1006 1006 nilotinib 200mg tab/cap item1006 1 nos 1007 1007 nitrazepam tab. 10 mg item1007 1 nos 1008 1008 norepinephine inj item1008 1 nos 1009 1009 norfloxacin 100mg tab item1009 1 nos 1010 1010 norfloxacin 200mg tab item1010 1 nos 1011 1011 notamycin 5% eye drops item1011 1 nos 1012 1012 octreotide injection 20 mcg/ml item1012 1 nos 1013 1013 octreotide injection10 mg./ml item1013 1 nos 1014 1014 ofloxacin 200 mg+tinidazole 600mg tab item1014 1 nos 1015 1015 ofloxacin 400 mg tab. item1015 1 nos 1016 1016 ofloxacin 50mg+ornidazole125mg syp. item1016 1 nos 1017 1017 onabotulinum toxin 100 i.u. item1017 1 nos 1018 1018 onabotulinum toxin 50 i.u. item1018 1 nos 1019 1019 ondensetron syp. item1019 1 nos 1020 1020 oxybutynin tab. 2.5 mg. item1020 1 nos 1021 1021 oxybutynin tab. 5 mg. item1021 1 nos 1022 1022 palaneccetron inj 250mcg item1022 1 nos 1023 1023 palaneccetron inj 75mcg item1023 1 nos 1024 1024 palanosetrone item1024 1 nos 1025 1025 palidocharial 3% inj. item1025 1 nos 1026 1026 pancreatic enzyme cap 10000 iu item1026 1 nos 1027 1027 paracetamol 650mg tab item1027 1 nos 1028 1028 paracetamol infusion item1028 1 nos 1029 1029 pazufloxacine 500mg inj item1029 1 nos 1030 1030 peadiatric digoxin elixir ip 0.05mg/ml. item1030 1 nos 1031 1031 pemetrexed 500 mg. item1031 1 nos 1032 1032 pemetrexed 100 mg. item1032 1 nos 1033 1033 penicillin g sodium inj. ip 5 million units item1033 1 nos 1034 1034 pentoxiphylline tab er 400mg item1034 1 nos 1035 1035 perfinidone tab. 200 mg item1035 1 nos 1036 1036 phenobarbitone syp. item1036 1 nos 1037 1037 pilocarpine 1% item1037 1 nos 1038 1038 piracetam 200 mg/ml inj 20% item1038 1 nos 1039 1039 piracetam 800 mg. tab. item1039 1 nos 1040 1040 piracetam syp 500 mg item1040 1 nos 1041 1041 piroxicam 20mg inj item1041 1 nos 1042 1042 pneumococeal vaccine item1042 1 nos 1043 1043 pneumovace 23 vaccine item1043 1 nos 1044 1044 povidone iodine gargles item1044 1 nos 1045 1045 pramipexol 0.125mg tab item1045 1 nos 1046 1046 pramipexol 1.5mg tab item1046 1 nos 1047 1047 pramipexol 1mg tab item1047 1 nos 1048 1048 prednisolone sodium succinate for inj. usp 20 mg. item1048 1 nos 1049 1049 prednisolone acetate 1% eye drops item1049 1 nos 1050 1050 prednisolone sodium phosphate inj. usp 40mg./ml item1050 1 nos 1051 1051 prilocaine2.5mg+lignocaine 2.5mg oint. item1051 1 nos 1052 1052 primaquine phosphate 15mg tab item1052 1 nos 1053 1053 propanolol tab 10mg item1053 1 nos 1054 1054 purified protein derivative (mantoux test) item1054 1 nos 1055 1055 pyridosiamine 60mg tab item1055 1 nos 1056 1056 pyridoxine 100mg tab item1056 1 nos 1057 1057 racecadotril 10 mg.cap item1057 1 nos 1058 1058 racecadotril 100 mg.cap item1058 1 nos 1059 1059 ramipril 5mg tab/cap item1059 1 nos 1060 1060 rasageline 0.5mg tab item1060 1 nos 1061 1061 residronate 35 mg.tab. item1061 1 nos 1062 1062 ringer lacted sodium 1000 ml item1062 1 nos 1063 1063 rituximab 100 mg.inj. item1063 1 nos 1064 1064 rituximab 500 mg.inj. item1064 1 nos 1065 1065 rocuromium 10mg/ml item1065 1 nos 1066 1066 ropivacaine 0.2% inj. item1066 1 nos 1067 1067 ropivacaine 0.5% inj. item1067 1 nos 1068 1068 ropivacaine 0.75 % inj. item1068 1 nos 1069 1069 ropivacaine 0.75% inj. item1069 1 nos 1070 1070 salmetrol 50 mcg.+fluticasone 250 mcg. item1070 1 nos 1071 1071 serrotiopeptidase 10mg tab item1071 1 nos 1072 1072 sevelamer carbonate 800 mg.tab item1072 1 nos 1073 1073 sildenafil citrate 25 mg( oral) tab. item1073 1 nos 1074 1074 silodosin 8mg cap item1074 1 nos 1075 1075 simethicone +dill oil+fenel oil drop item1075 1 nos 1076 1076 sodium chloride 1.6% (ns) glass bottle item1076 1 nos 1077 1077 sodium chloride 0.45% (ns) glass bottle item1077 1 nos 1078 1078 sodium chloride 3% (ns) glass bottle item1078 1 nos 1079 1079 sodium chloride irrigation solu. (ns) item1079 1 nos 1080 1080 sodium hyaluronate 2% inj. item1080 1 nos 1081 1081 sofosbuvir 400 mg. tab. item1081 1 nos 1082 1082 solifenacin succinate tab. 10 mg. item1082 1 nos 1083 1083 solifenacin succinatetab. 5 mg. item1083 1 nos 1084 1084 spironolactone tabs ip 100mg. item1084 1 nos 1085 1085 streptomycin 0.75 gm. inj. item1085 1 nos 1086 1086 succinyl choline inj. item1086 1 nos 1087 1087 sucralfate gel 1 gm/5ml item1087 1 nos 1088 1088 sulbactum 1 gm inj item1088 1 nos 1089 1089 sulfadoxine+pyrimethamine tab 500 mg +25 mg item1089 1 nos 1090 1090 sulphadoxine+pyrimethamine syp. item1090 1 nos 1091 1091 sultamicillin 375 mg tab item1091 1 nos 1092 1092 sumatriptan 50mg tab item1092 1 nos 1093 1093 sunitinib 50 cap item1093 1 nos 1094 1094 sunscreen gel spf 15 item1094 1 nos 1095 1095 sunscreen lotion spf 30 item1095 1 nos 1096 1096 tacrolimas oint 0.1% w/w item1096 1 nos 1097 1097 tadalafil 20 mg tab item1097 1 nos 1098 1098 tamsulosin 0.2mg tab item1098 1 nos 1099 1099 teicoplanin 200 mg.inj. item1099 1 nos 1100 1100 teicoplanin 400 mg.inj. item1100 1 nos 1101 1101 tencteplase inj. 30mg item1101 1 nos 1102 1102 tencteplase inj. 40mg item1102 1 nos 1103 1103 tenofovir tab. 300 mg. tab. item1103 1 nos 1104 1104 terbinafine 1.0% w/w cream/oint item1104 1 nos 1105 1105 terbinafine tab 250 mg. item1105 1 nos 1106 1106 teriflunomide 14mg tab item1106 1 nos 1107 1107 teriflunomide 7mg tab item1107 1 nos 1108 1108 terlipressin inj 1mg item1108 1 nos 1109 1109 thiocolchicoside 4 mg.tab. item1109 1 nos 1110 1110 thiocolchicoside 8 mg.tab. item1110 1 nos 1111 1111 thyroxine sodium 25mcg tab item1111 1 nos 1112 1112 thyroxine sodium 75mcg tab item1112 1 nos 1113 1113 ticarcilin+clavanic acid 3.1 gm inj. item1113 1 nos 1114 1114 tiotropium 18mcg dry powder cap item1114 1 nos 1115 1115 tirofiban 5mg inj. item1115 1 nos 1116 1116 tissue plasminogen activator 20 mg inj item1116 1 nos 1117 1117 tissue plasminogen activator 50 mg inj item1117 1 nos 1118 1118 tobramycin sulphate inj 80mg/2ml item1118 1 nos 1119 1119 tolterodine tab. 1 mg. item1119 1 nos 1120 1120 tolterodine tab. 2 mg. item1120 1 nos 1121 1121 tolterodine tab. 4 mg. item1121 1 nos 1122 1122 tolvaptan 15 mg.tab item1122 1 nos 1123 1123 topiramate 25mg tab item1123 1 nos 1124 1124 topiramate 50mg tab item1124 1 nos 1125 1125 torsemide 20 mg.tab item1125 1 nos 1126 1126 triamacinolon eacetonide inj.40 mg./ml. item1126 1 nos 1127 1127 triamcinolone acetonide 0.1% w/w paste item1127 1 nos 1128 1128 triamcinolone acetonide inj. 10 mg./ml. item1128 1 nos 1129 1129 trimethoxpsoralen 25mg tab item1129 1 nos 1130 1130 tropicamide0.8%+phenyl ephrine 5% item1130 1 nos 1131 1131 trypsin chymotrypsin tab item1131 1 nos 1132 1132 ulinastatin 1 lacs iu inj. item1132 1 nos 1133 1133 usg jelly 250 ml item1133 1 nos 1134 1134 varicella immunoglobin inj. item1134 1 nos 1135 1135 vasopressin inj 10 units item1135 1 nos 1136 1136 vasopressin inj 20 units item1136 1 nos 1137 1137 vit d3 drop 800 iu item1137 1 nos 1138 1138 vitamin bcomplex + vitamin b12 inj item1138 1 nos 1139 1139 vitamin e drop item1139 1 nos 1140 1140 voglibose 0.2mg tab item1140 1 nos 1141 1141 voglibose 0.3mg tab item1141 1 nos 1142 1142 white soft parrafin oint/cream item1142 1 nos 1143 1143 xantinol nicotinate sustained release tablet item1143 1 nos 1144 1144 zinc sulphate syp. item1144 1 nos 1145 1145 zonisamide 100mg tab item1145 1 nos 1146 1146 zonisamide 50mg tab item1146 1 nos ...

Medical And Health Services - Rajasthan

24070784 supply of supply of drugs iv fliuids &ampamp surgical items for llfd deoli tablet aceclofenac sust, tablet acyclovir, cream acyclovir, inj adrenaline, albendazole, capsule alphalipoic acid, syrup ambroxol hyd, inj amikacin, syp antacid, tab artesunate, inj antisnake venum, cap b. com vit c mecobala latic bac, beclomethasone clotrimazole gentamicin cream, lotion calamine, syp calcium gluco, vitamin d3, cyanoclobalmin, disp tab cefixime, inje ceftriaxone, cap cephalexin, syp cetrizine, tab cetrizine, cap chlotamphenicol, ont clobetasone propionate, talcum clotrimazole, vag gel clotrimazole, syp cyporheptadine,tab diazepam, inj etophylline,tab etoricoxib, syp ferrous salt, fab folic acid, lotion gamma benzene, eye/ear drop gentamicin, inj gentamicin, tab glimerpride, inj hydrocortisone, drops iron polymaltose, lotion ketocozale, ointment lin, lignocaine hydrochloride gel, cap lincomycin, tab mefenqamic acid, drops multivitamin, vial multivitamin, ors powder, eye drop ofloxacin, susp ofloxacin, ondansetron drop, tab pcm + serratiopepptidase+ aceclofenac sod, lotion povidone iodine, oint povidone, pregnancy test card, protein powder, cap doxycillin, wax dissolve ear drop,cream silver sulphadiazine,duolin respul, gum paint, paste, botroclot solution, inhalar salbutamol, asthalin respule, in electrolytes, inj ns 100 and 500ml, inj rl 500ml, in hemocele, surgical item – abdominal belt, blood transfusion set, breast pump, cat gut nylon/silk/ vicry/ no2to3 0, cord clamp, cotton, crape bandage, dispo syringe, distillt water, foleys catheter, iv set, iv canula, micro iv set, needle, paper tape, pedia set, polythene gloves, pop bandage, procto glysis, k 90 catherter, romo drain bag, ryles tubs, sv set,sanitary pad per cotton, sodium bycard, spinal needle, suction set, surgical blade, surgical gloves, urine bag, povidone iodine solution, cap mask, cervical coller, g dress, crap bandage, rib belt, ak traction long, ortho roll,suction tube, ng tube, knee cap, endotrachial tube, nebulization mask, pouch arm sling, mesh, baby kit, bad pan, walker, dyper, cervical brass, wrist support, thumb support, canula fixer, instrument – hamer, hommans retractor, bone holding forceps, hand drill machine chargeble with battery, patella clamp, drill bit, kwire cutter, bone curate, periosteum elavator, bone chisel, t handle, bone marreo neddle, water tub for plaster,implants – small dcp, locking bolt, narrow dcp, screw, locking screw, ss wire, k wire, canulated cancelous screw,biopolor prothesis, interlock nail tebia with locking bolt, ulna squire nail, radius, screw driver, canulated screw driver, stemman pin, external fixator – connecting rodes, shanzs pin, oliv wire, ring fixator, universal clamps, spanner, c arm imagger machine, surgical sponge, dyna plast, ioban, suction tube, dental item – mouth mirror tops, gic resto, tempo restoative, dental x ray films and holder, dental x ray clip, oil spray, h file, burs, hand protaper files, protaper gp, k files,suction tip, etchent, bonding agent, gp solvent, lignocaine spray, matrix band, composite, zno euginal....

Medical And Health Services - Rajasthan

23652451 supply of medicine in govt hospital chittorgarh tab. acelofenac 100mg, tab. acelofenac 100mg + serratiopeptidase 10mg, tab. acelofenac 100mg + pcm 300mg + chlorzoxone 250mg, tab. acyclovir 400 mg, tab. albendazole 400mg, tab. alprazolam 0.25mg, tab. alprazolam 0.5mg, tab. alprazolam 0.25mg + propranolol 20mg, tab. amlodipine 2.5mg, tab. amlodipine 5mg + atenolol 50mg, tab. amlodipine besilate 5mg, tab. amoxy 250mg + clav. acid 125mg, tab. amoxy 500mg + clavulanate 125 mg, tab. atenolol 25mg, tab. atenolol 50mg, tab. atenolol 50mg + amlodipine 5mg, tab. atorvastatin 10mg, tab. atorvastatin 20mg, azithromycin susp. 200mg/5ml, tab. azithromycin 100mg dt, tab. azithromycin 250mg, tab. calcium 500mg + vit. d3, tab. carbamazepine 100mg, tab. carbamazepine 200mg, tab. cefixime 100mg disp., tab. cefixime 200mg disp., tab. cefpodoxime proxetil 200 mg, tab. cefuroxime axetil 250mg, tab. cefuroxime axetil 500mg, tab. cephalexin 250 mg dt, tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg, tab. cetrizine 10 mg (oval), tab. cinnarizine 25 mg, tab. cinnarizine 20 mg + domperidone 15 mg, tab.clarithromycin 250 mg, tab.clonazepam 0.5mg, tab.clopidogrel 75 mg+ aspirin 75mg, tab.clopidogrel 75 mg, tab. clotrimazole vaginal, tab.cotrimoxazole (trimethoprim 80 mg + sulpha 400 mg ), tab.diazepam 5 mg, tab.diclofenac 50mg + serratiopeptidase 10mg, tab. dicyclomine 10mg + mefenomic acid 250mg, tab. dicyclomine hci 10mg + pcm 500mg, tab. dothiepin 75 mg., tab. ethamsylate 500mg, inj. ethamsylate 2ml, tab. ethambutol 800 mg, tab. etophylline + theophylline, tab. ferrous salt + folic acid, tab. fexofenadine 120 mg, tab. fluconazole 50 mg, tab. fluconazole 150 mg, tab. fluoxetine 20 mg, tab. folic acid 5 mg, tab. frusemide 40 mg, tab. gliclazide 80 mg + metformin hcl 500 mg, tab. glimepiride 1 mg, tab. glimepiride 2 mg, tab. glimepiride 1 mg + metformin 500 mg, tab. glimepiride 2 mg + metformin 500 mg, tab. ibuprofen 100mg + pcm 125 mg, tab. ibuprofen 400mg + pcm 325 mg + caffeine 30 mg tab., tab. ibuprofen 400mg + pcm 500mg, tab. isosorbide mononitrate 20 mg, tab. levofloxacin 500mg, tab. lisinopril 5 mg, tab. lithium carbonate 300 mg, tab. loperamide 2 mg, tab. lorazepam 2 mg, tab. losartan 25 mg, tab. losartan patassium 50 mg, tab. losartan pota. 50 mg + amlodipine 5mg, tab. losartan potassium. 50 mg + hydroch.12.5mg, tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg, tab. metformin 500 mg, tab. metoclopromide 10 mg, tab. nimesulide 100 mg, tab. nimesulide 100mg + serratiopeptidase 10mg, tab. ofloxacin 200mg, tab. ofloxacin + ornidazole 500 mg, tab. olanzapine 5 mg, tab. ondansetron 4mg, tab. ondansetron 8mg, tab. ornidazole 500mg, tab. pantoprazole 20 mg, tab. pantoprazole 40 mg, tab. pantoprazole 40 mg + domperidone 10 mg, tab. mecobalamin 1500 mcg, tab. pheniramine maleate 25 mg, tab. phenobarbitone 30 mg, tab. phenobarbitone 60 mg, tab. pioglitazone 15 mg, tab. pioglitazone 30 mg, tab. piracetam 800 mg, tab. piroxicam disp. 20 mg, tab. prazosin 1 mg, tab. prazosin 2.5 mg, tab. prazosin 5 mg, tab. prednisolone 10 mg, tab. prochlorperazine 5 mg, tab. primaquine phosphate 7.5 mg, tab. primaquine phosphate 15 mg, tab. promethazine 25 mg, tab. quinine sulphate 300 mg, tab. rabeprazole 20 mg + domperidone 10 mg, tab. rabeprazole 20 mg, tab. ramipril 2.5 mg, tab. ramipril 5 mg, tab. ramipril 10 mg, tab. ranitidine 150 mg, tab. ranitidine 150 mg + domperidone 10 mg, tab. risperidone 2 mg, tab. sertaline 25 mg, tab. sertaline 50 mg, tab. sertaline 100 mg, tab. sildenafil 50 mg, tab. tramadol hyd. 20 mg + pcm. 500 mg, tab. temsulosin 4 mg, tab. sodium valporate 500 mg, tab. phenytoin 100 mg, tab. ursodeoxycholic acid 300 mg, tab. thyroxin 100 mg (bottle pack), tab. thyroxin 50 mg (bottle pack), tab. thyroxin 25 mg (bottle pack), tab. citicolin 500 mg, tab. nicorandil 5 mg, tab. carbemezapin 200 mg, tab. nitroglycerin 2.6 mg, tab. paracetamol 500 mg, tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg, tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg, tab. trypsin chymotrypsin, tab. zolpidem 10 mg, tab. l orthinh l asprite, tab. arither and lumethar, tab. linezolid 600mg, tab. ntg 2.6, tab. cabergoline .5 mg, tab. itraconazole 100mg, tab. mefloc 100 mg, cap. pantoprazole 40 mg + domperidone 30 mg dsr, cap. multivitamin + minerals + zinc, cap. indomethacin 25 mg, cap. indomethacin 75 mg sr, tab.lincomycin 500 mg, cap. gabapentin 300 mg + mecobalamine 500 mg, cap. aerocort rotacap, inj. dexamethasone, inj. daizepam 10mg/ 2ml, inj. diclofenac, inj. clavulanate pot. + amoxycillin i 1.2gm, inj. dopamine 40mg / ml, inj. dobutamine 250mg / 5 ml, inj. enoxaparin sodium 60mg, inj. etophylline 84.7mg + theophylline 25.3mg / 2ml, inj. carboprost 250 mg., inj. frusemide 10mg, inj. gentamicin 80 mg, inj. hydrocortisone 100mg, inj. hydroxyprogesterone 500 mg, inj. lincomycin 1ml, inj. lincomycin 2 ml, inj. lignocaine hydrochloride 2% vial, inj. mecobalamin 500 mcg, inj. metronidazole iv (f.f.s.), inj. menadione sodium 1 ml, inj. metoclopromide, inj. multivitamin 10 ml. vial, inj. multivitamin 2 ml. amp., inj. nandrolone decanoate 25mg, inj. nandrolone decanoate 50mg, inj. ondansetron 2 mg / 1ml, inj. ondansetron 2 mg / 1ml, inj. ornidazole iv, inj. oxytocin 5 i.u. / 1 ml, inj. pantoprazole 40 mg, inj. paracetamol 150 mg / 1 ml, inj. pentazocine 30 mg / 1 ml amp., inj. ceftriaxone 1gm, inj. ceftriaxone 250mg, inj. ceftriaxone 500mg, inj. ceftriaxone 250mg. + sulbactum 125 gm, inj. ceftriaxone 500mg. + sulbactum 500 mg, inj. ceftriaxone 1gm. + sulbactum 500 mg, inj. ceftriaxone 1gm. + tazobactum 125 mg, inj. anti snake venum, inj. artesunate 60 mg (with ns, cartoon pack), inj. ascorbic acid 150 mg., inj. betamethasone 4 mg, inj. adrenaline, inj. alpha beta arteether 2 ml, inj. amikacin 100 mg, inj. amikacin 250 mg, inj. amikacin 500 mg, inj. pheniramine maleate 22.7 mg, inj. piperacillin 4 gm + tazobactum 500 mg (4.5mg), inj. piroxicam 40 mg, inj. ranitidine, inj. anti rabies vaccine, inj. rabeprazole 20 mg, inj. quinine dihydrochloride, inj. promethazine 25 mg / ml amp., inj. soda. bi carb 25 ml, inj. streptokinase 15 lakh iu, inj. tetanus toxoid, inj. tobramycin 40 mg, inj. tramadol hydrochloride, inj. tramadol hydrochloride, inj. tranexamic acid 500 mg, inj. triamcinolone 40 mg, inj. urokinase 5 lakh iu, inj. d 5% (f.f.s.), inj. d 10% (f.f.s.), inj. rl.(f.f.s.), inj. d.n.s. (f.f.s.), inj. n.s. (f.f.s.), inj. alamin sn /aminowel, inj. isolyte p (f.f.s.), inj. livofloxacin (f.f.s.), inj. manitol 20% (f.f.s.), inj. oflaxacin (f.f.s.), inj. ornidazole (f.f.s.), inj. ciprfloxacin (f.f.s.)inj. oflaxcin+orniodzole, inj. tirofiban, tab. atorvastation 80 mg, inj. botropase /clotaz/troyalase, inj. meg. sulf. (50%), inj. naloxone hcl, inj. meropenam 125 mg, inj. amiodaron 150 mg, resp. levosalbutamol, resp. salbutamol+ipratropium baromide, resp. budesonide .5 mg, inj. l ornithin l asparatais, inj. n.t.g., inj. levo sulpride, inj. hydrocoritison 200mg, inj. enalpril, inj. citicoline 1 gram, inj. piracetam, inj. butrum /butadol, inj. butrum /butadol, inj. linezolid, inj. ceftriaxone, inj. vit. b1+b6+b12, inj. heperin vial, inj. erythroptrin 4000, inj. praliduximt, inj. anti d, inj. diclofenac+dicyclomine, inj. pip.+tazo., inj. ct contrast, inj. ct contrastcream. beclomethasone 0.025% + clotrimazole 1% +, cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2%, oint. permethrin 5%, cream. acyclovir, oint. diclofenac + diethyla + met. sali. +menth + ol., oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2%, oint. clobetasol 0.05 % + gentamicin 0.1 %, oint. miconazole, tab. linezolid 600, tab. napra d, tab. neproxen+domperidom 250 mg, tab. neproxen+domperidom 250 mg, tab.rabiprazole+domperidon d, tab. rabiprazole it, inj. polybion 2 ml, inj. superspas/nobalspas 2ml, inj.dilzem 1 ml, inj.meropenam 1 gram, syp.digsestiv enzyme 200ml, tab. itraconzole 100, tab. itraconzole 200, tab. betahistadin 16 mg, tab. superspas/nobalspas, inj. xylocain 2% 30ml, inj. diclofanic 1ml, inj.natuzam pragestoen 100mg (2ml), syp. mefanic+ peracitamol 60ml, syp. mefanic acid 60 ml, syp. zinc 60ml, powder dexolac 500 gram, drops hydroxyzime 15ml, syp. solvin cold / reconite / sinerest /xinplus 60 ml, ot gown, b.p. cuff, b.p. pump, fetal doppler, needle cutter (1000 ml capacity), inj. montaz/acutaz hs /tazosaf/astract/aboxon 500 mg, inj. montaz/acutaz hs /tazosaf/astract/aboxon 1 g., drop. vitamin d3 15 ml, drop. vitamin d3 30 ml, drop a to z/bivital /vitamax 15 ml, pedia set, b.t. set, ped. blood doner set, blood doner set, foleys cathater no. 12, foleys cathater no. 14, foleys cathater no. 16, foleys cathater no. 18, urin collection beg, infent feeding tube all size, gloves all size 6.5, 7, 7.5, cord clamp, mucas extractor, micropore all size, proctiolys enema, sanitory pad pack (1x10), spinal needle all size, e.c.g. electrode (chest lid.), povidoneiodine solution 100 ml, suture silk with needle no. 1.0 length 76 cms, i.v. set, dispo mask, o.t. sheet, abdominal drain kit, flatus tube, ryles tube n0. 12,14,16,18, suction tube for suction machine, i.v. canula 18 ,20 ,22, i.v. canula 24, 26, dispo syringe 2 ml, dispo syringe 3 ml, dispo syringe 5 ml, suture silk with needle no. 2.0 length 76 cms, suture silk with needle cutting 3.0 length 76 cms, suture silk with needle cutting 8.0 length 76, suture silk 3.0 roun body, corrugated drain sheet, malecot cathetor no. 28,30,32, romadrain under waetr seal bag, k 90, k 91 cathetor, prolin no. 1 length 70 cms 1x12, polyglyoclic/polyglaction suture no.1 length 90 cms 1x12, polyglyoclic/polyglaction suture no. 0.1 length90 cms 1x12, baby kit unit, delivary kit unit, catgut chromic with needle no. 1 length 76 cms 1x12, catgut chromic with needle no. 1.0 length 76 cms 1x12, catgut chromic with needle no. 2.0 length 76 cms 1x12, catgut chromic with needle no. 3.0 length 76 cms 1x12, polypropylene suture with needle no. 1.0 length 70 cms 1x12, fast adsorbing polygloctin suture with needle no. 1.0 length 90 cms 1x12, dispo syringe 10 ml, micro set, f.b.n.c. kit, h.i.v. kit, romodrin beg., res. duolin/ipralest l, res. budecort/budejest, fast absorable poliglactin 910, vypro mesh, cotton roll, baby dipper(1x5), pv gloves (1x100), orthopaedic cotton roll, plaster of paris, knife blade, dispo 50 cc, neb. mask size 0 & 1 andaudlt, neonetal kit, oxygen delivery tube with mask, nasal prongs for cpap size 0 & 1, dispo. e.t tube size 2.5/3.0/ 3.5, suction canula size 6/8/10/12, sanitizer 250 ml, cannula fixator, nebuliser mask child, nebuliser mask adult, spinal needle 23no.(pricon), gallent blade, liquid o.r.s.packet, dispo. gown (iso)...

Medical Health And Family Welfare - Rajasthan

23613109 supply of medicine in govt hospital chittorgarh 2 tab. acelofenac 100mg 3 tab. acelofenac 100mg + serratiopeptidase 10mg 4 tab. acelofenac 100mg + pcm 300mg + chlorzoxone 250mg 5 tab. acyclovir 400 mg 6 tab. albendazole 400mg 7 tab. alprazolam 0.25mg 8 tab. alprazolam 0.5mg 9 tab. alprazolam 0.25mg + propranolol 20mg 10 tab. amlodipine 2.5mg 11 tab. amlodipine 5mg + atenolol 50mg 12 tab. amlodipine besilate 5mg 13 tab. amoxy 250mg + clav. acid 125mg 14 tab. amoxy 500mg + clavulanate 125 mg 15 tab. atenolol 25mg 16 tab. atenolol 50mg 17 tab. atenolol 50mg + amlodipine 5mg 18 tab. atorvastatin 10mg 19 tab. atorvastatin 20mg 20 azithromycin susp. 200mg / 5ml 21 tab. azithromycin 100mg dt 22 tab. azithromycin 250mg 23 tab. calcium 500mg + vit. d3 24 tab. carbamazepine 100mg 25 tab. carbamazepine 200mg 26 tab. cefixime 100mg disp. 27 tab. cefixime 200mg disp. 28 tab. cefpodoxime proxetil 200 mg 29 tab. cefuroxime axetil 250mg 30 tab. cefuroxime axetil 500mg 31 tab. cephalexin 250 mg dt 32 tab. cetrizine 5 mg + pcm 500mg + phenylprop 25mg 33 tab. cetrizine 10 mg ( oval ) 34 tab. cinnarizine 25 mg 35 tab. cinnarizine 20 mg + domperidone 15 mg 36 tab.clarithromycin 250 mg 37 tab.clonazepam 0.5mg 38 tab.clopidogrel 75 mg+ aspirin 75mg 39 tab.clopidogrel 75 mg 40 tab. clotrimazole vaginal 41 tab.cotrimoxazole ( trimethoprim 80 mg + sulpha 400 mg ) 42 tab.diazepam 5 mg 43 tab.diclofenac 50mg + serratiopeptidase 10mg 44 tab. dicyclomine 10mg + mefenomic acid 250mg 45 tab. dicyclomine hci 10mg + pcm 500mg 46 tab. dothiepin 75 mg. 47 tab. ethamsylate 500mg 48 inj. ethamsylate 2ml 49 tab. ethambutol 800 mg 50 tab. etophylline + theophylline 51 tab. ferrous salt + folic acid 52 tab. fexofenadine 120 mg 53 tab. fluconazole 50 mg 54 tab. fluconazole 150 mg 55 tab. fluoxetine 20 mg 56 tab. folic acid 5 mg 57 tab. frusemide 40 mg 58 tab. gliclazide 80 mg + metformin hcl 500 mg 59 tab. glimepiride 1 mg 60 tab. glimepiride 2 mg 61 tab. glimepiride 1 mg + metformin 500 mg 62 tab. glimepiride 2 mg + metformin 500 mg 63 tab. ibuprofen 100mg + pcm 125 mg 64 tab. ibuprofen 400mg + pcm 325 mg + caffeine 30 mg tab. 65 tab. ibuprofen 400mg + pcm 500mg 66 tab. isosorbide mononitrate 20 mg 67 tab. levofloxacin 500mg 68 tab. lisinopril 5 mg 69 tab. lithium carbonate 300 mg 70 tab. loperamide 2 mg 71 tab. lorazepam 2 mg 72 tab. losartan 25 mg 73 tab. losartan patassium 50 mg 74 tab. losartan pota. 50 mg + amlodipine 5mg 75 tab. losartan potassium. 50 mg + hydroch.12.5mg 76 tab. mefenamic acid 500 mg + dicyclomine hyd. 20 mg 77 tab. metformin 500 mg 78 tab. metoclopromide 10 mg 79 tab. nimesulide 100 mg 80 tab. nimesulide 100mg + serratiopeptidase 10mg 81 tab. ofloxacin 200mg 82 tab. ofloxacin + ornidazole 500 mg 83 tab. olanzapine 5 mg 84 tab. ondansetron 4mg 85 tab. ondansetron 8mg 86 tab. ornidazole 500mg 87 tab. pantoprazole 20 mg 88 tab. pantoprazole 40 mg 89 tab. pantoprazole 40 mg + domperidone 10 mg 90 tab. mecobalamin 1500 mcg 91 tab. pheniramine maleate 25 mg 92 tab. phenobarbitone 30 mg 93 tab. phenobarbitone 60 mg 94 tab. pioglitazone 15 mg 95 tab. pioglitazone 30 mg 96 tab. piracetam 800 mg 97 tab. piroxicam disp. 20 mg 98 tab. prazosin 1 mg 99 tab. prazosin 2.5 mg 100 tab. prazosin 5 mg 101 tab. prednisolone 10 mg 102 tab. prochlorperazine 5 mg 103 tab. primaquine phosphate 7.5 mg 104 tab. primaquine phosphate 15 mg 105 tab. promethazine 25 mg 106 tab. quinine sulphate 300 mg 107 tab. rabeprazole 20 mg + domperidone 10 mg 108 tab. rabeprazole 20 mg 109 tab. ramipril 2.5 mg 110 tab. ramipril 5 mg 111 tab. ramipril 10 mg 112 tab. ranitidine 150 mg 113 tab. ranitidine 150 mg + domperidone 10 mg 114 tab. risperidone 2 mg 115 tab. sertaline 25 mg 116 tab. sertaline 50 mg 117 tab. sertaline 100 mg 118 tab. sildenafil 50 mg 119 tab. tramadol hyd. 20 mg + pcm. 500 mg 120 tab. temsulosin 4 mg 121 tab. sodium valporate 500 mg 122 tab. phenytoin 100 mg 123 tab. ursodeoxycholic acid 300 mg 124 tab. thyroxin 100 mg ( bottle pack ) 125 tab. thyroxin 50 mg ( bottle pack ) 126 tab. thyroxin 25 mg ( bottle pack ) 127 tab. citicolin 500 mg 128 tab. nicorandil 5 mg 129 tab. carbemezapin 200 mg 130 tab. nitroglycerin 2.6 mg 131 tab. paracetamol 500 mg 132 tab. trifluoperazine 1 mg + chlordiazepoxide 10 mg 133 tab. trifluoperazine 1 mg + trihexyphenidyl 2 mg 134 tab. trypsin chymotrypsin 135 tab. zolpidem 10 mg 136 tab. l orthinh l asprite 137 tab. arither and lumethar 138 tab. linezolid 600mg 139 tab. ntg 2.6 140 tab. cabergoline .5 mg 141 tab. itraconazole 100mg 142 tab. mefloc 100 mg 143 cap. pantoprazole 40 mg + domperidone 30 mg dsr 144 cap. multivitamin + minerals + zinc 145 cap. indomethacin 25 mg 146 cap. indomethacin 75 mg sr 147 tab.lincomycin 500 mg 148 cap. gabapentin 300 mg + mecobalamine 500 mg 149 cap. aerocort rotacap 150 inj. dexamethasone 151 inj. daizepam 10mg / 2ml 152 inj. diclofenac 153 inj. clavulanate pot. + amoxycillin i 1.2gm 154 inj. dopamine 40mg / ml 155 inj. dobutamine 250mg / 5 ml 156 inj. enoxaparin sodium 60mg 157 inj. etophylline 84.7mg + theophylline 25.3mg / 2ml 158 inj. carboprost 250 mg. 159 inj. frusemide 10mg 160 inj. gentamicin 80 mg 161 inj. hydrocortisone 100mg 162 inj. hydroxyprogesterone 500 mg 163 inj. lincomycin 1ml 164 inj. lincomycin 2 ml 165 inj. lignocaine hydrochloride 2% vial 166 inj. mecobalamin 500 mcg 167 inj. metronidazole iv ( f.f.s. ) 168 inj. menadione sodium 1 ml 169 inj. metoclopromide 170 inj. multivitamin 10 ml. vial 171 inj. multivitamin 2 ml. amp. 172 inj. nandrolone decanoate 25mg 173 inj. nandrolone decanoate 50mg 174 inj. ondansetron 2 mg / 1ml 175 inj. ondansetron 2 mg / 1ml 176 inj. ornidazole iv 177 inj. oxytocin 5 i.u. / 1 ml 178 inj. pantoprazole 40 mg 179 inj. paracetamol 150 mg / 1 ml 180 inj. pentazocine 30 mg / 1 ml amp. 181 inj. ceftriaxone 1gm 182 inj. ceftriaxone 250mg 183 inj. ceftriaxone 500mg 184 inj. ceftriaxone 250mg. + sulbactum 125 gm 185 inj. ceftriaxone 500mg. + sulbactum 500 mg 186 inj. ceftriaxone 1gm. + sulbactum 500 mg 187 inj. ceftriaxone 1gm. + tazobactum 125 mg 188 inj. anti snake venum 189 inj. artesunate 60 mg ( with ns, cartoon pack ) 190 inj. ascorbic acid 150 mg. 191 inj. betamethasone 4 mg 192 inj. adrenaline 193 inj. alpha beta arteether 2 ml 194 inj. amikacin 100 mg 195 inj. amikacin 250 mg 196 inj. amikacin 500 mg 197 inj. pheniramine maleate 22.7 mg 198 inj. piperacillin 4 gm + tazobactum 500 mg ( 4.5mg ) 199 inj. piroxicam 40 mg 200 inj. ranitidine 201 inj. anti rabies vaccine 202 inj. rabeprazole 20 mg 203 inj. quinine dihydrochloride 204 inj. promethazine 25 mg / ml amp. 205 inj. soda. bi carb 25 ml 206 inj. streptokinase 15 lakh iu 207 inj. tetanus toxoid 208 inj. tobramycin 40 mg 209 inj. tramadol hydrochloride 210 inj. tramadol hydrochloride 211 inj. tranexamic acid 500 mg 212 inj. triamcinolone 40 mg 213 inj. urokinase 5 lakh iu 214 inj. d 5% ( f.f.s. ) 215 inj. d 10% ( f.f.s. ) 216 inj. rl. ( f.f.s. ) 217 inj. d.n.s. ( f.f.s. ) 218 inj. n.s. ( f.f.s. ) 219 inj. alamin sn / aminowel 220 inj. isolyte p ( f.f.s. ) 221 inj. livofloxacin ( f.f.s. ) 222 inj. manitol 20% ( f.f.s. ) 223 inj. oflaxacin ( f.f.s. ) 224 inj. ornidazole ( f.f.s. ) 225 inj. ciprfloxacin ( f.f.s. ) 226 inj. oflaxcin+orniodzole 227 inj. tirofiban 228 tab. atorvastation 80 mg 229 inj. botropase / clotaz / troyalase 230 inj. meg. sulf. ( 50% ) 231 inj. naloxone hcl 232 inj. meropenam 125 mg 233 inj. amiodaron 150 mg 234 resp. levosalbutamol 235 resp. salbutamol+ipratropium baromide 236 resp. budesonide .5 mg 237 inj. l ornithin l asparatais 238 inj. n.t.g. 239 inj. levo sulpride 240 inj. hydrocoritison 200mg 241 inj. enalpril 242 inj. citicoline 1 gram 243 inj. piracetam 244 inj. butrum / butadol 245 inj. butrum / butadol 246 inj. linezolid 247 inj. ceftriaxone 248 inj. vit. b1+b6+b12 249 inj. heperin vial 250 inj. erythroptrin 4000 251 inj. praliduximt 252 inj. anti d 253 inj. diclofenac+dicyclomine 254 inj. pip.+tazo. 255 inj. ct contrast 256 inj. ct contrast 257 inj. hcg 258 inj. hcg 259 syp. dextromethorphan 10 mg + cpm + phenylprop 12.5 mg 260 syp. dextromethorphan 10 mg + phenyl hcl2 mg 261 syp. ferrous salt + folic acid 262 syp. ibuprofen 100mg + pcm 125 mg + / 5ml 263 syp. liq.paraffin + milk of magnesia 264 syp. levocetrizine 265 syp. lactulose 10gm / 15 ml 266 syp. magaldrate 480 mg + simeth. 20 mg 267 syp. ofloxacin oral 268 syp. ofloxacin + ornidazole 269 syp. paracetamol 125 mg 270 syp. paracetamol 250 mg 271 syp. pcm + cpm + sod. cit. + pph 272 syp. pcm + promehazine 273 syp. salbutamol 2 mg + ambroxol 30 mg 274 syp. roxithromycin 50 mg / 5 ml 275 syp. sucralfate 1 g / 10 ml 276 syp. terbutaline sul. + bromh. + guaip. 277 syp. disodium hydrogen citrate 278 syp. cotrimoxazole 279 syp. cpm. 2.5 mg + ammonium chloride 125mg+sod. cit. 55mg 280 syp. cyprohepatidine + tricholin citrate 281 syp. chloprheniramine 4mg + codeine 10mg + menthol 0.1mg / 5ml 282 syp. amoxycillin + clavulanate 283 syp. antacid ( mag.hy. + allum.hy. ) 284 syp. haematinic with vitamins 285 syp. albendazole + ivermectin 286 syp. m.v.+minerals 287 syp. potasium cloride 288 drops. paracetamol 100 mg 289 drops. phenylephrine hyd + cpm. maleate 290 drops. sulphacetamide eye 291 drops. tobramycin 0.3 % eye 292 drops. dexamethasone + chloramphenicol 293 drops. dexamethasone + gentamycin 294 drops. dexamethasone + ofloxacin 295 drops. chloprheniramine + pcm + phenyleph 296 drops. gentamicin eye / ear 297 drops. xylometazoline 0.05% nasal 298 drops. xylometazoline 0.01% nasal 299 lotion. povidone iodine 300 lotion. povidone iodine 301 oint. povidone 302 oint. silver sulphadiazine 303 oint. silver sulphadiazine + chlorhexidin 304 cream. mometasone furoate 305 pregnancy test card 306 protein powder 307 gel. diclofenac 308 gel. clindamycim 1% 309 gel. lignocaine hydrochloride 310 gel. piroxicam 311 gel. c.p. 312 clotrimazole 1 % talcum 313 cream. erythromycin + alov vera 314 cream. fusidic acid + beclometh. dipro. 315 lotion. gamma benzene hexachloride 1 % 316 lotion. calamine 317 lotion. ketoconazole 1 % 318 shampoo. ketoconazole 2 % 319 cream. beclomethasone 0.025% + clotrimazole 1% + 320 cream. beclomethasone 0.025% + gentamicin 0.1% + miconazole 2% 321 oint. permethrin 5% 322 cream. acyclovir 323 oint. diclofenac + diethyla + met. sali. +menth + ol. 324 oint. clobetasol propionate 0.05% + miconazole 2 % gentamicin 0.2% 325 oint. clobetasol 0.05 % + gentamicin 0.1 % 326 oint. miconazole 327 tab. linezolid 600 328 tab. napra d 329 tab. neproxen+domperidom 250 mg 330 tab. neproxen+domperidom 250 mg 331 tab.rabiprazole+domperidon d 332 tab. rabiprazole it 333 inj. polybion 2 ml 334 inj. superspas / nobalspas 2ml 335 inj.dilzem 1 ml 336 inj.meropenam 1 gram 337 syp.digsestiv enzyme 200ml 338 tab. itraconzole 100 339 tab. itraconzole 200 340 tab. betahistadin 16 mg 341 tab. superspas / nobalspas 342 inj. xylocain 2% 30ml 343 inj. diclofanic 1ml 344 inj.natuzam pragestoen 100mg ( 2ml ) 345 syp. mefanic+ peracitamol 60ml 346 syp. mefanic acid 60 ml 347 syp. zinc 60ml 348 powder dexolac 500 gram 349 drops hydroxyzime 15ml 350 syp. hydroxyzime 100 ml 351 drops. dizestive+ enzyme 30ml 352 syp. lycopin 200ml 353 sachat vitamin d3 354 inj. b. complex 2ml 355 syp. liver tonice 200ml 356 inj.liycomicen 1 ml 357 inj. liycomicen 2 ml 358 cap. progeston 200 mg 1×10 359 cap. progeston 300 mg 1×10 360 tab. spiromicyn 500mg 1×10 361 cap.vitamin e 400 mg 1×10 362 tab. ursodeoxycholic 75 mg 1×10 363 tab. ursodeoxycholic 150 mg 1×10 364 drops. vitamin d 3 30ml 365 inj. hucog / lupi hcg 5000 iu 366 inj. cefrin plus / clones / taximax 375 mg 367 inj. cefrine plus / clones / taximax 750 mg 368 inj. merasure / meritrol 125 mg 369 syp. pre probiotic 60ml 370 oil vitamin ad 60ml 371 inj. drotavarin 2ml 372 syp. bpricilne 100ml 373 tab. normaxin 10 mg 374 syp. longifene / a to z / polybion / chery 200ml 375 cervical color 376 venoline set 377 crepe bendage 6 inch 378 crepe bendage 8 inch 379 crepe bendage 10 inch 380 inj. velthamate 2ml ampule 381 inj. buscogast 2ml ampule 382 syp. racecortodil+ofloxacin 60ml 383 syp. multvitamin+antioxidant 200ml 384 syp.cefuroxime 60ml 385 syp. cepodoxim+clavonate 30 ml 386 syp. arthmether+lumither 30 ml 387 inj.montaz / acutaz hs / tazo c / aboron / astract 250mg 388 inj.cefepime 500mg 389 drops.fungal distare+ papsine 15 ml 390 drops.chlolcicolchpherol 30ml 391 syp. levocetrizine + montelokast 60ml 392 drops. lactac enzyme 15 ml 393 inj. calcicem gluconate 10ml 394 malt protin +multi vitamin 250 gram 395 inj. netilmican 10mg 396 inj. netilmican 25mg 397 inj. netilmican 50mg 398 inj.clavam / acuclav / mega cv / agclav 150mg 399 inj.clavam / acuclav / mega cv / agclav 300mg 400 tab. lycopin+multi vitamin 401 tab. traxenemic+ethamsylate 402 tab.traxenemic+mefanic acid 403 sachet powder prebioatic+ lactic acid 1 gram 404 inj. ceftzoxon+tezbactm 281.25mg 405 inj. ceftzoxon+tezbactm562.50 mg 406 inj. pipzo / pipazo / tezomac 1.125 mg 407 tab. diclofenic+chymotripcin 408 inj.ampoxin / megapen 250 mg 409 inj. ampoxin / megapen 500 mg 410 inj. ampoxin / megapen 1 gm 411 mop ped 412 syp. health ok / mec total 100ml 413 inj. mefentermin 10 ml 414 swine flue vaccine .5 ml 415 swine flue vaccine 5 ml 1 vial 416 bp instrument ( mercury ) diamond / pagoda 417 n 95 mask 418 ppe kit iso certified 419 black googles for catractract operation 420 r.l. ( glass bottle ) 421 n.s. 500 ml ( glass bottle ) 422 n.s. 100 ml 423 inj. tazor / pipzo / tezomac / pipazo 4.5 mg 424 tab. l.n.z. / linzolid 600 mg 1x4 425 tab. ferobact 200 mg 1x10 426 tab. ferobact 300 mg 1x10 427 drops. atrex / droxin / hizet / hicope 428 tab. nynes / doxinate plus / pyrodox plus 1x10 429 inj. acuclav / agclav / mega cv 150 mg 430 inj. acuclav / agclav / mega cv 300 mg 431 tab. chymoral plus / sistal plus 1x10 432 tab. chymoral fort / sistal fort 1x15 433 syp. moxclav / mega cv / autoclav / slox 60 ml 434 syp. moxclav / mega cv / autoclav / slox ds 435 drops. moxclav / mega cv / slox 15 ml 436 tab. reblet it / rebimac it 437 tab. reblet d / rebimac d 438 tab. enzoflam / signoflam / sumoflam 439 sachet agysee d / argipreg 440 syp. piclin / cremafine 100 ml 441 inj. clindmicin 2ml 1 ampule 442 syp. amrodil s / solvin ls / trendil x / cafcail 60 ml 443 syp. solvin cold / reconite / sinerest / xinplus 60 ml 444 ot gown 445 b.p. cuff 446 b.p. pump 447 fetal doppler 448 needle cutter ( 1000 ml capacity ) 449 inj. montaz / acutaz hs / tazosaf / astract / aboxon 500 mg 450 inj. montaz / acutaz hs / tazosaf / astract / aboxon 1 g. 451 drop. vitamin d3 15 ml 452 drop. vitamin d3 30 ml 453 drop a to z / bivital / vitamax 15 ml 454 pedia set 455 b.t. set 456 ped. blood doner set 457 blood doner set 458 foleys cathater no. 12 459 foleys cathater no. 14 460 foleys cathater no. 16 461 foleys cathater no. 18 462 urin collection beg 463 infent feeding tube all size 464 gloves all size 6.5, 7, 7.5 465 cord clamp 466 mucas extractor 467 micropore all size 468 proctiolys enema 469 sanitory pad pack ( 1x10 ) 470 spinal needle all size 471 e.c.g. electrode ( chest lid. ) 472 povidoneiodine solution 100 ml 473 suture silk with needle no. 1.0 length 76 cms 474 suture silk with needle no. 2.0 length 76 cms 475 suture silk with needle cutting 3.0 length 76 cms 476 suture silk with needle cutting 8.0 length 76 477 suture silk 3.0 roun body 478 corrugated drain sheet 479 malecot cathetor no. 28, 30, 32 480 romadrain under waetr seal bag 481 k 90, k 91 cathetor 482 prolin no. 1 length 70 cms 1x12 483 polyglyoclic / polyglaction suture no.1 length 90 cms 1x12 484 polyglyoclic / polyglaction suture no. 0.1 length90 cms 1x12 485 baby kit unit 486 delivary kit unit 487 catgut chromic with needle no. 1 length 76 cms 1x12 488 catgut chromic with needle no. 1.0 length 76 cms 1x12 489 catgut chromic with needle no. 2.0 length 76 cms 1x12 490 catgut chromic with needle no. 3.0 length 76 cms 1x12 491 polypropylene suture with needle no. 1.0 length 70 cms 1x12 492 fast adsorbing polygloctin suture with needle no. 1.0 length 90 cms 1x12 493 i.v. set 494 dispo mask 495 o.t. sheet 496 abdominal drain kit 497 flatus tube 498 ryles tube n0. 12, 14, 16, 18 499 suction tube for suction machine 500 i.v. canula 18 , 20 , 22 501 i.v. canula 24, 26 502 dispo syringe 2 ml 503 dispo syringe 3 ml 504 dispo syringe 5 ml 505 dispo syringe 10 ml 506 micro set 507 f.b.n.c. kit 508 h.i.v. kit 509 romodrin beg. 510 res. duolin / ipralest l 511 res. budecort / budejest 512 fast absorable poliglactin 910 513 vypro mesh 514 cotton roll 515 baby dipper ( 1x5 ) 516 pv gloves ( 1x100 ) 517 orthopaedic cotton roll 518 plaster of paris 519 knife blade 520 dispo 50 cc 521 neb. mask size 0 & 1 andaudlt 522 neonetal kit 523 oxygen delivery tube with mask 524 nasal prongs for cpap size 0 & 1 525 dispo. e.t tube size 2.5 / 3.0 / 3.5 526 suction canula size 6 / 8 / 10 / 12 527 sanitizer 250 ml 528 cannula fixator 529 nebuliser mask child 530 nebuliser mask adult 531 spinal needle 23no. ( pricon ) 532 gallent blade 533 liquid o.r.s.packet 534 dispo. gown ( iso ) ...

Rajasthan University Of Health Science - Rajasthan

23529414 nit for annual rate contract of various chemicals & reagents and consumable items for central lab (biochemistry, pathology & microbiology) dept. at hospital of ruhs college of medical sciences, jaipur dengue test elisa for igm 3 dengue test elisa for igg 4 dengue test elisa for ns1 antigen 5 chikungunya test elisa for igm 6 toxoplasma igm elisa 7 toxoplasma igg elisa 8 cytomegalovirus igm elisa 9 cytomegalovirus igg elisa 10 rubella igm elisa 11 rubella igg elisa 12 herpes simplex 1 & 2 igm elisa 13 herpes simplex 1 & 2 igg elisa 14 scrub typhus igm elisa 15 hepatitis a igm elisa 16 hbsag elisa 17 anti hbs elisa 18 hbeag elisa 19 anti hbe elisa 20 anti hbc igm elisa 21 anti hbc igg elisa 22 hepatitis e igm elisa 23 chikungunya rapid test card for igm 24 dengue rapid test card for igm, igg and ns1 antigen 25 tissue roll 26 disposable polyethylene gloves 27 disposable petridish 100 mm ( individually packed ) 28 albert stain ( a + b each ) 29 antinuclear antibody ( ana ) elisa 30 ds dna elisa 31 chlamydia trachomatis igm elisa 32 cled media 33 corn meal agar 34 disposable individually packed centrifuge tube conical bottom 50 ml capacity 35 disposable sterile swab ( individually packed ) 36 thioglycollate medium 37 hcv igm elisa 38 hcv rapid test card 39 india ink 40 occult blood test for stool sample 41 sabouraud dextrose agar 42 urea ( 40% ) solution 43 edta vial 44 diamond pencil 45 pregnancy test card 46 vdrl rapid kit 47 hiv rapid kit 48 z.n. kit for afb 49 kits for ra factor 50 kits for crp 51 kits for aslo 52 kits for hbsag 53 kits for dengue ( for igm and igg ) 54 kits for malaria antigen test 55 kits for widal test ( kit of 5 ml of each antigen ) 56 absolute alcohol 57 methanol ar 58 filter paper 59 distilled water 60 immersion oil for microscopy 61 glass slide 75x25x1.33 mm 62 urine / sputum container plastic 63 cover slip 22x22 mm 64 plain tube 65 tips 100 1000 μl 66 tips 10 200 μl 67 vacutainer serum ( clot activator ) 68 sample storage vials ( plastic ) 69 acetone 70 autoclave indicator strip 71 blood agar base 72 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 73 brain heart infusion broth 74 disposable sterile test tube with swab individually packed 75 ecoshield 76 face mask 77 filter paper sheet whartman no. 1 78 glass test tube 100 mm x 12 mm without rim 79 glass test tube 75 mm x 12 mm without rim 80 h2o2 ( 30% ) 81 koh pellets 82 kovcks indole reagents 83 liquid paraffin 84 macconkey agar 85 macconkey broth 86 mannitol salt agar 87 mccartney bottle 88 microcentrifuge tube with cap capacity 2 ml 89 mueller hinton agar 90 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 91 nutrient agar 92 oxidase disc 93 peptone water 94 petridish glass 100 mm 95 petridish glass 75 mm 96 ph indicator strips 6.5 to 9 ph measurement 97 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 98 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 99 selenite f broth bacteriological 100 sim agar 101 simmons citrate agar 102 sodium chloride 103 sodium hydroxide pellets 104 sterile storage vial 2 ml capacity 105 sterile storage vial 5 ml capacity 106 sterile transport medium ( stuart medium ) with test tube and swab individually packed 107 stool container with spoon 108 triple layer mask 109 tsi agar 110 urea agar base 111 viral transport medium 112 gram stain kit 113 amikacin 30 μg 114 amoxycillin 30 μg 115 amoxyclav 20 / 10 μg 116 ampicillin + sulbactum 117 amphotericin b 118 azithromycin 15 μg 119 aztreonam 30μg 120 bacitracin ( 0.04 unit ) 121 bile esculin disc 122 cefepime 30 μg 123 cefixime 5 μg 124 cefoperazone + sulbactum 75 / 10 μg 125 cefoperazone 75 μg 126 cefotaxime 30 μg 127 cefotetan 128 cefoxitin 30 μg 129 cefpirome 130 cefpodoxime 10 μg 131 ceftazidime + clavulanic acid 30 / 10μg 132 ceftazidime 30 μg 133 ceftriaxone 30 μg 134 ceftriaxone + clavulanic acid 30 / 10μg 135 cefuroxime 30 μg 136 cephalexin 30 μg 137 chloramphenicol 30 μg 138 ciprofloxacin 5 μg 139 clarithromycin 15 μg 140 clindamycin 2 μg 141 clotrimazole 142 colistin 143 cotrimoxazole 25 μg 144 doripenam 10μg 145 doxycycline 30 μg 146 ertapenam 10μg 147 erythromycin 10 μg 148 faropenam 149 fluconazole 150 flucytosine 151 fosfomycin 200 μg 152 furazolidone 50 μg 153 fusidic acid 154 gentamicin 120μg 155 gentamicin 30μg 156 gentamycin 10 μg 157 hippurate 158 imipenam 10 μg 159 imipenam + edta 160 itraconazole 161 kanamycin 162 ketoconazole 15 μg 163 levofloxacin 5μg 164 lincomycin 10 μg 165 linezolid 30 μg 166 meropenam 10 μg 167 moxalactum 168 nalidixic acid 30μg 169 netilmycin 30 μg 170 nitrofurantoin 300 μg 171 norfloxacin 10 μg 172 novobiocin 173 nystatin 174 ofloxacin 5 μg 175 onpg 176 optochin 177 oxacillin 1 μg 178 piperacillin + tazobactum 100 / 10 μg 179 piperacillin 100 μg 180 polymyxin b 30 units 181 pristinomycin 15μg 182 teicoplanin 30 μg 183 tetracycline 30 μg 184 ticarcillin+clavulanic acid 75 / 10 μg 185 ticarcillin75μg 186 tigecyclin 15μg 187 tobramycin 10 μg 188 v factor 189 vancomycin 30 μg 190 voriconazole 1 μg 191 x + v factor 192 x factor 193 dept. of pathology 194 combi stick urine strips 195 leishmans stain 196 buffer for leishman stain ph6.8 197 anti – a ( monoclonal ) 10ml 198 anti – b ( monoclonal ) 10ml 199 anti – d ( monoclonal ) 10ml 200 trisodium citrate 3.8% 201 pt test kits 202 aptt test kits 203 ethanol lr 204 methanol lr 205 distilled water 206 csf diluting fluid 207 wbc diluting fluid 208 immersion oil for microscopy 209 hypochlorite solution 210 glass test tube 100 mm x 12 mm without rim 211 glass test tube 75 mm x 12 mm without rim 212 spirit 213 gauze roll 214 disposable syringe 2ml 215 disposable syringe 5ml 216 disposable syringe 10ml 217 disposable syringe 20ml 218 disposable needle 22g 219 disposable gloves latex 7½ inch 220 disposable gloves latex 7 inch 221 disposable gloves latex 6 inch 222 tourniquet 223 cotton roll 224 edta vial 225 lancet 226 adhesive tap 2 inch roll 227 2.5% sodium hypochlorite 228 40% formaldehyde formalin 229 tissue paper rolls 230 glass slide 75x25x1.33 mm 231 pasture pipettes with rubber teat ( 10 ml ) 232 urine container plastic 233 cover slip 20x20 mm 234 filter paper watsman 1x90mm 235 disposable esr pipette 236 capillary tube for ct 237 tips 100 1000 μl 238 tips 10 200 μl 239 face mask 240 test tube plastic 5 ml for esr 241 dept. of biochemistry 242 albumin 243 acid phosphatase 244 alk phasphate 245 amylase 246 alt ( sgpt ) 247 ast ( sgot ) 248 blood urea 249 bilirubin total 250 bilirubin direct 251 calcium 252 cholesterol 253 hdl kit with calibrator an qc 254 creatinine 255 glucose 256 ck mb kit with calibrator 257 ck nac 258 hba1c kit with calibrator 259 t. protein 260 s.magnecium 261 triglycerides 262 s. ldh 263 uric acid 264 serum phosphorous 265 lipase kit with calibrator 266 ggt 267 csf protein 268 csf protein control 269 ck mb control 270 hb1ac control level i and ii 271 multi calibrator 3 272 quality control ( normal ) level 2 273 quality control ( pathological / abnormal ) level 3 274 hypochlorite solution 275 methonol 70% 276 aliquot tubes up to 1.0 ml 277 plain tube without cap 278 plain tube with cap 279 tips 100 1000 μl 280 tips 10 200 μl 281 vacutainer ( fluoride ) 282 vacutainer serum clot activator 283 sample storage vials ( plastic ) 284 tissue paper rolls 285 distilled water...

Rajasthan University Of Health Science - Rajasthan

23489221 nit for annual rate contract of various chemicals and reagents and consumable items for central lab at ruhs hospital of medical sciences , jaipur 2 dengue test elisa for igm 3 dengue test elisa for igg 4 dengue test elisa for ns1 antigen 5 chikungunya test elisa for igm 6 toxoplasma igm elisa 7 toxoplasma igg elisa 8 cytomegalovirus igm elisa 9 cytomegalovirus igg elisa 10 rubella igm elisa 11 rubella igg elisa 12 herpes simplex 1 & 2 igm elisa 13 herpes simplex 1 & 2 igg elisa 14 scrub typhus igm elisa 15 hepatitis a igm elisa 16 hbsag elisa 17 anti hbs elisa 18 hbeag elisa 19 anti hbe elisa 20 anti hbc igm elisa 21 anti hbc igg elisa 22 hepatitis e igm elisa 23 chikungunya rapid test card for igm 24 dengue rapid test card for igm, igg and ns1 antigen 25 tissue roll 26 disposable polyethylene gloves 27 disposable petridish 100 mm ( individually packed ) 28 albert stain ( a + b each ) 29 antinuclear antibody ( ana ) elisa 30 ds dna elisa 31 chlamydia trachomatis igm elisa 32 cled media 33 corn meal agar 34 disposable individually packed centrifuge tube conical bottom 50 ml capacity 35 disposable sterile swab ( individually packed ) 36 thioglycollate medium 37 hcv igm elisa 38 hcv rapid test card 39 india ink 40 occult blood test for stool sample 41 sabouraud dextrose agar 42 urea ( 40% ) solution 43 edta vial 44 diamond pencil 45 pregnancy test card 46 vdrl rapid kit 47 hiv rapid kit 48 z.n. kit for afb 49 kits for ra factor 50 kits for crp 51 kits for aslo 52 kits for hbsag 53 kits for dengue ( for igm and igg ) 54 kits for malaria antigen test 55 kits for widal test ( kit of 5 ml of each antigen ) 56 absolute alcohol 57 methanol ar 58 filter paper 59 distilled water 60 immersion oil for microscopy 61 glass slide 75x25x1.33 mm 62 urine / sputum container plastic 63 cover slip 22x22 mm 64 plain tube 65 tips 100 1000 μl 66 tips 10 200 μl 67 vacutainer serum ( clot activator ) 68 sample storage vials ( plastic ) 69 acetone 70 autoclave indicator strip 71 blood agar base 72 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 73 brain heart infusion broth 74 disposable sterile test tube with swab individually packed 75 ecoshield 76 face mask 77 filter paper sheet whartman no. 1 78 glass test tube 100 mm x 12 mm without rim 79 glass test tube 75 mm x 12 mm without rim 80 h2o2 ( 30% ) 81 koh pellets 82 kovcks indole reagents 83 liquid paraffin 84 macconkey agar 85 macconkey broth 86 mannitol salt agar 87 mccartney bottle 88 microcentrifuge tube with cap capacity 2 ml 89 mueller hinton agar 90 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 91 nutrient agar 92 oxidase disc 93 peptone water 94 petridish glass 100 mm 95 petridish glass 75 mm 96 ph indicator strips 6.5 to 9 ph measurement 97 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 98 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 99 selenite f broth bacteriological 100 sim agar 101 simmons citrate agar 102 sodium chloride 103 sodium hydroxide pellets 104 sterile storage vial 2 ml capacity 105 sterile storage vial 5 ml capacity 106 sterile transport medium ( stuart medium ) with test tube and swab individually packed 107 stool container with spoon 108 triple layer mask 109 tsi agar 110 urea agar base 111 viral transport medium 112 gram stain kit 113 amikacin 30 μg 114 amoxycillin 30 μg 115 amoxyclav 20 / 10 μg 116 ampicillin + sulbactum 117 amphotericin b 118 azithromycin 15 μg 119 aztreonam 30μg 120 bacitracin ( 0.04 unit ) 121 bile esculin disc 122 cefepime 30 μg 123 cefixime 5 μg 124 cefoperazone + sulbactum 75 / 10 μg 125 cefoperazone 75 μg 126 cefotaxime 30 μg 127 cefotetan 128 cefoxitin 30 μg 129 cefpirome 130 cefpodoxime 10 μg 131 ceftazidime + clavulanic acid 30 / 10μg 132 ceftazidime 30 μg 133 ceftriaxone 30 μg 134 ceftriaxone + clavulanic acid 30 / 10μg 135 cefuroxime 30 μg 136 cephalexin 30 μg 137 chloramphenicol 30 μg 138 ciprofloxacin 5 μg 139 clarithromycin 15 μg 140 clindamycin 2 μg 141 clotrimazole 142 colistin 143 cotrimoxazole 25 μg 144 doripenam 10μg 145 doxycycline 30 μg 146 ertapenam 10μg 147 erythromycin 10 μg 148 faropenam 149 fluconazole 150 flucytosine 151 fosfomycin 200 μg 152 furazolidone 50 μg 153 fusidic acid 154 gentamicin 120μg 155 gentamicin 30μg 156 gentamycin 10 μg 157 hippurate 158 imipenam 10 μg 159 imipenam + edta 160 itraconazole 161 kanamycin 162 ketoconazole 15 μg 163 levofloxacin 5μg 164 lincomycin 10 μg 165 linezolid 30 μg 166 meropenam 10 μg 167 moxalactum 168 nalidixic acid 30μg 169 netilmycin 30 μg 170 nitrofurantoin 300 μg 171 norfloxacin 10 μg 172 novobiocin 173 nystatin 174 ofloxacin 5 μg 175 onpg 176 optochin 177 oxacillin 1 μg 178 piperacillin + tazobactum 100 / 10 μg 179 piperacillin 100 μg 180 polymyxin b 30 units 181 pristinomycin 15μg 182 teicoplanin 30 μg 183 tetracycline 30 μg 184 ticarcillin+clavulanic acid 75 / 10 μg 185 ticarcillin75μg 186 tigecyclin 15μg 187 tobramycin 10 μg 188 v factor 189 vancomycin 30 μg 190 voriconazole 1 μg 191 x + v factor 192 x factor 193 dept. of pathology 194 combi stick urine strips 195 leishmans stain 196 buffer for leishman stain ph6.8 197 anti – a ( monoclonal ) 10ml 198 anti – b ( monoclonal ) 10ml 199 anti – d ( monoclonal ) 10ml 200 trisodium citrate 3.8% 201 pt test kits 202 aptt test kits 203 ethanol lr 204 methanol lr 205 distilled water 206 csf diluting fluid 207 wbc diluting fluid 208 immersion oil for microscopy 209 hypochlorite solution 210 glass test tube 100 mm x 12 mm without rim 211 glass test tube 75 mm x 12 mm without rim 212 spirit 213 gauze roll 214 disposable syringe 2ml 215 disposable syringe 5ml 216 disposable syringe 10ml 217 disposable syringe 20ml 218 disposable needle 22g 219 disposable gloves latex 7½ inch 220 disposable gloves latex 7 inch 221 disposable gloves latex 6 inch 222 tourniquet 223 cotton roll 224 edta vial 225 lancet 226 adhesive tap 2 inch roll 227 2.5% sodium hypochlorite 228 40% formaldehyde formalin 229 tissue paper rolls 230 glass slide 75x25x1.33 mm 231 pasture pipettes with rubber teat ( 10 ml ) 232 urine container plastic 233 cover slip 20x20 mm 234 filter paper watsman 1x90mm 235 disposable esr pipette 236 capillary tube for ct 237 tips 100 1000 μl 238 tips 10 200 μl 239 face mask 240 test tube plastic 5 ml for esr 241 dept. of biochemistry 242 albumin 243 acid phosphatase 244 alk phasphate 245 amylase 246 alt ( sgpt ) 247 ast ( sgot ) 248 blood urea 249 bilirubin total 250 bilirubin direct 251 calcium 252 cholesterol 253 hdl kit with calibrator an qc 254 creatinine 255 glucose 256 ck mb kit with calibrator 257 ck nac 258 hba1c kit with calibrator 259 t. protein 260 s.magnecium 261 triglycerides 262 s. ldh 263 uric acid 264 serum phosphorous 265 lipase kit with calibrator 266 ggt 267 csf protein 268 csf protein control 269 ck mb control 270 hb1ac control level i and ii 271 multi calibrator 3 272 quality control ( normal ) level 2 273 quality control ( pathological / abnormal ) level 3 274 hypochlorite solution 275 methonol 70% 276 aliquot tubes up to 1.0 ml 277 plain tube without cap 278 plain tube with cap 279 tips 100 1000 μl 280 tips 10 200 μl 281 vacutainer ( fluoride ) 282 vacutainer serum clot activator 283 sample storage vials ( plastic ) 284 tissue paper rolls 285 distilled water...

North Western Railway - Rajasthan

23430876 supply of different type of medicines, lornoxicam 8mg. with paracetamol atleast 325mg. tab./cap., ketorolac tromethamine 10mg. dispersible tab., analgesic aerosol spray containing diclofenac diethylammonium atleast 1.16% with menthol 5% with linseed oil 3% and methyl salicylate 10% in atleast 75gm. canister, amoxycillin 250mg. dispersible tab. for kids, cefoperazone sodium 1gm. inj. with diluent, lincomycin 30mg./ml injection 2ml amp....

Government Medical College - Rajasthan

23054639 supply of chemical and reagents for microbiology lab : rate contract for 02 years 1 oxalic acid ( powder ) ( 500 gm ) 2 sodium hypochlorite ( liquid 10% ) solution ( 35 lt ) 3 acetone ( 500 ml ) 4 liquid ammonia ( 500 ml ) 5 absolute alcohol ( 500 ml ) 6 ammonium sulphate ( 500 gm ) 7 glacial acetic acid ( 500 ml ) 8 urea powder ( 500 gm ) 9 paradimethyl amino benzaldehyde ( 100 gm ) 10 ammonium oxalate crystals ( 500 gm ) 11 actidione ( 1 gm ) 12 phenyl crystal ( 500 gm ) 13 ferric ammonium sulphate ( 100 gm ) 14 di sodium hydrogen phosphate ( na2hpo4 ) ( 100 gm ) 15 sodium hydrogen phosphate ( nah2po4 ) ( 100 gm ) 16 sulphuric acid conc. ( 5 lt ) 17 nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) ( 5 gm ) 18 basic carbolfuschin powder ( practical grade ) ( 100 gm ) 19 barium chloride ( 100 gm ) 20 glycerol ( 500 ml ) 21 glucose anhydrous ( 500 gm ) 22 iso amyl alcohol ( 500 ml ) 23 malachite green ( practical grade ) ( 100 gm ) 24 sodium nitrite ( 100 gm ) 25 sulphanililc acid ( 100 gm ) 26 toluidine blue ( 100 gm ) 27 magnesium sulphate ( mgso4.7h2o ) ( 100 gm ) 28 n acetyl l cystine ( 25 gm ) 29 formaldehyde solution 40 % ( 5 lt ) 30 nigrocin ( himedia ) ( 100 gm ) 31 koh pallets ( 500 gm ) 32 naoh pallets ( 500 gm ) 33 concentrated hcl ( 500 ml ) 34 albert’s stain a and b for diphtheria ( staining solution ) ( 100 ml ) 35 brilliant cresyl blue ( 100 ml ) 36 liquid paraffin ( 500 ml ) 37 sodium acetate ( 500 gm ) 38 sodium sulphite ( 500 gm ) 39 sodium carbonate ( 500 gm ) 40 potassium bromide ( 500 gm ) 41 sodium thiosulphate ( 500 gm ) 42 spirit ( 500ml ) 43 poly vinyl alcohol ( 250ml ) 44 ammonium chloride ( 500 gm ) 45 sodium meta bisulphite ( 500 gm ) 46 sodium bicarbonate extra pure ( 500 gm ) 47 crystal violet ( practical grade ) ( 100 gm ) 48 bromothymol blue powder ( 25 gm ) 49 cetylpyridinium chloride ( 100 gm ) 50 alpha naphthylamine ( 100 gm ) 51 sodium deoxycholate ( 100 gm ) 52 magnesium citrate ( 500 gm ) 53 asparagine ( 5 gm ) 54 sodium citrate ( 500 gm ) 55 lactophenol ( cotton blue ) ( 100 ml ) 56 omera reagent / v p reagent ( 100 ml ) 57 potassium tellurite ( 25 gm ) 58 ferric chloride ( 500 gm ) 59 cyanogen bromide ( 100 gm ) 60 andrade’s indicator ( 125 ml ) 61 dimethyl sulphoxide ( dmso ) ( 500 ml ) 62 iodine crystal ( 500 gm ) 63 potassium idodide ( 250 gm ) 64 safarnine ( 100 gm ) 65 neutral red ( 100 gm ) 66 dpx mount ( 250 ml ) 67 paradimethylaminocinnamaldehyde ( 100 gm ) 68 hydrogen peroxide ( h2o2 ) ( 100 ml ) 69 alpha – naphthalamine ( 100 gm ) 70 sodium hippurate ( 100 gm ) 71 alpha – naphthol ( 100 gm ) 72 creatinine ( 100 gm ) 73 l – pyrolidonyl b – nephthalamide ( 50 gm ) 74 gelatin ( 500 gm ) 75 sodium borohydrate ( 100 gm ) 76 cobalt chloride ( 100 gm ) 77 agarrose with high eeo ( 100 gm ) 78 dextrose anhydrous ( 500 gm ) 79 lactose ( 500 gm ) 80 maltose ( 500 gm ) 81 mannitol ( 500 gm ) 82 dulcitol ( 500 gm ) 83 sucrose ( 500 gm ) 84 xylose ( 500 gm ) 85 arabinose ( 500 gm ) 86 sorbitol ( 500 gm ) 87 schaudinns solution ( 250 ml ) 88 microsporidiatrichome blue stain ( 250 ml ) 89 merthiolate iodine formalin ( 250 ml ) 90 chloroform ( 500 ml ) 91 formamide ( 500 ml ) 92 methylene blue ( 25 gm ) 93 nonidet p 40 ( 100 ml ) 94 phosphoric acid ( 500 ml ) 95 potassium di hydrogen phosphate ( 500 gm ) 96 potassium permanganate ( 500 gm ) 97 isopropanol ( 500 ml ) 98 sodium bicarbonate ( 500 gm ) 99 giemsa stain solutoin ( 1 kit ) 100 disposable syringe 5ml with needle 101 disposable syringe 10ml with needle 102 disposable syringe 20ml with needle 103 disposable syringe 50 ml with needle 104 measuring cylinder 50 ml plastic 105 measuring cylinder 100 ml plastic 106 measuring cylinder 500 ml plastic 107 measuring cylinder 1000 ml plastic 108 test tube racks 48 holes for 12 mm test tubes 109 test tube racks 48 holes for 15 mm test tubes 110 nitril gloves medium size 6.5 each 111 nitril gloves small size 6.5 each 112 latex gloves 6.5” unsterilized ( pack of 100 pc. ) 113 latex gloves 7.5” unsterilized ( pack of 100 pc. ) 114 disposable needle 18 gauge 115 staining jars 100 ml 116 plastic dropping bottle 125 ml 117 plastic dropping bottles 500 ml 118 sterile disposable petri dish 90mm 119 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 120 disposable plastic test tubes 75 x12 mm 121 beaker plastic various size 50 ml. 122 beaker plastic various size 100 ml. 123 beaker plastic various size 250 ml. 124 beaker plastic various size 500 ml . 125 beaker plastic various size 1000 ml. 126 thumb press disposable dropper 127 screw cap plastic vial 3 ml disposable with label self standing 128 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 129 vacutainer ( 5 ml without edta ) 130 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 131 . sterile cotton swab ( i