University of Rajasthan - Rajasthan

37663529 supply of chemical, glassware and consumable , at botany department, uor, jaipur , chemical items : , acetone extrapure , 99% , biotin extrapure , 99% , boric acid extrapure ar, 99% , calcium chloride ( fused ) pure , 90 % 95% , calcium chloride dehydrate extrapure ar , 99.5% , calcium nitrate tetrahydrateextrapurear , acs , 99% , chloroform extrapure , 99% , coomasiebrillant blue for molecular biology , cooper sulphate extrapure ar , 99.5% , cooper sulphate pentahydrateextrapure ar , acs , cooper sulphate.7h2o , cupic chloride extrapure ar , acs exiplus, , dichlorimethaneextrapure ar , 99.5% , diethyl ether extrapure ar , 99.5% , dimethyl sulfoxideextrapure ar, 99.5% , dipotassium hydrogen phosphate extrapure ar, 99.5% , dimethyl sulfoxide ( sigma aldich ) , dipotassium phosphate extrapure ar , 99.5% , ethanol ( pack of 20 ) , hplc –grade methyl tertiary butyl ether ( mtbe ) for hplc, 99.5% , isoamyl alcohol extrapure ar, 99% , magnesium sulphate hepatahydrateextrapure ar, 99% , manganese ( ii ) chloride tetrahydrateextrapure ar 99% , manganese bi chloride , methanol extrapure ar, 99.8% , monopotassium phosphate , n hexane pure, 99% , petroleum ether ( 40 60*c ) extrapure ar , petroleum ether ( 60 80*c ) extrapure ar , petroleum ether ( 80 100*c ) extrapure ar , phenol extrapure ar, 99.5% , phosphoric acid extrapure ar , acs, 85% , potassium chloride extrapure ar, 99.5% , potassium hydrogen phosphate extrapure ar, 99.5% , potassium hydroxide extrapure ar, 85% , potassium nitrate , sodium bicarbonate extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , vitamin –b1 , ethidium bromide , for molecular biology , tris , free base, for molecular biology , n, n, n, n cetyltrimethyl ammonium bromide , rm 4867 , muller hinton agar ( mha ) himedia , polyvinylpyrrolidone ( pvp ) k 30 , agarose , silica gel 60 120 mesh , silica gel self –indicating , deionized water , taq polymerase ( 1 unit / ul ) , rnase a ( dnase free ) 20mg / ml , 1kb ladder dna , bromophenol blue extrapure ar , 10x tbe , gelelectrophoresis power supply , vortexmixture , 20*c pcr minicoler , 96 places , 0.2 capacity , 20* c minicoler with gel filled cover 32 places , 1.5 ml capacity , dntp mix , 100ml ( 25mm each ) , 1000ul , cytokinin , auxin , gibbrellic acid , acetic anhydride , triton x100 , lactic acid , aneline blue , toluidere blue , acetocarmine , basic fuschine , litmus milk , fast green , gluteraldehyde , osmium tetraoxide , yeast extract mannitol ( yem ) , mannitol , agar , ms medium prepared murashige&skoog medium w / cacl2 , vitamins & mes ; w / o surose& agar , gold nano particles dispersion ( spherical ) ( au20 ) , 0.05mg / ml citrale. 0.1mm in pbs , zinc oxide nano powder type i , silver nanoparticals dispersion ( spherical ) ( ag20 ) 0.02mg / ml in citrate 5mm , graphene platelet nano powder ( gpn type i ) , cupic oxide nano powder , carbon nano tubes multiwalled , twin 20 , potato dextrose agar , potato detose broth , sabrourauddetoxe agar , yeast extract powder , bushellhaas broth , parafilm m roll 125’ lx4w , plant dna isolation kit , chloroplatinic acid hexahydrate , ethyl cellulose , 1 butyle 3 methylelimidazolium iodide , 4 tert butyl pyridine ( tbp ) , guanidiniumthiocyanate , valenonitrile chemical , dye solar cell sample , terpineol , titanium ( iv ) oxide , fto , ti nanoxide , iodolyte pn 50 , iodolyte z 150 , lithium iodide , silica gel for column , hexane >95% , 1 –octadecene , oleylamine , glassware items : , test tube ( culture ) without rim 15ml [ 9910007 ] , test tube ( culture ) without rim 20ml [ 9910008 ] , test tube ( culture ) without rim 30ml [ 9910010 ] , 10x tbe [ ml011 ] , pcr minicooler 20°c, 96 place, 0.2ml capacity [ 525110 ] , pcr minicooler 20°c, 32 place, 1.5ml capacity [ 526030 ] , round bottom flask 250ml [ 4260021 ] , autoclave bages 12x24 [ 550022 ] , autoclave indicator tape 075x500 [ 680000 ] , beaker 1000ml [ 1000d29 ] , beaker 100ml 1000d16 ] , beaker 2000ml [ 1000d30 ] , beaker 250ml [ 1000d21 ] , beaker 500ml [ 1000d24 ] , beaker 50ml [ 1000d12 ] , bod bottles 300ml [ 1250022 ] , burette boroflow 50ml [ 2122012 ] , cell spreader 3cm , cover glass 22x22 [ 9115s02 ] , culture petri dish s line 100x15 [ 3165077 ] , culture petri dish s line 100x20 [ 3165a77 ] , culture petri dish s line 150x25 [ 3165081 ] , eppendrof tube 2ml [ 500020 ] , round bottom flask 1000ml [ 4260029 ] , round bottom flask 100ml [ 4260016 ] , round bottom flask 250ml [ 4260021 ] , roudn bottom flask 2000ml 4260030 ] , glass spreader [ 9865683 ] , round bottom flask 500ml [ 4260024 ] , flask erlenmeyer, conical, narrow mouth 50ml [ 4980012 ] , flask erlenmeyer, conical, narrow mouth 100ml [ 4980016 ] , flask erlenmeyer, conical, narrow mouth 250ml [ 4980021 ] , flask erlenmeyer, conical, narrow mouth 500ml [ 4980024 ] , flask erlenmeyer, conical, narrow mouth 1000ml [ 4980029 ] , flask erlenmeyer, conical, narrow mouth 2000ml [ 4980030 ] , funnel 50mm [ 6140065 ] , funnel 100mm [ 6140077 ] , glass rod 7x150 [ 9850107 ] , glass rod 9x150 [ 9850109 ] , glass rod 9x305 [ 9850409 ] , glass rod 7x305 [ 9850407 ] , glass spreader 6x150mm l shaped [ 9865683 ] , incoulatingnichrome wire loop with insulated hadle 2mm long [ la650 ] , incoulatingnichrome wire loop with insulated hadle 4mm long [ la014 ] , measuring cylinder 100ml [ 3022016 ] , measuring cylinder 10ml [ 3022006 ] , measuring cylinder 250ml [ 3022021 ] , measuring cylinder 25ml [ 3022009 ] , measuring cylinder 50ml [ 3022012 ] , measuring cylinder 5ml [ 3022005 ] , measuring tape ( high quality ) 5 m , microcentrifuge tube 1.5ml [ 500010 ] , micropipette single channel variable volume 0.2 2ul [ lhc37112002 ] , micropipette single channel variable volume 0.5 10ul [ hc37112005 ] , micropipette single channel variable volume 2 20ul [ lhc37112008 ] , micropipette single channel variable volume 10 100ul [ lhc37112020 ] , micropipette slides 76x26x1 [ 9100p02 ] , micro tip box 200 1000ul [ 524059 ] , microtips 0.5 10ul [ 521050 ] , microtips 2 200ul [ 521014 ] , microtips 200ul [ 521014 ] , microtips 200 1000ul [ 521020 ] , micrtips 5 10ul [ 521050 ] , parafilm 2 wide [ 380010 ] , petridish 80x15mm [ 3165072 ] , petridish 90x15mm [ 3165a75 ] , pipette stand box 6 pipette stand with drawer , pipette tips 10ul 521100 ] , pipette tips 20ul [ 521108 ] , pipette tips 100ul [ 521101 ] , pipette tips 200ul [ 521101 ] , pipette tips 1000ul 521103 ] , pipette measuring ( mohr type ) , class a 5ml [ 7060p05 ] , pipette measuring ( mohr type ) , class a 10ml [ 7060p06 ] , pipette measuring ( mohr type ) , class a 25ml [ 7060p09 ] , quartz cuvettes , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml [ 1501030 ] , separating funnel 250ml [ 6402021 ] , spatulla ( chattawayspatulla, big spoomspatulla one end flat and one end spoon ) , glass sprayer for tlc , stirrer 7x150mm [ 9850107 ] , stirrer 9x150mm [ 9850109 ] , test tube stand ( plastic, 19 and 25 holes assorted ) [ 202040 ] , test tube 12x100mm [ 9800u03 ] , test tube 15x150mm [ 9800u05 ] , test tube 25x150mm [ 9800u08 ] , test tube 32x200mm [ 9800u10 ] , blotting paper a3 ( 1pkt ) , tong for beaker , tong for flask , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , volumetric flask 50ml [ 5641012 ] , volumetric flask 100ml [ 5641016 ] , volumetric flask 200ml [ 5641020 ] , volumetric flask 500ml [ 5641024 ] , volumetric flask 1000ml [ 5641029 ] , whatman filter paper round grade no. 1 size 110mm , blotting paper , glass quvette , quartz cuvettes , falcon tube 15ml sterile [ 500021 ] , glass tube with pp screw cap 30ml flat bottom [ 9910010 ] , glass tube with pp screw cap 30ml amber flat bottom [ 9911010 ] , glass tube with pp screw cap 10ml amber flat bottom [ 9901006 ] , glass tube with pp screw cap 10ml rflat bottom [ 9900006 ] , borosil 1000ml chromatography column with stopcock, 6100068 , borosil 500ml chromatography column with stopcock & sintered disc, 6101064 , borosil 450ml plain chromatography column with glass stopcock, 6100063 , borosil 200ml plain chromatography column with glass stopcock, 6100060 , borosil 200ml buchner funnel with sintered disc, porosity grade: 5, 3606920 , borosil 1000ml 34 / 35 joints round bottom short neck boiling flask, 4380d29 , laboratory retort stand lab support stand with a burette clamp and 1 flask ring clamps , burette stand with finger clamp , borosil 47mm glass filter holder, 5350029 , borosil 1000ml heating mantle, gme010 , lab porcelain mortar and pestle ( 60mm , 80mm, 100mm , 130 mm 160mm ) set , generic tlc silica plate aluminium ( 25 sheets 20*20cm ) , rectangula tlc chamber ( 20*20cm ) , microtip boxes medical grade virgin polypropylen empty tipbox 1000m ( borosil ) bgt 01000 etr , dionized water otds ( dm wster ) 5l , microtip box for microtip of 2 200 ml , air tight jar ( tupperware ) 10 kg , air tight jar ( tupperware ) 5.5l , air tight jar ( tupperware ) 2.5 lit , air tight jar ( tupperware ) 1.1l , air tight jar ( tupperware ) 500 ml , air tight jar ( tupperware ) 250ml , aluminium foil ( pkt ) ( 72 mt ) , binder clips small size ( pkt ) , bottle brush ( set ) , brown tape 2 inch , cello tape dispenser ( small ) , cing film plastic wrap ( 300 meter ) , colourfullpens ( uniball ) , compartment metal mesh desk organizer , computer mouse , desk organizer drawer , diary spiral , dustbin ( 50 liter ) with pedal , megnatic white board dusterwith spring marker holder , apsara non dust eraser ( pkt ) , extension cord with power switch , fevicol ( 200g ) , feviquick , fevistick , index file ( lever arch box file ) no.40 , laminated cobra files , glue , hand towel ( 13x21 inch ) , hot glue gun , silicon heat resistant microwave hand gloves , blue nitrile handglove ( rubber ) pkt ( size m ) , size ( l ) , handgloves ( autoclave ) pair , toshiba canvio partner 1 tb external hard disk drive hdd , highlighter multicolour ( pkt of 5 , interactive digital board ( samsung ) , key holder , laptop bags , cadyce ca 6ucwc 60w 6 port usb wall charger with quick charge and usb c port , m seal , notice board ( 3x2 ft. ) , paper cutter , document plastic folder with push and lock , document file folder , pen drive ( 16 gb ) hp , pencil ( pkt ) apsera , pens ( pack of 6 ) ( uniball ) , permanent marker ( pack of 12 ) , permanent marker ( big ) blue+black , kensington k33374 wireless presenter with red laser pointer ( black ) , 3x4 inch transparent self adhesive plastic pouch bag for packing / storage, pack of 500 , box pouches , victorex oxo biodegradable packing material, 4 inch ( 100 mm ) , 100 meters length per unit, pack of 3 , power extension cord , printer rim , register , rubber band pkt ( big + small ) , scale ( 12 inch ) pkt , scales ( 6 inch ) pkt , scissor ( big ) , scissor ( small ) , scotch brite sponge , pencil sharpener pkt , sketch pens ( doms ) pkt , correction pen , stamp pad , stamp pad ink ( blue ) camel , sticky notes set , stock register , strapler ( big ) , strapler ( small ) , strapler pin pkt ( 24x6 ) , strapler pin pkt no. 10 , tissue paper ( pkt ) 100 pcs , tissue rolls ( pkt ) 225 meter , u clips ( pkt ) , vim bar , cello tape roll 2inch , cello tape roll 1inches , punching machine no 480 , punching machine no 600 , wireless headphone with mice oneplus , l folder , brown tape roll 2inch , rubber band pkt ( 200 gms ) , duster cloth , wet wipes , black tape water proof , double sided tape ( 1 inch ) , double sided tape ( 2 inch ) , silicon tape double sided for wall waterproof grip tape 3 metre length , transparent box with 36 grid , transparent box for storage pack of 5 different size , durocell aaa bettery ( pack of 10 ) , duracell ultra aa ( pack of 10 ) , lock small harrison , lock big harrison t 26 , door close ozone silver scissor aram overhead=en 1 2 ( nsk=580 estd ) , lock small harrison , lock big harrison t 26 , door close ozone silver scissor aram overhead=en 1 2 ( nsk=580 estd ) , pen hauseaerox pack of 50 ball pen...

Government Medical College - Rajasthan

37370637 tender for supply of reagent and consumables for hla lab 2 kit consumbales for immucor luminex system installed in hla lab 3 hla a sso typing kit 4 hla b sso typing kit 5 hla drb sso typing kit 6 hla dpa1 / b1 typing kit 7 hla dqa1 / b1 typing kit 8 hla dr345 typing kit 9 hla c sso typing kit 10 costar 96 well thermal cycler plates 11 costar polyethylene sealing tape 12 streptavidin pe ( 85 ul @ 0.85ul / test ) 13 corning strip tubes and caps 14 pra screen class i & class ii 15 pra class i ab 16 pra class ii ab 17 single antigen class i 18 single antigen class ii 19 singe antigen mic a kit 20 kir typing kit or similar 21 non hla antibody kit 62 pannal antibodies 22 c1q screening kit / c 3d 23 dsa ( lysate based crossmatch ) kit 24 filter plates for dsa 25 aluminum sealers 26 sheath fluid 20l 27 kit for immucor luminex 28 terrasaky trays 29 rabbit compliment 30 positive control 31 negative control 32 eosin dye / fluorescence dye 33 lymphocyte separation medium 34 rpmi 1640 35 paraffin liquid light 36 formaline 37 glass beads ( 3 to 5 mm ) 38 other 39 digital dry bath 24 holes for 12 mm tubes +5ºc above ambient to 100ºc maximum heating power 12w microprocessor control with digital performance. available with buzzer alarm 40 dna extraction kit 41 edta vails 42 heparine vails 9ml. 43 plane vails 44 ethanol 500 ml. 45 microcentrifuge tube ( 1.5 ml. ) 46 microcentrifuge tube ( 0.5 ml. ) 47 dna diluent 500 ml. 48 neuclear free water 500 ml. 49 15 ml. conical tube with cap ( marking in tube ml ) 50 15 ml. tube with cap ( marking in tube ml ) 51 15 ml tube stand plastic with transprant cover 52 50 ml tube stand plastic with transprant cover 53 1.5 ml tube stand plastic with transprant cover 54 pcr tube stand plastic with transprant cover 55 pcr tube 8 strip ( packing 125 strips ) 56 pcr caps 8 strip ( packing 125 strips ) 57 tips filter 200 ul 58 tips filter 10 ul 59 tips 1000 ul 60 tips filter 100 ul 61 optical plate sealer 62 pcr tube tray ( co star ) 63 pcr pad gel 64 distill water 65 micro centrifuge machine micro centrifuge with 12x1.5 / 2.0ml & pr strip rotor head, speed 15000 rpm 66 red cell lying reagent 67 pc for cdc pcr & nc for cdc 68 rabbit compliment cups 69 oil lig parafilm 500 ml 70 2 ml marked droppers ( packing 100 droppers ) 71 eosin 5% himedia 125 ml 72 round filter paper grade 1 125 mm x 100 circles 73 formaline 500 ml 74 hamilton syring single channel 1 ul disp. 75 hamilton multichannel syring 5 ul disp. 76 aluminium foil 9meter 77 powder free gluoves m&l 78 dsa screening test with mic qualitative 79 taq polymerase 80 hla b 27 kit ssp 81 hla for celiac diease 82 powder agar 500gm 83 etheliun bromide 25gm 84 hla kit abdr ssp 10 test 85 electrophorasis unit 96 well cell size 9.2x25.5x5.6 cm gel tray size – 7x7 cm, 7x10 cm ( od ) ( wxl ) ready agarose – 8 12 2x8 well base buffer volume – 270 ml 86 calibrator luminax immucore 1kit...

Medical College - Rajasthan

34652403 rate contract for kits and consumables for rtpcr lab , ethanol molecular grade , iso propanol molecular grade , nuclease free water molecular grade , rna zap [ rna kill ] , cool racks for pcr tube ( 0.2ml ) with temperature indicator , aluminium foil , vortex mixer for tubes , micro tips for 100 1000?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10?l, low retentionrnase, dnase & pyrogen free sterile , micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10?l , aluminium foil 72 meter , bottle top dispenser with bottle capacity 1 liter capcity 1 10ml , cryo storage card board box 100 wells with cover 2.0ml , discarding jar with swinging lid 5 liter with biosafety symbol , disposable sterile speciman collection swab dacron type , gown blue cloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer with dispensar to be attached to wall , lysol , micro titer pipette set variable volume 5 50?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , microcentrifuge 8 tube rotor , microcentrifuge tube 1.5ml molecular grade sterile , safety goggles , trough reservoir capacity 75ml polypropylene , wash bottle 500ml new type , ziploc bag 12x8 , ziploc bag 4x3 , ziploc bag 8x6 , manual multichannel micropipette variable volume autoclavable 100 300?l , eppendorf tube 1.5ml with screw caped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300?l...

Sms Medical College - Rajasthan

34632156 rate contract for kits and consumables for rtpcr lab ( nit 71 ) i. ethanol molecular grade 2. so propanol molecular grade 3 nuclease free water molecular grade 4 rna zap [ rna kim 5 cool racks for pcr tube ( 0.2m1 ) with temperature indicator 6. aluminium foil 7. vortex mixer for tubes 8. micro tips for 100 1000p1, low retention rnase, dnase & pyrogen free sterile 9•micro tips for 10400p1, low retention rnase, dnase & pyrogen free sterile 10, micro tips for 2 10p1, low retention rnasc, dnase & pyrogen free sterile 11. micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10p1 12 . aluminium foil 72 meter 13. bottle top dispenser with bottle capacity 1 liter eapcity 1 10m1 14, cry° storage card board box 100 wells with cover 2.0m1 15. discarding jar with swinging lid 5 inter with biosafety symbol 16, disposable sterile speciman collection swab dacron type 17. gown blue cloth back open full sieves 18, gown green cloth back open full sieves 19 . gown red cloth back open full sieves 20 . gown white ciotti back open full sieves 21. hand sanitizer with dispensar to be attached to wall, 22. lysol — 23 micro titer pipette set variable volume 5 50a1. single channel fully autoclavable ce iva certified. super blow out piston with volumes of 50111 and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 24 . microcentrifuge 8 tube rotor 25. microcentrifuge tube 1.5m1 molecular grade sterile 26. safety goggles 27 . trough reservoir capacity 75mi polypropylene 28. wash bottle 500m1 new type 29. ziploc bag i2x8 30. ziploc bag 4x3 31. ziploc bag 8x6 32. manual multichannel micropipette variable volume autoclavable 100 3000 33. eppendorf tube i.5m1 with screw coped self standing 34. micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300u1...

Rajasthan University Of Health Science - Rajasthan

34209179 annual rate contract for supply of various chemicals / reagents / consumable items for microbiology central lab ( under mnjy ) at ruhs hospital of medical sciences, jaipur 1. india ink 2. absolute alcohol 99.9% .3. filter paper sheet whartmann no. 1 ( 460 mm x570mm ) 4. • sterile sample storage vial ( individually packed ) capacity 2 ml microcentrifuge tube 5 blood culture bdttle ( adult ) glass bottle 100 ml capacity wilh lid of aluminium with rubber cork in it without media 6. kovacs indole reagent 7. liquid paraffin 8. ph indicator strip 6.5 to 9.0 ph measurement 9. kol l pellets 0. chrom agar for candida 1. chrom agar for bacteriological purpose 12. lpcb 13. l lysine decarboxylase, 14. l ornithine decarboxylase __.____ broth 15. l arginine dihydrolase _______ broth 16. mannitol salt agar 17. modified hugh & leifson 0 / f test 18. loeffler serum medium base 19. comnmeal agar 20. andredes indicator 21. bromocresol purple 22. glucose phosphate broth ( mr vp medium ) 23. methyl ted indicator 24. alpha naphthol 25. simmon citrate agar 26. — christensen urease agar 27. urea40% 28. triple sugar iron agar, 70. lmipcnam10mcg 71. imipenam + 1sd’ia 10 / 750 mcg linezolid 30 mcg 72. 73. meropenam 10 mcg 74. minocycline 30 mcg 75. nalidixic acid 30 mcg 76. nitrofurantoin 300 mcg 77. oxacillin 78. piperacillin 100 mcg 79. piperacillin + tazobactum 100 / 10 mcg 80. polymixin ii 300 units 81. teicoplanin 30 meg 82. tetracycline 30 mcg 83. — tigecycline 15 meg 84. vancomycin 30 mcg 85. fosfomycin 50 ig 86. furazolidone 50 j.ig 87. flucytosine e test strip — 88. caspofungin e test strip 89, posaconazole e tcst strip 90. lulconazole e test strip, etc....

University of Rajasthan - Rajasthan

34054037 supply of chemicals, laboratory accessories and outsourcing servicing supply of chemicals, laboratory accessories and outsourcing servicing at botany department, uor, jaipur , chemical items : , 2(4 iodophenyl) 3 (4 nitrophenyl) 5 phenyl 2h tetrazolium chloride (int) 98% , 1 kb dna ladder , 1,10 phenanthroline , 1,2 dichloroethane, hi lr , 100 bp dna ladder , 10x mops buffer , 1 amine 2 napthol 4 sulfonic acid , 1n hydrochloric acid , 1 naphthaleneacetic acid; , 2,3,5 triphenyl tetrazolium chloride , 2,4 dichlorophenoxyacetic acid , 2,4 dinitrophenylhydrazine, hi ar , 20 bp dna ladder(50 ?g) , 2 mercaptoethanol , 2 oxoglutarate , 2 thiobarbituric acid , 3,3’ diaminobenzidine , 3,3 diaminobenzidine tetrahydrochloride (dab hcl) , 5,5 dithiobis (2 nitrobenzoic acid) (dtnb) , 50 bp dna ladder 50ln (150?l) , 50 x tae buffer , 500 bp dna ladder , 5 bromo 4 chloro 3 indolyl phosphate disodium salt (bcip) extrapure, 98% , 5 bromo 4 chloro 3 indolyl ? d galactopyranoside(x gal) 98% , 6 benzylaminopurine , 6x gel loading buffer , 6x orange gel loading buffer , abscisic acid , acetic acid glacialextrapure, 99.5% , acetic acid glacial, hi ar™ , acetone hplc grade 99.9% , acetone pure 99% , acetone, hi ar , acrylamide , adenosine 5 triphosphate , adonitol (ad, sugar discs , agar powder, bacteriological , agarose special, low eeo (nuclease and protease free) , amikacin (ak 10mcg), antibiotic discs , ammonium acetate for hplc, 99% , ammonium dihydrogen phosphate , ammonium ferrous sulphate hexahydrate extrapure, 98% , ammonium molybdate tetrahydrate , ammonium molybedate tetrahydrate extrapure ar, 99% , ammonium persulfate(aps) , ammonium sulphate , amoxyclav (amc 30mcg), antibiotic discs , a napthylamine , andrade’s indicator , aniline blue , anisaldehyde , arabinose (ar), sugar discs , arsenic acid sodium salt heptahydrate , ascorbate oxidase , atp , barium chloride , beef extract powder , betaine , biscrylamide , boric acid , boric acid extrapure, 99.5% , bovine serum albumin , bovine serum albumin ph 7.0 , bromo thymol blue , bromocresol green sodium salt (water soluble) acs (3,3”,5,5 tetrabromo mcresolsulfonphthalein sodium salt) dye content — 90% , buffer capsule ph 4 , buffer capsule ph 7 , buffer capsule ph 9 , butanol extra pure , calcium carbonate extrapure 98% , calcium chloride anhydrous , calcium chloride dihydrate , calcium chloride dihydrate extrapure ar,99.5% , calcium nitrate tetrahydrate , calcium phytate , carbenicillin (cb 100mcg), antibiotic discs , carboxy methyl cellulose sodium , carboxymethyl cellulose , casein enzyme hydrolysate, type i (tryptone type i) , casein hydrolysate , catechol , ceftriaxone (ctr 30mcg), antibiotic discs , cellobiose (ce), sugar discs , chaps buffer extrapure, 99% , chitosan (high mw) , chitosan (low mw) , chitosan (medium mw) , chloroform : isoamyl alcohol (24:1) , chloroform extrapure , cholorodinitrobenzene , ciprofloxacin (cip 10mcg), antibiotic discs , citric acid anhydrous extrapure, 99% , cobalt chloride hexahydrate , colloidal chitin , congo red , coomassie® brilliant blue g 250 , coomassie® brilliant blue r 250 , copper (ii) chloride anhydrous , copper (ii) sulphate pentahydrate , copper(ii) sulfate (cuso4) , cotrimazine (cm 30mcg), antibiotic discs , cotrimoxazole (cot 25mcg), antibiotic discs , ctab , cu nanopowder , cycloheximide , cysteine , d (+) glucose anhydrous , d biotin , deacetylated chitin (high mw extrapure,90% da) , deacetylated chitin (low mw extrapure10 150m.pas, 90% da) , deacetylated chitin (medium mw extrapure, 150 500m.pas, 90% da) , dextrose (de), sugar discs , diethyl pyrocarbonate , diethylpyrocarbonate (depc) , diphenylamine , diphenylamineextrapure ar, 99% , di potassium hydrogen ortho phosphate , di sodium hydrogen phosphate dihydrate, hi ar , disodium phosphate (na2h po4) , disodium phosphate (na2h po4) , dithio nitrobenzoic acid , dithiothretiol (dtt), molecular biology grade , dl dopa , d mannitol, for molecular biology , dnase i, rnase free , dntp mix, 10 mm (2.5 mm each) , dpph , dpta , dulcitol (du), sugar discs , ecori, 5000 units , edta , electrophorsis kitone kit , ethanol (absolute) 500ml , ethidium bromide , ethyl acetate , evans blue dye , ferric chloride anhydrous , ferrous ammonium sulphate , ferrous sulphate heptahydrate, hi ar/acs , ferrric chloride (fecl3) , first strand cdna synthesis kit , fluorescein diacetate , folin ciocalteu reagent , formaldehyde sol 37 41%, hi ar , formamide 500ml , formic acid , fructose (fc), sugar discs , galactose (ga), sugar discs , gallic acid , gelatin bacteriological , gentamicin (gen 10mcg), antibiotic discs , gibberellic acid , glucosinolate , glutathione , glutathione oxidized , glutathione reduced , glutathione reductase , glycerol , glycine , guaicol , h2so4 , hemocytometer , hexane , hi pure a soil dna extraction kit , hydrogen peroxide , hydroxyl amine , hydroxylamine hydrochloride (nh2oh.hcl) , imidazole , indole 3 acetic acid (iaa); , indole 3 butyric acid(iba); , inositol (is), sugar discs , inulin (in), sugar discs , iodine , iodine resublimed , isopropyl alcohol extrapure , kanamycin (k 30mcg), antibiotic discs , kinetin , kovac’s indole reagent , l glutamic acid , l glutamine , l (+) tartaric acid, , labolene phosphate free , lactophenol , lactose (la), sugar discs , l ascorbic acid, a.r , levofloxacin (le 5mcg), antibiotic discs , lithium chloride 100gm , litmus milk , l methionine , l phenylalanine , l tryptophan , magnesium chloride anhydrous500 gm , magnesium sulphate 500gm , magnesium sulphate. 7h2o , maleic acid , maltose (ma), sugar discs , manganese (ii) sulfate tetrahydrate (500gm) , manganese (ii) sulphate monohydrate, hi ar™/acs , mannitol 500gm , mannitol, sugar discs , mannose (mo), sugar discs , melibiose (mb), sugar discs , mercuric chlorideextrapure ar, acs, exiplus, multi compendial, 98% , mercury(ii) oxide (hgo) , mesitylene extrapure, 98% (1,3,5 trimethyl benzene) , methanol , methanol extrapure , methanol pure 99% , methoxyamine hydrochloride , methyl jasmonate , methyl red sodium salt (water soluble) acs, 95% , methyl viologen , mo nanopowder , monosodium phosphate (nah2po4) , m phosphoric acid sticks, hi ar™/acs , ms medium w/cacl2& vitamine , mspi (hpaii), 3000 units , murashige and skoog (m.s) media 5lt , n(1 napthyl) ethylene diaminedihydrochloride , nadh , nadph , nano2 , naoh , napthyl etylene diamine dihydrochloride , nessler’s reagent , netillin (net 30mcg), antibiotic discs , nicotinic acid , ninhydrin , nitrobluetetrazolium chloride (nbt) , nitrofurantoin (nit 300mcg), antibiotic discs , n methyl n (trimethylsilyl) trifluoroacetamide (mstfa) , nuclease free water , nutrient agar , o dianisidine (25 g) , ofloxacin (of 5mcg), antibiotic discs , orthophosphoric acid , orthophosphoric acid extrapure, 85% (phosphoric acid) , oxalic acid , oxidase discs , p amino benzoic acid , pcr master mix 100r (2.5ml) , pda , pectin pure , peptone bacteriological grade , perchloric acid , phenol crystals 100gm , phenol saturated with 10mm tris hcl ph8.0, 1mm edta , phenol, saturated w/10% water500ml , phenol: chloroform: isoamyl alcohol mixture , phenylmethanesulphonyl fluoride , phosphate bufferph 7.2 (apha) , phytase agar media , picloram , picric acid , pikovskaya’s agar , p nitrophenol , p nitrophenyl phosphate disodium , polyethylene glycol mw6000 , polyvinyl pyrrolidone (pvp) k 30 , potassium biphosphate, hi ar , potassium chloride , potassium chloride 99.5% , potassium chromate, , potassium dichromate pure, 99.5% , potassium dihydrogen orthophosphate extrapure ar, 99.5% , potassium dihydrogen phosphate (kh2po4) , potassium hydrogen phosphate (k2h po4) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium permanganate extrapure, 99% , potassium sulfate (k2so4) , prestained protein ladder , proline 99% , protein loading dye , psti, 3000 units , putrescine dihydrochloride , pvpp , pyridine, hi ar/acs , pyridoxal 5’ phosphate anhydrous, hi lr , pyrogallol , quercetin , raffinose (rf), sugar discs , restriction digestion kit , revertaid reverse transcriptase, 10,000 u , rhamnose (rh), sugar discs , ribitol , riboflavin , rna gel loading dye (0.25ml) , rnase100mg , rnase inhibitor (20 u/?l) 2500 units , rnasezap , rochelle salt(na k tartrate) , salicin (sa), sugar discs , salicylic acid , schffs reagent , selenium dioxide (seo2) , silver nitrate, hi lr , silver sulphate pure, 98.5% , simmons citrate agar , sio2 powder , skim milk powder , sodium acetate 100g , sodium acetate 3m , ph 5.2 5.4 , sodium acetate anhydrousfor hplc & uv spectroscopy, 99% , sodium acetate trihydrate , sodium acetate trihydrate , sodium azide (nan3) , sodium bicarbonate , sodium bisulphite , sodium carbonate anhydrous, hi ar/acs , sodium chloride , sodium chloride extrapure ar, 99.9% , sodium citrate anhydrous , sodium citrate tribasic dihydrate extrapure ar, 99% , sodium citrate, 3.8% w/v , sodium dithionite , sodium dodecyl sulphate, ultrapure , sodium fluoride , sodium fluoride pure, 98% , sodium hydrogen sulphite, hi ar/acs , sodium hydroxide pellet , sodium hydroxide pellets extrapure ar, 98% , sodium hypochlorite , sodium hypochlorite, hi ar™/acs(4% w/v solution) , sodium molybdate dihydrate, hi ar™/acs , sodium phenolate , sodium phosphate dibasic anhydrous extrapure ar, 99% , sodium phosphate monobasic anhydrous extrapure ar, 99% , sodium sulfite, hi ar/acs , sodium sulphite , sodium tetraborate , sorbitol (sb), sugar discs , spermidine , spermine , stannous chloride dihydrate dihydrate pure, 97% , starch soluble , streptomycin (s 10mcg), antibiotic discs , sucrose (su), sugar discs , sulfosalicylic acid , sulphanilic acid, purified , sulphosalicylic acid (3%) , taq dna polymerase (3 u/?l) (includes enzyme: 1 vial; 10x taq buffera : 4 vials; 25 mm mgcl2: 4 vials), 1000units , taq polymerase (5 units/?l) , temed , tetra chloroacetic acid , tetracycline (te 30mcg), antibiotic discs , thiamine hydrochloride , thiobarbituric acid (tba) , thiourea, hi ar/acs , titanium (?) oxysulfate hydrate , tlc silica gel 60 f254 , toluene , toluene extrapure ar, 99.5% , toluene, rectified, l.r. , trehalose (te), sugar discs , trichloroacetic acid extrapure ar, acs, 99.5% , triclogel , triclogel dispenser bottle , trimethylsilane (tms) , tris (hydroxylmethyl) aminomethane , tris base , tris buffer ar, acs for molecular biology, 99.9% , tris hydrochloride , tris hydrochloride (tris hcl) extrapure ar, 99% , triton x 100 , trizol reagent® , trypan blue dye , tryptone, certified (casein enzyme hydrolysate) , turbo dna freetm kit , tween 20 , urea extrapure ar, 99.5% , urea extrapure, 99% , xylose (xy), sugar discs , yeast extract 500gm , yeast mannitol broth , zeatin , zinc chloride 500gm , zinc dust , zinc oxide, hi ar™500gm , zinc sulphate heptahydrate , zn nanopowder , glassware items : , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , beaker, glassware , beaker, glassware , beaker, glassware , beaker, glassware , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim,amber, glassware , cover glass, square, glassware , funnel, glassware , funnel, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , microscopic glass slides, plain, ground edges, glassware , petri plats glass, 90mm, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , stirring rod, glassware , test tubes with rim, glassware , watch glasses, borosil s line, 150 ml, glassware , plasticware items : , applied biosystems™ microamp™ optical fast well reaction plate with barcode & optical adhesive films , art™ gel loading pipette tips (20 ?l) , carboy with stopcock ( liquid storage container), 10li , centrifuge tube conical bottom sterile 15 ml (pack of 500) , centrifuge tube conical bottom sterile 50 ml (pack of 500) , conical centrifuge tube rack , draining tray , drying rack , eppendorf tubes (1.5) (pack of 500) , eppendorf tubes (2 ml) (pack of 500) , funnel, 100 mm , funnel, 50 mm , ice bucket , ice tray (1 l) , ice tray (4 l) , junior 4 way tube rack , measuring cylinder class b, material: pp autoclavable 10 ml , pcr rack with cover (pack of 6) , pcr tubes (0.2 ml) (pack of 1000) , pcr tubes box for 0.2 ml , petri plates 100 mm (pack of 12) , pipette tips 0.2 10 ?l(pack of 1000) , pipette tips200 1000 ?l(pack of 500) , pipette tips2 200 ?l (pack of 1000) , plastic pots , polygrid test tube stand , rack for micro tube , test tube basket with cover 180x170x160 , tip box for 200 1000 ?l(pack of 10) , tip box for 5000 ?l (pack of 2) , tip box of 2 200 ?l (pack of 10) , utility tray, material: pp autoclavable; 320x260x100 , utility tray, material: pp autoclavable; 320x260x70 , utility tray, material: pp autoclavable; 360x310x130 , wash bottle new type (750 ml) , wash bottles plastic, 250ml; , wash bottles plastic, 500ml; , other items : , 1kg gross aluminium silver kitchen foil roll paper , 3 step interlocking micro tube rack (24x0.2 ml,14x0.5 ml and 12x1.5 ml tubes) (pack of 6) , autoclavable bags (pack of 100) , casting tray , cheese cloth , comb set (pack of 2) , conical centrifuge tube rack (pack of 4) , cryo cube box , cryo tags , cryocan ba 11 liquid nitrogen container (20l capacity) , cryo cube box1.8ml (pack of 8) , falcon tubes (15 ml) (pack of 500) , falcon tubes (50 ml) (pack of 500) , hand protector grip , hands on™ nitrile examination gloves , hijama surgical blades size 11 , liquid nitrogen flask , magnetic stirrer bar (round) 8x30 mm (pack of 10) , magnetic stirrer bar (round) 8x50 mm (pack of 10) , microcentrifuge tubes box for 1.5 ml(pack of 4) , microchattaway spatula , mortar and pestle (suitable for crushing of plant sample in liquid nitrogen) , multipurpose labelling tape , nitrile gloves powder free large , nitrile gloves powder free medium , non absorbent cotton , nylon membrane filter , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , parafilm tape (size in inches 4 x 125) , pcr rack with cover; 96 well , pipette rack horizontal , pointer spatula (6) , purple nitrile gloves (medium size) , qualitative filter paper grade 1: 11um 150 mm 100/pk , quartz cuvette; capasity; 1.0 ml;190 nm to 2500nm , quartz cuvette; capasity; 3.5 ml;190 nm to 2500nm , romino® silicone heat resistant cooking pinch mitts , round magnetic stirrer bar 8x30 mm , round magnetic stirrer bar 8x50 mm , spatula; 200mm , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , sterial scalpel blade no.22 , syringe filter 4 mm, 0.2 micron (sterile) 100/pack , syringe filter holder, pc (reusable), 13 mm , test tube stand 12 tubes(pack of 4) , tissue roll , tough tags , vertical gel casting system, 18 x 18 cm (glass plates dimension) , whatman® qualitative filter paper, grade 2 , out sourcingservicingitems : , mrna sequencing , small rna/ micro rna sequencing , sequencing of pcr products...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

District Hospital - Rajasthan

33741304 supply of kits, chemical, glassware, reagents items in biochemistry lab v 10111.3 bi. albumin ( liquid ) , end point linearity agm / l 2 82 alk. phos. 1, 4 a 120011 / 1, 3 133 alt ( gp ) ( liq ) .kincnc, linearity a60011 / 1, 4 64 amylase ( liq ) , kinetic, linearity a 1500u / l 5 135 ast ( got ) ( liq ) , kinetic, linearity a 6000 / l 6 b6 bilirubin ( direct ) ( liq ) , fixed time, linearity a limp / di 7 b7 flilirubin ( total ) . fixed time, linearity aning / dl 8 138 calcium ( liq. ) , end point, linearity al5mg / dl 9 139 cholesterol ( liq. ) . end point, linearity al000mg / di. 10 serum ck m 8 kit with calibrator and control ( liquid stable or lyophilised 1310 reagent reconstitution stability 30 days at 2 8°c immunoinhibition uv kinetic method ) , linearity a 2000 u / 1, with lyophilised calibrator and control having reconstitution stability a 7 days at 2 8°c. 11 b11 ck nac , kinetic, linearity a20001.1 / 1, 12 1312 creatinine ( liq ) , kinetic, linearity a25mg / dl 13 b13 gamma gt ( liquid ) , kinetic, linearity a 1000u / l 14 b14 glucose ( lig. ) , kinetic, linearity 2600mg / c1l 15 1315 hb alc / illa ( liquid ) , end point linearity a7 23g / dl 16 1316 hdl cholesterol ( liquid ) direct clearance method, kinetic, linearity a150mg / dl 17 si? ld pyruvate > lactate ( liquid ) , kinetic, linearity a 110011 / 1. 18 13111 lipase , kinetic, linearity a 60011 / 1 19 b19 phosphorus ( inorganic ) ( liq. ) end point, linearity a20mg, / d i, 20 820 total protein ( liquid ) ( mono reagent ) , end point linearity z 12grn / d1 21 621 triglycerides ( liquid ) , end point, linearity e. 1000mg / dl 22622 urea ( liq. ) , kinetic, linearity . 300mg / d1, 23 1123 uric acid ( liq ) , end point linearity z 20mg / dl 24 624 acid phosphata se ( acp ) ( liquid stable, ready to use ) kinetic, linearityz75111 / l or fulyautomatic analyser. 25 825 cs!: microprotein ( liquid stable, ready to use ) linearityz400mg / d1. ( for fully automatic clinical chemistry analyser ) 26 1126 magnesium, end point, ready to use, liquid stable, linearityz50ing / d1 27 b27 serum ada 28 b28 ise electrode ( ci ) linearity 2191 mmol / l. 29 b29 lib alc callb, series 30 830 ise electrode ( na ) linearity z37 &187m mot / l 31 multi calibrator for fully auto analyser ( for calibration of above biochemical b31 parameter. calibrator should be tracable to internationally accepted norms calibrator will run as per requirement time to time ) 32 b32 multi control for fully auto analyser ( control of high, normal / low will run daily ) above biochemical parameter should be tracable for internationally accepted norms. 33 b33 lithium 34 b34 wash solution, 4xsl ( must for 5800 and dxc700 au ) 35 835 cleaning solljtio 6x450ml 36 b36 photometer lamp, 12 v, 20 wt ( leach ) ( must for 480 and dxc 700 ) 37 837 sample. clip, 2.5ml ( pkg of 1000 ) 38 b38 mixing bar ( spiral ) au5800 39 839 mixing bar ( l shaped ) au5800 40 640 sample probe ( 1 each ) 41 b41 reagent probe ( 1 each ) 42 b42 s syringe ( ] each ) 43 843 r syringe ( 1 each ) 44 1344 pinch valve tubing ( pkg of 2 ) 45 84s mixing bar ( spiral ) au480 / dxc 700 au 46 546 mixing bar ( l shaped ) au480 / dxc 700 au 47 b47 hitachi sample cup, polystyrene, highly transparent, non sticky, 17mm x 38mm or 2m1 48 648 white paper laboratory tissue roll ( for cleaning of equipments, pattern 1349 plain and should be thick and not leave the rashes or fibers on cleaning • surfaces ) 49 sodium hypochlorite solution ( 5 10% ) 50 1350 tray with divided 2 4 compartments ( perfect for hold and transport of racks with samples ) 51 b51 ma ricer pen with fine tip ( red / black, usable on glassware ) 52 b52 antiseptic soap for hand wash ( liquid ) 53 1353 hand sanitizer ( liquid ) , concentration of contents according to who guidelines 54 1354 add wash solution ( should be compatible with imola l& ii ) 55 655 blood sample vial with screw dip 17x45 mm 56 956 ciwash solution 2.5l. ( should be compatible with imola l& 11 ) 57 1357 calibration sera 20x5 level 3 58 959 ck mb calib 59 b59 ck mb control 60 1360 ckky lyte universal reagent pack 61 b61 cl electrode for ckk lyte 62 b62 cleaning solution ( contamination avoidance ) ( for all 680 ) 63 1363 cleaning solution pack ckk byte 64 1364 cleaning solution weekly wash ( for au 680 ) 65 b65 i dp pinch valve tube assembly ( for au680 ) 66 b66 external quality control 67 867 i lb alc calib. series 68 b68 hb aic control level 1 and level 2 69 b69 hdl / ldl cholesterol calib 70 870 human assayed multi sera level 2 71 b71 human assayed multi sera level 3 72 b72 ise buffer ( for au680 ) 73 973 ise calibator a folig bag 74 1374 ise callbrant b 75 b75 ise electrode ( ref ) 76 b76 ise internal ref ( for au6801 77 1377 ise mid std ( for au680 ) 78 b78 ise ref ( for au680 ) 79 679 80 1380 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 1381 1382 ise selectivity cherkffor aug80 ) _ ise serum std high ( for au680 ) b83 b84 b85 b86 ise serum std low ( for a11680 ) ise wash solution internal filling solution for ckk lyte k electrode for cm lyre lipid control level 1 lipid control level 2 b87 b88 microcentrifuge_tubes with attached hinged cap ( 1.s ml ) micropipette 10 pl fixed volume 1389 1390 b91 1392 893 694 b95 micropipette 50p1 fixed volume micropipette fixed volume 100 pl micropipette fixed volume 1000 micropipette fixed volume 500 id micropipette variable volume range 100 1000 p1 micropipette variable volume range 10 100 pl micropipette variable volume range 200 1000 pl b96 b97 micropipette variable volume range 20 200 pl micropipette variable volume range 5 50 p1 898 microcentrifuge tube ( 1.5 ml 1399 na electrode for ckk lyte 13100 13101 plane vial with clot activation 4 ml pm lot for imola rx imola 6102 poly propylene micro litre tips ( upto 200 pl ) yellow tips. 103 b103 poly propylene micro litre tips ( upto 200 p1 1000 pl ) blue tips 104 13104 i ref electrode for ckk lyle _ 105 13105 test tube stand ( 48 holes ) plastic 106 8186 test tube stand ( 96 hole, plastic 107 108 b107 torniquete 13108 trouble shooting kit for ckk lytc 109 13109 wash solution ( for au680 ) 110 b110 wash solution no. 1 ( fully auto analyzer ) 111 8111 wash solution no. 2 ( fully auto analyzer ) 112 [ 1112 wash solution no. 3 ( fully auto analyzer ) u&csf total proteins red prrogallol colour 150 nil. 20 bag filter element 113 b113 8114 114 115 6115 10 ca rtidge filter 116 13116 10 carbon filter 117 b117 10 d.i.cartridge 118 13118 1812 ro membrane 119 13119 booster pump 120 8120 pressure gauge 121 13121 solenoid valve 122 13122 flow restrictor 123 13123 7 ltilresin recharge 124 9124 inlet valve 125 8125 peristalitic pump head ( cal a ) 126 8126 peltier tile 127 b127 halogen lamp 128 b128 spt nozzle . 129 8129 saline diluent 130 b130 sodium electtrode 131 8131 potrasium electrode 132 b132 chloride electrode 133 8133 reference electrode 134 13134 alakaline wash solution 135 8135 acid wash solution, etc....

Medical College - Rajasthan

33735606 supply of kits chemical reagents glassware items kits chemical reagents glassware items , biochemistry lab reagents / kits / chemical / glassware / polyware etc items , albumin ( liquid ) , end point, linearity =8gm / l , alk. phos. ( liq. ) , kinetic, linearity = 1200u / l , alt ( gpt ) ( liq ) , kinetic, linearity =600u / l , amylase ( liq ) , kinetic, linearity = 1500u / l , ast ( got ) ( liq ) , kinetic, linearity = 600u / l , bilirubin ( direct ) ( liq ) , fixed time, linearity = 8mg / dl , bilirubin ( total ) , fixed time, linearity =25mg / dl , calcium ( liq. ) , end point, linearity =15mg / dl , cholesterol ( liq. ) , end point, linearity =1000mg / dl , serum ck mb kit with calibrator and control ( liquid stable or lyophilised reagent reconstitution stability 30 days at 2 8°c immunoinhibition uv kinetic method ) , linearity = 2000 u / l with lyophilised calibrator and control having reconstitution stability = 7 days at 2 8°c. , ck nac , kinetic, linearity =2000u / l , creatinine ( liq ) , kinetic, linearity =25mg / dl , gamma gt ( liquid ) , kinetic, linearity = 1000u / l , glucose ( liq. ) , kinetic, linearity =600mg / dl , hb a1c / hb ( liquid ) , end point, linearity =7 23g / dl , hdl cholesterol ( liquid ) direct clearance method, kinetic, linearity =150mg / dl , ld pyruvate > lactate ( liquid ) , kinetic, linearity =1100u / l , lipase , kinetic, linearity = 600u / l , phosphorus ( inorganic ) ( liq. ) end point, linearity =20mg / dl , total protein ( liquid ) ( mono reagent ) , end point, linearity = 12gm / dl , triglycerides ( liquid ) , end point, linearity = 1000mg / dl , urea ( liq. ) , kinetic, linearity = 300mg / dl , uric acid ( liq ) , end point, linearity = 20mg / dl , acid phosphatase ( acp ) ( liquid stable, ready to use ) kinetic, linearity=75iu / l or fully automatic analyser. , csf microprotein ( liquid stable, ready to use ) linearity=400mg / dl. ( for fully automatic clinical chemistry analyser ) , magnesium, end point, ready to use, liquid stable, linearity=50mg / dl , serum ada , ise electrode ( cl ) linearity =191 mmol / l. , hb a1c calib. series , ise electrode ( na ) linearity =37 &187mmol / l , multi calibrator for fully auto analyser ( for calibration of above biochemical parameter. calibrator should be tracable to internationally accepted norms. calibrator will run as per requirement time to time ) , multi control for fully auto analyser ( control of high, normal / low will run daily ) above biochemical parameter should be tracable for internationally accepted norms. , lithium , wash solution, 4x5l ( must for 5800 and dxc700 au ) , cleaning solutio 6x450ml , photometer lamp, 12 v, 20 wt ( 1each ) ( must for 480 and dxc 700 ) , sample cup, 2.5ml ( pkg of 1000 ) , mixing bar ( spiral ) au5800 , mixing bar ( l shaped ) au5800 , sample probe ( 1 each ) , reagent probe ( 1 each ) , s syringe ( 1 each ) , r syringe ( 1 each ) , pinch valve tubing ( pkg of 2 ) , mixing bar ( spiral ) au480 / dxc 700 au , mixing bar ( l shaped ) au480 / dxc 700 au , hitachi sample cup, polystyrene, highly transparent, non sticky, 17mm x 38mm or 2ml , white paper laboratory tissue roll ( for cleaning of equipments, pattern plain and should be thick and not leave the rashes or fibers on cleaning surfaces ) , sodium hypochlorite solution ( 5 10% ) , tray with divided 2 4 compartments ( perfect for hold and transport of racks with samples ) , marker pen with fine tip ( red / black, usable on glassware ) , antiseptic soap for hand wash ( liquid ) , hand sanitizer ( liquid ) , concentration of contents according to who guidelines , acid wash solution ( should be compatible with imola i & ii ) , blood sample vial with screw cap 17x45 mm , c1wash solution 2.5l. ( should be compatible with imola i & ii ) , calibration sera 20x5 level 3 , ck mb calib , ck mb control , ckky lyte universal reagent pack , cl electrode for ckk lyte , cleaning solution ( contamination avoidance ) ( for au 680 ) , cleaning solution pack ckk lyte , cleaning solution weekly wash ( for au 680 ) , dp pinch valve tube assembly ( for au680 ) , external quality control , hb a1c calib. series , hb a1c control level 1 and level 2 , hdl / ldl cholesterol calib , human assayed multi sera level 2 , human assayed multi sera level 3 , ise buffer ( for au680 ) , ise calibator afolig bag , ise calibrant b , ise electrode ( ref ) , ise internal ref ( for au680 ) , ise mid std ( for au680 ) , ise ref ( for au680 ) , ise selectivity check ( for au680 ) , ise serum std high ( for au680 ) , ise serum std low ( for au680 ) , ise wash solution , internal filling solution for ckk lyte , k electrode for ckk lyte , lipid control level 1 , lipid control level 2 , microcentrifuge tubes with attached hinged cap ( 1.5 ml ) , micropipette 10 ?l fixed volume , micropipette 50?l fixed volume , micropipette fixed volume 100 ?l , micropipette fixed volume 1000 ?l , micropipette fixed volume 500 ?l , micropipette variable volume range 100 1000 ?l , micropipette variable volume range 10 100 ?l , micropipette variable volume range 200 1000 ?l , micropipette variable volume range 20 200 ?l , micropipette variable volume range 5 50 ?l , microcentrifuge tube ( 1.5 ml ) , na electrode for ckk lyte , plane vial with clot activation 4 ml , pm kit for imola rx imola , poly propylene micro litre tips ( upto 200 ?l ) yellow tips. , poly propylene micro litre tips ( upto 200 ?l 1000 ?l ) blue tips , ref electrode for ckk lyte , test tube stand ( 48 holes ) plastic , test tube stand ( 96 holes ) plastic , torniquete , trouble shooting kit for ckk lyte , wash solution ( for au680 ) , wash solution no. 1 ( fully auto analyzer ) , wash solution no. 2 ( fully auto analyzer ) , wash solution no. 3 ( fully auto analyzer ) , u&csf total proteins red prrogallol colour 150 ml. , 20 bag filter element , 10 cartidge filter , 10 carbon filter , 10 d.i.cartridge , 1812 ro membrane , booster pump , pressure gauge , solenold valve , flow restrictor , 7 ltr.resin recharge , inlet valve , peristalitic pump head ( cal a ) , peltier tile , halogen lamp , spt nozzle , saline diluent , sodium electtrode , pottasium electrode , chloride electrode , reference electrode , alakaline wash solution , acid wash solution , ise detergent , ise l solution , ise buffer , serum low / high calibrators , precision check kit , c1 solution wedge , wash solution 9 , wash solution 3 , starter kits ( 1+2 ) , wash buffer , reaction modules , light cheak , il 6 , pct , ferritin , d dimer , crp , troponin , nt probnp , vitamin b12 , vitamin d3 , serum folate , serum c peptide , tube set for ise , tube set , na electrode , k electrode , cl electode , ref electrode , s tube , r tube , peristalitic pump tube , light source lamp , s probe , r probe , 1 year pm kit , 2 year pm kit , peltier assembly , d 10 dual recorder pack , lyphocheck diabetes control , vacutainers sodium citrate vial , tsh , t3 , t4 , access 1312 2x50 cet ( 3300 ) , access ferritin 2x50 oct ( 33020 ) , access cea 2x50 tests ( 33200 ) , access afp 2x50 det ( 33210 ) , access ultrasnsitve insulin2x5000 ( 33410 ) , access total [ 34 1cg 2x50 det ( a85264 ) , access hlh 2x50 pet ( 33510 ) , access hfsh 2x50 pet ( 33520 ) , access prolactin 2x50 dot ( 33530 ) , access estradiol 2x50 de ( 33540 ) , access progesterone 2x50 det ( 33550 ) , access testosterone reagent kit2x50 ( 33560 ) , access estradiol reagent kit 2x500 et ( 33570 ) , access ultrasnsitve high, 2x50 de ( 33580 ) , access cortisol 2x50 det ( 33600 ) , access theophylline 2x50 det ( 33700 ) , access digoxin 2x50 det ( 33710 ) , access total t4 2x50 det ( 33800 ) , access t uptake 2x50 dot ( 33810 ) , access hypersensitive htsh 2x50 de ( 33820 ) , access total t3 2x50 det ( 33830 ) , access thyroglobuun 2x50 det ( 33860 ) , access thyroglobuun 2x50 det ( 33880 ) , access thyroglobulin all 2x50 det ( 33890 ) , access hav ab kit ( 2x50 tests ) 34200 , access as hbs ii 2x50 det ( 34280 ) , hav igm 2x50t kit ( 34210 ) , hbs ag 2x50t ( 34220 ) , 110s ag confirmatory ( 34222 ) , hoc ag confirmatory ( 34222 ) , hoc ab 2x50t kit ( 34240 ) , hbc igm 2x50t kit ( 34250 ) , access hbs ag 2x50t kit ( 24290 ) , access fibs ag confirmatory ( 34292 ) , access chlamyd1a 200 + 50 0e7 hz ( 34401 ) , access rubella igg 2x50 dot ( 35134430 ) , access rubella igm kit ( 34440 ) , access 70x0 igg 2x50 oft ( 34450 ) , access 70x0 igm 11 ( 2.x507ests ) , access total ige 2x50 det ( 35000 ) , access hybritech psa rgt kit 2x50 ( 37200 ) , access hybritech free psa rgt kit ( 37210 ) , access ostase reagent kit 2x50 test ( 37300 ) , access ca 125 ii ( ov monitor ) 2x50det ( 366357 ) , access ck mb reagent kit ( 2x50 test ) ( 386371 ) , access ( r ) br monitor ( ca 15.3, 2x50 det ( 387620 ) , access ca 19 9 ( gi monitor ) 2x 50det ( 387687 ) , access ifab ifab pont kit, 2x50 oct ( intrinsic factor antibody ) ( 387952 ) , access myoglobin, 2x50 oft ( 973243 ) , access dhea s 2x50 det ( a10826 ) , anti tpo ( a12985 ) , access free t3 assay 2x50 det ( a13422 ) , access epo reapont 2x50 test ( a10364 ) , pth kit 2x50 test ( a16972 ) , access troponsne 12x50 det ( old part no 33340 ) ( a78303 ) , access folate 2x 50 det ( ow part no a142081 ) ( a98032 ) , access 25.0h vitamin 0 2x50 det ( 1 a 98856 ) , access amh 2x50 det ( b13127 ) , access b12 cals ( 33005 ) , access ferritin cals ( 33025 ) , access cea calibrators ( 33205 ) , access afp cals s0 s6 ( 33215 ) , access accutni cals ( troponin 1 cal ) s0 s5 ( 33345 ) , access insulin cal so s5 ( 33415 ) , access total b hcg cals ( 33505 ) , access lh calibrato ( 33515 ) , access fsh calibrators ( 33525 ) , access prolactin cals ( 33535 ) , access estradioal cal s0 s5 ( 33545 ) , access progesteronecal ( 33555 ) , access testosterone cal, s0 s5 ( 33565 ) , access estriol calibrator set so s ( 33575 ) , access hgh calss0 s5 ( 33585 ) , access cortisol cals s0 s5 ( 33605 ) , access theophyllinecals s0 s5 ( 33705 ) , access digoxin cals so s5 33715 , access total t4 cals ( 33805 ) , access uptake cal so 1x6 33815 , access htsh calibrators ( 33825 ) , access total t3 cals so s5 ( 33835 ) , access thyroglobulin cals. so s5 ( 33865 ) , access free t4 cals 50 55 ( 33885 ) , access tg ab cals ( 33895 ) , access hav ab calibrators ( 34205 ) , hav igm calibrators ( 34215 ) , hbs ag cals ( 34225 ) , hbs ab calibrators ( 34215 ) , hbc igm calibrators ( 34255 ) ) , access ab hbs ii calibrators ( 34285 ) , access cmv igg calibrators ( 34415 ) , access rubella igg ( 34435 ) , access rubeklla igm cals ( 34445 ) , access toxo igg cals s0 55 ( 34455 ) , access toxo igm ii calibrators ( 34475 ) , access total ige calibrator so ( 35005 ) , access hybritech psa cal kit ( 37205 ) , access hybritech free psa cal kit ( 37215 ) , access ostase calibrator kit ( 37305 ) , access ca 125 ii ( ov monitor ) calibrators ( 386358 ) , access ck cals 50 55 ( 386372 ) , access ( r ) brmonitor calib so s5 ( 387647 ) , access ca 19 9 ( gi monitor ) calibrators ( 387688 ) , access myoglobincalibrators ( 973244 ) , access dhea s cals , 50 55 calibratr ( a10827 ) , access ft3 cals s0 s5 ( a13430 ) , access epo calibrators 5x 2.5ml, 1x 10ml ( a16365 ) , anti tpo calibrators ( a18227 ) , access folatecal. set so s5 fz. ( old part no a14207 ) ( a98033 ) , pth cal ( a16953 ) , access 25 oh vitamin d calibrator ( a98857 ) , access® amh calibrators so s5 ( 613128 ) , reaction vesssels ( 10x 1008 ) ( 386167 ) , access substrate 4 x 130ml ( 81906 ) , wash buffer / ii ( 1 x 101 ) 1 x 500 ( a16793 ) , waste bags ( 20x ) 20x2000 ( 973157 ) , ctranox, 1x 1 gallon ( 81912 ) , ctranox, 1x 1 letter ( 81911 ) , access system check soln, 6x4m ( 81910 ) , access sample cups 2ml ( 81910 ) , immuno assay liqui check cardiac market control lt level low 6x3ml ( 145 ) , immunoassay speciality contdrol level 1 ( 6x5ml ) ( 364 ) , immunoassay speciality contdrol level 2 ( 6x5ml ) ( 365 ) , immunoassay speciality contdrol level 3 ( 6x5 ml ) ( 366 ) , immuno assay liqui check tumer market tri level control 1x3x2ml ( 368x ) , immuno assay lypho control 12x5ml ( 370 ) , access amh controls, 3 levels, 2x 2ml ( b131129 ) , specialty tool kit ( a21913 ) , care kit ( a34821 ) , racks ( 471913 ) , pm kit ( b21384 ) , htsh kit ( hypersensitive tsh ) ( 33820 ) , htsh calibrators ( 33825 ) , access tsh ( 3rd is ) ( b63284 ) , access tsh ( 3rd is ) calibrators ( b63285 ) , k3 edta tubes , glass test tube ( 75x12mm ) ...

Sms Medical College - Rajasthan

33641597 rate contract for disposable and glassware and consumable and miscellaneous items ( nit 48 ) i. aluminium foil — 2. autoclavable borosil screw capped tubes 5ml 3. autoclavable borosil screw capped tubes1 omm 4. autoclavable petridish sample required 5. disposable gloves ( non sterile in pack of 25 to 50 pairs ) b a ) size 6.5 b ) size 7 c ) size 7.5 d ) size 8 6. centrifuge plastic test tubes with cap sterile 4, ’ 7. coplin jar with lid ( rectangular pvc ) 8. sterile disposable, polystyrene, optically clear, petridishes 9omm x15mm ( 4” ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment z aa £ 9. sterile disposable swab sticks individual ipacked size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expjry sample required to be supplied in installment_ 10. sterile disposable swab st1ck wth test tubes individually packed size ( 150 mmx 12mm ) , sterulized by gamma radlation with date of manufacture & exp1ry sample required 11. sample racks ( 96 slois / rack ) 12x75 mm tube 12. disposable stool sample coniainer with spatula 13. plastic discard container with lid and sieve 14. disposable autoclave bag a ) red 30l b ) yellow30l 15. transparentbag30l a ) red _15l b ) yellow.i5mlb 16. c ) transparent bag 15 l 17. disposable bag a. ) black 30l plastic basket ( jali ) autoclavable—small 18. a ) medium 7”x7”x7” b ) large 9”x9”x9” 19. 20. plastic pipe for water supply / 2 inch plastic trays i y2’ xi wx 6” 21. i plastic trays for reagent bottles 22. plastic dropper a ) b ) big 23. tissue paper rolls 100 meter 24. tie 8” long for lying plastic bags — 25. syringe needle sterile disposable . _... a ) 10ml b ) 2nml — c ) 5ml 26. disposable test tube with screw cap and label, individually packed, sterilized by gamma radiation with date of manufacture & expiry _.... sample require! ) a ) 1onmlr _ b ) 5ml — 27. steriledisposa [ 3le container wide mouth individually packed supplied in installment ( for sputum, urine ) without spoon 30 ml self standmng, sterilized by gamma radiation — 28. test tube stand 29. microtitre polystyrene plate of 96 round bottom wells with lid, individually packed sterilized by gamma radiation with date of manufacture & expiry sample required 30. nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plast1c shaft with breakable point about .._. i5cmnlong !—m 31. plain vial for blood collection 5ml — 32.. microcentrifuge tube ( 1.8 ml molecular biology grade ) 33. tooth pick...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

Medical College - Rajasthan

33047950 rate contract for consumable and reagents for various rtpcr labs rate contract for consumable and reagents for various rtpcr labs , n 95 mask ( niosh certified ) , isopropanol molecular grade , nuclease free water molecular grade , rna zap [ rna kill ] , cool racks for pcr tube ( 0.2ml ) with temperature indicator , aluminium foil , vortex mixer for tubes , micro tips for 100 1000?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10?l, low retentionrnase, dnase & pyrogen free sterile , micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10?l , aluminium foil 72 meter , bottle top dispenser with bottle capacity 1 liter capcity 1 10ml , cryo storage card board box 100 wells with cover 2.0ml , discarding jar with swinging lid 5 liter with biosafety symbol , disposable sterile speciman collection swab dacron type , gown blue cloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer with dispensar to be attached to wall , lysol , micro titer pipette set variable volume 100 1000?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 10 100?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 5 50?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 30 300?l. eight channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , microcentrifuge 8 tube rotor , microcentrifuge tube 1.5ml molecular grade sterile , pcr master mix with dntps, taq, mgcl 12, buffer 2000rnx , pcr thermo conductive rack for 96 pcr tubes , safety goggles , trough reservoir capacity 75ml polypropylene , wash bottle 500ml new type , ziploc bag 12x8 , ziploc bag 4x3 , ziploc bag 8x6 , manual multichannel micropipette variable volume autoclavable 100 300?l , eppendorf tube 1.5ml with screw caped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300?l...

Sms Medical College - Rajasthan

33046527 rate contract for consumable and reagents for various rtpcr labs ( nit 37 ) 1. n 95 mask ( niosh certified ) 2. !so propanol molecular grade 3. nuclease free water molecular grade 4. rna zap [ rna kill ] 5. cool racks for pcr tube ( 0.2m1 ) with temperature indicator 6. aluminium foil 7. vortex mixer for tubes 8. micro tips for 100 1000111, low retention rnase, dnase & pyrogen free sterile 9. micro tips for 10 100g1, low retention rnase, dnase & pyrogen free sterile 10. micro tips for 2 10g1, low retention rnase, dnase & pyrogen free sterile 11. micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10g1 12. aluminium foil 72 meter 13. bottle top dispenser with bottle capacity 1 liter capcity 1 10m1 14. cryo storage card board box 100 wells with cover 2.0m1 15. discarding jar with swinging lid s liter with biosafety symbol 16. disposable sterile speciman collection swab dacron type 17. gown blue cloth back open full sieves 18. gown green cloth back open full sieves 19. gown red cloth back open full sieves 20. gown white cloth back open full sieves 21. hand sanitizer with dispensar to be attached to wall 22. lysol, 23. micro titer pipette set variable volume 100 1000g1. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50g1 and below volumes ensures deliver ) of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 24. micro titer pipette set variable volume 10 100g1. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50g1 and below volumes ensures deliver ) of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 25. micro titer pipette set variable volume 5 50g1. single channel fully autoclavable ce ivd certified. super blow out piston wit: volumes of 50g1 and below volumes ensures delivery of micro si drops. piston should be made up of rust free polyether imide / ultralight fortron 26. micro titer pipette set variable volume 30 300g1. eight charm ( fully autoclavable ce ivd certified. super blow out piston witl volumes of 50g1 and below volumes ensures delivery of micro si. drops. piston should be made up of rust free polyether imide / ultralight fortron 27. microcentrifuge 8 tube rotor 28. microcentrifuge tube 1.5m1 molecular grade sterile 29. pcr master mix with dntps, taq, mgci 12, buffer 2000rnx 30. pcr thermo conductive rack for 96 pcr tubes 31. safety goggles 32. trough reservoir capacity 75ml polypropylene 33. wash bottle 500m1 new type 34. ziploc bag 12x8 35. ziploc bag 4x3 36. ziploc bag 8x6 37. manual multichannel micropipette variable volume autoclavabl 100 300g1 38. eppendorf tube 1.5m1 with screw caped self standing 39. micropipette tips filtered, rnase free, dnasc free, pyrogen free, sterile 100 300g1...

Sms Medical College - Rajasthan

33046439 next generation sequencer with accessories and ancillary equipment for tropical medicine and virology department high throughput sequencing system with 3 year warranty. storage server: 128gb ram, 32 core processor, i0otb storade pre installed with necessary blo informatics pipelines forviral genomeanalysis work station compumer: 8core process or 128gb ram, 4th storage bio safety cabinet class ii a2 1.2 refrigerated microcentrifuge heat i3lock deep freezer •2o deep fteezer ( 40°c ) 1.3 1.4 1.5 1.6 refrigerator 1.7 — mini spin 1.8 1.9 pcr ( thermal cycler ) water purification system a mjcropipe11fes single channel of variable volume 0.1 2.5 jil x 10 10 1. 1 l0j.tix10 2 20plxio 10 100 tl x 10 100 100ojilx10 adjustable volume digital multiple channel micropipettes 1.11 30ul 300u1 5ul 50 ul 1.12 vortex mixer 1.1 1.13 insirument for qc check an perform rragment analysis axd qc check interms of nucleic acid quality and quantity w1t1l plate shaker 1.14 — 1.16’ dna rna quantification system — next generation sequencing consumables (some qty provided along with system start up) rest to be oted the price in financial bid . 1.17’ plastic ware — 1.19 laminar flow non refrigerated m1crocentrifuge — mini cenirifuge . and 20 deg) — 1.20 1.21 1.22 walk in coolbr (cold rooms) (4 8 dbg — 1.23 ice flaking machlne — 1.24 vertical autoclave scanner . 1.25 desktop computer with printer & 1.26 laptop with five — 1 27 inverter air conditioner (split type type) star rating 1.28 gel doc imaging system — 1.29 electrophoresis system magnetic stands 96 well plate 1.5 ml/2 ml tubes 100% exiaust — 1.30 1 31 io1ogica1 safety cabinet based on class u type b 2, vertical flow 1.32’ bioinformatics person support in the lab for3 years vendor should provide support in genome scqucncing with bioinformatics expertise and train the faculty/ technical staff on site till warranty period. v l.l il4ml 12’.j v bioinformatics person support in the iab for3 years vendor should provide support in genome sequencing with bioinformntics expertise and train the fnculty/ technical stafr on site till warranty period. 1.32* 1.33e the vendor shnuld process samples for sars cov 2 genome sequencing at their facility in case of any sysnem breakdpwn ata cost decided by the college 1 34 administration. vendor should provide test kits for sars cov 2 gennme analysis with complete kit. etc ...

Rajasthan University Of Health Science - Rajasthan

32695056 supply of various chemical, regents and consumable item for central lab, annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur , india ink , absolute alcohol 99.9% , filter paper sheet whartmann no. 1 ( 460 mm x 570 mm ) , plain tube ( made of plastic, without cap, capacity 5 ml ) , tips 10 200 microloite ( white in colour ) , tips 100 1000 microlitre ( white or blue in colour ) , vacutainer serum ( clot activator ) 4 5 ml capacity , sterile sample storage vial ( individually packed ) capacity 2 ml microcentrifuge tube , blood culture bottle ( adult ) glass bottle 100 ml capacity with lid of aluminium with rubber cork in it , kovacs indole reagent , liquid paraffin , ph indicator strip 6.5 to 9.0 ph measurement , alber stain ( a + b ) , koh pellets , sda with chloramphenical , chrom agar for candida , chrom agar for bacteriological purpose , lpcb , l lysine decarboxylase broth , l ornithine decarboxylase broth , l arginine dihydrolase broth , mannitol salt agar , modified hugh & leifson o / f test , loeffler serum medium base , cled , corn meal agar , andrede’s indicator , bromocresol purple , glucose phosphate broth ( mr vp medium ) , methyl red indicator , alpha naphthol , simmon citrate agar , christensen urease agar , urea 40% , triple sugar iron agar , peptone type i bacteriological , sim agar , blood agar base , bhi broth , deionized water , fluid thioglycollate broth ( anaerobic ) with indicator , macconkey agar , nutrient agar , muller hinton agar , n, n, n’, n’ tetra methyl p phenylenediamine dihydrochloride , coverslip box ( 1 x 20 small box ) , glass slide , disposable polythene gloves , disposable petridish 100 mm ( individually packed ) , disposable sterile swab ( individually packed ) , disposable sterile swab with test tube ( individually packed ) , sputum container plastic , disposable sterile universal container ( individually packed ) , stool container with spoon , h2o2 ( 30% ) , mccartney bottle , petridish glass 150 mm , petridish glass 100 mm , petridish glass 75 mm , tissue paper roll , brain heart infuson ( bhi ) agar , immersion oil for microscopy , bacitracin ( 10 unit ) , bile esculin disc , cotrimoxazole 25 ?g , fosfomycin 50 ?g , furazolidone 50 ?g , imipenam 10 ?g , meropenam 10 ?g , clotrimazole 10 ?g , fluconazole 10 ?g , ketoconazole 10 ?g , itraconazole 30 ?g , flucytosine e test strip , amphotericin b 50 ?g , caspofungin e test strip , posaconazole e test strip , luliconazole e test strip , scrub typhus igm elisa , rpr test for syphilis based on antigen coated on carbon particle , vdrl rapid test card for qualitative detection of antibodies ( igg and igm ) to treponema pallidum , rheumatoid factor ( rf ) latex test kit , antistreptolysin o ( aslo ) latex test kit , crp test latex kit , dengue rapid test card for igm, igg and ns1 , dengue igm elisa , dengue igg elisa , dengue ns1 antigen elisa , chikungunya igm elisa , hav igm elisa , anti hcv elisa , hev igm elisa , hbsag elisa , anti hdv igm , toxoplasma igm elisa , toxoplasma igg elisa , rubella igm elisa , rubella igg elisa , cytomegalovirus igm elisa , cytomegalovirus igg elisa , herpes simplex virus igm elisa , herpes simplex virus igg elisa , hbeag elisa , anti hbc igm elisa , anti hbe elisa , anti hbs elisa , ana elisa , anti ds dna elisa , widal slide test , widal tube test , malaria by card test ( antigen for p.v., p.f. / pan ) , anti hcv rapid card test , urine pregnancy test card / strip , sars cov 2 ( antibody test ) , hbsag rapid test card , hiv rapid test card , chikungunya igm rapid test card , stool for occult blood test kit , h1n1 qualitative detection & differentiation of type a influenza viruses, pandemic influenza, pandemic h1 influenza virus and human rnasep gene ( ic ) , hbv dna quantitative , hcv rna quantitative , hiv 1 rna quantitative , hpv dna qualitative ( qualitative detection of 14 high risk hpv genotypes & differentiation of hpv 16 & 18 genotypes of human papilloma viruses ( hpv ) ) , mtb / ntm ( qualitative detection & differentiation of mycobacterium tuberculosis complex & nontuberculous mycobacteria ) , dengue ( qualitative detection & differentiation of dengue virus serotypes 1 to 4 ) , chikungunya ( qualitative detection of chikungunya virus ) , hsv ( qualitative detection & differentiation of herpes simplex virus 1 & 2 ) , zika virus ( qualitative detection of zika virus ) , rna extraction kit , dna extraction kit , rpmi 1640 medium buffered with mops , cation adjusted mueller hinton broth [ camh broth ] , skirted plate 96 well x 0.2 ml ( autoclavable ) , vancomycin powder , oxacillin powder , colistin powder , fluconazole powder , itraconazole powder , ketoconazole powder , flucytosine powder , amphotericin b powder , voriconazole powder , nystatin suspension 10000 units nystatin per ml in dulbecco phosphate buffered saline ...

Rajasthan University Of Health Science - Rajasthan

32694985 annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur , india ink , absolute alcohol 99.9% , filter paper sheet whartmann no. 1 ( 460 mm x 570 mm ) , plain tube ( made of plastic, without cap, capacity 5 ml ) , tips 10 200 microloite ( white in colour ) , tips 100 1000 microlitre ( white or blue in colour ) , vacutainer serum ( clot activator ) 4 5 ml capacity , sterile sample storage vial ( individually packed ) capacity 2 ml microcentrifuge tube , blood culture bottle ( adult ) glass bottle 100 ml capacity with lid of aluminium with rubber cork in it , kovacs indole reagent , liquid paraffin , ph indicator strip 6.5 to 9.0 ph measurement , alber stain ( a + b ) , koh pellets , sda with chloramphenical , chrom agar for candida , chrom agar for bacteriological purpose , lpcb , l lysine decarboxylase broth , l ornithine decarboxylase broth , l arginine dihydrolase broth , mannitol salt agar , modified hugh & leifson o / f test , loeffler serum medium base , cled , corn meal agar , andrede’s indicator , bromocresol purple , glucose phosphate broth ( mr vp medium ) , methyl red indicator , alpha naphthol , simmon citrate agar , christensen urease agar , urea 40% , triple sugar iron agar , peptone type i bacteriological , sim agar , blood agar base , bhi broth , deionized water , fluid thioglycollate broth ( anaerobic ) with indicator , macconkey agar , nutrient agar , muller hinton agar , n, n, n’, n’ tetra methyl p phenylenediamine dihydrochloride , coverslip box ( 1 x 20 small box ) , glass slide , disposable polythene gloves , disposable petridish 100 mm ( individually packed ) , disposable sterile swab ( individually packed ) , disposable sterile swab with test tube ( individually packed ) , sputum container plastic , disposable sterile universal container ( individually packed ) , stool container with spoon , h2o2 ( 30% ) , mccartney bottle , petridish glass 150 mm , petridish glass 100 mm , petridish glass 75 mm , tissue paper roll , brain heart infuson ( bhi ) agar , immersion oil for microscopy , bacitracin ( 10 unit ) , bile esculin disc , cotrimoxazole 25 ?g , fosfomycin 50 ?g , furazolidone 50 ?g , imipenam 10 ?g , meropenam 10 ?g , clotrimazole 10 ?g , fluconazole 10 ?g , ketoconazole 10 ?g , itraconazole 30 ?g , flucytosine e test strip , amphotericin b 50 ?g , caspofungin e test strip , posaconazole e test strip , luliconazole e test strip , scrub typhus igm elisa , rpr test for syphilis based on antigen coated on carbon particle , vdrl rapid test card for qualitative detection of antibodies ( igg and igm ) to treponema pallidum , rheumatoid factor ( rf ) latex test kit , antistreptolysin o ( aslo ) latex test kit , crp test latex kit , dengue rapid test card for igm, igg and ns1 , dengue igm elisa , dengue igg elisa , dengue ns1 antigen elisa , chikungunya igm elisa , hav igm elisa , anti hcv elisa , hev igm elisa , hbsag elisa , anti hdv igm , toxoplasma igm elisa , toxoplasma igg elisa , rubella igm elisa , rubella igg elisa , cytomegalovirus igm elisa , cytomegalovirus igg elisa , herpes simplex virus igm elisa , herpes simplex virus igg elisa , hbeag elisa , anti hbc igm elisa , anti hbe elisa , anti hbs elisa , ana elisa , anti ds dna elisa , widal slide test , widal tube test , malaria by card test ( antigen for p.v., p.f. / pan ) , anti hcv rapid card test , urine pregnancy test card / strip , sars cov 2 ( antibody test ) , hbsag rapid test card , hiv rapid test card , chikungunya igm rapid test card , stool for occult blood test kit , h1n1 qualitative detection & differentiation of type a influenza viruses, pandemic influenza, pandemic h1 influenza virus and human rnasep gene ( ic ) , hbv dna quantitative , hcv rna quantitative , hiv 1 rna quantitative , hpv dna qualitative ( qualitative detection of 14 high risk hpv genotypes & differentiation of hpv 16 & 18 genotypes of human papilloma viruses ( hpv ) ) , mtb / ntm ( qualitative detection & differentiation of mycobacterium tuberculosis complex & nontuberculous mycobacteria ) , dengue ( qualitative detection & differentiation of dengue virus serotypes 1 to 4 ) , chikungunya ( qualitative detection of chikungunya virus ) , hsv ( qualitative detection & differentiation of herpes simplex virus 1 & 2 ) , zika virus ( qualitative detection of zika virus ) , rna extraction kit , dna extraction kit , rpmi 1640 medium buffered with mops , cation adjusted mueller hinton broth [ camh broth ] , skirted plate 96 well x 0.2 ml ( autoclavable ) , vancomycin powder , oxacillin powder , colistin powder , fluconazole powder , itraconazole powder , ketoconazole powder , flucytosine powder , amphotericin b powder , voriconazole powder , nystatin suspension 10000 units nystatin per ml in dulbecco phosphate buffered saline...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Rajasthan University Of Health Science - Rajasthan

31583020 chemicals reagents consumable items for department of microbiologywork list of annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology sl. no. item description 1 electrical items : 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 alberts stain 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbc (igm & igg) total test 13 anti hbe elisa test kit 14 hbeag elisa kit 15 anti hbs antibody elisa kit 16 hbs ag elisa kit 17 cytomegalovirus (cmv) igg elisa kit 18 cytomegalovirus (cmv) igm elisa kit 19 dengue ns1 antigen elisa kit 20 hav igm elisa kit 21 hcv igm elisa kit 22 hev igm elisa kit 23 ds dna elisa kit 24 ana elisa kit 25 herpes simplex virus (hsv 1 & 2) igg elisa kit 26 herpes simplex virus (hsv 1 & 2) igm elisa kit 27 rubella igg elisa kit 28 rubella igm elisa kit 29 toxoplasma igg elisa kit 30 scrb typhus igm ag elisa kit 31 toxoplasma igm elisa kit 32 biodegradable plasic bags (yellow, red, blue, black) 33 bleaching powder 34 blood agar base 35 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 36 brain heart infusion broth 37 cled media 38 conc. h2so4 39 corn meal agar 40 cover slips 22 x 22 mm 41 crp test kit 42 deionized water 43 dengue rapid test card along with ns1 antigen 44 deoxycholate citrate agar 45 di sodium hydrogen phosphate 46 discarding plastic buckets (yellow, red, blue, black) 20 litre 47 disposable individually packed centrifuge tube conical bottom capacity 50 ml 48 disposable polythene gloves 49 disposable sterile test tube with swab individually packed 50 dubos medium 51 ecoshield 52 edta powder 53 face mask 54 ferric chloride 55 filter paper box whartman no. 1, 12.5 cm circular 56 filter paper sheet whartman no. 1 57 fluid thioglycollate broth (anaerobic) with indicator 58 formalin pellets 59 glass marking pencils (red, white) 60 glass test tube 100 mm x 12 mm without rim 61 glass test tube 75 mm x 12 mm without rim 62 h2o2 (30%) 63 koh pellets 64 kovcks indole reagents 65 l arginine 66 l lysine mono dihydrochloride 67 lactophenol cotton blue solution 68 liquid paraffin 69 loeffler serum medium base bovine serum 70 lowenstein jensen medium 71 macconkey agar 72 macconkey broth 73 maltose 74 mannitol 75 mannitol salt agar 76 mccartney bottle 77 methyl red powder 78 microcentrifuge tube with cap capacity 2 ml 79 mr vp medium (glucose phosphate broth) 80 muller hinton agar 81 n acetyl l cysteine 82 n naphthyl ethylene diamine dihydrochloride 83 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 84 nigrosin 10% 85 nutrient agar 86 oxidase disc 87 peptone water 88 perforated bucket (red, blue) 15 litre double bin 89 petridish glass 90 mm 90 petridish glass 75 mm 91 ph indicator strips 6.5 to 9 ph measurement 92 phenol 93 pottasium dihydrogen phosphate 94 pregnancy test card 95 ra factor kit 96 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 97 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 98 robertson cooked meat medium readymade 99 vdrl rapid test card 100 sabraud’s dextrose agar 101 selenite f broth bacteriological 102 sim agar 103 simmons citrate agar 104 sodium chloride 105 sodium hydroxide pellets 106 sodium hypochlorite solution 107 sterile autoclavable skirted plate 96 wells x 0.3 ml 108 sterile readymade plates of blood agar (90 mm size) 109 sterile readymade plates of macconkey agar (90 mm size) 110 sterile readymade plates of nutrient agar (90 mm size) 111 sterile storage vial 2 ml capacity 112 sterile storage vial 5 ml capacity 113 sterile transport medium (stuart medium) with test tube and swab individually packed 114 stool container with spoon 115 sulphanilamide 116 tcbs 117 triple layer mask 118 trypticase soya broth 119 tsi agar 120 urea agar base 121 viral transport medium 122 widal slide test 123 wilson and blair medium 124 xylene 125 xylose 126 resazurin powder 127 sterile readymade plates of dca (90mm size) 128 sterile readymade plates of tcbs (90mm ) 129 vancomycin powder 130 vencomycin disc 131 amikacin 30 µg 132 amoxycillin 30 µg 133 amoxyclav 20/10 µg 134 amphotericin b 135 ampicillin + sulbactum 136 azithromycin 15 µg 137 aztreonam 30µg 138 bacitracin (0.04 unit) 139 bile esculin disc 140 cefepime 30 µg 141 cefixime 5 µg 142 cefoperazone + sulbactum 75/10 µg 143 cefoperazone 75 µg 144 cefotaxime 30 µg 145 cefotetan 146 cefoxitin 30 µg 147 cefpirome 148 cefpodoxime 10 µg 149 ceftazidime + clavulanic acid 30/10µg 150 ceftazidime 30 µg 151 ceftriaxone 30 µg 152 cefuroxime 30 µg 153 cephalexin 30 µg 154 chloramphenicol 30 µg 155 ciprofloxacin 5 µg 156 clarithromycin 15 µg 157 clindamycin 2 µg 158 clotrimazole 159 colistin 160 cotrimoxazole 25 µg 161 cyclopirox 50 µg 162 dalfopristine 163 daptomycin 164 doripenam 10µg 165 doxycycline 30 µg 166 e strip for esbl detection 167 e strip for mbl detection 168 e strip oxacillin 169 ertapenam 10µg 170 erythromycin 10 µg 171 faropenam 172 fluconazole 25 µg 173 fosfomycin 200 µg 174 furazolidone 50 µg 175 fusidic acid 176 gentamicin 120µg 177 gentamicin 30µg 178 gentamycin 10 µg 179 griseofulvin 10 µg 180 hippurate 181 imipenam 10 µg 182 itraconazole 8 µg 183 kanamycin 184 ketoconazole 15 µg 185 levofloxacin 5µg 186 lincomycin 10 µg 187 linezolid 30 µg 188 meropenam 10 µg 189 miconazole 10 µg 190 moxalactum 191 nalidixic acid 30µg 192 netilmycin 30 µg 193 nitrofurantoin 300 µg 194 norfloxacin 10 µg 195 novobiocin 196 nystatin 197 ofloxacin 5 µg 198 onpg 199 optochin 200 oxacillin 1 µg 201 piperacillin + tazobactum 100/10 µg 202 piperacillin 100 µg 203 polymyxin b 30 units 204 pristinomycin 15µg 205 quinopristin 206 teicoplanin 30 µg 207 terbinafine 1 µg 208 tetracycline 30 µg 209 ticarcillin+clavulanic acid 75/10 µg 210 ticarcillin75µg 211 tigecyclin 15µg 212 tobramycin 10 µg 213 v factor 214 vancomycin 30 µg 215 voriconazole 1 µg 216 x + v factor 217 x factor 218 immersion oil 219 (occuet blood in stool ) kit hemoccult sensa aninophezone test 220 grams stain kit 221 hcv igmrapid card 222 sterile urine container single pack 223 culture loop (nicrome)1mm 24 gauge wire loop 224 culture loop (nicrome) 2mm24 gauge wire loop 225 cotton roll 226 disposable petri disc 90 mm 227 sterile disposable swab sticks with test tube 228 sterile disposable cotton swab (individual pack) 229 hbsag rapid test card 230 aluminium foil (72 meter) 231 rpr test kit 232 vaccutainer vial 4.5ml (serum activator without gel) 233 disposable plain tube 5ml (without cap) plastic 234 disposable plain tube 8ml (without cap) plastic 235 test tube stand 96 hole plastic 236 urea solu 40% 237 glass test tube 10ml 238 glass test tube 20 ml 239 aslo test kit 240 phenyl alanin agar 241 sulphide indole motility test (sim motility medium) 242 test tube holder bighole for 20ml test tube 243 disposable test tube 20ml ...

Sms Medical College - Rajasthan

31026062 rate contract for supply of consumable items for rtpcr lab n 95 mask (niosh certified) , isopropanol molecular grade , ethanol molecular grade , microcentrifuge tube 1.5ml rnase, dnase & pyrogen free , powder free nitrile glove medium , powder free nitrile glove large , cryo gloves medium size , powder free nitrile glove small , gloves latex large , gloves latex medium , gloves latex small , sodium hypochlorite 10% , yellow colored biosafety bag with biosafety symbol 30l , yellow colored biosafety bag with biosafety symbol 5l , red colored biosafety bag with biosafety symbol 30l , red colored biosafety bag with biosafety symbol 5l , black colored biosaety bag with biosafety symbol 30l , black colored biosaety bag with biosafety symbol 5l , nuclease free water molecular grade , cotton roll 500gm , surgical mask 3 play , pcr tube 0.2ml with caps , knee length gown disposable black open full sleves , shoe cover covering till knee , head cover , kim wips 100, 11.17x21.3cm , kim wips 500 37.33x42.16cm , micro centrifuge tube 0.5ml sterile , ppe jump suit with hand gloves and 2 pair shoe cover disposable , rna later [rna live] , rna zap [rna kill] , abro tape , cool racks for pcr tube (0.2ml) with temperature indicator , aluminium foil , discardingjar with swinging lid , mini coolers 20 degree , spray bottles , autoclavable transparent bmw bags 2 lt. capacity , 2% gluteraldehyde , screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , pcr tube rack 1.5 ml , tissue roll (absorbent) , pcr tube 0.5ml , votrec mixer for tubes , absolute alcohol , aerosol free rnase ,dnase, sterile racked flter tips 0.5 10ul , aerosol free rnase ,dnase, sterile racked flter tips 1.0 10ul , aerosol free rnase ,dnase, sterile racked flter tips 100 1000ul , aerosol free rnase ,dnase, sterile racked flter tips 10 100ul , aerosol free rnase ,dnase, sterile racked flter tips 10 200ul , aerosol free rnase ,dnase, sterile racked flter tips 2.0 20ul , aerosol free rnase ,dnase, sterile racked flter tips 0.2 20ul , aerosol free rnase ,dnase, sterile racked flter tips 20 300ul , aerosol free filter tips 0.5 20 ?l , aerosol free filter tips 10 100 ?l , aerosol free filter tips 100 1000 ?l , micro titer pipette set variable volume 0.2–10 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 10– 100 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 100–1000?l fully autoclavable ce ivd certified , micro tips for 100 1000 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10 ?l, low retention rnase, dnase & pyrogen free sterile , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 1 10ul , aluminium foil 72 meter , aspirator bottle with stopcock capcity 10 liters , autoclavable biosafety transparent bag 2l , bench protector size 32 x 460 cms , bottle top dispenser with bottle capcity 1 liter capacity 1 10ml , burner self ignating type or laminar air flow , cryo labels 33 x13 mm approx , cryo screw cap tubes with o ring molecular grade 1.8ml , cryo storage card board box 100 wells with cover 2.0ml , cryo storage polypropylene box 100 wells with cover 90c temp 1.8ml , cryo storage polypropylene box 81 wells with cover 90c temp 1.8ml , diamond marker , discardingjar with swinging lid 5 liter with biosafty symbol , disposable sterile specimen collection swab dracon type , distilled water , echoshield , face shields disposable , falcon tube 15ml sterile , falcon tube 50ml sterile , filter paper pkt no.1 12.5cms , filter paper sheet 46x57 cms , forcep pointed stainless steel 8 , goggles disposable fully covered broad , gown bluecloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer in dropping bottle 500ml , hand sanitizer with dispenser to be attached to wall , lab soakers size 16x20 pad , lint[ kim ]wips 145x200 mm , lint[ kim ]wips 380x600 mm , loop holder with nichrome wire , lysol , marker pen , micro amp optica 8 tube with cap and instrip type , micro pipette stand for 5 pipette , micro titer pipette set fixed volume 100?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 20?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 5?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 50?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 500?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 100 1000?l.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1.0 10ul .single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 10 100ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 2 20ul.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1 10ml . single channelfully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , microcentrifuge 8 tube rotor , microcentrifuge box with cover for 0.5ml with 100 wells , microcentrifuge box with cover for 1.5ml with 64 wells , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free0.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free1.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free2.0 ml conical bottom , microcentrifuge tube 1.5ml molecular grade sterile , microcentrifuge tube 2.0ml molecular grade sterile , mini cooler for pcr tube , optical pcr 8 tubes strip with cap (0.1ml) dnase/ rnase/ inhibition free) compatible with biorad rt pcr machine , parafilm 2x 250 , pcr cooler for 96pcr tube (0.2ml) 20c , pcr master mix with dntps, taq, mgci12, buffer 2000 rxns , pcr optical plate seal for 96 well plate , pcr plate non skirted low profile dnas rnaspyrogen free 96 well , pcr plate semi skirted low profile dnas rnaspyrogen free 96 well , pcr thermo conductive rack for 96 pcr tubes , pcr tube corbett type strip 100ul , pcr tube polypropylene 0.1ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml high profile 8 well strip with cap , pcr tube polypropylene 0.2ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml with caps , pcr tube polypropylene 0.5ml with caps , pcr tube rack 0.2 ml ,96 hole with cover , plastic cable lock tie type for discard bags disposable , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , racks for falcon tubes 50ml , reversible racks for micro tubes and pcr tube with cover 96 holes , safety goggles , stop watch timer electronic , storage box 0.5ml (mct rack) , storage box 1.8ml (mct rack) , test tube plain 12x75mm , thermohygrometer digital , thermometer digital with probe for refrigerator , trough reservoir capacity 75 ml polypropylene , utility tray size 320x260 mm , utility tray size 360x310 mm , utility tray size 540x435 mm , vtm sampleracks for 120 tubes , vtm sampleracks for 62 tubes , vtm tube box 36 wells with cover , wash bottle 500ml new type , ziploc bags 12” x 8” , ziploc bags 4” x 3” , ziploc bags 8” x 6” , vtm with dacron swab (dacron swabs 2 nos. for each vtm tube) , manual multichannel micropipette variable volume autoclavable 100 300ul , eppendorf tube 1.5ml with screw capped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 100 300ul , tough tags for ampoules 1.5 ml...

Medical College - Rajasthan

31022922 rate contract for supply of consumable items for rtpcr labs rate contract for supply of consumable items for rtpcr labs , n 95 mask (niosh certified) , isopropanol molecular grade , ethanol molecular grade , microcentrifuge tube 1.5ml rnase, dnase & pyrogen free , powder free nitrile glove medium , powder free nitrile glove large , cryo gloves medium size , powder free nitrile glove small , gloves latex large , gloves latex medium , gloves latex small , sodium hypochlorite 10% , yellow colored biosafety bag with biosafety symbol 30l , yellow colored biosafety bag with biosafety symbol 5l , red colored biosafety bag with biosafety symbol 30l , red colored biosafety bag with biosafety symbol 5l , black colored biosaety bag with biosafety symbol 30l , black colored biosaety bag with biosafety symbol 5l , nuclease free water molecular grade , cotton roll 500gm , surgical mask 3 play , pcr tube 0.2ml with caps , knee length gown disposable black open full sleves , shoe cover covering till knee , head cover , kim wips 100, 11.17x21.3cm , kim wips 500 37.33x42.16cm , micro centrifuge tube 0.5ml sterile , ppe jump suit with hand gloves and 2 pair shoe cover disposable , rna later [rna live] , rna zap [rna kill] , abro tape , cool racks for pcr tube (0.2ml) with temperature indicator , aluminium foil , discardingjar with swinging lid , mini coolers 20 degree , spray bottles , autoclavable transparent bmw bags 2 lt. capacity , 2% gluteraldehyde , screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , pcr tube rack 1.5 ml , tissue roll (absorbent) , pcr tube 0.5ml , votrec mixer for tubes , absolute alcohol , aerosol free rnase ,dnase, sterile racked flter tips 0.5 10ul , aerosol free rnase ,dnase, sterile racked flter tips 1.0 10ul , aerosol free rnase ,dnase, sterile racked flter tips 100 1000ul , aerosol free rnase ,dnase, sterile racked flter tips 10 100ul , aerosol free rnase ,dnase, sterile racked flter tips 10 200ul , aerosol free rnase ,dnase, sterile racked flter tips 2.0 20ul , aerosol free rnase ,dnase, sterile racked flter tips 0.2 20ul , aerosol free rnase ,dnase, sterile racked flter tips 20 300ul , aerosol free filter tips 0.5 20 ?l , aerosol free filter tips 10 100 ?l , aerosol free filter tips 100 1000 ?l , micro titer pipette set variable volume 0.2–10 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 10– 100 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 100–1000?l fully autoclavable ce ivd certified , micro tips for 100 1000 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10 ?l, low retention rnase, dnase & pyrogen free sterile , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 1 10ul , aluminium foil 72 meter , aspirator bottle with stopcock capcity 10 liters , autoclavable biosafety transparent bag 2l , bench protector size 32 x 460 cms , bottle top dispenser with bottle capcity 1 liter capacity 1 10ml , burner self ignating type or laminar air flow , cryo labels 33 x13 mm approx , cryo screw cap tubes with o ring molecular grade 1.8ml , cryo storage card board box 100 wells with cover 2.0ml , cryo storage polypropylene box 100 wells with cover 90c temp 1.8ml , cryo storage polypropylene box 81 wells with cover 90c temp 1.8ml , diamond marker , discardingjar with swinging lid 5 liter with biosafty symbol , disposable sterile specimen collection swab dracon type , distilled water , echoshield , face shields disposable , falcon tube 15ml sterile , falcon tube 50ml sterile , filter paper pkt no.1 12.5cms , filter paper sheet 46x57 cms , forcep pointed stainless steel 8 , goggles disposable fully covered broad , gown bluecloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer in dropping bottle 500ml , hand sanitizer with dispenser to be attached to wall , lab soakers size 16x20 pad , lint[ kim ]wips 145x200 mm , lint[ kim ]wips 380x600 mm , loop holder with nichrome wire , lysol , marker pen , micro amp optica 8 tube with cap and instrip type , micro pipette stand for 5 pipette , micro titer pipette set fixed volume 100?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 20?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 5?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 50?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 500?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 100 1000?l.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1.0 10ul .single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 10 100ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 2 20ul.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1 10ml . single channelfully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , microcentrifuge 8 tube rotor , microcentrifuge box with cover for 0.5ml with 100 wells , microcentrifuge box with cover for 1.5ml with 64 wells , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free0.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free1.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free2.0 ml conical bottom , microcentrifuge tube 1.5ml molecular grade sterile , microcentrifuge tube 2.0ml molecular grade sterile , mini cooler for pcr tube , optical pcr 8 tubes strip with cap (0.1ml) dnase/ rnase/ inhibition free) compatible with biorad rt pcr machine , parafilm 2x 250 , pcr cooler for 96pcr tube (0.2ml) 20c , pcr master mix with dntps, taq, mgci12, buffer 2000 rxns , pcr optical plate seal for 96 well plate , pcr plate non skirted low profile dnas rnaspyrogen free 96 well , pcr plate semi skirted low profile dnas rnaspyrogen free 96 well , pcr thermo conductive rack for 96 pcr tubes , pcr tube corbett type strip 100ul , pcr tube polypropylene 0.1ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml high profile 8 well strip with cap , pcr tube polypropylene 0.2ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml with caps , pcr tube polypropylene 0.5ml with caps , pcr tube rack 0.2 ml ,96 hole with cover , plastic cable lock tie type for discard bags disposable , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , racks for falcon tubes 50ml , reversible racks for micro tubes and pcr tube with cover 96 holes , safety goggles , stop watch timer electronic , storage box 0.5ml (mct rack) , storage box 1.8ml (mct rack) , test tube plain 12x75mm , thermohygrometer digital , thermometer digital with probe for refrigerator , trough reservoir capacity 75 ml polypropylene , utility tray size 320x260 mm , utility tray size 360x310 mm , utility tray size 540x435 mm , vtm sampleracks for 120 tubes , vtm sampleracks for 62 tubes , vtm tube box 36 wells with cover , wash bottle 500ml new type , ziploc bags 12” x 8” , ziploc bags 4” x 3” , ziploc bags 8” x 6” , vtm with dacron swab (dacron swabs 2 nos. for each vtm tube) , manual multichannel micropipette variable volume autoclavable 100 300ul , eppendorf tube 1.5ml with screw capped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 100 300ul , tough tags for ampoules 1.5 ml...

Jawaharlal Nehru Medical College - Rajasthan

30800832 rate contract for covid 19 lab consumable items rate contract for covid 19 lab consumable items 1.01 aerosol free tips 10 ui stenle and rnase free 1.02 aerosol tree tips 20ul sterile and rnase free 1.03 aerosol free tips 200ul sterile and rnase free 1.04 aerosol tree tips 1000ulstenleandrrnase free 1.05 ethanol molecular grade 1.06 isopropyl alchol ( isoprcpa! ol ) molecular grade 1.07 nitril gioves powder free medium size 1.08 nitrll gloves powder tree large size 1.09 1.5 ml graduated microcentrifuge tube with flat top capcertified rnase & dnase free 1.1 optical pcr 8 strip tube ( 0.2m1 pcr dnai’rnaseipcr inhibition free ) comaptible with biored pcr 8 strip cap ( 0.1ml pcr compatible dnairnaseipcr inhibition free 1.11 molecular grade nuclease free water 1.12 screwcapwial2.0min 1.13 0.1 ml hard shell optical pcr plate with seal 96well ( coupatible with biored rt pcr ) 1.14 kim wipes ( kimtech science brand 11x21 cm> 1.15 surface and ermronment disinfectant hydrogen peroxide 1 ltr 1.16 surface and enwonment disinfedtant hydrogen peroxide 5ltr...

Jawaharlal Nehru Medical College - Rajasthan

30783751 rate contract for covid 19 lab consumables and other items aerosol free tips 10 ul sterile and rnase free, ethanol molecular grade, isopropyl alchol, nitril gloves powder, 1.5 ml graduated microcentrifuge tube with flat top capcertified rnase & dnase free, optical pcr, molecular grade nuclease, screw cap, kim wipes, surface and environment disinfectant hydrogen peroxide....

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Rajasthan University Of Health Science - Rajasthan

30259092 chemicals reagents consumable items for department of microbiology chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , dengu igm elisa kit , chikungunya igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , lugols iodine solution , plastic scurbber , test tube washing brush , disposable test tube 20ml...

Department of Agricultural Research and Education - Rajasthan

30036485 bids are invited for beakers 50 ml ch/gla/plast etc , beakers 1000 ml ch/gla/plast etc , beakers 2000 ml ch/gla/plast etc , blotting paper (46x57) cm mill made) ch/gla/plast etc , filter papers 10. 1 (50 mm) ch/gla/plast etc , filter papers no.1 (90 mm) ch/gla/plast etc , aspritator bottle (10 lit) ch/gla/plast etc , carboy with stop cock ch/gla/plast etc , particulte respirator (with exhation valve) ch/gla/plast etc , spoon scale ch/gla/plast etc , funnels plain (25 mm) ch/gla/plast etc , funnels plain (35 mm) ch/gla/plast etc , petri dish (100 mm) ch/gla/plast etc , 10ul microtips ch/gla/plast etc , 200ul microtips ch/gla/plast etc , 2ml microcentrifuge tube ch/gla/plast etc , 1.5 ml microcentrifuge tube ch/gla/plast etc , 0.5 ml microcentrifuge tube ch/gla/plast etc , pestle and mortar ch/gla/plast etc , pestle and mortar, ch/gla/plast etc , pestle and mortar. ch/gla/plast etc , clean wrap ch/gla/plast etc , aluminium foil ch/gla/plast etc , laboratory aperson ch/gla/plast etc , blotting paper ch/gla/plast etc , seeding germination box size with cover ch/gla/plast etc , three layered aluminium foil pouch ch/gla/plast etc , lint free wipes ch/gla/plast etc total quantity : 1...

Medical And Health Services - Rajasthan

29959065 supply of lab regents supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clothing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , hb.tube , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 μl ) , blue tips for micro pipette ( 1000 μl ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , cryo vial 1.8 ml , micro centrifuge tube 1.5 ml , micro centrifuge tube 2.0 ml , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 μl , aerosol barrier tips 20 μl , aerosol barrier tips 100 μl , aerosol barrier tips 200 μl , aerosol barrier tips 1000 μl , 96 well sample rack ( 1.5 ml to 2.0 ml microcentrifuge tube rack ) , aluminiumfoil ( 50 mtr rolls ) , 96 well cryo box for croyo vial 1ml to 2 ml , cryo screw cap vial with o ring molecular grade 1.8 ml , reversible rack for mct and pcr tube , low profile pcr tube 01 to 0.2 ml strip of 8 tube with cap , zip lock packets for 8x4 in poly bag size ( 8x4ich. ) , zip lock packets for 8x4 in poly bag size ( 5x7 ich. ) , zip lock packets for 8x4 in poly bag size ( 6x8 ich. ) , zip lock packets for 8x4 in poly bag size ( 10x12 ich. ) , tough tags / cryo labels , autoclavable bmw discardbags 30 ltr red , autoclavable bmw discardbags 5 ltr red , autoclavable bmw discardbags 30 ltr yellow , autoclavable bmw discardbags 30 ltr black , autoclavable bmw discardbags 5 ltr yellow , autoclavable bmw discardbags 80 ltr yellow , water molecular grade 500 ml , self locking cable tie for bmw bags , 96 well cooler for pcr tube 20°c , micro pipette stand , sanitizer with ( >70% alcohol ) ( 500 ml packing ) , hypochlorite 5% to 10% , formalin , 96 well racks for 1.5 ml and 2 ml micro centrifuge tube , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , spin column for viral nucleic acid extraction , cryo gloves , viral rna extraction kit , rt pcr reagents kit for covid 19 testing , single channel micropipette 2 20μl , single channel micropipette5 50μl , single channel micropipette10 100 μl , single channel micropipette50 200 μl , single channel micropipette100 1000 μl , multi channel micropipette2 20 μl , multi channel micropipette30 300 μl , multi channel micropipette5 50 μl , falcon tube 50 ml , falcon tube 15 ml , pcr tube rack 96 well for 0.1 0.2 μl tube , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) ....

Medical And Health Services - Rajasthan

29948600 supply of lab regents 1. hcv test (tr dot rapid card) 2. hbsag test (rapid card) 3. hbsag elisa test kit m 4. hiv test (tr dot rapid card) 5. hiv elisa test kit (4t gen.) hcv elisa test kit vdrl test kit (strip) 6. 7. 8. urine pregnancy test kit (card) 9. dengue test kit (rapid card) 10. dengue 1gm elisa test kit — 11. dengue ns 1 elisa test kit 12. id card for gel card cross matching (for biorad machine) 13. pt test reagent kit (4x2 ml) 14. widal test kit 15. malaria card (rapid test for malaria antigen) 16. crp test 17. aslo test kit 18. r.a. factor kit (slide method) . 19, anti a, anti b & anti d (monoclonal lgg & 1gm) 20. anti d (monoclonal igg & 1gm) 21. anti d monoclonal 1gm 22. anti h lectin 23. anti a1 lectine 24. bovine albumin 25. anti human globulin (codnbs sera) 26. multistix urine test strips (for 10 parameter) 27. urine trip for ketones & glucose 28. leishman stain liquid (ready to use) 34. capillary tube for clothing time 35. esr stand 36. methanol 37. dionised water 38. sample cup for 8iochemstry 39. ecoshield 40. absolute isopropenol (molecular grade) 41. reservior trough 42. plain glass test tube 43. 96 well vtm rack (for 15 ml vtm) 44. blood sugar test kit(manual) /3. r/30.a giemsa stain solution (ready to use) field stain reagent (a+b) 31. whatmans filter paper 32. ph.paper (litmus paper) 33. cover slip for slide 45. s. urea (manual) 46. s. creatinine (manual) 47. s. bilirubin (manual) s. sgot (manual) s. sgpt (manual) wr.c dilutingfluid? 48. 49. 50. 51. r.b.c diluting fluid 52. semen diluting fluid 53. eosinophil diluting fluid 54. platelet diluting fluid 55. sahlis haemoglobinometer 56. hb.tube m 57. hb. pipette 58. w.b.c pipette 59. r.b.c pipette 60. improved neubauer counting chamber 61. clean sole solution (glass ware) 62. levermed lab airticals disinfectant 63. combystyne labairticle disinfectant ia .? tourniquet 65. sealer tips 66. yellow tips micro pipette (10 100 l) 67. blue tips for micro pipette (10oo pl) 68. sterile urine container screw cap 3oml 69. liss (low ionic strength saline) 70. 3.2% sodium citrate coated disposable esr tube/pipette 71. pricker disposable(lancet) 72. sulphur powder 73. glacial acetic acid 74. liquid paraffin (heavy) 75. iodine solution 76. xylene 77. microscope glass slide 78. k) edta disposable vaccutainer vial 79. plain disposable vaccutainer vial 80. sodium floride (naf) disposable vaccutainer vial 81. clot activator disposable vaccutainer vial 82. 3.2% sodium citrate disposable vaccutainer vial 83. chikengunya 1gm elisa test kit 84. scrub typus elisa test kit 85. cryo vial 1.8 ml 86. micro centrifuge tube 1.5 ml 87. micro centrifuge tube 2.0 ml 88. ethanol molecular grade(500 ml) 89. aerosol barrier tips 10 i.tl 90. aerosol barrier tips 20 il 91. aerosol barrier tips 10o ill 92. aerosol barrier tips 20o ul 93. aerosol barrier tips 1000 ul i 94. 96 well sample rack (1.5 ml to 2.0 ml microcentrifuge tube rack)95. aluminiuni foil (50 mtr rolls) 96. 96 well cryo box for croyo vial imi to 2 ml 1 cryo screw cap vial with o ring molecular grade 1.8 ml 98. reversible rack for mct and pcr tube 99. low profile pcr tube 01 to 0.2 ml strip of 8 tube with cap 100 zip lock packets for 8x4 in poly bag size (8x4ich.) 101 zip lock packets for 8x4 in poly bag size (5x7 ich.) 102 zip lock packets for 8x4 in poly bag size (6x8 ich.) 103 zip lock packets for 8x4 in poly bag size (lox 12 ich.) 104 tough tags/cryo labels 105 autodavable bmw discard bags 30 ltr red 106 autoclavable bmw discard bags 5 ltr red 107 autoclavable bmw discard bags 30 itr yellow 108 autoclavable bmw discard bags 30 ltr black 109 autoclavable bmw discard bags s ltr yellow 110 autoclavable bmw discard bags 8o ltr yellow 77. 111 water molecular grade 50o ml 112 self locking cable tie for bmw bags 113 96 well cooler for pcr tube 20vcr 114 micro pipette stand 115 sanitizer with (>70% alcohol) (s00 ml packing) 116 hypochlorite 5x to 10% 117 rormalin 118 96 well racks for 1.5 ml and 2 ml micro centrifuge tube 119 low profile pcr plate with sealer 120 pcr plate sealer 1 121 rnase zap 122 70% ethanol (5o0 ml packing) 123 spin column for viral nucleic acid extraction 124 cryo gloves 125 viral rna extraction kit 126 rt pcr reagents kit for covid 19 testing 127 single channel micropipette 2 20ul 128 single channel micropipette 5 5oiil 129 single channel micropipette 10 100 jil 130 single channel micropipette 50 200 ii 31 single channel micropipette 100 1oo0 pl 132 multi channel micropipette 2 20 p1 133 multi channel micropipette 30 30o u1 134 multi channel micropipette 5 50 p1 135 falcon tube 50 ml 136 falcon tube 15 ml 137 pcr tube rack 96 well for 0.1 0.2 p1 tube 138 pt test vial 139 creatinine manual kit 2x100ml 140 urea manual kit 2x10oml 141 scrub typhus rapid card test kit. 142 chikungunya rapid card test kit. 143 serum cholesterol test kit (manual) 144 serum triglycerides test kit (manual) 145 serum hdl test kit (manual). 146 serum alkaline phosphatase test kit (manual). 147 serum protein test kit (manual). 148 serum albumin test kit (manual). ...

Department of Agricultural Research and Education - Rajasthan

29508428 bids are invited for bod incubator (700 x 900 x650 mm 15 cu. ft with 490 ltrs. capacity) chemical , colony counter digital chemical , double distillation unit (1.5 lt / hr) chemical , hot air oven (18x 24x18) chemical , potassium nitrate 99.5 % ar chemical , petroleum ether 40 60°c ar chemical , sodium nitrite 98 % ar chemical , sodium hydroxide pellets 98% ar chemical , potassium chloride 99.5 % ar chemical , sodium acetate anhydrous ar> 99% chemical , beakers 50 ml chemical , beakers 1000 ml chemical , beakers 2000 ml chemical , blotting paper (46x57) cm mill made) chemical , filter papers 10. 1 (50 mm) chemical , filter papers no.1 (90 mm) chemical , aspritator bottle (10 lit) chemical , carboy with stop cock chemical , particulte respirator (with exhation valve) chemical , spoon scale chemical , funnels plain (25 mm) chemical , funnels plain (35 mm) chemical , petri dish (100 mm) chemical , three layered aluminium foil pouch printed (18x12 cm) chemical , 10ul microtips chemical , 200ul microtips chemical , dry bath incubator chemical , 2ml microcentrifuge tube chemical , 1.5 ml microcentrifuge tube chemical , 0.5 ml microcentrifuge tube chemical , pestle and mortar chemical , pestle and mortar, chemical , pestle and mortar. chemical , clean wrap chemical , aluminium foil chemical , laboratory aperson chemical , blotting paper chemical , seeding germination box size with cover chemical , three layered aluminium foil pouch chemical , lint free wipes chemical , sample container 60 ml chemical , sample container 100 ml chemical , laboratory spatula chemical , geepol (cleaning solution 5 litre) chemical , disinfectant for hand wash 5lit chemical , drying rack chemical , test tube basket chemical , test tube rack chemical , funnel 65 mm chemical , flask (flat bottom) 250 ml chemical , aluminium foil chemical , test sieve 2 mm chemical , test sieve 1 mm che...

Medical College - Rajasthan

27456523 supply of various type of test kits and consumables for biochemistry department 1 serum sugar 2 serum total protein 3 serum albumin 4 serum total cholesterol 5 serum triglyceride 6 serum calcium 7 serum phosphorus 8 serum uric acid 9 serum ggt 10 serum acid phosphatase 11 serum creatine phosphakinase ( ck nac / cpk ) 12 serum ck mb kit with calibrator & control 13 multi calibrator 14 serum urea 15 serum creatinine 16 sgot 17 sgpt 18 alkeline phosphatase 19 csf microprotein 20 hitachi sample cup 21 disposable test tube ( 12 x 75mm with rim, 5ml capacity, bottom round, autoclavable and thermal resistant, highly transparent 22 white paper laboratory tissue roll 23 paper rim ( a4 size ) 24 rack for hold disposable test tubes & hitachi cups 25 disposable assay tip on rack ( tip size 0 200 μl ) 26 disposable assay tip on rack ( tip size 100 1000 μl ) 27 disposable assay tip ( tip size 5000 μl ) 28 tray with divided 2 4 compartments 29 plastic dustbin with foot operated lid ( 50 ltr capacity ) 30 plastic disposable begs for biomedical waste ( 50 ltr capacity ) 31 narrow mouth distilled water dispenser bottle ( 500 ml ) 32 glass pipettes ( capacity 10ml ) 33 glass pipette dispenser / controller 34 glass pipette stand 35 sample roller mixer for 5ml liquid vials 36 microcentrifuge tube ( capacity 1 2 ml ) 37 rack for hold the 1 2 ml microcentrifuge tube 38 marker pen fine tip 39 antiseptic soap for hand wash ( liquid ) 40 hand sanitizer ( liquid ) , 41 blood sample collection tube size for adult ~7 ml capacity 42 blood sample collection tube size for pediatric ~5 ml capacity 43 adaptor for 5 ml capacity pediatric blood sample collection tube...

Rajasthan University Of Health Science - Rajasthan

27023275 annual rate cont for various regents consumable chemicals for department of pathology microbio biochem blood bank 2 edta vial with cap & label ( 5ml ) 3 plain vial with cap & label ( 5ml ) 4 plain vial working ( riya ) vial 5 ml 5 glass slides 6 band aid ( round ) 7 thermacol box 8 donor pressure ball 9 permanent marker pen ( blunt ) 10 permanent marker pen ( pointed ) 11 hand sanitiser ( alcorub ) 12 10% sodium hypochloride 13 tips 100 ul 14 tips 1000 ul 15 dropper 16 distilled water 17 tissue paper roll 18 all types of blood bags 19 transfer blood bag 300 ml 20 double blood bag 350 / 450ml ( sagm ) 21 triple blood bags 350 / 450ml ( sagm ) 22 rapid card test 23 rapid card hbsag test 24 rapid card hcv ( tri dot ) test 25 rapid card hiv ( tri dot ) test 26 rapid card malaria antigen test 27 rapid card vdrl test 28 elisa kit 29 hbsag elisa kit 30 hcv elisa kit 31 hiv ( 4th generation ) elisa kit 32 abd blood grouping anti sera 33 anti a blood grouping antisera 34 anti b blood grouping antisera 35 anti d ( igg+igm ) rh blood grouping antisera 36 anti a1 blood grouping antisera 37 anti ab blood grouping antisera 38 bbr temperature chart 39 microbiology 40 alpha naphthol ar 41 aniline 42 autoclave indicator strip 43 bleaching powder 44 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 45 brain heart infusion broth 46 conc. h2so4 47 corn meal agar 48 di sodium hydrogen phosphate 49 dubos medium 50 face mask 51 ferric chloride 52 glass marking pencils ( red and white ) 53 l arginine 54 l lysine mono dihydrochloride 55 liquid paraffin 56 loeffler serum medium base bovine serum 57 mannitol 58 mannitol salt agar 59 mccartney bottle 60 methyl red powder 61 microcentrifuge tube with cap capacity 2 ml 62 n acetyl l cysteine 63 n naphthyl ethylene diamine dihydrochloride 64 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 65 oxacillin powder 66 perforated bucket ( red, blue ) 15 litre double bin 67 ph indicator strips 6.5 to 9 ph measurement 68 phenol 69 pottasium dihydrogen phosphate 70 sim agar 71 simmons citrate agar 72 sodium hydroxide pellets 73 sterile autoclavable skirted plate 96 wells x 0.3 ml 74 sterile readymade plates of blood agar ( 90 mm size ) 75 sterile readymade plates of macconkey agar ( 90 mm size ) 76 sterile readymade plates of nutrient agar ( 90 mm size ) 77 sterile storage vial 2 ml capacity 78 sterile storage vial 5 ml capacity 79 stool container with spoon 80 sulphanilamide 81 triple layer mask disposable 82 xylose 83 gram stain kit 84 vancomycin powder 85 amphotericin b 86 cefotetan 87 cyclopirox 50 μg 88 dalfopristine 89 daptomycin 90 doripenam 10μg 91 doxycycline 30 μg 92 e strip for esbl detection 93 e strip for mbl detection 94 e strip oxacillin 95 ertapenam 10μg 96 erythromycin 10 μg 97 faropenam 98 fosfomycin 200 μg 99 griseofulvin 10 μg 100 imipenam 10 μg 101 kanamycin 102 meropenam 10 μg 103 netilmycin 30 μg 104 oxacillin 1 μg 105 piperacillin + tazobactum 100 / 10 μg 106 piperacillin 100 μg 107 polymyxin b 30 units 108 pristinomycin 15μg 109 quinopristin 110 teicoplanin 30 μg 111 terbinafine 1 μg 112 tigecyclin 15μg 113 voriconazole 1 μg 114 ( occuet blood in stool ) kit hemoccult sensa aninophezone test 115 micro pipette tips 200 micro liter 116 micro pipette tips 1000 micro liter 117 micro pipette tips 10 micro liter 118 hbsag rapid card ( test kit ) 119 rpr slide method ( test kit ) 120 vacutainer vial ( serum activator without gel ) 4ml. size 13x75mm 121 disposable plain tube without cap ( plastic ) 5ml. size 13x75mm 122 disposable plain tube without cap ( plastic ) 8ml 123 test tube stand 96 hole ( plastic ) 124 pathology 125 anti a ( sera ) 126 anti b ( sera ) 127 anti d ( sera ) 128 sodium metabisulfite 129 sprit 130 g6pd kit ( 12 tests ) 131 ocult blood kit 132 coombs anti sera 133 disposible nediles ( 24guage ) 134 ketone strips 135 microscope bulf 136 cedar wood oil 137 rapid h & e 138 sodium citrate 3.2% 139 small test tube plastic 140 small test tube glass 141 urine multi strips 142 new improved neubaur counting chamber having nsilwar watad 9 mm 2 ruled area 143 giemsa stain liquid 144 hematoxiline powder 145 myloproxidase 146 disposable syringes 2ml 147 disposable syringes 5ml 148 disposable syringes 10ml 149 disposable syringes 20ml 150 cotton roll 151 petridish disposable 152 hand senitiser 153 dlc counter ( 8 diffrential min ) 154 activated charcoal 155 chloral hydrate 156 formalin ( formaldehyde 37 40 % 157 glycerin 158 malt diastase 159 numbering paper 160 peanut oil 161 sulfurous acid 162 disposable gloves n1. sterile n2. unsteriliged 163 non specihe esterase kit 164 bovine albumin 22% 165 control for five part cbc analayser ( high ) 166 control for five part cbc analayser ( low ) 167 control for five part cbc analayser ( normal ) 168 csf fluid 169 disposinle sterile urine container 170 edta coated vial with cap and lebal 171 platelet diluting fluid 172 vacutainer edta vial 173 vacutainer sodium citrate 3.2 % vial 174 biochemistry 175 amylase 176 calcium 177 ck mb kit with calibrator 178 ck mb control 179 csf protein control 180 csf protein / urine protein estimation kit with standard / calibrator 181 glucose 182 hba1c kit with calibrator 183 hb1ac control level i and ii 184 hdl kit with calibrator 185 lipase kit with calibrator and control 186 acid phosphatase 187 s.magnecium 188 tips 100 1000 μl 189 tips 10 200 μl 190 vacutainer ( fluoride ) 191 vacutainer serum clot activator 192 micro pipette 100 1000 micro liter 193 micro pipette 1000 micro liter 194 micro pipette 10 100 micro liter 195 sample storage vials ( plastic ) 196 ada with calibrator & control 197 ada with calibrator & control 198 ada with calibrator & control 199 sample cup for auto analyzer ( hitachi cups ) 200 ada with calibrator & control 201 test tube stand...

Government Medical College - Rajasthan

26875564 supply of microcentrifuge , vrdl , supply of microcentrifuge , taxes , gst ( in amount ) , camc shall be given after 03 year warranty period for 07 year @ 4% of the net rate ( excluding gst as applicable ) and yearly escalation of 5% on last years camc price will be considered ....

Sms Medical College - Rajasthan

26819876 supply of laboratory reagents albumin reagents, alkaline ptase reagents , amlyase regents , anti human coombs sera , aslo , bilirubin direct and total , blood sugar reagents , blude tipps , cappilary tube , cbc paper roll , chikungunia rapid card , control for pt , control of semi auto analyser , cover slip , crp , csf diluting fluids , csf protein reagents , cuvettes for prothrombin time , dengue ns1 , dengue rapid card , disposable lancet , esr tubes , syringe , distilled water , edta vial , fluoride oxalaled viales , glass marking pencil , glass slides , grouping antigen , hb strip , hbsag card test , hdl direct reagents , jsb i and ii , kit for chikungunia elisa , dengue elisa , kit for t3 t4 tsh , kit for scrub typhus elisa , leishmans stain , malaria card antigen , marker , mask n 95 , mt vials , multistix , n / 10 hcl , non vaccume big red screw capped plasatic tube , p.t. regents , plain plastic tube , paper roll for pt machine , paraffin oil , platelet diluting fluid , ppe kit, pregnancy strip , pt.vials , ra kit , rbc diluting fluids , s. uric acid reagents , s.calcium regents , s.ck mb , s.ck nac , s. creatinine reagents , s.ldh , savlon , screw capped microcentrifuge tube , scrub typhus rapid card , seman diluting fluids , sgot reagents , sgpt reagents , sodium ciitrrate , sodium hypochloride , steel ball for pt , sticker , t.e.c. diluting fluids , tincher iodine , tissue paper roll , total cholsterol reagents , total protein reagents , tourniquate rubber , triglycerides reagents , urea reagents , uristix , vdrl kit , vtm , wash reagents washing solution for semiautoanaliyser , wbc dilubing fluids , widal kit , yellow tipps , sugar strips etc...

Sms Medical College - Rajasthan

26760747 supply of consumables and reagent for rtpcr lab micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , microcentrifuge 8 tube rotor, microcentrifuge box with cover for 0.5ml with 100 wells, microcentrifuge box with cover for 1.5ml with 64 wells, microcentrifuge tube (eppendorf) dnas, rnas and pyrogen free 0.5ml conical bottom, microcentrifuge tube (eppendorf) dnas, rnas and pyrogen free 1.5ml conical bottom, microcentrifuge tube (eppendorf) dnas, rnas and pyrogen free 2.0 ml conical bottom, microcentrifuge tube 1.5ml molecular grade sterile, microcentrifuge tube 2.0ml molecular grade sterile, mini cooler for pcr tube, optical pcr 8 tubes strip with cap (0.1ml) dnase/ rnase/ inhibition free) compatible with biored rt pcr machine, parafilm 2x 250, pcr cooler for 96 pcr tube (0.2ml) 20c, pcr master mix with dntps, taq, mgci12, buffer 2000 rxns, pcr optical plate seal for 96 well plate, pcr plate non skirted low profile dnas rnas pyrogen free 96 well, pcr plate semi skirted low profile dnas rnas pyrogen free 96 well, pcr thermo conductive rack for 96 pcr tubes, pcr tube corbett type strip 100ul, pcr tube polypropylene 0.1ml low profile 8 well strip with cap, pcr tube polypropylene 0.2ml high profile 8 well strip with cap, pcr tube polypropylene 0.2ml low profile 8 well strip with cap...

Sms Medical College - Rajasthan

26760543 supply of consumables and reagent for rtpcr lab n 95 mask ( niosh certified ) , isopropanol molecular grade, ethanol molecular grade, microcentrifuge tube 1.5ml rnas, dnas & pyrogen free, powder free nitrile glove medium, powder free nitrile glove large, cryo gloves medium size, powder free nitrile glove small, gloves latex large, gloves latex medium, gloves latex small, sodium hypochlorite 10%, autoclavable yellow colored biosafety bag with biosafety symbol 30l, autoclavable yellow colored biosafety bag with biosafety symbol 5l, autoclavable red colored biosafety bag with biosafety symbol 30l, autoclavable red colored biosafety bag with biosafety symbol 5l, autoclavable black colored biosaety bag with biosafety symbol 30l, autoclavable black colored biosaety bag with biosafety symbol 5l, nuclease free water molecular grade, tough tags for ampoules 1.5ml, , cotton roll 500gm, surgical mask 3 play, pcr tube 0.2ml with caps, knee length gown disposable black open full sleves, shoe cover covering till knee, head cover, kim wips 100, 11.17x21.3cm, kim wips 500 37.33x42.16cm, micro centrifuge tube 0.5ml sterile, ppe jump suit with hand gloves and 2 pair shoe cover disposable, rna lattar [ rna live ] , rna zap [ rna kill ] , rna zap , abro tap, cool racks for pcr tube ( 0.2ml ) with temperature indicator, aluminium foil, discarding jar with swinging lid, mini coolers 20 degree, spray bottles, autoclavable transparent bmw bags 2 lt. capacity, cryo lables, 2% gluteraldehyde, screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial, polycarbonate storage box 96 wells with stand ampoules 1.5 ml, pcr tube rack 1.5 ml, tissue roll ( absorbent ) , pcr tube 0.5ml, votrec mixer for tubes, absolute alcohol, ...

Medical College - Rajasthan

26745211 supply of consumable and reagent for rtpcr lab 1 n 95 mask ( niosh certified ) 2 isopropanol molecular grade 3 ethanol molecular grade 4 microcentrifuge tube 1.5ml rnas, dnas & pyrogen free 5 powder free nitrile glove medium 6 powder free nitrile glove large 7 cryo gloves medium size 8 powder free nitrile glove small 9 gloves latex large 10 gloves latex medium 11 gloves latex small 12 sodium hypochlorite 10% 13 autoclavable yellow colored biosafety bag with biosafety symbol 30l 14 autoclavable yellow colored biosafety bag with biosafety symbol 5l 15 autoclavable red colored biosafety bag with biosafety symbol 30l 16 autoclavable red colored biosafety bag with biosafety symbol 5l 17 autoclavable black colored biosaety bag with biosafety symbol 30l 18 autoclavable black colored biosaety bag with biosafety symbol 5l 19 nuclease free water molecular grade 20 tough tags for ampoules 1.5ml, 21 cotton roll 500gm 22 surgical mask 3 play 23 pcr tube 0.2ml with caps 24 knee length gown disposable black open full sleves 25 shoe cover covering till knee 26 head cover 27 kim wips 100, 11.17x21.3cm 28 kim wips 500 37.33x42.16cm 29 micro centrifuge tube 0.5ml sterile 30 ppe jump suit with hand gloves and 2 pair shoe cover disposable 31 rna lattar [ rna live ] 32 rna zap [ rna kill ] 33 rna zap 34 abro tap 35 cool racks for pcr tube ( 0.2ml ) with temperature indicator 36 aluminium foil 37 discarding jar with swinging lid 38 mini coolers 20 degree 39 spray bottles 40 autoclavable transparent bmw bags 2 lt. capacity 41 cryo lables 42 2% gluteraldehyde 43 screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial 44 polycarbonate storage box 96 wells with stand ampoules 1.5 ml 45 pcr tube rack 1.5 ml 46 tissue roll ( absorbent ) 47 pcr tube 0.5ml 48 votrec mixer for tubes 49 absolute alcohol 50 aerosol free rnas , dnas, sterile racked flter tips 0.5 10ul 51 aerosol free rnas , dnas, sterile racked flter tips 1.0 10ul 52 aerosol free rnas , dnas, sterile racked flter tips 100 1000ul 53 aerosol free rnas , dnas, sterile racked flter tips 10 100ul 54 aerosol free rnas , dnas, sterile racked flter tips 10 200ul 55 aerosol free rnas , dnas, sterile racked flter tips 2.0 20ul 56 aerosol free rnas , dnas, sterile racked flter tips 20 300ul 57 aerosol free filter tips 0.5 20 μl 58 aerosol free filter tips 10 100 μl 59 aerosol free filter tips 100 1000 μl 60 micro titer pipette set variable volume 0.2–10 μl fully autoclavable ce ivd certified 61 micro titer pipette set variable volume 10– 100 μl fully autoclavable ce ivd certified 62 micro titer pipette set variable volume 100–1000μl fully autoclavable ce ivd certified 63 micro tips for 100 1000 μl, low retention rnas, dnas & pyrogen free sterial 64 micro tips for 10 100 μl, low retention rnas, dnas & pyrogen free sterial 65 micro tips for 2 10 μl, low retention rnas, dnas & pyrogen free sterial 66 micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 1 10ul 67 aluminium foil 72 meter 68 aspirator bottle with stopcock capcity 10 liters 69 autoclavable biosafety transparent bag 2l 70 bacillocid 71 bench protector size 32 x 460 cms 72 bottle top dispenser with bottle capcity 1 liter capacity 1 10ml 73 burner self ignating type for laminar air flow 74 cryo labels 33 x13 mm approx 75 cryo screw cap tubes with o ring molecular grade 1.8ml 76 cryo storage card board box 100 wells with cover 2.0ml 77 cryo storage polypropylene box 100 wells with cover 90c temp 1.8ml 78 cryo storage polypropylene box 81 wells with cover 90c temp 1.8ml 79 diamond marker 80 discarding jar with swinging lid 5 liter with biosafty symbol 81 disposable sterile specimen collection swab dracon type 82 distilled water 83 echoshield 84 face shields disposable 85 falcon tube 15ml sterile 86 falcon tube 50ml sterile 87 filter paper pkt no.1 12.5cms 88 filter paper sheet 46x57 cms 89 forcep pointed stainless steel 8 90 goggles disposable fully covered broad 91 gown blue cloth back open full sleves 92 gown green cloth back open full sleves 93 gown red cloth back open full sleves 94 gown white cloth back open full sleves 95 hand sanitizer in dropping bottle 500ml 96 hand sanitizer with dispenser to be attached to wall 97 lab soakers size 16x20 pad 98 lint [ kim ] wips 145x200 mm 99 lint [ kim ] wips 380x600 mm 100 loop holder with nicrome wire 101 lysol 102 marker pen 103 micro amp optica 8 tube with cap and in strip type 104 micro pipette stand for 5 pipette 105 micro titer pipette set fixed volume 100μl fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 106 micro titer pipette set fixed volume 20μl fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 107 micro titer pipette set fixed volume 5μl fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 108 micro titer pipette set fixed volume 50μl fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 109 micro titer pipette set fixed volume 500μl fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 110 micro titer pipette set variable volume 100 1000μl.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 111 micro titer pipette set variable volume 1.0 10ul .single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 112 micro titer pipette set variable volume 10 100ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 113 micro titer pipette set variable volume 5 50ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 114 micro titer pipette set variable volume 2 20ul.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 115 micro titer pipette set variable volume 1 10ml . single channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 116 micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 117 micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. 118 microcentrifuge 8 tube rotor 119 microcentrifuge box with cover for 0.5ml with 100 wells 120 microcentrifuge box with cover for 1.5ml with 64 wells 121 microcentrifuge tube ( eppendorf ) dnas, rnas and pyrogen free 0.5ml conical bottom 122 microcentrifuge tube ( eppendorf ) dnas, rnas and pyrogen free 1.5ml conical bottom 123 microcentrifuge tube ( eppendorf ) dnas, rnas and pyrogen free 2.0 ml conical bottom 124 microcentrifuge tube 1.5ml molecular grade sterile 125 microcentrifuge tube 2.0ml molecular grade sterile 126 mini cooler for pcr tube 127 optical pcr 8 tubes strip with cap ( 0.1ml ) dnase / rnase / inhibition free ) compatible with biored rt pcr machine 128 parafilm 2x 250 129 pcr cooler for 96 pcr tube ( 0.2ml ) 20c 130 pcr master mix with dntps, taq, mgci12, buffer 2000 rxns 131 pcr optical plate seal for 96 well plate 132 pcr plate non skirted low profile dnas rnas pyrogen free 96 well 133 pcr plate semi skirted low profile dnas rnas pyrogen free 96 well 134 pcr thermo conductive rack for 96 pcr tubes 135 pcr tube corbett type strip 100ul 136 pcr tube polypropylene 0.1ml low profile 8 well strip with cap 137 pcr tube polypropylene 0.2ml high profile 8 well strip with cap 138 pcr tube polypropylene 0.2ml low profile 8 well strip with cap 139 pcr tube polypropylene 0.2ml with caps 140 pcr tube polypropylene 0.5ml with caps 141 pcr tube rack 0.2 ml , 96 hole with cover 142 plastic cable lock tie type for discard bags disposable 143 polycarbonate storage box 96 wells with stand ampoules 1.5 ml 144 racks for falcon tubes 50ml 145 reversible racks for micro tubes and pcr tube with cover 96 holes 146 safety goggles 147 stop watch timmer electronic 148 storage box 0.5ml ( mct rack ) 149 storage box 1.8ml ( mct rack ) 150 test tube plain 12x75mm 151 thermohygrometer digital 152 thermometer digital with probe for refrigerator 153 tough tags for ampoules 24 x13 mm approx 154 trough reservoir capacity 75 ml polypropylene 155 utility tray size 320x260 mm 156 utility tray size 360x310 mm 157 utility tray size 540x435 mm 158 vtm sample racks for 120 tubes 159 vtm sample racks for 62 tubes 160 vtm tube box 36 wells with cover 161 wash bottle 500ml new type 162 ziploc bags 12” x 8” 163 ziploc bags 4” x 3” 164 ziploc bags 8” x 6” 165 vtm with dacron swab ( dacron swabs 2 nos. for each vtm tube ) 166 manual multichannel micropipette variable volume autoclavable 100 300ul 167 eppendorf tube 1.5ml with cap 168 micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 100 300ul...

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Medical College - Rajasthan

26169897 purchase of consumable and reagents 1 10 ul sterile low retention filter racked (10x96 tips/racks) 2 20 ul sterile low retention filter racked (10x96 tips/racks) 3 100 ul sterile low retention filter racked (10x96 tips/racks) 4 200 ul sterile low retention filter racked (10x96 tips/racks) 5 1000 ul sterile low retention filter racked (6x96 tips/racks) 6 50 ml centrifuge tube with cap. sterile conical falcon (500 tubes) 7 15 ml centrifuge tube with cap. sterile conical falcon (500 tubes) 8 0.5 ml graduated micro centrifuge tube, sterile (1000 tubes) 9 1.7 ml graduated micro centrifuge tube, sterile (1000 tubes) 10 2 ml graduated micro centrifuge tube, sterile (500 tubes) 11 sample handling – cooler (0.2 ml) ( 20ºc) (0ºc) (1xpink) 12 sample handling – cooler (0.2 ml) ( 20ºc) (0ºc) (1xblue) 13 twin rack reversible for microcentrifuge tubes (2 pk) 14 microamp tm optical 8 cap strips (300 strips) 15 microamp tm fast 8 tube strip, 0.1/0.2 ml 125 strips (125 strips) 16 molecular grade ethanol (merk) molecular grade (500 ml) 17 beta mercaptoethanol (sigma/ merck) (250 ml) ...

Medical College - Rajasthan

26097407 supply of various type of test kits and consumables for biochemistry department 1 serum sugar 2 serum total protein 3 serum albumin 4 serum total cholesterol 5 serum triglyceride 6 serum calcium 7 serum phosphorus 8 serum uric acid 9 serum ggt 10 serum acid phosphatase 11 serum creatine phosphakinase (ck nac/cpk) 12 serum ck mb kit with calibrator & control 13 multi calibrator 14 serum urea 15 serum creatinine 16 sgot 17 sgpt 18 alkeline phosphatase 19 csf microprotein 20 hitachi sample cup 21 disposable test tube (12 x 75mm with rim, 5ml capacity, bottom round, autoclavable and thermal resistant, highly transparent 22 white paper laboratory tissue roll 23 paper rim (a4 size) 24 rack for hold disposable test tubes & hitachi cups 25 disposable assay tip on rack (tip size 0 200 µl) 26 disposable assay tip on rack (tip size 100 1000 µl) 27 disposable assay tip (tip size 5000 µl) 28 tray with divided 2 4 compartments 29 plastic dustbin with foot operated lid (50 ltr capacity) 30 plastic disposable begs for biomedical waste (50 ltr capacity) 31 narrow mouth distilled water dispenser bottle (500 ml) 32 glass pipettes (capacity 10ml) 33 glass pipette dispenser/controller 34 glass pipette stand 35 sample roller mixer for 5ml liquid vials 36 microcentrifuge tube (capacity 1 2 ml) 37 rack for hold the 1 2 ml microcentrifuge tube 38 marker pen fine tip 39 antiseptic soap for hand wash (liquid) 40 hand sanitizer (liquid), 41 blood sample collection tube size for adult ~7 ml capacity 42 blood sample collection tube size for pediatric ~5 ml capacity 43 adaptor for 5 ml capacity pediatric blood sample collection tube ...