Department Of Local Bodies - Rajasthan

35128956 work of providing electrical good for electrical store in municipal corporation jaipur heritage headquarter building 2022 23 , supply of led bulb , power consumption 9 10 wattlight colour white 1400 1500 w make: philips, hawells, halonix , power consumption 15 17 watt light colour white 1400 1500 w make: philips, hawells, halonix , supply of 4 feet led battenolour temp. 6500 k of 20 22 watt make: philips, hawells, hpl, crompton , supply of led 2 x 2 square & light panel of cool day light colour 6500 k colurs temp, jp 20 protected 36 watt , recessed type , surface type make: crompton, bajaj, surya , supply of extension board having 4 socket of 6 amp and 1.5 mtr. heavy duty wire. made on wooden box . , supply of air blower heater of 2000 watt fan forcel curwlation type having convection type heating mathod & steel body.make: bajaj, surya, usha, orient , ceiling fan 1200 mm sweepfour blade.orient, crompton, sujata , wall mounting fan 1200 mm sweep.make: polar, orient, bajaj. , supply of wireless cordless calling remote door bell battery operated.make: anchar, cona, gold medel, orient. , pliar supply of combination snap ring plier made out of heavy caben steel of 8 inch length. make: taparia. , phase tester supply of analog voltage / phase multipurpose line tester having plastic body material and mearuring range of 50 500 v make: taparia, colour yellow. , screw driver supply of long handle screw driver. make: taparia 903ibt , supply of taparia 840 screw driver hand tool kit , supply of hammer made of heavy duty steel. make: taparia, stanley, tata. , ubod steel curved claw hammer of 62 kg weight with wooden handle. , supply of portable and compact, extension type aluminum telescopic ladder. foldable multipurpose multi step having load capacity of 150 kg. , 21.3 ft. , supply of strong and durable aluminium folding ladder with plat form made out of heavy aluminium pipe. , 7 step 7.5 feet height , 10 step 11 feet height , supply of professional rotary hammer drill machine with sds plus. eary to change tooth holder. ball gromment for preventing cable break with soft grip main and ausuiliary handle suitable upto 26 mm drill bit. with 7 piece rotary hammer deill set. make: bosch, black decker, dewalt. , supply of reducer of ms tube for sodium light bracket 40 mm dia to reduce it upto 30 mm dia with bolt welded inner side for adjust. , supply of hanging type 6 amp bed switch made out of industraial grade polycarbonate of fire resistent abs matertial hpl / philips / anchor / hevells , micrometer screw gauge with ratchet stop, stainless steel body, accurately threaded c.p rod. pitch 1 / 100, size 25 mm , m 266f digital clamp meter with frequency digital multimeter ( 2000 counts ) , pvc tape roll , 198 l direct cool single door 4 star refrigerator make samsung / lg / whirlpool...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

35113889 supply of construction ( assistant mason ) item , item description , concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30 / min, weight 80 kg, size 80 ( mm ) x 50 ( mm ) , electric drill up to 10mm taparia / gadore / jhalani / pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg, drill spindle connecting thread 3 / 8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm , plastic drumsplatic water drums with lock ring to lock and seal, must have strong handles on side to easy carry / transport. capacity 200 ltr. , troweliron mason trowel with wooden handle ( 10 to 12 inches long and 6 inches wide ) , plumb rule and bob :heavy iron plumb rule and bob with chord ( at least 3 meter ) approx. weight around 1 kg , spirit level : taparia 300 mm spirit level level accuracy: 1 mm / m width ( mm ) : 50 mm weight ( kg ) : 0.165 kg length ( mm ) : 300 mm height ( mm ) : 20 mm material: aluminium frame and rubber moulding , water level tube: transparent water level hose which can be used in construction works for checking levels 2mm, 10 meters in length , grinders:grinder with a vibration reducing side handle and trigger grip with powerful 13 amp motor. , vibrators: concrete vibrator, capacity: 2800 rpm, power source diesel / electricity, voltage 230 v , tile cutters: heavy ironceramic tile cutter with unique comfort grip handle: 26 82 x 22 x 13 cm; 3.38 kilograms approx. , power wet saws: • corrosive resistant stainless steel top supports tiles up to 12 x 12 inch • adjustable rip fence with miter gauge for accurate straight and miter cuts • blade cooling water reservoir to keep blade cool while minimizing dust and debris • bevel cuts tile from 0 to 45 degrees. cut material: stone / masonry • cross cut capacity: 7.75 inch; diagonal cut capacity: 7.25 inch , wedges: made of hard plastic, standerd size , jointers: a pair of long and short convex jointers made of heavy grade steel , mason’s line: masons linedimensions: 5.892 cms ( l ) x 6.096 cms ( w ) x 15.697 cms ( h ) . , try square: stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pins: large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line , brick bolster / brick chisel:made of carbon steel with dual hand guard, size 4 x 8, 1 / 2 inch , brick hammer: made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammer: made of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axe: one side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbar: iron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel: 6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer: 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boaster: with carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammer: large hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in size , scrabbling hammer: one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel: 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spade: spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beaters: used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden float: flat board with a handle to hold, made of hard wood for durability, size: 12? ( 300mm ) x 5? ( 125mm ) . , metal float: smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? ( 300mm ) x 5? ( 125mm ) . , floating rule: floating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcher:scratcher trowel made of steel 16 x 4 1 / 2 with wood handle , trowel ( khurpi ) : made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 meter:measuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladder:bamboo ladders of 10 / 12 feet , wooden pole ( balli ) :wooden poles of 10 & 12 feet for making wooden decks , wooden sieve:wooden sieve of large size , tasla:galvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrow:double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolley:air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle:standerd , hacking tool: satnderd...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

35113887 supply of agriculture items , item description , auger:for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe:short handle , wide blade , garden hand tools:handle made of plastic and head made of stainless steel , garden hoes:3 tooth tynes made of stainless steel triangular furrow long handle made of wood , extragarden knife sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateursmad e of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine 3*2pictures binded with wood border , charts / picture s related to safety measure 3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

North Western Railway - Rajasthan

34947067 supply of wooden handles 77 cm longwooden handles 77 cm long, wooden handles 77 cm long for picks beater to w.rlys drg no.mt / 818 fig i alt 3 & is 620 / 1985...

Rajasthan Small Industries Corporation Limited - Rajasthan

34909023 etender for rate contract for supply of tent and tarpaulines for one year etender for rate contract for supply of tent and tarpaulins for one year , tents 80 kg. m.k. iii o.g. complete with all components and accessories as per technical specification of the tender , tents 80 kg. m.k. iii o.g. complete with all components and accessories as per technical specification of the tender but without iron accessories , store tent size 15 mtr.x 6 mtr. vat o.g. complete with all components and accessories as per technical specification of the tender , store tent size 15 mtr.x 6 mtr. vat o.g. complete with all components and accessories as per technical specification of the tender but without iron accessories , epip tents known as tent private m.k. iii vat complete with all components and accessories as per technical specification of the tender , epip tents known as tent private m.k. iii vat complete with all components and accessories as per technical specification of the tender but without iron accessories , swiss cottage tent size 3.66 mtr. x 3.66 mtr. x 3.05 mtr x 1.37 mtr. with detachable cloth kanat for bath room and detachable chick kanat for verandha complete with components and accessories as per technical specifications of tender , bath tent size 1.85 mtr. x 1.85 mtr. complete with all components and accessories as per technical specification of the tender , kabul pal tent size 3.66 x 3.66 x 2.5 mtr. complete with all components & accessories. , double fly tent size 4.5 x 4.5 x 2.5 mtr. complete with all components & accessories. , double fly tent size 4.3 x 4.3 x 2.5 mtr. complete with all components & accessories. , single fly tent 3.66 x 3.66 x 2.2 mtr. complete with all components & accessories. , double fly / shouldries 3.66 x 3.66 x 2.5 mtr. complete with all components & accessories. , shouldries double fly size 3.0 x 3.0 mtr. complete with all components & accessories. , shouldries double fly size 2.44 x 2.44 mtr. complete with all components & accessories. , double fly tent size 4.88 x 4.88 mtr. complete with all components & accessories. , civil tent cum shamiyana size 84x40’ complete with all components & accessories. , tarpaulins made of basic cotton duck conforming to is: 1422 / 1983 ( latest amended ) variety no.2 weighting 610 grams / sqm. mtr. processed to meet is:2089 / 1977 ( latest amended ) common proofed cotton duck having 1½” hems around the border with complete joints completed with aluminum eyelets all around at one meter distance and on the corner of triangular spaces ( colour of tarpaulins shall be as per requirements of consignee ) , tarpaulins made of basic cotton duck conforming to is: 1422 / 1983 ( latest amended ) variety no.3 weighting 475 grams / sqm. mtr. processed to meet is:2089 / 1977 ( latest amended ) common proofed cotton duck having 1½” hems around the border with complete joints completed with aluminum eyelets all around at one meter distance and on the corner of triangular spaces ( colour of tarpaulins shall be as per requirements of consignee ) , shamiyana made of two fold one cotton canvas white verity no. 4 is 1422 / 1983 & printed shitting cloth is 180 / minimum size 15’x15’ & kanate is two fold one is water proof canvas & printed shitting cloth same is standard & ( with complete accessories ) iron pole powder coated & accessories ) as follow: 1. 2” isi mark 16 gage round powder coated ms pipe 4 pec ridge pole per shamiyana size with corner clip. 2. 2”isi mark 16 gage round powder coated ms pipe 4 pec standing pole 12 feet each with clip. 3. iron pages 2 ft. 15 mm iron road 4 pec each shamiyana. 4. 3 kg iron hummer with wooden handle 2’ feet long , 15’x15’x13’x8’ size canopy made of two fold one cotton canvas white verity no. 4 is 1422 / 1983 & printed shitting cloth is 180 / minimum size 15’x15’ & kanate is two fold one is water proof canvas & printed shitting cloth same is standard & ( with complete accessories ) iron pole powder coated & accessories as follow: 1. 2” mark 16 gage round powder coated ms pipe 4 pec ridge per shamiyana size with corner clip. 2. 2”2 mark 16 gage round powder coated ms pipe 4 pec standing pole 12 feet each with clip. 3. iron pages 2 ft. 15 mm iron road 4 pec each shamiyana 4. 3 kg iron hummer with wooden handel 2’ long....

North Western Railway - Rajasthan

34840648 supply of waterproof synthetic tentwaterproof synthetic tent, light weight prefabricated waterproof synthetic tent. specification: 1 material of the synthetic tent must be waterproof nylon / parachute cloth with double layer. 2. size of the tent 16x10x8x6 feet ( lxbxhxwall ) 3. minimum weight of tent along with accessories 30kg. 4. colour military / safety. 5. structure and support heavy gauge aluminium pipe of 30 mm diameter for main structure and for side support. aluminium pipe of 25 mm diameter & nylon ropes with pegs.6. doors two nos with net and must be operated by heavy duty zipper chain7. window 4 nos with net and must be operated by velcro. 8. ground shape must be of heavy duty waterproof hdpe sheet of 16x10 feet ( lxb ) size. 9. accessories there must be m s pegs and two nos hammer of 1.5kg with wooden handle supplied with the tent for erraction of the tent. 10. packing the unit must be packed in roll luggage beg for easy handling . section engineer rajasthan 2.00 set...

Department Of Transport - Rajasthan

34795919 tender for supply of stationery all pin, file lase, file tag, gum bottle, register, stapler, stapler pin, file cover, envelope, dak pad, pokar wooden handle, stamp pad, carbon paper, punching machine, file pad, rubber ring, clip file, flag, marker, l folder, note pad, spirall note book, box file, photostat paper rim, printer toner, pen drive, key board, optical mouse, blower....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34770009 8_ supply of agriculture at gasss jamba ki dhani, gsss padasala district jodhpur. , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2 pictures binded with wood border , charts related to animal feed 3*2 pictures binded with wood border , charts to related breeds of cow and buffalo 3*2 pictures binded with wood border , charts related to animal houses 3*2 pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2 pictures binded with wood border , charts / picture s related to milk machine 3*2 pictures binded with wood border , charts / picture s related to milking methods 3*2 pictures binded with wood border , charts / picture s related to clean milk production 3*2 pictures binded with wood border , charts / picture s related to dairy records 3*2 pictures binded with wood border , charts / picture s related to tincture iodine 3*2 pictures binded with wood border , charts / picture s related to safety measure 3*2 pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2 pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border , charts / picture s related to health hazards. 3*2 pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34769928 5_ supply of food processing at gsss jajiwal kallan district jodhpur. , list of non recurring tools and equipments: baking oven deck oven ( double deck manual ) semi automatic, 380 to 415 v, electric stainless steel, 50 to 60 hz, 1250 x 845 x 1220 mm, 20 to 300 degree c, 2 decks, 4 trays, three phase, 3kw each deck , convection oven’ ( 7 trays, 600mm / 400mm ) semi automatic, three phase, electric, gas, frequency ( hertz ) 50 – 60, stainless steel, for pizza, breads, bun, biscuit, 220 380 v, 300 degree c , dough proofer stainless steel body, automatic, single door, 220 v approx. , hand blender cum mixer with plastic body & stainless steel blades, 800 watt hand blender with mixer and whisker, interlock, frequency50 60 hz, 300 watt , mixer and grinder 5 litre with dry and wet grinding jar, should also have kneading and chopping features along with jars, min. 2000 rpm , electric fryer stainless steel body deep fryer machine with lid cover & fryer basket ( plastic handle ) , capacity 3 litre with adjustable temperature control ( 150° c to 190° c ) , approx. 2500 watt power , baking pan loaf pan / pie pan / cake pan ( electrical 300w each ) , planetary mixer 5 litre and 20 lt. electrical with 20 litre capacity bowl, automatic , power 1 + kilowatt, 50 hz, 220v automatic, stainless steel, 220 v, 1.1kw, 20 litre, 22r / min, 770 x 400 x 830 mm, 230r / min , spiral mixer 20 litre , refrigerator two door: 1 no ( 240 lt. ) convertible freezer with deep fridge mode , deep freezer 500 lt. 500 litre double door deep freezer with wired shelves & castor wheels for easy mobility, freezing point up to 20degree, size: 88 x 174 x 74 cm; 39 kilograms approx. , lpg gas burner with 3 brass burners, two medium and 1 small, manual ignition and stainless steel tray, width 70 cm, size 690x360x55 mm , lpg gas cylinder commercial commercial lpg gas cylinder ( 19 kg ) with regulator and gas pipe , weighing scale 10 50kg, mild steel, industrial, business30kg, 1 kg to 10 kg, accuracy 1 gm to 5 gm, 220 v ac , work table 4’ x 10’ work table for students made of stainless steel , high speed exhausts high suction at low noise with aerodynamically designed blades ideal for duct size of 9.5x 9.5 inches, 2000 r.p.m. air delivery ( cmm ) : 470, 60 watt , serrated bread knife serrated edge bread slicer knife 14 inches with wooden handle , knives stainless steel blade knives of all sizes with non slip handle , thermometer digital lcd waterproof thermometer 2 of them should measure , timer digital kitchen magnetic countdown stopwatch timer with loud alarm ( up to 96 db ) with back stand , bread tin / mould aluminium bread tin with cover, nonsticky carbon base, volume 1000 ml , aluminium cake pan aluminium cake pan / mould, round shape ( 12 inch diameter * 3 inch height ) , fd 3020 , cooling racks stainless steel 9 shelves cooling rack for bakery products. size:9 shelves, size: 1500 x 550 x 1800 h [ mm ] , dough scrappers and plastic steel dough scrapper dimensions: 12.5 x 15cm ( 6 inches ) along with plastic dough scrapper also can be used as cake polisher and cutter and smoother , flour sifter / sieves 12 inch brass / stainless steel frame sieve , apron & head gear chef hat and kitchen apron adult adjustable white apron with hat & kitchen pocket, adjustable for men and women, ( 33l x 26w ) , reusable , measuring cup and measuring jug different sizes and measurements as per need , measuring spoon measuring spoons: u taste 18 / 8 stainless steel measuring spoons set of 9 piece: 1 / 16 tsp, 1 / 8 tsp, 1 / 4 tsp, 1 / 3 tsp, 1 / 2 tsp, 3 / 4 tsp, 1 tsp, 1 / 2 tbsp. & 1 tbsp. dry and liquid ingredients , mixing bowl / vessels stainless steel mixing bowls sets with lid from small to large size ( 1kg to 5 kg ) , moulds / cutter stainless steel cookie cutter of different shapes , muffin tray stainless steel non stick cupcake baking slot tray for 12 muffin cup , nozzle set stainless steel piping nozzles tips 24 pieces , pallet knife straight and bent size 10 inch , straight and bend pallet knives of stainless steel , plates full, half and quarter plate sets made of porcelain / virgin plastic, microwave safe, break and chip resistant , rolling pin standard size for most needs: rolling pin for baking 16 inches , cake rings 3 pcs of round cake rings, small cake ring : diameter = 10 cm ( 4 inch ) , height = 4.5 cm, medium cake ring : diameter = 15 cm ( 6 inch ) , height = 4.5 cm, big cake ring : diameter = 20 cm ( 8 inch ) , height = 4.5 cm, steel , spatula and pastry brush silicone spatula and pastry brush set ( medium & large size ) , spoon ( big and small ) different sizes of spoon ( tea spoon , sugar spoon, serving spoon etc. ) set , storage containers different sizes of storage containers made of plastic, large, medium and small , strainer stainless steel soup & juice strainer & liquid filter ( large free size ) , turn table cake turn table 12 inch or 30 cm dais steel , wire whiskers stainless steel wire whiskers with wooden handle medium and large , water storage can transparent plastic water dispenser bottle 10l / 20l , packaging material food grade plastic round food container storage box, microwave safe, kitchen storage, reusable plastic containers for fridge storage ( different sizes ) , pizza cutter stainless steel pizza cutter free size , dough sheeter compact size manual dough sheeter: thickness range 0 12mm 1 / 2 / inches roller width 27cm 11 inches size 50x55x22 cm ( hxlx d ) 20x22x9 inches, weight approx. 11 kg / 22lbs , writing board with white board marker and duster 6’ x 4’ white board, 4 color white board marker in a pack of 10 each color, 01 duster , fire extinguishers 1 co2 type fire extinguisher for electrical equipment’s, minimum 4.5 kg, 1 abc type fire extinguisher for lpg, minimum 4.5 kg...

Indian Army - Rajasthan

34669438 bids are invited for stn boq pokar wooden handle , oddonil , ink blue , stamp pad blue , glass 350 ml , glass 250 ml , room freshner , pencil cell, battery 1.5 v , tissue paper , bond paper total quantity : 92...

Rajasthan High Court - Rajasthan

34610987 rate contract for stationery items through all pin, borar bodkins square wooden handle without eyed pin, brown tape, cello tape, conference pad, dustbin, envelope, file pad, file folder, file cover, file kobra, glue stick, highlighter, camlin, lesses, marker pen, note book, order sheet, page marker, pen, paper cutter, handy, pencil, punching machine, refill, register, staples pin, slip book, stamp pad, kores, cqamlin....

Department Of Technical Education - Rajasthan

34588574 bids are invited for mechatronics boq part 3 saw setter , dovetail chisel inches with handle , dovetail chisel inches with handle , mortise chisel 1 by 8 inches with handle , mortise chisel 3 by 8 inches with handle , mortise chisel 1 by 2 inches with handle , gimlet screw auger inches , gimlet screw auger 3 by 8 inches , pincer 8 inches 350 gm approx. , flat bastard file 12 inches single cut , flat bastard file 12 inches double cut , rasp cut half round file 10 inches , round bastard file 12 inches x inches , triangular file 4 inches slim taper , triangular file 8 inches , triangular file 10 inches , adjustable spanner 12 inches chromium plated , screw driver engg. pattern handle, 8 mm dia, 12 inches size , screw driver engg. pattern handle, 8 mm dia, 10 inches size , carpentry screw driver 12 inches with wooden handle , carpentry screw driver 18 inches with wooden handle , carborundum universal stone oil stone 6 inches x 2 inchesx 1 inch , claw hammer 250 gm. , mallet 500 gm approx. , straight peen hammer 500 gm with wooden handle , combination plier 8 inches , spring caliper inside 6 inches , spring caliper outside 6 inches , spring divider 6 inches , outside firm joint caliper 6 inches , straight peen hammer, 300 gm with wooden handle , cross peen hammer 200 gm with wooden handle , caliper outside, 6 inches , caliper inside, 6 inches , caliper odd leg 6 inches , scriber , centre punch 6 inches , combination plier , measuring tape steel 3m , hand vice 2 inches , collet type pin vice 6 mm , universal surface gauge steel base 12 inchessize with marker , micrometer 0 25 mm range l.c. 0.01 mm in side chrome plated , steel scale 12 inches , combination plier standard size 8 inches , standard wire gauge swg , snip angular 12 inches , divider 6 inches , soldering iron 125 watt , compass 8 inches , compass 10 inches...

Department Of Technical Education - Rajasthan

34563594 bids are invited for stop watch , abels flash and fire point apparatus , junkers gas calorimeter , refrigerant leak detector , single cylinder 2 stroke petrol engine test rig , single cylinder 4 stroke petrol engine test rig , plotter colour , digital vernier calipers , screw thread micrometer , bevel protector , thread gauge , wire gauge , sine bar , cnc turning machine , cnc trainer milling machine with standardaccessories and siemens controller , wooden smoothing plane 9 inch , cast steel hand saw 18 inch with handle , hand saw 12 inch with handle , carborundum universal stoneoil stone 6 inches x2 inchesx 1 inches , claw hammer 250 gm , malletwooden 500 gm approx. , straight pen hammer , cross pen hammer 500 gm with wooden handle , ball pen hammer 800 gm with wooden handle , steel scale 12 inch , try square 10 inches stainless steel blade 0.45 kg wt. approx. , file bastard 12 inches with handle , file half round second cut 16 inches with handle , file square smooth length 10 inches, 3 by 8 inches square with handle , haksaw frame adjustable 8 12 inch with handle , try square 6 inches size stainless steel blade one side graduated approx. wt. 0.24 kg , try square 10 inches size stainless steel blade one side graduated approx. wt. 0.45 kg , stainless steel scale 12 inches , caliper outside 6 inches , caliper inside 6 inches , centre punch 6 inches , welding screen , welding goggles , welding gloves pairs , tong 12 inches , chipping hammer , hacksaw frame 12 inches , ball peen hammer 500 gm , wire brush , three phase arc welding machine 400 amp with cable and electrode holder , std. wire gauge , steel rule 12 inches, made of stainless steel , straight snip 12 inches , bend snip 12 inches , spring devider , cutting plier 6 inches , ball pen hammer 500 gm. , straight pen hammer 500 gm. , sheet folding machine hand operated , try square 12 inches , wooden mallet , dot punch , double point scriber , trammel , anvil with stand 50 kg., made of cast iron , sheet bending machine , pistol type hand drill machine 13 mm capacity, electric single phase with cord 500 watts with wooden drill bit set of all different size drill bits up to 13mm. , tee bar cramp 3 inches length , electric hand drill machine10 mm, 500watt , electric hand blower single phase, power input 0.5kw 1kw, no load speed 14000 18000 rpm , handheld surface wood planer machine with tools, power input 0.5kw 0.7kw, maximum cutting depth 2.5 mm 3 mm, weight 2.5 kg 3 kg, no load speed 12000 18000 rpm , wooden grinding machine with set of tools, power 1 kw, maximum rpm 15000, wheel diameter 100 mm , disc sander machine, power input 0.2kw 0.5kw, eccentricity 1 1.5 mm, frequency 50 hz, weight 1 kg 1.5 kg, no load speed 7000 12000 rpm , pipe wrench isi mark size 12 inches, 300 mm , pipe wrench isi mark size 18 inches, 450 mm , pipe vice 50 mm pipe dia. capacity wt. 6 kg. approx. round pillar , drill machine vice 6 inches or 150 mm jaw size wt. 15 kg. approx. , die stock with handle and die set of inches inches , inches inches and 1 inches inches bsp with rechat , set of letter punch a to z made of steel , tap wrenches handles 1 inches or 25 mm with tap set 6, 8 mm, 10, 13 mm size bsw , hss twist drill , taper shank, 1 by 8 inches to 1 inches, 7 pieces , reamers1 by 8 inches to 1 inches, 7 pieces , vernier caliper mono block with lower screw lock stainless steel 200mm x 0.01 mm least count digital , vernier caliper mono block with lower screw lock stainless steel 200mm x 0.02 mm least count , micrometer 0 25 mm range l.c. 0.01 mm outside chrome plated digital , micrometer 0 25 mm range l.c. 0.01 mm in side chrome plated , vee block, 3 inches x 2 inches x 1 inches with magnetic base , tubular box spanner set heavy duty zinc plated with tomy 6 32 mm, 12 pieces , ring spanner drop forged chrome plated set 6 32 mm12 pieces , soldering kit with material equipment, soldering wax with wire material , brazing kit with copper rod and chemical , spot welding machine , arc welding transformer , electronic single phase arc welding transformer , arc welding transformer set consist of copper wound transformer fitted on steel frame cover with m.s. sheet , anvil small size weight 25kg , centre lathe , flash and fire point measurement apparatus abels, cleveland, penesky martin , viscosity measuring apparatus usi, saybolt visco meter , conradson inchess apparatus for carbon residue test , frost free 220 ltr. domestic refrigerator , window type air conditioner 1.5 ton 3star , split type air conditioner 1.5 ton 5star , soldering and brazing complete units , sling psychrometer , digital hygrometer thermometer humidity meter with lcd display 50 to 100 degree celsius , rh 10 100 percent...

Department Of Technical Education - Rajasthan

34563024 supply of stop watch , abels flash and fire point apparatus , junkers gas calorimeter , refrigerant leak detector , single cylinder 2 stroke petrol engine test rig , single cylinder 4 stroke petrol engine test rig , plotter colour , digital vernier calipers , screw thread micrometer , bevel protector , thread gauge , wire gauge , sine bar , cnc turning machine , cnc trainer milling machine with standardaccessories and siemens controller , wooden smoothing plane 9 inch , cast steel hand saw 18 inch with handle , hand saw 12 inch with handle , carborundum universal stoneoil stone 6 inches x2 inchesx 1 inches , claw hammer 250 gm , malletwooden 500 gm approx. , straight pen hammer , cross pen hammer 500 gm with wooden handle , ball pen hammer 800 gm with wooden handle , steel scale 12 inch , try square 10 inches stainless steel blade 0.45 kg wt. approx. , file bastard 12 inches with handle , file half round second cut 16 inches with handle , file square smooth length 10 inches, 3 by 8 inches square with handle , haksaw frame adjustable 8 12 inch with handle , try square 6 inches size stainless steel blade one side graduated approx. wt. 0.24 kg , try square 10 inches size stainless steel blade one side graduated approx. wt. 0.45 kg , stainless steel scale 12 inches , caliper outside 6 inches , caliper inside 6 inches , centre punch 6 inches , welding screen , welding goggles , welding gloves pairs , tong 12 inches , chipping hammer , hacksaw frame 12 inches , ball peen hammer 500 gm , wire brush , three phase arc welding machine 400 amp with cable and electrode holder , std. wire gauge , steel rule 12 inches, made of stainless steel , straight snip 12 inches , bend snip 12 inches , spring devider , cutting plier 6 inches , ball pen hammer 500 gm. , straight pen hammer 500 gm. , sheet folding machine hand operated , try square 12 inches , wooden mallet , dot punch , double point scriber , trammel , anvil with stand 50 kg., made of cast iron , sheet bending machine , pistol type hand drill machine 13 mm capacity, electric single phase with cord 500 watts with wooden drill bit set of all different size drill bits up to 13mm. , tee bar cramp 3 inches length , electric hand drill machine10 mm, 500watt , electric hand blower single phase, power input 0.5kw 1kw, no load speed 14000 18000 rpm , handheld surface wood planer machine with tools, power input 0.5kw 0.7kw, maximum cutting depth2.5 mm 3 mm, weight 2.5 kg 3 kg, no load speed 12000 18000 rpm , wooden grinding machine with set of tools, power 1 kw, maximum rpm 15000, wheel diameter 100 mm , disc sander machine, power input 0.2kw 0.5kw, eccentricity 1 1.5 mm, frequency 50 hz, weight 1 kg 1.5 kg, no load speed 7000 12000 rpm , pipe wrench isi mark size 12 inches, 300 mm , pipe wrench isi mark size 18 inches, 450 mm , pipe vice 50 mm pipe dia. capacity wt. 6 kg. approx. round pillar , drill machine vice 6 inches or 150 mm jaw size wt. 15 kg. approx. , die stock with handle and die set of inches inches , inches inches and 1 inches inches bsp with rechat , set of letter punch a to z made of steel , tap wrenches handles 1 inches or 25 mm with tap set 6, 8 mm, 10, 13 mm size bsw , hss twist drill , taper shank, 1 by 8 inches to 1 inches, 7 pieces , reamers1 by 8 inches to 1 inches, 7 pieces , vernier caliper mono block with lower screw lock stainless steel 200mm x 0.01 mm least count digital , vernier caliper mono block with lower screw lock stainless steel 200mm x 0.02 mm least count , micrometer 0 25 mm range l.c. 0.01 mm outside chrome plated digital , micrometer 0 25 mm range l.c. 0.01 mm in side chrome plated , vee block, 3 inches x 2 inches x 1 inches with magnetic base , tubular box spanner set heavy duty zinc plated with tomy 6 32 mm, 12 pieces , ring spanner drop forged chrome plated set 6 32 mm12 pieces , soldering kit with material equipment, soldering wax with wire material , brazing kit with copper rod and chemical , spot welding machine , arc welding transformer , electronic single phase arc welding transformer , arc welding transformer set consist of copper wound transformer fitted on steel frame cover with m.s. sheet , anvil small size weight 25kg , centre lathe , flash and fire point measurement apparatus abels, cleveland, penesky martin , viscosity measuring apparatus usi, saybolt visco meter , conradson inchess apparatus for carbon residue test , frost free 220 ltr. domestic refrigerator , window type air conditioner 1.5 ton 3star , split type air conditioner 1.5 ton 5star , soldering and brazing complete units , sling psychrometer , digital hygrometer thermometer humidity meter with lcd display 50 to 100 degree celsius , rh 10 100 percent...

Rajasthan Electronics And Instruments Limited - Rajasthan

34440714 offer for supply of tools , iron bit 35 watt , crimping tool dowells (big) , soldering iron 35 watt , soldering iron stand , soldering iron 50 watt , long nose plier standard size , wooden handle for file 6” , hexa blade – 12” , hexa blade – 6” , wire cutter and stripper , mas 830 digital multimeter , solder pot (tinning pot) , flat nose plier 6” size , cross head screw driver 4 , cross head screw driver 6 , blower, model no: rb 500 , spanner set (all size) , allen key set standard (1.5 to 10 mm) , screw driver set , combination plier , tool kit cover (for keeping screw drivers, pliers, allen key, soldering iron etc.) => limited...

Indian Army - Rajasthan

34352087 bids are invited for stationary pokar wooden handle , oddonil , ink blue , stamp pad blue , glass 350 ml , glass 250 ml , room freshner , pencil cell,battery 1.5 v , tissue paper , bond paper total quantity : 92...

Department Of Local Bodies - Rajasthan

34337125 work of supplying essential materials under indria gandhi urban employment scheme ( irgy urban ) 2 hydraulic excavator of 1 cum bucket 3 concrete mixer 0.4 / 0.28 cum 4 concrete mixer 1 cum 5 vibrator ( needle type 40mm ) 6 surface vibrator 7 water tanker 6 kl capacity 8 mason ( ist class ) 9 painter 10 mali 11 driver ( for road roller, concrete mixer, truck etc. ) 12 expert artist ( for conservation of fresco paintings andother decorative work ) 13 mild steel round bar 12 mm dia and below 14 mild steel round bar above 12 mm dia 15 cold twisted bars ( tmt bars ) 16 structurals such as tees, angles channels and r.s. joists 17 m.s. clamps 18 stone grit 6 mm and down size or pea sized gravel 19 stone aggregate ( single size ) : 06 mm nominal size 20 stone aggregate ( single size ) : 10 mm nominal size 21 stone aggregate ( single size ) : 12.5 mm nominal size 22 stone aggregate ( single size ) : 20 mm nominal size 23 stone aggregate ( single size ) : 25 mm nominal size 24 stone aggregate ( single size ) : 40 mm nominal size 25 aggregates 10 mm to 5 mm 26 aggregates 13.2 mm to 5.6 mm 27 aggregates 13.2 mm to 10 mm 28 aggregates 22.4 mm to 2.36 mm 29 aggregates 25 mm to 10 mm 30 aggregates 45 mm to 2.8 mm 31 aggregates 45 mm to 22.4 mm 32 aggregates 53 mm to 2.8 mm 33 aggregates 53 mm to 22.4 mm 34 aggregates 63 mm to 2.8 mm 35 aggregates 63 mm to 45 mm 36 aggregates 90 mm to 45 mm ( hand broken ) 37 stone crusher dust finer than 3mm with not more than 10%passing 0.075 sieve. 38 pre coated stone chips of 13.2 mm nominal size 39 stone for masonary work 40 random rubble stone 41 through and bond stone 42 locally available sand 43 coarse sand 44 fine sand 45 moorum 46 gravel / quarry spall at site 47 filter media / filter material as per table 300 3 ( mort&hspecification ) 48 earth 49 whiting 50 dehradun white lime 51 unslaked lime 52 plaster of paris 53 empty gunny bag ( empty cement bag ) 54 white sand stone gang saw cut 30mm thick. 55 red sand stone gang saw cut 30mm thick. 56 kota stone slab 20 mm to 25 mm thick ( semi polished ) area900 2000 sqcm 57 kota stone slab 25mm thick ( rough cheseled ) 58 kota stone slab 20 mm to 25 mm thick ( semi polished ) area2001 5000 sqcm 59 marble dust / powder. 60 precast terrazo tiles 22 mm thick ( light shade ) 61 precast terrazo tiles 22 mm thick ( medium shade ) 62 precast terrazo tiles 22 mm thick ( dark shade ) 63 chequered terrazo tiles 22 mm thick ( light shade ) 64 chequered terrazo tiles 22 mm thick ( medium shade ) 65 chequered terrazo tiles 22 mm thick ( dark shade ) 66 chequered precast cement concrete tiles 22mm thick usingmarble chips of size 6mm light shade using white 67 acid and alkali resistant tiles 300x300 mm size, 10 mm thick 68 precast chequered cement tiles 22 mm thick dark shade using ordinary cement 69 cobble stones in sizes 125x125x75mm 70 factory made interlocking c.c. paver block m 30 grade, 100mm thick 71 factory made interlocking c.c. paver block m 30 grade, 80mm thick 72 factory made interlocking c.c. paver block m 30 grade, 60mm thick 73 cement concrete jali 50 mm thick 74 cement concrete jali 40 mm thick 75 cement concrete jali 25 mm thick 76 portland cement 77 cement opc 78 cement ppc 79 white cement 80 water proofing cement paint 81 acid proof cement 82 cement primer 83 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 600mm x 600mm 84 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 800mm x 800mm 85 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 600mm x 1200mm 86 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 800mm x 1200mm 87 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 896mm x 1215mm 88 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 1000mm x 2000mm 89 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 250mm x 375mm 90 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 300mm x 450mm 91 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 200mm x 600mm 92 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 300mm x 600mm 93 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 250mm x 1000mm 94 fiber glass reinforced plastic chajja. 95 fibre glass cloth 96 bricks class 100 ist grade 97 f.p.s. bricks class designation75 98 f.p.s. bricks tile class designation 100 99 f.p.s. bricks tile class designation 75 100 f.p.s. clay fly ash bricks class designation 75 101 modular bricks class designation 75 102 modular bricks of class designation 75 103 brick aggregate ( single size ) : 63 mm nominal size 104 brick aggregate ( single size ) : 40 mm nominal size 105 brick aggregate ( single size ) : 20 mm nominal size 106 brick bats 107 hard crete 108 surkhi 109 flyash 110 primar ( premix ) 111 enamel paint 112 floor enamel paint in all shades except green 113 roofing paint for iron sheets in red colour 114 synthetic enamel paint in black or chocolate shade 115 synthetic enamel paint in all shades except black or chocolate shade. 116 paint 117 pavement marking paint 118 primer for cement paint 119 water based cement paint 120 aluminium primer 121 aluminium paint 122 acid proof paint ( chocolate or black ) 123 black japan 124 special primer 125 metal primer 126 red oxide zinc chromate primer 127 white lead 128 distemper primer 129 dry distemper 130 oil bound washable distemper / acrylic distemper 131 acrylic exterior pain 132 premium acrylic exterior paint 133 textured exterior paint. 134 plastic emulsion paint 135 melamine polish 136 spirit. 137 water proofing materials 138 gypsum board 139 jute rassi 140 masking tape. 141 sand bags ( cost of sand and empty cement bag ) 142 putty blade 143 paint brush size 150mm 144 paint brush size 125mm 145 sand paper ( paper size a4 ) 146 steel shovel ( fawda ) with wooden handle ( 90cm long ) 147 steel shovel ( gaiti ) with wooden handle 148 hand trowel with wooden handle 149 iron tagari size 16 inch dia meter. 150 plastic water barrel ( drum ) capacity ( 200ltr ) 151 plastic water barrel ( drum ) capacity ( 250ltr. ) 152 teak wood 8 ft. length wooden pole ( balli ) 153 sal wood fanta size 8 ft. length 154 wooden ladders size 20 ft. length...

Jaipur Municipal Corporation - Rajasthan

34326505 work of supplying essential materials under indria gandhi urban employment scheme ( irgy urban ) nit no.37 xen hq heritage 1 hydraulic excavator of 1 cum bucket 2 concrete mixer 0.4 / 0.28 cum 3 concrete mixer 1 cum • 4 vibrator ( needle type 40mm ) 5 surface vibrator 6 water tanker 6 kl capacity 7 mason ( 1st class ) 8 painter 9 mali 10 driver ( for road roller, concrete mixer, truck etc. ) 11 expert artist ( for conservation of fresco paintings and other decorative work ) 12 mild steel round bar 12 mm dia and below 13 mild steel round bar above 12 mm dia 14 cold twisted bars ( tmt bars ) 15 structurals such as tees, angles channels and r.s. joists 16 m.s. clamps 17 stone grit 6 mm and down size or pea sized gravel 18 stone aggregate ( single size ) : 06 mm nominal size 19 stone aggregate ( single size ) : 10 mm nominal size 20 stone aggregate ( single size ) : 12.5 mm nominal size 21 stone aggregate ( single size ) : 20 mm nominal size 22 stone aggregate ( single size ) : 25 mm nominal size 23 stone aggregate ( single size ) : 40 mm nominal size 24 aggregates 10 mm to 5 mm 25 aggregates 13.2 mm to 5.6 mm 26 aggregates 13.2 mm to 10 mm 27 aggregates 22.4 mm to 2.36 mm 28 aggregates 25 mm to 10 mm 29 aggregates 45 mm to 2.8 mm 30 aggregates 45 mm to 22.4 mm 31 aggregates 53 mm to 2.8 mm 32 aggregates 53 mm to 22.4 mm 33 aggregates 63 mm to 2.8 mm 34 aggregates 63 mm to 45 mm 35 aggregates 90 mm to 45 mm ( hand broken ) 3.6 stone crusher dust finer than 3mm with not more than 10% passing 0.075 sieve. 37 pre coated stone chips of 13.2 mm nominal size 38 stone for masonary work 39 random rubble stone 40 through and bond stone 41 locally available sand 42 coarse sand 43 fine sand 44 moorum 45 gravel / quarry spall at site 46 filter media / filter material as per table 300 3 ( mort&h specification ) 47 earth 48 whiting 49 dehradun white lime 50 unslaked lime 51 plaster of paris 52 empty gunny bag ( empty cement bag ) 53 white sand stone gang saw cut 30mm thick. 54 red sand stone gang saw cut 30mm thick. 55 kota stone slab 20 mm to 25 mm thick ( semi polished ) area 900 2000 sqcm 56 kota stone slab 25mm thick ( rough cheseled ) 57 kota stone slab 20 mm to 25 mm thick ( semi polished ) area 2001 5000 sqcm 58 marble dust / powder. 59 precast terrazo tiles 22 mm thick ( light shade ) 60 precast terrazo tiles 22 mm thick ( medium shade ) 61 precast terrazo tiles 22 mm thick ( dark shade ) 62 chequered terrazo tiles 22 mm thick ( light shade ) 63 chequered terrazo tiles 22 mm thick ( medium shade ) 64 chequered terrazo tiles 22 mm thick ( dark shade ) . 65 chequered precast cement concrete tiles 22mm thick using marble chips of size 6mm light shade using white 66 acid and alkali resistant tiles 300x300 mm size, 10 mm thick 67 precast chequered cement tiles 22 mm thick dark shade using ordinary cement 68 cobble stones in sizes 125x125x75mm , 69 factory made interlocking c.c. paver block m 30 grade, 100mm thick 70 factory made interlocking c.c. paver block m 30 grade, 80mm thick 71 factory made interlocking c.c. paver block m 30 grade, 60mm thick 72 cement concrete jali 50 mm thick 73 cement concrete jali 40 mm thick 74 cement concrete jali 25 mm thick 75 portland cement 76 cement opc 77 cement ppc 78 white cement 79 water proofing cement paint 80 acid proof cement ? ) .1 81 cement primer s2 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 600mm x 600mm 83 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 800mm x 800mm . 84 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 600mm x 1200mm 85 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 800mm x 1200mm 86 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 896mm x 1215mm 87 ceramic glazed vitrified tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 1000mm x 2000mm 88 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 250mm x 375mm 89 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 300mm x 450mm 90 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 200mm x 600mm 91 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 300mm x 600mm 92 mat & glossy ceramic tiles of colour standard white, grey, ivory, fume, red brown, light green, light blue, and other light shades 1st quality size 250mm x 1000mm 93 fiber glass reinforced plastic chajja. 94 fibre glass cloth 95 bricks class 100 1st grade 96 f.p.s. bricks class designation75 97 f.p.s. bricks tile class designation 100 98 f.p.s. bricks tile class designation 75 99 f.p.s. clay fly ash bricks class designation 75 100 modular bricks class designation 75 101 modular bricks of class designation 75 102 brick aggregate ( single size ) : 63 mm nominal size 103 brick aggregate ( single size ) : 40 mm nominal size 104 brick aggregate ( single size ) : 20 mm nominal size 105 brick bats 106 hard crete 107 surkhi 108 flyash 109 primar ( premix ) 110 enamel paint 1 1 1 floor enamel paint in all shades except green 112 roofing paint for iron sheets in red colour 113 synthetic enamel paint in black or chocolate shade 7 114 synthetic enamel paint in all shades except black or chocolate shade. 115 paint 116 pavement marking paint 117 primer for cement paint 118 water based cement paint 119 aluminium primer 120 aluminium paint 121 acid proof paint ( chocolate or black ) 122 black japan 123 special primer 124 metal primer 125 red oxide zinc chromate primer 126 white lead 127 distemper primer 128 dry distemper 129 oil bound washable distemper / acrylic distemper 130 acrylic exterior pain 131 premium acrylic exterior paint 132 textured exterior paint. 133 plastic emulsion paint 134 melamine polish 135 spirit. 136 water proofing materials 137 gypsum board 138 jute rassi 139 masking tape. 140 sand bags ( cost of sand and empty cement bag ) 141 putty blade 142 paint brush size 150mm 143 paint brush size 125mm 144 sand paper ( paper size a4 ) 145 steel shovel ( fawda ) with wooden handle ( 90cm long ) 146 steel shovel ( gaiti ) with wooden handle 147 hand trowel with wooden handle 148 iron tagari size 16 inch dia meter. 149 plastic water barrel ( drum ) capacity ( 200ltr ) 150 plastic water barrel ( drum ) capacity ( 250ltr. ) 151 teak wood 8 ft. length wooden pole ( balli ) 152 sal wood fanta size 8 ft. length 153 wooden ladders size 20 ft. length...

Sarva Shiksha Abhiyan Authority - Rajasthan

34322858 food industry item supply in vocational education food industry item supply under vocational education in gsss shahabad , item list , granite table top granite counter top work station for students, dimension as per lab size, should be constructed in the lab separately before the establishment of lab, two sinks with water connection must be attched to this work station 1 granite table top granite counter top work station for students, dimension as per lab size, should be constructed in the lab separately before the establishment of lab, two sinks with water connection must be attched to this work station 1 granite top counter with wooden shelfs & doors below the counter to store the material and consumables, should be constructed before the establishmen t of the lab list of non recurring tools and equipments , list of non recurring tools and equipmentssemi automatic, 380 to 415 v, electric stainless steel, 50 to 60 hz, 1250 x 845 x 1220 mm, 20 to 300 degree c, 2 decks, 4 trays, three phase, 3kw each deck , convection oven’ ( 7 trays, 600 mm / 400mm ) semi automatic, three phase, electric, gas, frequency ( hertz ) 50 – 60, stainless steel, for pizza, breads, bun, biscuit, 220 380 v, 300 degree c , dough proofer stainless steel body, automatic, single door, 220 v approx. , hand blender cum mixer with plastic body & stainless steel blades, 800 watt hand blender with mixer and whisker, interlock, frequency50 60 hz, 300 watt , mixer and grinder 5 litre with dry and wet grinding jar, should also have kneading and chopping features along with jars, min. 2000 rpm , electric fryer stainless steel body deep fryer machine with lid cover & fryer basket ( plastic handle ) , capacity 3 litre with adjustable temperature control ( 150° c to 190° c ) , approx. 2500 watt power , baking pan loaf pan / pie pan / cake pan ( electrical 300w each ) , planetary mixer 5 litre and 20 lt. electrical with 20 litre capacity bowl, automatic , power 1 + kilowatt, 50 hz, 220v , spiral mixer 20 litre automatic, stainless steel, 220 v, 1.1kw, 20 litre, 22r / min, 770 x 400 x 830 mm, 230r / min , refrigerator two door: 1 no ( 240 lt. ) convertible freezer with deep fridge mode , deep freezer 500 lt. 500 litre double door deep freezer with wired shelves & castor wheels for easy mobility, freezing point up to 20degree, size: 88 x 174 x 74 cm; 39 kilograms approx. , lpg gas burner with 3 brass burners, two medium and 1 small, manual ignition and stainless steel tray, width 70 cm, size 690x360x55 mm , lpg gas cylinder commercial commercial lpg gas cylinder ( 19 kg ) with regulator and gas pipe , weighing scale 10 50kg, mild steel, industrial, business30kg, 1 kg to 10 kg, accuracy 1 gm to 5 gm, 220 v ac , work table 4’ x 10’ work table for students made of stainless steel , high speed exhausts high suction at low noise with aerodynamically designed blades ideal for duct size of 9.5x 9.5 inches, 2000 r.p.m. air delivery ( cmm ) : 470, 60 watt , serrated bread knife serrated edge bread slicer knife 14 inches with wooden handle , knives stainless steel blade knives of all sizes with non slip handle , thermometer digital lcd waterproof thermometer 2 of them should measure , timer digital kitchen magnetic countdown stopwatch timer with loud alarm ( up to 96 db ) with back stand , bread tin / mould aluminium bread tin with cover, nonsticky carbon base, volume 1000 ml. , aluminium cake pan aluminium cake pan / mould, round shape ( 12 inch diameter * 3 inch height ) , fd 3020 , cooling racks stainless steel 9 shelves cooling rack for bakery products. size:9 shelves, size: 1500 x 550 x 1800 h [ mm ] , dough scrappers and plastic steel dough scrapper dimensions: 12.5 x 15cm ( 6 inches ) along with plastic dough scrapper also can be used as cake polisher and cutter and smoother , flour sifter / sieves 12 inch brass / stainless steel frame sieve , apron & head gear chef hat and kitchen apron adult adjustable white apron with hat & kitchen pocket, adjustable for men and women, ( 33l x 26w ) , reusable , measuring cup and measuring jug different sizes and measurements as per need , measuring spoon measuring spoons: u taste 18 / 8 stainless steel measuring spoons set of 9 piece: 1 / 16 tsp, 1 / 8 tsp, 1 / 4 tsp, 1 / 3 tsp, 1 / 2 tsp, 3 / 4 tsp, 1 tsp, 1 / 2 tbsp. & 1 tbsp. dry and liquid ingredients , mixing bowl / vessels stainless steel mixing bowls sets with lid from small to large size ( 1kg to 5 kg ) , moulds / cutter stainless steel cookie cutter of different shapes , muffin tray stainless steel non stick cupcake baking slot tray for 12 muffin cup , nozzle set stainless steel piping nozzles tips , pallet knife straight and bent size 10 inch , straight and bend pallet knives of stainless steel , plates full, half and quarter plate sets made of porcelain / virgin plastic, microwave safe, break and chip resistant , rolling pin standard size for most needs: rolling pin for baking 16 inches , cake rings 3 pcs of round cake rings, small cake ring : diameter = 10 cm ( 4 inch ) , height = 4.5 cm, medium cake ring : diameter = 15 cm ( 6 inch ) , height = 4.5 cm, big cake ring : diameter = 20 cm ( 8 inch ) , height = 4.5 cm, steel , spatula and pastry brush silicone spatula and pastry brush set ( medium & large size ) , spoon ( big and small ) different sizes of spoon ( tea spoon , sugar spoon, serving spoon etc. ) set , storage containers different sizes of storage containers made of plastic, large, medium and small 2 / 3 sets ( as per need ) , strainer stainless steel soup & juice strainer & liquid filter ( large free size ) , turn table cake turn table 12 inch or 30 cm dais steel , wire whiskers stainless steel wire whiskers with wooden handle medium and large , water storage can transparent plastic water dispenser bottle 10l / 20l , packaging material food grade plastic round food container storage box, microwave safe, kitchen storage, reusable plastic containers for fridge storage ( different sizes ) ( 1pack of 25 ) , pizza cutter stainless steel pizza cutter free size , dough sheeter compact size manual dough sheeter: thickness range 0 12mm 1 / 2 / inches roller width 27cm 11 inches size 50x55x22 cm ( hxlx d ) 20x22x9 inches, weight approx. 11 kg / 22lbs , writing board with white board marker and duster 6’ x 4’ white board, 4 color white board marker in a pack of 10 each color, 01 duster , fire extinguishers 1 co2 type fire extinguisher for electrical equipment’s, minimum 4.5 kg, 1 abc type fire extinguisher for lpg, minimum 4.5 kg , list of recurring tools & equipments , gloves unisex quilted heat resistant baking gloves with filling, protection up to 450° f , hand towels cotton hand towels 60 x 40 cm , icing combicing comb with different patterns, steel / plastic , parchment paper parchment paper 40 gsm, dimensions: length 28cm, width 25cm, colour white, material paper ( each pack contains 100 parchment papers ) , piping bag disposable icing bags made of a clear poly material, stretch resistant dimension: 12 inches long and 8.5 inches wide at the top. , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., micro porous surgical tape, paracip / parachoice, ( each pack contains 100 icing bags ) , consumables for lab wheat flour, bread flour, chocolate chips and powders, sugar ( white & brown ) honey, molasses, corn syrup and alternatives. decorating ingredients ( frostings, icing & glazing, fondant, modelling chocolate ) yeast, bread & pizza toppings, eggs, fats, preservatives, bakery spices, milk powder, raising agents etc. as per need ( should be procured by the school after the establishment t of the lab....

Ministry of Skill Development And Entrepreneurship - Rajasthan

34319589 tender for disposal of e waste obsolete it equipments/electronic items, the national skill training institute, jodhpur, rajasthan, invites tenders for disposal of e waste – obsolete it equipment/electronic/ scrap items mentioned in the annexure i “as is where is” basis 1el long nose plier 6 (s 05/19) 03 nos. 2 steel almirah with 12 locker each locker size 450x305x430 mm made of 20swg, 19820x955x485mm (s 05/32) 02 nos. 3 student bench6 x 10 x1/2 (s 05/77) 06 no. 4 air cooler, evapourative air cooler steel body complete with fan motor fitted an water pump capacity 6000 cu./in. motor 1/6 hp, 34 x 34 x 40 (s 05/48) 01 no. 5 plastic tip hammer 50mm dia wooden handle (s 05/94) 02 nos. 6 plier side cutting (s 05/48) 03 nos. 7 diagonal nose plier 6 (s 05/70) 02 nos. 8 needle nose plier 150mm (s 05/71) 02 nos. 9 diagonal cutting nose plier 160mm (s 05/96) 03 nos. 10 rubber hand gloves 11000 v (s 05/98) 01 no. 11 screw driver 150mm (s 05/131) 03 nos. 12 honda portabel generator set 2.1kw, 230v, pf unit without dc output alongwith battery (s 05/82) 01 no. 13 drill ss twist block 2, 5 and 6 mm set of 3 pc (s 05/57) 02 sets 14 soldering iron 25w (s 05/148) 02 nos. 15 hand vice 100mm (s 05/15) 04 nos. 16md 1 set of stud bolt remover 02 nos 17 charge lead acid battery 12x, 180ax(amcu) 02 nos 18 volt and amp. meter 5 to 30v, 10 60 01 nos 19 student bench 6*10*1½ 06 nos 20 evaporative air coolar comp.with fan, motor, filter, pads and water pump, cap=6000 cub/hr motor⅙ hp, size 34*34*40 01 nos 21 oil can (half pint) 01 nos 22 steel almirah with 12 lockers 1980x950x485 mm 1 no. 23md ii combination ptier 6 05 nos 24 screw driver 12 04 nos 25 chisel mojmake 8 02 nos 26 soldering iron 35 watt 01 nos 27 carborator 01 nos 28 straight noseplier 150 04 nos 29 feelar gauge 20 10 nos 30 evaporated air cooler with fan and water pump o1 nos 31mmv 1 oil can 1/2 ltr. 2 32 automobile tray, 4x4x6 1 33 seisser 1 34 metal shelving cabinat without lokers drawers adjestable steel almira 2 35 steel almira with 12 lokesrs size 455x305x30 mm of 1950x955x455mm 1 36 carburator of bajaj super spacco 1 37 cylinder bore gauge cop. 18 35 mm 1 38mmv ii wheel allignment service equipment, ( aero make) wa 2100 set (a) wa 500, toeint gauge, (b) wa 650 turn table set (c) wa 600 caster, camber gauge 1 39 wall modle type inflation gauge 10kgs/150lbs (hycomake.) 1 40 cut sectional model of gearbox ( sliding mesh) three forworded and one revers mounted on stand comp. with stand gear cut by milling. 1 41 cut sectional model of deft gear assembly, show the working principle of dift, milling m/c gut gear, base size (45x45) cm 1 42 mocup hydrolic brake assembly with master cylinder w.c., b.s, b.p, wheel on wooden base. 1 43 steel almirah with 12 lokers (1980x955x485) mm 1 44 hot patch mechine ( puncture repare, clining m/c) 1 45 evaporate coolar 1 46 oil can 1/2 ltr. 1 47 tube (6.7x15) inch 4 48 lead acid battery 88ah, 12 v 1 49 pad lock (metador stepony) 1 50 diffrential stand 1 51 hydraulic jack (5 tone) 1 52 hydraulic jack (10 tone) 1 53 tripple leg grapper puller with bearing attachment (450 mm) 1 56 high rat discharge battery tester 1 57 battery 75 a 2 58 steel lock for tool box 10 59 mahindra & mahindra station wegon chasis 1 60wc&s evaporative air cooler (steel body) complete with fan motor 1 61 on line ups with iso lation transformer suitable for single phase ac input and ac output flux mounted, rating 1.0 kwa, backup time 30 min 30 62 nesting chair with seat &back 15 63welder combination side cutting plier 160mm 1 no. 64 table steel office (clerk) 1 no. 65 tubular chair with arm 1 no. 66 lock 50mm 01 no. 67 steel tape 2 meter 03 nos. 68 writng board with viterous enamalled steel sheet top surface board color white writng with marker pen for class room 1200 x 1800 mm 01 no. 69 drill bit 1 6 mm 6 pieces 70 screw driver 300mm 2 nos 71 line tester 3 nos 72 long nose plier 3 nos 73 spark lighter 1 no 74 snip tool 1 no 75 round file 200mm 1 no 76 round nose plier 02nbp 77 hacksaw frame 300 mm 02nb 78 student bench 4nbs 79 steel almirah with 12 lockers 1980x950x485 mm 1 no. 80library tubular chair with arm 03 nos. 81 tubular chair without arm 01 nos. 82 steel table clerk (blue) 1 no. 83 lock 38 mm 1 nos 84store steel tubler chair with canning and with arm 2 85 chair cane bottom tubular steel armless 8 86 computer p iv set 2 87 cd rom 1 88 ups 500va 3 89 forge portable dia 18 hearth 1 90 welding blow pipe low pressure 1 91 acetylene gas plant [low pressure] 1 92 volt & amhere tester moving coil d.c. 3 93 rheostate steel brand wire wound resistance 0 10 ohm., 4.5 amp. 15cmx6.2cm 2 94 rheostate steel brand resistance 210 ohm. amp.2.3 tube length 50cm. dia6.2cm. 2 95 blow lamp one point 1 96 ball peen hammer 600gm 10 97 grease gun hand operated 2 98 chisel cold 5x1/4 2 99 automobile tray with hamdle 1 1/2*2*4 4 100 cycle puwp ti hul with nozzle 1 101 moving coil ammeter portable class range 5 0 5 amp 14 1248,68 7 102 moving coil volt meter portable class range 0 30 v/dc as per i5 1248 4 103 hammer ball peen 100 gm 2 104 hammer cross peen 100 gm 9 105 rule wooden 4 fold 2 106 soldering iron 35w 1 107 nipple forming tools to form nipple on pressure line 6,8,10 dia size std make 1 108 coil spring tube bender set of 5 pieces 3 109 tube flaring tools from 3/16 to 5/8 3 110 swagging tools size 3,4,6,7,10,12 set of 6 piece 1 111 soldering icon 60 watt 1 112 file round 2nd cut 6 3 113 screw pitch gauge 1 114 d.e. ring spanner shallow offset american set of 6 2 115 crow bar 6*1 1 116 torque wrench square live 450 to 950 1 117 d.e. open jaw spanner set of 9 pcs 2 118 jenny caliper 15cm 1 119 ms office(xp) software 1 120 computer intel core 2 duo 2 121 evaporative air cooler (steel body) complete with fan motor 2 122 konika minolta cpoier 1 123 digital fax machine canon 1 124 chalk board with beeding size s*3 2 125 file punching machine 1 126 room heater 1 127 stepler machine 1 128 hammer planshing 1lbs 2 129 hammer creasing 2 130 milimeter 1 131 milimeter sayno 1 132 steel almirah with 12 lockers 1980*950*485mm 1 133 orient make table fan 1 134 wooden rack 1 135 counter amco make with weight 5,2,1,0.5,0.1,0.05kg 1 136 weight type 300kg capicty with loose weight 100kg 2,50kg 1,20kg 2,10kg 1 1 137fitter file half round smooth 8” 01 nos. 138 engineering scale metric 30cm. 02 nos. 139 bench vice 10 cm. 12 nos. 140 material stand 01 no. 141 drill machine bench type 13mm 01 nos. 142 square file 200 mm 08 nos. 143 triangular file 200 mm 09 nos. 144 file second cut round 6 15 nos. 145 combination plier 15 cm 02 nos. 146 jenny caliper 15 cm 02 nos. 147 feeler gauge 01 nos. 148 outside micrometer 0 1 01 nos. 149 centre punch 10 cm 06 nos. 150 cold chisel 20 cm 8 nos. 151 drill twist 11 nos. 152 steel rule 01 nos. 153 file flat secund cut 8 15 nos. 154 file flat secund cut 250 mm 09 nos. 155 inside caliper 150 mm 01 nos. 156 half round file 10 01 nos. 157 hacksaw frame 300 mm 07 nos. 158 scriber 175 mm 07 nos. 159 round file 200 mm 15 nos. 160 divider 150 mm 01 nos. 161 air cooler 01 nos. 162 pipe die 01 nos. 163 office table 02 nos. 164 white board 01 nos. 165estste automatic voltage current, copper wound conformoing to is 8448/77 1 no. 166 steel balti 1 no. 167 mottca stand 1 no. 168 telephone box 1 no. 169 polycon tank (200 ltr) 1 no. 170 monoblock water pump 0.5h.p, khaitan make 1 no. 171 servo motor operated line voltage corrector 1 no. 172 fawada 02 nos. 173 fawada 02 nos. 174 water filter cum purifier 1 no. 175 aquagaurd hi flow water filter cum purifier 1 no. 176 water purifier eureka forbes makes 1 no. 177 trainees honour board 8x3 1/4’’ 1 no. 178 sing board 14’x3’ 1 no. 179 honour board 8 x 3 1 no. 180 water purifier 1 lr. cnferming is. 14724 hypura make 1 no. 181 water color side wall(150 litr) 1 no. 182 water color side wall(40 litr) 1 nos ...

Sarva Shiksha Abhiyan Authority - Rajasthan

34315847 supply and installation lab equipment in vocational schools ( food industry ) agriculture releted item supply in vocational education agriculture releted item supply under vocational education in gsss kalpajagir , item list , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground.features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs.features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine3*2pictures binded with wood border , charts / picture s related to safety measure3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards.3*2pictures binded with wood border , germination test equipmentmade of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material , raw material list ( recurring items list ) , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete...

Sarva Shiksha Abhiyan Authority - Rajasthan

34304209 agriculture releted item supply in vocational education agriculture releted item supply under vocational education in gsss kalpajagir , item list , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground.features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs.features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine3*2pictures binded with wood border , charts / picture s related to safety measure3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards.3*2pictures binded with wood border , germination test equipmentmade of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material , raw material list ( recurring items list ) , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete , brick work in c.m 1:5 mix including all labour charges etc complete , brick work in c.m 1:5 mix using 2nd class ground moulded chamber burnt bricks with including cost and conveyance of all materials and including all labour charges etc complete , plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34281072 supply of material for vocational educution agriculturelab material for vocational educution lab agriculturelab , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine 3*2pictures binded with wood border , charts / picture s related to safety measure 3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

Indian Army - Rajasthan

34189628 bids are invited for brown wrapping paper roll , pencil cell , register 3 qr , note book pad , talc sheet , fevicol , high lighter , stapler big size kangaro , borocil glass medium , phool jharu soft broom , jetter pen , dettol hand wash , plastic tray , stamp pad , colin , power wooden handle , stickey note pad , bamboo hard broom , phenyl , lamination paper roll , erraser , paper pin , napthalene ball , uniball pen blue...

Sarva Shiksha Abhiyan Authority - Rajasthan

34175196 supply of vocational lab agriculture equipments and tools vocational lab agriculture equipments and tools , agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine 3*2pictures binded with wood border , charts / picture s related to safety measure 3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

Sarva Shiksha Abhiyan Authority - Rajasthan

34174006 supply of agriculture laboratory agriculture laboratory , agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine 3*2pictures binded with wood border , charts / picture s related to safety measure 3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

Indian Army - Rajasthan

34134226 bids are invited for brown wrapping paper roll , pencil cell , register 3 qr , note book pad , talc sheet , fevicol , high lighter , stapler big size kangaro , borocil glass medium , phool jharu soft broom , jetter pen , dettol hand wash , plastic tray , stamppad , colin , power wooden handle , stickey note pad , bamboo hard broom , phenyl , lamination paper roll , erraser , paper pin , napthalene ball , uniball pen blue total quantity : 424...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34096934 supply of agriculture agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handlemedium size25 ltr. capacity , models related to various types of animal houses models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / pictures related to health hazards 3*2pictures binded with wood border , charts / pictures related to milk machine 3*2pictures binded with wood border , charts / pictures related to milking method 3*2pictures binded with wood border , charts / pictures related to clean milk production 3*2pictures binded with wood border , charts / pictures related to dairy records 3*2pictures binded with wood border , charts / pictures related to tincture iodine 3*2pictures binded with wood border , charts / pictures related to safety measure 3*2pictures binded with wood border , charts / pictures related to vaccination schedule toanimals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation 3*2pictures binded with wood border , charts / pictures related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

Sarva Shiksha Abhiyan Authority - Rajasthan

34031540 supply and installation of lab equipments and material for vocational education lab agriculture supply and installation of lab equipments and material for vocational education lab agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handlemedium size25 ltr. capacity , models related to various types of animal houses models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / pictures related to health hazards 3*2pictures binded with wood border , charts / pictures related to milk machine 3*2pictures binded with wood border , charts / pictures related to milking method 3*2pictures binded with wood border , charts / pictures related to clean milk production 3*2pictures binded with wood border , charts / pictures related to dairy records 3*2pictures binded with wood border , charts / pictures related to tincture iodine 3*2pictures binded with wood border , charts / pictures related to safety measure 3*2pictures binded with wood border , charts / pictures related to vaccination schedule toanimals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation 3*2pictures binded with wood border , charts / pictures related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

North Western Railway - Rajasthan

34005716 supply of synthetic brush paint & varnishsynthetic brush paint & varnish, synthetic filament oval ferrule bound brush for paint & varnish.size 6 / 0 mm. shape & design of brush shall be as per fig.1 of is:487 / 2012.filament of brush shall be manufacturing from golden / black colored, synthetic polymer nylon 612 of specific gravity 1.067+ 0.004 & melting point 209+ 8 degree c. the entire mass of the filaments shall be firmly set in the 0.8+ 0.2 mm mild steel ferrule with suitable non metallic wedge using epoxy polymer. wooden handle timber shall be free from pits, knots, cracks & straight grained along length and seasoned to a content of 15% max. for securing the bridle strip and the ferrule to the handle, four round headed steel nails of 1.40mm diameter and 12.5 mm length shall be used....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33977233 supply and installation tools, equpment furniture for agriculture 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 5 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 5 11 knapsack sprayer 2 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake,spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle/s lightly curved blade. 5 17 secateurs made of stainless steel,0 steel cutting blade 5 18 specialty spades suitable for garden ,made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 20 sprinklers medium size garden sprinklers fitted with water pipe 1/2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large (plastic/ gl sheet) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc (automatic temperature compensation) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm,bucket 20 litre,orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine,leg rings, colar,branding (hot and cold) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest (available in local market) 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 (230mm) 2 45 lactometer made of glass 2 46 teat siphon fine finish ,teat plug with syphon 2 47 charts/picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts/picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts/picture s related to milking methods 50 charts/picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts/picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts/picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts/picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts/picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts/ pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts/picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, (snf, fat , water test etc.) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl/gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight (lb.)= 1.62, product width (in): 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment (ppe) include gloves, foot and eye protection, protective hearing devices (earplugs, muffs) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 1 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 raw material list (recurring items list) 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea,dap,pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash 2 6 seeds of various agriculture crops (as per curriculum) healthy and good quality of seeds of various crops 10 7 fertilizers samples samples of different type of fertilizer packed in plastic jars 10 8 duster used to clean 5 9 ropes jute rope of 100 meter 2 10 tape measuring of land area 100 mtr standard tape 2 11 sprayers having capacity of 1 litre 5 12 sprayers fitted on every bottle made of plastic ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Sms Medical College - Rajasthan

33885210 supply of stationery items at hospital 1 acr form pad tic 2 age & sex book size: a 4 , 60gsm, one side printed, gumming sheet 50x2 perforated binding a 3 all pin pkt. — t shape only pt 4 attendance register — 20 pages 1c13 1 5 attendance register — 40 pages a 6 attendance register — 60 pages wl 7 attendance register — 80 pages 31 8 bill encashment register — 100 pages ‘i3 1 9 bill transit register — 100 pages !3 1 10 binder clip pkt. 32mm. 134 11 binder clip pkt. 41 mm. pi 12 budget control register — 100 pages e 13 calculator— 12 digits sharp / canon / casio lin 14 carbon paper pkt. pi 15 cash book — three col. 300 pages neelgagan e 16 cd re writable 17 cello tap 1 f 18 cello tap 2 f 19 chapdi pkt. ( pack of 10 pcs. ) f 20 color flag pkt. — different color f 21 computer cartridge — 80 column. i 23 computer paper — green, size:a4, 70 gsm p 22 computer paper — white, size:a4, 70gsm f 24 computer paper —single with back adhesive 3x4 f 25 computer ribbon i 26 consumption register — 200 pages 1 27 dak pad — good quality 1 28 dam pad 29 diet register — 100 pages 30 discharge ticket — blue card sheet ( 18x28cms. ) printed both side ( as per sample ) 31 dispatch register — 400 pages neelgagan 32 envelope — cloth 12x16 printed one side 33 envelope — cloth 18x14 34 envelope — paper size: 11x5 35 envelope — paper size: 9x4 36 envelope for x ray khaki color, size • 11x13, one side printed, hospital name with details envelope for x ray khaki color, size 12x15, one side printed, hospital name with details pc 17 envelope for x ray khaki color, size 9x1 i, one side printed, hospital name with details pc 39 fevi stick gum — 8 gms. iw 40 file cover — good quality pc 41 file lace — full length — good quality pt 42 file tag — good quality pc 43 fitness book — gazette iw 44 fitness book — non gazette lcu 45 ga 79, 80 deduction form pad p ( 46 gum bottle — 150m1 iw 47 high lighter pen 16 48 income tax calculation form pad — 100 nos. pt 49 indent book — 5 forms with paper binding pc 50 indoor ticket — 8 pages, 65 gsm, printed both side ( as per sample ) el 51 injury report form 60gsm, paper with binding from paper perforated, 21x35cms., 50x2 paper ( as per sample ) pc 52 investigation slip 60gsm, white / blue / green / red size:16x26 / 2 one side printed ( 50 slips pad ) p ( 73 jitteritefill [ li 1 53 , jssy registration register — 400 pages ( both size printed ) size: 16 ) ( 26 / 4 j 54 labor room register — 200 pages ( both side printed ) i 55 ledger book — 200 pages ( neelgagan / unique ) 57 legal paper — green — 70 gsm — 500 nos. p 56 legal paper white — 70gsm — 500 nos. p 58 lining register— 100 pages e 59 lining register — 200 pages e 60 lining register — 300 pages e 61 log book 62 lpc form pkt.of 100 nos. 63 marker pen — big 64 marker pen for laboratory purpose 65 note sheet pad —size a3, 70gsm ( both side lining ) 67 opd slip carbonless size: 8x10x2, 60gsm, white paper 500x2 with printed ( as per hospital opd slip ) 66 opd slip size: 8x10x1, 60gsm, white paper, 500x i with printed ( as per hospital opd slip ) 68 p.l. form — ga 45 69 paper weight plastic 70 pay posting register — 400 pages, 72 pen — gel — ( good quality ) 74 pen drive — 8gb — kingston / sendisk 75 plastic folder — good quality 76 poker — iron handle 77 poker — plastic handle 78 poker wooden handle, r 79 punching machine — big 80 punching machine — small 81 receipt register — 200 pages neelgagan 71 refill pen — flair — ezee click 82 refills for flair pen 94 ribbon for computer cartridge 83 stamp pad — big ( blue / red / green ) 85 stamp pad — ink — 100m1. 84 stamp pad — small ( blue / red / green ) 86 stamp postage register — 80 pages 87 stapler machine — big 88 stapler machine — small 89 stapler pin — big 90 stapler pin — small 91 stock register — 200 pages 92 voucher pad — 100 nos. ( as per sample ) 93 white correcting fluid pen....

Revenue Department - Rajasthan

33869588 purchase of stationary 01. plastic dori ( in per kg. ) 02. allpin ( 100gm ) packet 03. u pin plastic coated ( 100 ) pkt per unit 04. file lace 24 inch nukaa% inch 924 no. ( per bundle 100 pic. ) in per pkt. 05. stapler pin packet no 10 standard brand per packet 06. stapler pin packet no24 / 6 standard brand per packet 07. stapler pin packet no 17 / 23 standard brand per packet 08. blue carbon paper standard brand ( 100 carbon per pket ) 09. sketch pen ( per packet ) 10. self sticking page marker 1x3 ( 50x50 ) per pkt i i. t pin allpin packet ( 100gm ) per unit 12. file tag 8 inch length nukaa3 / 4 inch standard brand ( per bundle 100 pic.in per pkt. ) pc unit 13. stapler machine no i0 standard brand per unit 14. stapler machine 24 / 6 standard brand per unit 15. stapler machine 17 / 23 standard brand per unit 16. register — 100 page white paper 8.5 x 13 inch per unit 17. register — 200 page white paper 8.5 x 13 inch per unit 18. register 400 page white paper 8.5 x 13 inch 19. register — 400 page green paper 8.5 x 13 inch per unit 20. gum 150 m.l. standard brand per unit , 21. gum 700 m.l. standard brand per unit 22. simple pencil standard brand per unit 23. short hand pencil standard brand per unit 24. pencil sharpner standard brand per unit 25. simple eraser standard brand per unit 26. stamp pad standard brand 160 / 97 m.m. ( big ) per unit 27. stamp pad standard brand 110 / 70 m.m. ( small ) per unit 28. stamp pad ink standard brand 100 m.l. per unit 29. plastic folder f / s size ( strip ) ( per piece ) 30. plastic folder a 4 size ( strip ) ( per piece ) 31. spiral diary page 40 ( 51 / 2 x 81 / 2 inch ) ( per piece ) 32. white fluid pen ( per piece ) 33. magnetic pin container ( per piece ) 34. paper weight glass 100gm ( per piece ) 35. acrylic paper weight officer ( per piece ) 36. poker with wooden handle ( ice braker ) ( per piece ) 37. dora gitta 100 gm cotton ( per piece ) 38. cello tape ( big ) 60 meter x 1 / 2 inch ( per piece ) 39. cello tape ( big ) 60 meter x 11 / 2 inch ( per piece ) 40. scale 12 inch standard brand ( per piece ) 41. ball pen 42. gel pen ( per piece ) 43 gel refill ( per piece ) 44. highlighter ( per piece ) 45. marker pen ( per piece ) 46. paper cutter big ( per piece ) 47. sponge pot / damper ( per piece ) 48. short hand note book ( per piece ) 49. glue stick 15 gram ( per piece ) 50. simple dak pad standard brand ( per piece ) 51. big slip book 33 no ( per piece ) 52. cello tape / dispenser big standard brand ( per piece ) , 53. paper punching machine no.280 standard brand ( per piece ) 54. white board 04 x 03 feet standard brand ( per piece ) 55. pen drive 16 gb standard brand ( per piece ) 56. pen drive 32 gb standard brand ( per piece ) 57. c. d. r ( per piece ) 58. pension kulak ( per piece ) 59. table top 16 x 22 size ( per piece ) 60. pen container ( per piece ) 61. pen stand ( per piece ) 62. income tax form ( per thousand ) 63. file flap 24 x 4 inch rope of 3 feet ( per thousand ) 64. craft envelope ( thick cover ) 4x9 inch 90 gsm ( per thousand ) 65. craft envelope ( thick cover ) 5x11 inch 90 gsm ( per thousand ) 66. envelope 4x9 inch ( laminated ) 100 gsm ( per thousand ) 67. envelope 5x11 inch ( laminated ) 100 gsm ( per thousand ) 68. envelope 10x12 inch ( laminated ) 100 gsm ( per thousand ) 69. envelope 12x16 inch ( laminated ) 100 gsm ( per thousand ) 70. cloth envelope 12x16inch ( laminated ) 100 gsm ( per thousand ) 71. sarvarak sheet full size different colon ( per thousand ) as per office model 72. file cover ( handmade sheet ) 80 kg 10.6 inch x 14.6 inch , 200 gsm or more print with office name ( per thousand ) 73. file pad 10.6 inch x 14.6 inch with 03 feet rope with broad cloth patti print 36 ons or more with office name ( per thousand ) 74. single file cover ( handmade sheet ) 80 kg 11 inch x 15 inch , 200 gsm or more ( per thousand ) ....

Medical College - Rajasthan

33655219 stationary items for govt medical college kota paper pencil eraser 1. alpin pkt. 2. candle 10 3. carbon paper small l0 ( or 4. chalk white 2 5. cello tape big 6. cello tape small 7. envelope 11 x 5 8. envelope 9 x 4 9. envelope a 4 size laminated 10. envelope legel size cloth ii. eraser big 12. file lace ( 13. file cover set 14 file pad cloth cotted 15. gum bottle 300 mls. 16. gum stick, 8gm 17. lock medium 18. marker pen 19. note sheet pad green 100 pages 20. paper veight ( glass ) 21. pencil nhbu — 22. pencil cell ( aa ) 23. peon book 24. pin cushion im pocker wooden handle 26. punching machine big 27. register linedar 28. register despatch 29. register receipt 30. register attencence student 31. register attendence staff 32. scale ( ss ) 12 33. sharpner washing power 34. soap 36. stamp pad — big 37. stamp pad small 38. stapler machine and pin big 38. stapler big 39. stepler— 1edium 40. stepler—small 41. stepler pin big stapler pin small 42. 43, whitener pen 44. zerox rim a 4 size 45. zerox rim f / s size c d plain 46. 47. f.vc bili form? budget register bill register m 48. 49. 50. register linedar big size potract 51. calculator — 52. colourful flag pad 53. envelop a 3 size cloth coted 54. alpin pkt. ( t shape ) 55. binder clip midium size 56. dak marking pad plastic coted 57. service book 60 pages 58. pentioner kulak 59. plastic folder 60. strip file 61. drawing pin for board 62. u pin etc ...

Government Medical College - Rajasthan

33648621 stationary items for govt. medical college kota stationary items for govt. medical college kota , stationery items as per technical bids specification , alpin pkt. , candle , carbon papersmall , chalkwhite , cello tape big , cello tape small , envelope 11 x 5 , envelope 9 x 4 , envelope a 4 size laminated , envelopelegel size cloth , eraser big , file lace , file cover set , file pad cloth cotted , gum bottle 300 mls. , gum stick, 8gm , lock – medium , marker pen , note sheet padgreen 100 pages , paper weight ( glass ) , pencil hb , pencil cell ( aa ) , peon book , pin cushion , pocker wooden handle , punchingmachinebig , register linedar , register despatch , register receipt , register attencence student , register attendence staff , scale ( ss ) 12 , sharpner , washing power , soap , stamp pad – big , stamp pad – small , stepler – big , stepler – medium , stepler – small , stepler pin –big , stepler pin –small , whitner pen , zerox rim a 4 size , zerox rim f / s size , c d plain , f v c bill form , budget register , bill register , register linedar big size potract , calculator , colourful flag pad , envelop a 3 size cloth coted , alpin pkt. ( t shape ) , binder clip midium size , dak marking pad plastic coted , service book 60 pages , pentioner kulak , plastic folder , strip file , drawing pin for board , u pin...

Department of Information Technology and Communication - Rajasthan

33538296 rate contract rfp for stationary, computer media, consumable and other office itmes 1 canon toner 320 2 canon toner 328 3 canon toner 337 4 canon toner 324 5 toner hp 6511a 6 toner hp ce 278a 7 toner hp cc388a 8 toner hp 05a 9 toner hp 230a 10 toner hp 287a 11 toner hp cf280a, 1 canon toner 328 2 canon toner 337 3 canon toner 324 4 toner hp 6511a 5 toner hp ce 278a 6 toner hp cc388a 7 toner hp 05a 8 toner hp 230a 9 toner hp 287a 10 toner hp cf280a, ( a ) cd / dvd 1 dvd r with cover ( frontech / samsung / moserbaer / hp / sony ) ( b ) usb pen drive ( 3.1 and above ) 1 32 gb ( kingston / sandisk / hp / moserbaer / transcend ) 2 64 gb ( kingston / sandisk / hp / moserbaer / transcend ) 3 128 gb ( kingston / sandisk / hp / moserbaer / transcend ) ( c ) external hard disk drive 1 1 tb sata usb powered ( seagate / wd / transcend ) 2 2 tb sata usb powered ( seagate / wd / transcend ) 3 4 tb usb powered ( seagate / dell / sony / wd / transcend ) 4 512 gb ssd usb powered ( seagate / wd / aarvex ) 5 1 tb ssd usb powered ( seagate / wd / aarvex ) 6 2 tb ssd usb powered ( seagate / wd / aarvex ) d internal hard disk drive 1 512 gb sata hdd 7200 rpm, ( seagate / wd / transcend / aaevex ) 2 1 tb sata hdd 7200 rpm ( seagate / wd / transcend / aaevex ) 3 512 gb ssd ( seagate / wd / transcend / aaevex ) 4 1 tb ssd ( seagate / wd / transcend / aaevex ) 5 512 gb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) 6 1 tb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) ( e ) ram 1 desktop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 2 laptop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 3 desktop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 4 laptop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) ( f ) other items 1 usb optical mouse ( logitech / iball / hp / dell ) 2 optical wireless mouse ( logitech / iball / hp / dell ) 3 usb keyboard ( logitech / iball / hp / dell ) 4 wireless keyboard ( logitech / iball / hp / dell ) 5 wireless keyboard & mouse combo ( logitech / iball / hp / dell ) 6 web camera ( logitech / iball ) ( minimum hd 720p 30fps 1280*720 resolution ) 7 vga cable standard size 1.5 meter 8 hdmi cable 1.5 meter 9 speaker set ( 2 nos. ) with usb power, 1.2 watt, 3.5 mm input 10 mechanical keyboard ( tvs gold ) , 1. all pin ( 26 mm, nw 70 gram ) 2. binder clip : a. 19 mm b. 25 mm c. 32 mm d. 41 mm 3. gem clip / u pin ( plastic cover ) 4. poker ( wooden handle ) 5. poker ( iron base ) 6. transparent adhesive tape ( scotch / cello / wonder ) , 7. brown packing tape ( scotch / cello / wonder ) a. 1, 55 meter b. 2, 55 meter 8. both side tape ( scotch / cello / 3m ) a. 1 wide both side tape thick b. 1 wide both side tape thin 9. cleaner ( colin / cleen ) ( 500 ml ) 10. gum ( camlin / kores ) a. 700 ml b. 150 ml 11. glue stick 15 gm ( kores / scotch / fevi stick ) 12. large paper cutter ( natraj or equivalent brand ) 13. hb pencil ( camlin / natraj / faber castel ) 14. non dust eraser ( camlin / natraj / faber castel ) 15. sharpener ( camlin / natraj / faber castel ) 16. scale plastic ( 12 ) ( natraj / camlin ) 17. scale iron ( 12” ) ( ajanta / camlin / natraj ) 18. stamp pad 110mm x 70mm ( ashoka ) 19. punching machine ( kangaroo or equivalent brand ) a. 14 page punching capacity ( dp 480 ) b. 22 page punching capacity ( dp 680 ) c. 60 page punching capacity ( dp 800 ) d. 1 hole punching no. 10 20. stapler ( kangaroo / max ) a. staples use :no. 10, stapling capacity upto 15 pages, loading capacity:50 staples b. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hp 45 equivalent ) c. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hdz 45 equivalent ) 21. stapler pin ( kangaroo / max ) a. no. 10 1m ( 20x50=1000 staples ) b. no. 24 / 6 ( 20x50=1000 staples ) c. no. 26 / 6 ( 20x50=1000 staples ) 22. envelop ( cloth ) a4 size with min. 100 gsm paper 23. envelop ( cloth ) fs size with min. 100 gsm paper 24. cd / dvd permanent marker ( camlin / faber castel / luxor ) 25. paint marker ( golden color ) ( camlin / faber castel / luxor ) 26. white board marker ( camlin / luxor / faber castel / kores ) 27. correction fluid ( camlin / luxor / faber castel / kores / kangaro ) 28. peon book 100 sheets 29. slip pad 140mm x 225mm, 70 gsm inner paper with line, 1 mm card sheet on back, 30. spiral slip pad a. 140mm x 225mm, 70 gsm, multi color inner paper with line, card sheet on back and plastic cover 80 sheets ( 160 pages ) b. 140mm x 225mm, 70 gsm, inner paper with line, card sheet on back and front 80 sheets ( 160 pages ) 31. white board duster 32. white board duster ( magnate ) 33. a4 size photo paper 180 gsm ( 50 sheets per pkt ) ( desmat / novajet / epson / kodak ) 34. 75 gsm paper a4 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 35. 75 gsm paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 36. 75 gsm a3 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 37. 75 gsm green pie paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 38. address label ( for laser printer a 4 size ) 100 sheet in a packet ( desmat or equivalent ) a. 16 label per page b. 24 label per page 39. basta ( cloth ) size 90*90 40. file pad – weight 32 ons, size 10*15, 36 ( dori 4*27 flap ) 41. file cover ( 31 kg cpm board ) with printing of deptt name 42. file lace best quality ( 100 nos. of laces in one bunch ) 43. file tag best quality ( 50 nos. of laces in one bunch ) 44. transparent l shape folder ( plastic ) ( solo / trio ) 45. ring binder, 1, 2 d, pvc folder a4 size, holds upto 250 sheets ( solo / trio or equivalent ) 46. index file ( box file ) 47. pen a. reynolds 0.45 b. cello fine grip c. flair writo meter d. flair ball pen e. uniball eye fine f. parker roller pen ( beta premium i. parker vector standard j. uniball gel impact k. uniball eye broad 48. duster ( cloth ) 2ft x 2ft. 49. post it ( 3m ) a. size 3” x 3” 100 sheets, 50. cell ( duracell ) a. pencil cell ( aa ) b. pencil cell ( aaa ) 51. pvc cards packet of 50 pvc cards ( 30 mil ) 52. dustbin plastic min 12 litr. ( poly propylene plastic ) without cover 53. dustbin min. 12 litr ( poly propylene plastic ) with cover 54. dustbin 15 ltr ( poly propylene plastic ) with cover 55. water jug plastic ( 2 ltr. or more ) ( poly propylene plastic ) – ( cello / prestige / orient / milton or equivalent ) 56. extension board ( make: belkin ) a. 4 socket b. 6 socket c. 8 socket 57. scissors ( kangaro munix ) stainless steel, 185 mm ( munix sl 1173 ) 58. electric kettle ( prestige, borosil ) , 1.5 litre 59. tea flask tuff insulated jug 1 litres ( cello / milton ) 60. best quality white window envelop ( 50 piece ) 11 x 5 80 gsm 61. towel 100% cotton, 75 cm x 150 cm ( bombay dyeing ) 62. refillable self inking stamp seal two line 63. refillable self inking stamp seal three line 64. refillable self inking stamp seal four line 65. refillable self inking stamp seal five line 66. refillable self inking stamp seal big size ( more than 5 line ) , 1. 9 u rack with pdu & cooling fan 2. installation charges for 9 u rack 3. i / o port set ( network keystone jack, gang box, face plate ( dlink / digisol / dax / amp / molex ) 4. cat 6 network cable box 305 mtr. ( d link / digisol / dax / amp / molex ) 5. laying of cat 6 cable 6. isi mark pvc casing 1 inch 7. laying of pvc casing 8. 5 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 9. 8 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 10. rj 45 connector ( dlink / digisol / digilink / molex ) ....

Sms Medical College - Rajasthan

33454927 stationery items supply at hospital paper acr form pad f age & sex book size: a 4 6ogsm, one side f printed. gumming sheet 50x2 perforated binding — aii pin pkt. — t shape only i attendance register —20 pages 1 attendance register —40 pages i attendance register —60 pages? — attendance register — 80 pages . bill encashment register — 100 pages bill transii register — 100 pages .. biider ciip pkt. 32mm. binderclippktr4lmfll. rdget control register — 100 pages calculatorr — 12 digits siarp / canon / casio carbon paper ikt. cash book — three col 300 pages neelgagan 15 16 cd re writable cello tap 1” cello tap 2” 17 18 19 chapdipkt. ( packofl0pcs. ) color flag pkt. — different color 20 21 — computer cartridge — 80 column. 23 computer paper green. size:a4, 70 gsm 22 computer paper — white, size:a4. 7ogsm 24 computer paper single with back adhesive 3x4” 25 — computer ribbon 26 consumption register — 200 pages 27 dakpad goodquality dam pad 28 29 diet register 100 pages 30 discharge ticket — blue card sheet ( 1 8x28cms. ) printed both side. ( as.per.sample ) envelope for x ray khaki color. size i ix 13, 31 32 dispatch register — 4i0 pages neelgagan i envelope — cioth i 2x 16” printed one side 33 envelope—cloth 18x14” 34 envelope — paper size: i 1x5” 35 envelope — paper size: 9x4” 36 / | one side printed. hospital name with details 38 fnvelope for x ray khaki color, size 12xl5, one side printed, 1ospital name with details 37 envelope for x ray khaki color, size 9x1 1. one side.printed._hospital.name.with.details 39 fevi stick gum 8 gms. m 40 filecover—goodquality 41 file lace — full length good quality 42 file tag good quality fitness book gazette fitness book non gazette ga 79. 80 deduction form pad gum bottle— 150m1 high lighter pen 43 44 income tax calculation form pad — 100 nos. indent book — 5 forms with paper binding indoor ticket 8 pages. 65 gsm. printed both side ( as per sample ) 51 injury report form 6ogsm. paper with binding from paper perforated. 21 x35cms., 50x2 paper 51 injury report form 6ogsm, paper with binding from paper perforated. 2lx35cms., 50x2 paper ( as per sample ) 52 investigation slip 6ogsm. white / blue / green / red size: i 6x262 one side printed ( 50 slips pad ) 73 jitter refill 53 jssy registration register 400 pages ( both ize printed ) size: 16x26’4 54 l:abor room register 20g pages ( both side printed ) 55 ledger book — 200 pages ( neelgagan / unique ) 57 legal paper green 70 gsm 500 nos. 56 legal paper white — 70gsm 500 nos. 58 lining register 100 pages 59 lining register — 200 pages s0 lining register — 300 pages 61 log book 62 lpc form pkt.of 100 nos. 62 lpc form pkt.of 100 nos. 63 marker pen—big marker pen for laboratory purpose 65 note sheet pad size al, 7ogsm ( both side lining ) 67 opd slip carbonless size: 8x10x2. 6ogsm white paper 500x2 with printed ( as per hospital _ opd slip ) opd slip size: 8xl0xl. 6ogsm. white paper, 500xl_with_printed_ ( as_per_hospital_opd_slip ) 68 p.lform ga 45 69 paper weight plastic 70 pay posting register 400 pages. 72 pen — gel — ( good qualiiy ) . 74 pen drive — 8gb kingston / sen [ ) isk 75 plastic folder — good quality 76 poker iron handle 77 poker plastic handle 78 poker wooden handle 79 punching machine — big .__.. 80 punching machine small 81 receipt register 200 pages neelgagan 71 refiil pen — flair ezee click 82 refilis for fiair pen . _ 94 ribbon for computer cartridge 83 stamp pad? — big (blue/red/green) 85 stamp pad — ink — i ooml. stamp padd — small (blue/red/green) 86 stamp postage register? — 8i pages 87 stapler machinee — big 88 stapler machine? — smail . 89 stapler pin—big 90 stapler pin — small . 91? — stock register — 200 pages 92 voucher pad 100 nos. (as per sample) 93 white correcting fluid pen etc ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33126851 supply of equipment and articles for uch jodhpur i dissection set (complete) 2 electric saw for sectioning body & limbs electric, height 2o0mm, max. throat 2oomm, table size (lxw) 600x600mm, blade speed (mtr/min.) 20 100, blade size (lxwxt) 3 505x27x0.9mm, motor capacity 3 hp 0l j hand saw for sectioning body & limbs blade size (lxwxt) 3505x27x0.9mm; wooden handle 0l 4 skeleton (articulated) imported quality non toxic pvc bone like material; articulated on a stand with trollcy wheels. 0l 5 skeleton (non articulated) imported quality non toxic pvc bone like material; non articulated having 206 bones. 03 6 diagrams (region wise) embossed diagrams (lx2 ft.) on a ply board of the following: o lungs o heart r thorax o abdominal cavity o liver o kidneys with ureten & urinary bladder . male reproductive organs r female reproductive organs o parts of brain o eyes o oral cavity o parts of a tooth o cell division o developmentofface o formation of blastocyst . mammary glands (breast) . testis (l.s,) . ovary (l.s.) o extrahepatic biliary apparatus o pancreas 0l each (20 pcs.) 7 models (viscera) nontoxic pvc/plastic/pop models of the following: o heart r brain o lungs r eyes 0l each (15 pcs.) a. . r1 re s;24 sign & seal utl firms . ear o larynx . liver . pancreas . spleen o stomach . kidney r uterus o shoulderjoint . knee joint o elbow ioint 8 half torso (male) half body (3 ft.) pvc/plastic torsomale 0t 9 half torso (female) half body (3 ft.) pvc/plastic torsofemale 0l l0 full torso (male or female) full body (5 ft.) pvc/plastic torsofemale 0l ll histological slides with cabinet prepared glass slides of human body structures/ viscera with ground edge lx3 cabinet frame of mds fumished with laminated sheets, hinged door with lock of capacity 100 slides with 5 drawers (50 slides in 0l cabinet) 0l cabinet t2 class jars with lid lxw i x 1.5 05 pcs. lxw 1 x 1 05 pcs. l0 l3 projector with screen & speakers (audio visual aid) t4 refrigerator l5 computer with printer 6 surgical gloves (7 05 pkt. 7 dissection apron 02 pcs 8 formalin 100lts. 9 phenol 500 ml. 20 glycerol 2t distilled water 200lts. 22 scalpel blade (ss; 22 no.) 05 pkt. 23 syringe (20 ml.) l0 pcs 24 plastic trays ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33020793 supply of agriculture 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools handle made of plastic and head made of stainless steel 5 4 garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 11 knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body 2 12 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle / s lightly curved blade. 5 17 secateurs made of stainless steel, 0 steel cutting blade 5 18 specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 2 20 sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity 1 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height 5 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre ) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) 2 45 lactometer made of glass 2 46 teat siphon fine finish , teat plug with syphon 2 47 charts / picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts / picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts / picture s related to milking methods 3*2 pictures binded with wood border 2 50 charts / picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts / picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts / picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts / picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts / picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts / pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts / picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea, dap, pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash ...

Government Medical College - Rajasthan

32921721 supply of stationary and printing iteam in jk lon hospital kota supply of stationary and printing iteam in jk lon hospital kota , fofhkuu izdkj dh tkp fjikszv qkezl ,oa vu; qkeszl vksfj;uv ogkbzv isij@vu; isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z rfkk ljl lfgr 200 isij izfr ism ,d rjq nikbz izfr gtkj isij , size = 18 x22/12 , size = 18 x22/10 , size = 18 x22/08 , size = 18 x22/06 , size = 18 x22/05 , size = 18 x22/04 , size = 17 x27/12 , size = 17 x27/10 , size = 17 x27/08 , size = 17 x27/06 , size = 17 x27/05 , size = 17 x27/04 , fofhkuu izdkj dh tkp fjikszv qkezl ,oa vu; qkeszl vksfj;uv ogkbzv isij@vu; isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z rfkk ljl lfgr 200 isij izfr ism nksuksa rjq nikbz izfr gtkj isij , size = 18 x22/12 , size = 18 x22/10 , size = 18 x22/08 , size = 18 x22/06 , size = 18 x22/05 , size = 18 x22/04 , size = 17 x27/12 , size = 17 x27/10 , size = 17 x27/08 , size = 17 x27/06 , size = 17 x27/05 , size = 17 x27/04 , fofhkuu izdkj dh tkp fjikszv qkezl jaxhu isij 58 th ,l ,e e; isij ,oa fizfuvax dk;z rfkk ljl ckbzafmax lfgr 200 isij izfr ism ,d rjq nikbz izfr gtkj isij , size = 18x22/12 , size = 18x22/10 , size = 18x22/08 , size = 18x22/06 , size = 18x22/05 , size = 18x22/04 , fofhkuu izdkj dh tkp fjikszv qkezl jaxhu isij 58 th ,l ,e e; isij ,oa fizfuvax dk;z rfkk ljl ckbzafmax lfgr 200 isij izfr ism nksuksa rjq nikbz izfr gtkj isij , size = 18x22/12 , size = 18x22/10 , size = 18x22/08 , size = 18x22/06 , size = 18x22/05 , size = 18x22/04 , ,dljs fyqkqs e; fyqkqk ,oa fizfavax dk;z lfgr 80 th ,l ,e dsoy ,d rjq nikbz izfr gtkj , size = 10.5x12.5 , size = 8.5x10.5 , size = 11.5x14.5 , size = 12.5x17.5 , size = 14.5x17.5 , dkmz khv e; isij ,oa fizfuvax dk;z] 9 fdyksxkze , size = 22 x28/05 izfr gtkj , size = 22 x28/06 izfr gtkj , lelr izdkj ds jftlvj yky dimk okbzfmx 200 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz` , size = 17 x27/02 , size = 17 x27/04 , lelr izdkj ds jftlvj yky dimk okbzfmx 300 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz , size = 17 x27/02 , size = 17 x27/04 , lelr izdkj ds jftlvj yky dimk okbzfmx 500 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz , size = 17 x27/02 , size = 17 x27/04 , lvhsdj lkbzt 10 lseh x4 9 lseh x 3 1000 lvhdj izfr isdsv ¼dv dsoy 3 uecj ij gksuk pkfg, , , ih ,y mk;jh okmz esa hkrhz ejhtks dks fu% kqyd nok gsrq ¼18x22@6 ,d rjq ldkbz cyw ,oa ,d rjq lqsn isij vksfj;uv isij 58 th ,l ,e dsoy ou lkbm fizuv 200 isij izfr ism e; ljl ckbzfmax ,oa uecjhx lfgra , , ih ,y mk;jh okmz es hkrhz ejhtks dks fu% kqyd nok gsrq ¼18x22@8 ,d rjq ldkbz cyw ,oa ,d rjq lqsn isij vksfj;uv isij 58 th ,l ,e dsoy ou lkbm fizuv 200 isij izfr ism e; ljl ckbzfmax ,oa uecjhx lfgra , bumksj fvfdv lkbzt 10x12x1 60 gsm nih gqbz 1000 isij izfr isdsv , vks ih mh fvfdv vkjksx; vkwu ykbzu lkbzt 8 x 10x2 60gsm dkczu dkwih lfgr ,oa fizuv lfgr 500 issij lsv izfr isdsv , uxn tek jlhn 08x10 x 1, 60gsm dkczu dkih jfgr rfkk fizuv lfgr 1000 isij izfr isfdv , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 2, 300 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 4, 300 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 2, 500 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 4, 500 ist izfr jftlvj , discharge ticket 22 x 28x6, 9kg card sheet one side print per thousand , discharge ticket 22 x 28x6, 9kg card sheet two side print per thousand , discharge ticket 22 x 28x5, 9kg card sheet one side print per thousand , discharge ticket 22 x 28x5, 9kg card sheet two side print per thousand , discharge ticket a4 size, 9kg card sheet one side print per thousand , discharge ticket a4 size, 9kg card sheet two side print per thousand , bar code sticker roll size 50mmx25mm , adt/gate pass sticker – size 10x5 c.m. without print per thousand , fu%kqrd ¼qzh½ dsvsxjh mk;jh 18x22x8 double numbering (100+100) with binding , obstetric ultrasound report with new sonography registration certificate (1:2 ds vuqikr esa] igyk isij 90gsm sunshine paper o vu; nks isij 58gsm) – size 18x22/4 – 30 dk lsv izfr ism ¼dqy 90 isij izfr ism½ , i.p.d. slip – multicolor, 90 gsm, deo paper, size – 18x23/2 (12 inch x 19.5inch) izfr gtkj , lvskujh vkbzve~l dk fooj.k , mkd iqflrdk ¼peon book½ 50 ist , ,q oh lh qkezl~ izfr gtkj , dsk cqd & 200 ist , ,&4 lkbzt tsjksdl ogkbzv isij jhe 70 th ,l ,e 500 isij izfr jhe , ,&4 lkbzt tsjksdl ogkbzv isij jhe 75 th ,l ,e 500 isij izfr jhe , ,&4 lkbzt ;syks isij 70 th ,l ,e 500 isij izfr jhe , yhxy lkbzt isij fje 75 gsm 500 isij izfr jhe@isdsv , gydk cy;w isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , gydk xqykch isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , gydk gjk isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , dot matrix printer paper rim 10 x 12x1 60gsm , lvsiyj fiu lekwy izfr isdsv 10 1m steel , lvsiyj fiu chx izfr isdsv 24@6 steel , qkbzy ism dyksfk dksvsm yky@uhyk izfr ux , qkby doj fon~ ysl 100 u mpp xq.koùkk izfr ux , qkbzy vsx 8 bap] thick, 90 degree izfr xzql , qkbzy ysl 24 bap] thick, cotton base izfr xzql , fjfliv jftlvj 100 ist 54 th ,l ,e izfr ux , fmlisp jftlvj 100 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 200 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk & lvwmsuv 200 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 100 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 50 ist 54 th ,l ,e izfr ux , jftlvj ykbunkj ,&4 lkbzzt 300 ist izfr ux , jftlvj ykbunkj ,&4 lkbzzt 200 ist izfr ux , jftlvj ykbunkj ,&4 lkbzzt 100 ist izfr ux , lfkkbz lvkd jftlvj lkbzt ,&4 100 ist izfr ux , vlfkkbz lvkd jftlvj lkbzt ,&4 100 ist izfr ux , absent statement register , pay posting register with binding & numbering – 100 pages , pay posting register with binding & numbering – 300 pages , notesheet pad green 100 pages 54 gsm , vehicle log book diary 200 pages 18x22x4 orient paper , color notes (stickey notes) – 25mmx75mm multicolour 3 sheet , scale (ss) – 12inch steel , calculator – 12 display digit big size , cello tape big (brown) – 3inch x 50mtr. (40 microns) , cello tape big (transparent) – 3inch x 50mtr. (40microns) , cello tape (small size) – 1inchx60mtr. transparent , whitener/correction fluid vial – 20ml. , whitener pen/correction pen , glue/gum stick – 8gms. , alpin(steel pins) packet (100 gms) , alpin(steel pins) packet (60 gms) , alpin t shape small packet – 50gms. , upin packet – 25gms, steel, plastic coated , pin container – magnet – small , envelop blue – legal size cloth, 90 gsm , envelop brown (a4 size),90gsm , envelop – 11x5 white , envelop – 9x4 white , envelop yellow (a4 size) laminated 90gsm , envelop a 3 size cloth coated , paper weight glass 50gm , paper weight glass 100gm , green pen(cello permanent o.h.p. pen) , red pen(cello permanent o.h.p. pen) , black pen(cello permanent o.h.p. pen) , dak marking pad – plastic coated, red/blue , sutli – 100gms. , box file(index file) , marker black(jumbo size) – 10mm tip refillable , marker blue(jumbo size) – 10mm tip refillable , stapler steel heavy duty – capacity of staple upto 200 pages , stapler (medium size) – in built reloader indicator half strip, pin support – 24/6 , stapler (small size) – iron base plastic cover – pin support 10 1m , stapler big – steel body long – pin capacity 24/6 , stamp pad – small 100mmx70mm blue , stamp pad – small 100mmx70mm red , stamp pad big (160mm x 97mm) blue , stamp pad ink (bottle) – 50 ml. blue , stamp pad ink (bottle) – 50 ml. red , carbon paper packet – rich blue 210mmx330mm 100 sheets per packet , carbon paper packet – black 210mmx330mm 100 sheets per packet , plastic folder – legal size , office paste (xksan) 500ml bottle , highlighter pen – chisel tip 3mm yellow , highlighter pen – chisel tip 3mm orange , scissor small , punch machine medium , punch machine big heavy duty capacity upto 50 pages , punch machine big heavy duty capacity upto 100 pages , punch machine big heavy duty capacity upto 200 pages , poker – wooden handle...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32481878 2_ supply of construction at govt. sr. sec. school bap block bap, district jodhpur. 2_ supply of construction at govt. sr. sec. school bap block bap, district jodhpur. , construction ( assistant mason ) list of non recurring tools & equipment’s : concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30 / min, weight 80 kg, size 80 ( mm ) x 50 ( mm ) , electric drill up to 10mm taparia / gadore / jhalani / pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg, drill spindle connecting thread 3 / 8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm , safety belt unisex adjustable safety belt ( full body harness and lanyards ) with hook options ( scaffolding ) and line attachments, made of high quality polyester, with alloy steel buckles, capacity up to 2000 kg , water tank water tank to store water ( must be with cover ) , trowel iron mason trowel with wooden handle ( 10 to 12 inches long and 6 inches wide ) , plumb rule and bob heavy iron plumb rule and bob with chord ( at least 3 meter ) approx. weight around 1 kg , spirit level taparia 300 mm spirit levellevel accuracy: 1 mm / m width ( mm ) : 50 mm weight ( kg ) : 0.165 kg length ( mm ) : 300 mm height ( mm ) : 20 mm material: aluminium frame and rubber moulding , try square stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pins large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line , brick bolster / brick chisel made of carbon steel with dual hand guard, size 4 x 8, 1 / 2 inch , brick hammer made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammer made of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axe one side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbar iron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel 6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boaster with carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammer large hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in size , scrabbling hammer one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spade spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beaters used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden float flat board with a handle to hold, made of hard wood for durability, size: 12? ( 300mm ) x 5? ( 125mm ) . , metal float smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? ( 300mm ) x 5? ( 125mm ) . , floating rule floating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcher scratcher trowel made of steel 16 x 4 1 / 2 with wood handle , trowel ( khurpi ) made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 meter measuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladder bamboo ladders of 10 / 12 feet , wooden pole ( balli ) wooden poles of 10 & 12 feet for making wooden decks , wooden sieve wooden sieve of large size , tasla galvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrow double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolley air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle standerd , hacking tool satnderd , list of recurring tools & equipment’s : bricks 9 in. x 4 in. x 3 in. each , stone basalt or granite stone, must be hard stone for construction pupose , sand river sand for construction purpose , concrete block 12 inch brick 12x7x5 inches , cement ordinary portland cement of any brand , water pipe 50 meter garden water hose pipe with sprayer and hose connector, material pvc , safety glasses scratch resistant polycarbonate transparent safety glasses, unisex , safety helmet polycarbonate / polymer unisex adjustable helmet with chin strap, size 28 cm x 20 cm x 15 cm , safety vests bright yellow safety construction vests with bright reflectors, made of polyester, unisex, size 11.81 x 10.98 x 6.3 inches ( large ) , safety gloves nylon chemical & cut resistant unisex safety gloves , safety boots steel toe safety shoes, lightweight & durable with good breathability , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., microporous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Central Organisation Railway Electrification - Rajasthan

32378475 supply of copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar]copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar],copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar...

Department Of Training And Technical Education - Rajasthan

32267828 supply of electrician trade tools and equipments measuring steel tape combination plier insulated 200 rrm ( 40 +2 ) nos. screr.r, driver lnsulated :lmnr x i 5c rnrr. i ) iamond head ( 40 +2 ) nos. 4. screr.vdriver insulated 6mm x 150 rnm ( 40 +2 ) nos. 5. electrician screwdriver thin stem insu lated hand le zlmm x 100 mm ( 10 +2 ) nos. 6. heavv duty screwdriver insu iated 5nrnr x 200 rnm ( 40 +2 ) nos7. h lectrician screwdriver thin stem insu lated hand le 4mnr x 250 rrnr ( 40 +2 ) nos8. punch flentre 9mrr x 150 mnr ( 40 +2 ) nos. 9. knife double bladed electrician i00 mm ( 40 +2 ) nos. 10. neon tester 500 v ( 40 +2 ) nos. lt steel rule graduated both in metric and english lrnit 300 innr u, ith precision of ii4ii, mm ( 40 +2 ) nos. t2. hammer, cross peen with handle 250 glams ( 40 +2 ) nos. b. shop tools & equipment fot 2 1+1 ) units no additional items are required li ) list of tools & accessories 13. hammer. ball peen with handle 500 granrs .i n os. 14. pincer 50 rrrr 4 nos. 15. c clamp 200 nrm and l0 ( ) rnrr 2 nos. each 16. spanner adjustable drop forged, ss 50 mrr & ioomnr 2 nos. each , l ) ] , .., ...; 11, , , , , r blou larnp brass ( lhisel cold 25 nrnr x 100 nlnl chisel tirmer r, ith wooden handle 6 mm x 200 ntnr allen key alloy steel l. 5 l0 mm ( setof 9 ) 0.5 ltr. capacity pull ) puller with 3 legs i 150 nrm & 300nrnr bearing puller linside and otttsjde t scissors blade. ss 150 rrnt 1.5 sq nrtr to 16 sq trtn crinrping lool 16 jq rrlrll to 95 sq rnm wire cutter and stripper iiil rn mallet hard wood 0.ril lill halnmer extractor type 250 grarns hacksaw tranre radjustable l00nrrr fixed 150 2 nos. each try square ll50 nrrl blade outside calliper ., il ] nt .p, inr.t t pd inside calliper i: r sorirts tr oe l 5l rrn spring i pe plicrs long nose insulated 15i rnrn 1 nos. pliers 4 n os llat nose insulated pliers round nose insulated l0ll nm treezers l5c mrn i 4 nos. snip straight and bent heavldut5 250 nirt d.e. metric spanner double ended 6 12 nrrn drill hand brace 0 l00rnm 1 nos. drill s.s. lwist block 2 nrm.5 ntnr and 6 rnrn set of 3 50 nm x 200mm 50 nrnr x 20 { ) mbl gauge. wire imperial stainlees steel wire ( ) atrgl metric maked in swg & mnr l0l ) rrnr lnd cut uilh handle { l nos. file half round l0l rrn lnd cut rvith handle i 4 nos. file round 20ll rn1 llnd cut r, ith handle file llat rough i : ( l lrn . iih handle .1 os. lil ir, irl u ith hrndle file flat smooth l: ir , rlx ith lirndlc file rasp, half round 20il !r1nr bastard rvith handle coppet bit soldering iron. 0.15 kg i leat ;rlor:rl nrrzzle. pvc type. 25itlrrrr 4 nos. de soldering gun plane cutters smoothing cutter file flat , file flat bastard grease gun bradawl pipe vice cast iron with hardened jaw open scissor blade 57. hand vice 50 mm jav, , l nos. 58. table vice 100 mm.jau, t lros. 59. oil can 250 ml i l, jos. 60 contactor & auxiliary contacts 3 phase. 415 vola. 25 amp u.ith 2 nos. each 2noandlnc 6t contactor & auxiliary contacts. 3 phasc. 4 1 5 volt. 32 anrp u, ith 2 l. os. each 2noand2nc 62. limit switch limit switch. l iver opetated 24 i nos. 500v 2 contacts 61, rotary switch 16 r i.140 i nos. 64. relay a. cut out relays b. reverse current c. over current d. [ jnder voltase a. 164. 1.10 i l.jo. each b. r6, 4. 440v c. 16a.4 10v d.360v 440v 65. pin type. shackle type, egg l, pe & suspension type insulators incjuding hardware fittin { r i nos. each 66. llydrometer i nl, s. 61. hand drill machine 0 6 rrrrrr c.rpel it1 i os. 68. portable electric drill machine 0 i2 mrr capacit ) 750rv.2, 10v i no. with chuck and ker 69. load bank ( larnp / heater t pe ) 6 k , . iph r no. 70. brake test arrangement with tu, o sorine balance ratinp 0 ro s ko i , .r. 71 laboratory t ) pe induction coil 1000 w i nos. 72. orrf side micrometer 0 25 nrm least counl 0.01mm 2 nos. 13. thermorneter digital 0c 150 c i no. 14. series test lamp 230v.60w , 1nos. 75. knife switch dpdt fitted with fuse terminals l6 arrp rtr nos. 16 knife switch tpdt fitted with fuse terminals l6 amp / 440 v 4 nos. 77. miniature breaker 16 amp i nos. eadh plate 60cm x 60cm x 3. i5mm copper plate 60cm x 60cru x 6mm gi plate leach 79. earth electrode primary electrode 2 i 00x28x3.25mm secondaq, cu strid 20x5mrn i no. 80. mccb l00a, nps. triple pole i no. 8r. fi.cb and rccb 25arrrps. double pole and 2 5r mps. double pole ian i0 ma i each fuses hrc glass re*ire t1 pe .1 f.ach 83. rheostat ( sliding type ) 0 0 25 ohm. 2 amp 300 ohm. 2 amp i ohm. 10amp l0 ohrn. 5 arnd 0 0 i no. each 84. capacitors various electronic component various lamps rubber mat plug socket piano switch lanrp holder llr v. i a cab les: twisted paii non metal lic sheathed cable underground feeder cable ribbon cable metallic sheathed cable multiconductor cable coaxial cable bus bar rvith brackets irrir cacl l 2x4x l electrician helmet yellorv colour rcc pole with accessories ( ms angle iron.cclamp, stal insulaior etc.t o ill and material. safety belt stanclald qualitl l 2 nos. list of eouidment ohm meter; series type & shunt 5012000 ohrn analog 2 nos. each tvne ooftable box digital multi meter a.c. voltmeter m.l. analog. poftable box type housed in bakelite case illlrlti range 75 v i50v rrl0 600v milli voltmeter centre zero analog. poftable box type housed in bakelite case i00 0 100 mv arrmeter mc analog. pofiable 0 i0 ( ) ria. 0 5 a. 0 25 a box type housed in bakelite case 2l os. each ac ammeter ml. analog. 0 i a. 0 5 a 0 25 a 2 nos. each porrable bor type housed in bakelite case kilo wattmeter analog name of the tools and specification 0 1.5 ikw. pressure coil raring 1.101 r i.10v, current iat ing lia / i 0aanaloge. porrabie t1, pe housecl in llaiiclite case 2 nos. i i digital wattmeter a.c. energy meter a c e*.gy m.t* poner factor meter digital f =, f*r. ) , m.t.t isingte phase. j 0 .l.. 240v l4lilll , vp. .fhrce phase. i 5a ..!40v llqry4ry!. i440v.20a, three pnase portu h le bo tlpe 145 to 5i i l:z f nos. l , ) s. 102. r03. 104. i05. 106. lvagrtetic flur metcr 0 j, , u rc., la : , . __ i u rneler lu.r. n, e ter i ( lj read ( lrrt 0.0 ; _ , rs. , lo 700 ( r lurncns ill . i attcr_v. ] t, ffiejoc ceroooorpm ._ln;__ i t0 { ) c0 rlm tongtester / ctu.pmffi 2 ns : ryanjos 5oov l , i, * 3 point d.c. starter f or 2.5 kw dc r;otoi :. t07. 108. i l 109. i t0. l i 12. i i3. j po int d.c. starrer for 2.5 k l, dc motor j no. i i 4. ] whrt stone bridge r.r ith i galvanotneter and batterv i nos. i 15. single phase variable auto franst ormer cooled ) i 16. phase sequence indicator i phase..ll5 v i nos. 117 . crowler ac starters: a. resistance type slarter b. direct online starter c. star delta starter manual d. star delta stafter semi automatic e. star delta starter fully automatic f. star delta starter soti stafter g. auto transformer type tachometer 9. oscilloscope dual trace 20 mhz i no. 120. function generator 2 to 200 kilz. sine, square triangular 220 v 50 llz. single phase !no. 121 soldering lron temperature controlled soldering l50 , i an. li.l voir discrete component trainer discrete component ( for diode and trarrsislol circuill rr ith 2 itos. regulated pou er !:upplv +5, 5 v.+12.9 12 y linear l.c. lrainer [ . ireal lc. trainer u, ith reglilated pou er slrppll, i .2v i to i5v t } lc socket i6pin and 20 pins with bread boaril ] digital l.c. trainer digital i.c. trainer 7 se, :rren1 d isp lav , and bread board domestic appliances a. 1500 wa11. 2.10v i no. each b. e lectric kerlle b. i 500 ?ttr 2 10 / c. e iectric lron c. automatic 750 . 240 d. immersion heater , d l50f u, a1i. l 10v 126. ie. a.c. ceiling fan and ac c. f, e , .rrr ii0 v table fan 1 . geyser ( storage type ) t. l0 iitrc i g. mixture & grinder h. washing machine serniautomatic i. motor pump set oiltesting kit electric induction plate inverter with battery i kya wirh l2 v barterv lnplrt l2 r, olt dc. outputi no. voltage stabilizer 1ntr vi ac output 110v.i0a dc power supply 0 , 30 v 5 a 12 nos. battery charger i0 potential transformer 4 current transformer i solar panel w ith battery pentium iv computer or latest . ink jet/ laser printer c, shop machinery d.c. shunt generator with control pane motor generator ( ac to dc) d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motor d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motordc compound motor u,ith !itarter and sw itch l. j l. :r .::/.) i,l1s i ll 143. motor cenerator(dc to ac) set lshnnt motor rating: 5 hp. consisting of shunt motor with 440v ac generator rating : starling cornpen5ator and su itch j phase. .1 rvi::. :. j kva. directll coupled lo ac generalor 4lr(, ll0 volls. 0.8 pl. with exciter and switch board 50rr ,: i:s mounted with regulator, breaker. ammeter, voltmeter fieq uency meter. knile hlade su itch arrd lure. e1g. set cotnplete r.l ith ca:t irorr bed plate. lixing holts. [oundat ion bolt. arrd llexible coupling. lno. 144. ac squirel cage motor with 5 iip.3 i)hase.4l5v.50 hz star delta starter and triple pole ir,rn clad u itch lirc u ith mrchanical lord. i no. t45. ac phase wound slip ring motor 5 ilp440 v.i phase.s0 hz urith stafier su itch i no. 146. universal motor with 2+,.1 v. 50 t{2. 1 iip i no. stafter/s,,,itch 147 . synchronous motor with 3 l)hase. 3 iip. 4rt[)v. 50h2. ] i no. accessories like starter. ercitation ,1 poie aflangemen t.. 148. thyristor /lgbtcontrolled d.c motor drive with tachogenelator feedback arrangement i ii) lno. 149. thyristor/igbt controlled a.c. vryf uor,!r()l .l ?nase. i i o. motor drive with llp r 50. single phase llansfonrer. corc i kva.240141 5 v. 50 hz 3 nos. t1,pe. ail cooled l5t three phase transformer. shell t1pe oil cooled with delta/ star 3 ri va.,ll 5/2,10 v. 50 hz 2 r os. 152. electrical machine trainer diesel cenerator set with changeover switch. over current hreaker and uater/ air cooled with armature. star deita connections ac 3 phase 7.5 i{va. .i: 5 rar;tg v t,, l ,, hi 1,.,, r. ,. ,. insi tirie 154. ljsed dc generators seriesshunt and compound type lor overhau ling practice i i o ilach 155. pillar e lectric drill machine motorized i 2 ll) rnrr (.:rp:ic rt. i i i ;. r 1l:. 44() ,. 1 phae. irrdrrr l;o h4rtor with d(ll starter. bencir tvde 156. motorised bench grinder i hp. 3 phase. 440v with . o doi starter. ifo,,rhie sidc xi.h sn]oot;i and iougir ni;ee i ,vi1ir iool ilase 157 . a.c. selies type motor i tit 140 .50 ilz , nir i 58. single phase capacitor motor with starter switch i hi.2,10 i0 117 159. manual motor coil winding machine with srep arbor no. 160. ceiling tan coil winding machine 250v. i0 i{7:. i q.,. ith spced contr0i o i l6l primary current injection set 220i. i0 l1z. i t!. olrtpirl current 20(r a (nriri) t ir[r iinr er | 62. stepper moror with digital controller ino. t6t. shaded poie motor fractional t ip.2,l0t/.50 llz ,o. d.shonfloorfurnitureandmaterials for2(l+lliilit::trr,;dditrinli .tctns are required 164. working bench l,5.rx 1.21) * x11.75 :rl , :rs. t65. wiring board : n]etcr i :;,elcir^ith0.j llio. incter projectr,rii (,rr lh. top t 66. lnstn rctors table lo. 167. instnrctors chair .. ,)s. 168. metal rack l00cm x i 50crr x..l ictn 169. [ ockers with dralvers 2.5 nr r 1.20 rn r 0. 5 rn { lc dra,r,er*10 tirauer) i lil f.acir l iainee 170. almirah 2. i rn r 1.2[t m x 0.5 nr ] ,lr o. 171 black board/white board lrninirnurn 46 lect, , t fo. 112. fire extinguisher co2 ,./ k( i i n rs. t7 3. fire bucket slselof six) etc ...

Rajasthan High Court - Rajasthan

32159938 tender for rate contract for the supply of office stationery items at rajasthan high court jodhpur tender for rate contract for the supply of office stationery items at rajasthan high court jodhpur , office stationery items , globe brand “t” all pin pkt. ( 70 gram. ) , u pinclips coated globe ( @100 pc pkt ) , all pin cusionpremier / vekon / polo , wooden handle ice peaker national ( superior quality ) , address sticker desmat ( 1, 10, 12 & 16a4 size ) ( 100 sheet per packet ) , cello tape big 2 wonder 65mtr length , cello tape small ½ wonder 65mtr , brown tape 2 wonder 65mtr. , pen pot ( as per office sample ) , eraser apsara / fabar castle , sharpner apsara / fabar castle , highlighter 5 pen set ( faber castle / camlin ) , whitener pen ( 7ml ) camlin / other , marker pen ( camlin / other ) , cd marker pen luxer / camlin / other , sketch pen luxar ( sign pen ) , add gel pen achiver , uniball eye pen ( fine ) ub157 , uniball gel impact pen ( in all available color ) , pilot v5 hi tecpoint pen , pilot v7 hi tecpoint pen ( refillable ) , classmaate ( insta glide / oct gel ) pen , reynold trimex pen , reynolds 045 fine carbure pen , butter flow ball pen , reynolds liquiflo pen , refill add gel achiver pen , refill gel ( classmate ) , refill jotter pen , cartridge / refill pilot v7 / v5 hi tecpoint pen ( 02 pc. per pkt ) , permanent marker ink bottle 15 ml camel ( as per sample ) , apsara black beauty pencil hb , red pencil packet ( apsara / other ) , three colour desmat past it flag 3x1x3x80 , yellow colour desmat flag 3x1x60 ( as per office sample ) , plastic flag 5 colour , stamp pad medium ashoka ( as per sample ) , stamp pad bigashoka ( as per sample ) , stamp pad ink 30 mlashoka , paper cutter medium ( natraj ) , paper cutterbig size ( natraj ) , lesses packetno. 924 ( as per office sample ) , water dumper small ( as per office sample ) , water dumper big ( as per office sample ) , rubber band small , rubber band big , file pad legal size ( as per office sample ) , file flaps 5” red color ( as per office sample ) , kores clear gum stick transparent ( 15gm ) 5 yrs non drying guarantee , scale steel 12 , scale plastic 12 , box of binder clip black kent no. 8032s 32mm , plastic lock ( 10 inch nylon zip cable ties organiser ) ( as per office sample ) , lahi , pocket diary luxer / other , short hand note book neel gagan ( 200 page ) , conference pad lodha brand ( 15 leaves ) , conference pad plane ( without line as per office sample ) , slip book no.22 desmat / neelgagan / other ( as per office sample ) , slip book desmatno.33 desmat / neelgagan / other ( as per office sample ) , lodha slip pad no. 1 a4 size slip pad , stapler small hd10d. kangroo ( blue packing ) , stapler big hp 45 kangroo ( blue packing ) , kangaro hd 23s13 heavy duty stapler , stapler pin small no.10 kangroo ( blue packing ) , stapler pin big 24 / 6 kangroo ( blue packing ) , stapler pinno. 23 / 20 kangroo , stapler pinno. 23 / 24 kangroo , stapler pinno. 23 / 15 kangroo , stapler pinno. 23 / 10 kangroo , stapler pinno. 23 / 17 kangroo , stapler pinno. 23 / 13 kangroo , punching machine kangroo dp 280 ( blue packing ) , punching machine big kangroo dp500 ( blue packing ) , secissor big 210mm ( kangroo munix sl 1183 ) , secissor medium 152mm ( kangroo munix sl 1160 ) , secissor small 128mm ( kangroo munix sl 1150 ) , calculator casio / citizen medium , calculator casio / citizen big , 32 gb pen drive usb 3.0 steel body , 64 gb pen drive usb 3.0 steel body , 128 gb pen drive usb 3.0 steel body , plastic l folder with pocket f / ssize ( as per office sample ) , cause listplastic folder f / ssize ( as per office sample ) , plastic f / s size spring file ankita ( as per sample ) , plastic f / s size clip file ankita ( as per sample ) , index / box f / s file shubham brand ( as per sample ) , legal size springflat file ( gatta ) ( as per office sample ) , self inking ruber seal , ruber seal wooden base per line upto 2.5 ( for office ) , coloured sheets 90 gsm ( yellow / pink / etc. ) , envelops cloths 10x12 ( as per sample available in store section ) , envelops cloths 16x12 ( as per sample ) , craft enevelope ( brown ) 16x12 100 gsm with printing star quality , craft enevelope ( brown ) 9x4 100 gsm with printing star quality , craft enevelope ( brown ) 11x5 100 gsm with printing star quality , craft envelope size ( 12*18 ) a grade, 100 gsm with printing , envelops white 9*4 100 gsm ( as per sample ) , envelops white 11*5100 gsm ( as per sample ) , yellow envelope big size ( 18*12 ) cloth coated , yellow envelop size ( 16x12 ) laminated ( as per office sample ) , plastic envelop ( tearless ) 16x12 size ( as per office sample ) , plastic envelop ( tearless ) a4 size ( as per office sample ) , register 96 page with cover page printing ( 70 gsm page ) ( as per office sample ) , register 192 page with cover page printing ( 70 gsm page ) ( as per office sample ) , register 288page with cover page printing ( 70 gsm page ) ( as per office sample ) horizontal line , handmade paper made administrative file cover set with printing & cloth striping on edge ( quality, colour & printing must be as per office sample ) , handmade paper made judicial file cover set with printing and lamination required in red, green, yellow color ( quality, colour & printing must be as per office sample ) , plastic dori ( in kg ) , plastic bora / katta ( size 40*40 ) ( as per sample ) , lock small 40 mm 5 lever ( harison / other ) , lock medium50 mm 6 lever ( harison / other ) , lock big 65 mm 8 lever ( harison / other ) , basic telephone plane ( beetel c 11 ) , telephone caller id ( beetel c 51 ) , telephone ( 01+01 ) ( beetel m 78 ) , wall clock ( ajanta 397 / equivalent standard ) , wall clock ( ajanta 5077 / equivalent standard ) , remote bell electric ( cona original genuine, product code no. 2866, range up to 50 meters, 32 assorted tunes, product code no. 2866, dimension 165x85x178 ( mm ) , remote bell cordless ( cona silver 3221 ) , power extension cord of 4 plug having 10 ft. 1mm wire bottom covered wooden hand made board ( by use vinay / anchor / or any branded 3 pin top socket with individual swtich ) , power extension cordwith spike control for use of computer systems with minimum 5 mtr. cable ( as per sample ) , canvas bag big with zip ( 15x12x16= h*w*l in inch ) ( as per office sample ) , canvas bag small with zip ( 9x12x16= h*w*l in inch ) ( as per office sample ) , water camper 5 ltr. ( milton / cello ) , water camper 10 ltr. ( milton / cello ) ...

Rajasthan Council Of Secondary Education - Rajasthan

32083145 bids are invited for agriculturelab ( q3 ) total quantity : 1 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools handle made of plastic and head made of stainless steel 5 4 garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 11 knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body 2 12 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle / s lightly curved blade. 5 17 secateurs made of stainless steel, 0 steel cutting blade 5 18 specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 2 20 sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity 1 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height 5 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre ) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) 2 45 lactometer made of glass 2 46 teat siphon fine finish , teat plug with syphon 2 47 charts / picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts / picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts / picture s related to milking methods 3*2 pictures binded with wood border 2 50 charts / picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts / picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts / picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts / picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts / picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts / pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts / picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea, dap, pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash 2 raw material list ( recurring items list ) 6 seeds of various agriculture crops ( as per curriculum ) healthy and good quality of seeds of various crops 10 7 fertilizers samples samples of different type of fertilizer packed in plastic jars 10 8 duster used to clean 5 9 ropes jute rope of 100 meter 2 10 tape measuring of land area 100 mtr standard tape 2 11 sprayers having capacity of 1 litre 5 12 sprayers fitted on every bottle made of plastic...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040953 supply of equipments, articles and chemicals for dept. of pharmacy list of articles/equipments (consumable) 1 dropping bottles 5 2 dropper 100 3 sieves (stainless steel, size 10,20,40,60 meshes) 03 each 4 chopping board 05 5 chopping knife 05 6 burettes 10 7 pipette 10 8 graduated dropping pipette 05 9 graduated conical testing flask 05 10 beakers (50 ml to 1000 ml) 25 11 stand with ring clamp 05 12 distillation apparatus with liebig chamber 02 13 graduated flask round bottom (different size) 10 14 spirit lamp 20 15 weighing box (chemical) 10 16 tripod stand with wire gauge 15 17 temperature thermometer 10 18 leather pad for succussion 05 19 test tube holder 25 20 test tube 200 21 retort with stopper 05 22 desiccator with silica plate 05 23 amber glass bottles (50 & 100 ml) with cork and cap 100 24 pycnometer (specific gravity bottle) 02 25 litmus paper 10 packs 26 filter paper 10 packs list of articles/equipments (other) 27 spatula (stainless steel) 30 28 spatula (wooden handle) 10 29 stop watch (racer) 15 30 botanical slides (medicinal plants slides) a) diatoms (w.m.) b) spirogyra (w.m.) c) stem tip d) aspergillus e) valvox (w.m.) f) rhizhopus sporangium g) penicillium (w.m.) h) yeast (w. m.) i) lichen rons j) mushroom k) spirogyra conju. 01 each 31 hot plate 01 32 laboratory press 02 animal specimens 33 spider (karoliyo) 1 6 25 sign & seal of firms 34 flea (fly) 1 35 snail (gokal gay) 1 36 cockroch 1 37 ant (kidi) 1 38 honey bee (madh makhi) 1 plant specimens 39 alum (fatakadi) 1 40 naphthelin (damar goli) 1 41 red phosphorus (match sticks) 1 42 boric acid 1 43 camphor(kapur) 1 44 salt 1 45 iron 1 46 aluminium 1 47 pencil lead 1 48 copper sulphate powder 1 49 calcium carbaid powder 1 50 hydrocloride acid 1 51 silver nitraite 1 52 barium cloride 1 53 lithium 1 54 glycerin 1 55 formalin 1 56 vinegar 1 57 lemon juice 1 58 copper 1 59 backing soda 1 60 sand 1 61 egg shell 1 62 sea shell 1 63 bryophyllum (elcho) 1 64 male fern (rhizome) 1 65 river fish 1 66 sea salt 1 67 magnet 1 68 x ray 1 69 amoxycillin 1 70 b.c.g. vaccine 1 71 aspirin 1 72 radium 1 73 diazepam 1 74 deriphylin 1 75 gentamysin 1 76 salbutamol 1 77 crab 1 78 dye indigo 1 79 crude rock oil 1 80 sponge 1 81 bili patra 1 82 galo (giloy) 1 83 jelly fish 1 84 animal charcoal 1 7 25 sign & seal of firms list of chemicals 85 hydrochloric acid (hcl) 500 ml. 86 nitric acid (hno3) 500 ml. 87 solu. of potassium bicarbonate 500 ml. 88 concentrated h2so4 500 ml. 89 iodine solution 500 ml. 90 distil water 5 litres 91 naoh solution 500 ml. 92 potassium ferrocyanide 500 ml. 93 agno3 500 ml. 94 cuso4 powder 500 gm. 95 agno3 solution 500 ml. 96 dilute hn03 500 ml. 97 ammonium oxalate solution 500 ml. 98 dilute acetic acid 500 ml. 99 barium chloride solution 500 ml. 100 dilute hcl 500 ml. 101 ammonium chloride solution (nessler’s reagent alkaline k2hgi4) 500 ml. 102 alcohol 1000 ml 103 anhydrous cuso4 500 gm 104 calcium carbide cac2 500 gm 105 salicylic acid/ sodium salicylate 500 ml. 106 potassium hydrogen sulphate (khno3) 500 ml. 107 potassium cupric tartrate 500 gm. 108 mercuric sulphate solution 500 ml. 109 solution of lime 500 ml. 110 chcl3 chloroform 500 ml. 111 phynophathaline solution 500 ml. 112 hydrogen sulphied h2s 500 ml. 113 potassium permagnate solution 500 ml. 114 potassium mercuric iodide 500 ml. 115 k2co3 potassium carbonate 500 ml. 116 calcium hydroxide 500 ml. 117 cupric hydroxyide 500 ml. 118 borax solution 500 ml. 119 carban dissulphide 500 gm. 120 sugar of milk 5 kg. 121 cane sugar 1 kg. 122 globules(size 10, 20, 30, 40, 50, 60) 1 kg each 123 tablets 500 gm 124 oils (almond, sandalwood, olive, sesame, lavender, rosemary, chaulmoogra) 500 ml each 125 paraffin (vaseline) 500gm 126 yellow bee wax 500 gm 127 starch (semisolid) 500 gm 128 sulphur powder ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040940 supply and installation of lab furnitures 1 lab table with shelves for pharmacy dept. size: as per drawing · gate – wooden, handle with lock. · outer boarder with polish · inside – white color (oil paint) · granite stone top with molding water proof ply 19mm 01 2 lab table with shelves for anatomy dept. size: as per drawing · gate – wooden, handle with lock. · outer boarder with polish · inside – white color (oil paint) · granite stone top with molding water proof ply 19mm 01 3 lab table with shelves for biochemistry dept ...