Medical Health And Family Welfare - Rajasthan

39684195 supply of essential chemicals, reagents, test related items and other materials in various sections of government district hospital sirohi for the year 2023 24. , alkaline phosphatase erba , s bilirubin d erba , s creatnine kit erba , serum albumin erba , serum calcium erba , serum cholesterol erba , serum ldl erba , serum tg erba , serum uric acid erba , sgot erba , sgpt erba , total protein kit erba , blood sugar kit erba , blood urea kit erba , s bilurubin t erba , urine strip foranalyser ( lauradekhaphan ) erba , cpk mp erba , ck nac erba , serum phsophorus kit erba , hdl kit erba , biorad machine kitsanti d rh 1 igg / igm , biorad machine kits anti a , biorad machine kits anti b , biorad machine kits diaclon forward 4 x12 , biorad machine kits diaclon forward amd reverse group 24 x12 , biorad machine kits id coombs card , biorad machine kits liss combs +enzyme , biorad machine kits liss diluent solution 2 500 ml , biorad gel card biorad anti igg+c3d , alkaline phosphatase randox , blood sugar kitrandox , calibration solution kit 3randox , control solutions randox , s bilirubin direct randox , s creatnine kit randox , serum albuminrandox , serum amylase randox , serum calciumrandox , serum cholesterol randox , serum hdl randox , serum hdl calibration randox , serum ldh calibration randox , serum ldl randox , serum tgrandox , serum uric acid randox , sgot randox , sgpt randox , total protein kit randox , wash solution 1 randox , wash solution 2 randox , blood urea kit randox , control 1 solution randox , control 2 solution randox , s bilurubin total randox , cpk mb kit randox , cpk nac kit 3 randox , ferritin randox , lipase randox , aso randox , sodium randox , rheumatoid factor randox , lipid control1, 2, 3 randox , serum diluent water randox , sfri clair60 ml , sfri diluent 20 lit , sfri lyse 5 lit , sfri quench 1 litr , sfri control set ( n m h ) , pt inr reagent neoplastin stago cougalation analyser st art4 , pt inr stagoneoplastin control n / pstago cougalation analyser st art 4 , pt inrcuvette stago cougalation analyser st art4 , pt inr ballsstago cougalation analyser st art4 , pt inrstago cougalation analyser st art4printer rolls , tips 4.125 mlstago cougalation analyser st art4 , calcium chloride 0.025 stago cougalation analyser st art4st art4 , deficient 9 detection kit stago cougalation analyser st art 4 , deficient 8 detection kitstago cougalation analyser st art 4 , alkaline phosphatase for dia sys 200 analyser , bilirubin direct dia sys 200 analyser , ldh kit dia sys 200 analyser , adenosine de aminasekit dia sys 200 analyser , creatnine kit for dia sys 200 analyser , serum albumin for dia sys 200 analyser , serum amylase for dia sys 200 analyser , serum calcium for dia sys 200 analyser , serum cholesterol for dia sys 200 analyser , serum ldl for dia sys 200 analyser , serum tg for dia sys 200 analyser , serum uric acid for dia sys 200 analyser , sgot for dia sys 200 analyser , sgpt for dia sys 200 analyser , total protein kit for dia sys 200 analyser , blood sugar kit for dia sys 200 analyser , blood urea kit for dia sys 200 analyser , bilirubin total dia sys 200 analyser , crp fs for dia sys 200 analyser , crp quantitative dia sys 200 analysermade , pro calcitonin dia sys 200 analyser , di dimer dia sys 200 analyser , tru cal crp dia sys 200 analyser , tru cal di dimer dia sys 200 analyser , tru cal lipiddia sys 200 analyser , cpk mb dia sys 200 analyser , ck nac dia sys 200 analyser , antibact cleaner dia sys 200 analyser , alkaline cleanerdia sys 200 analyser , tru cal u dia sys 200 analyser , tru bal / lab ndia sys 200 analyser , urine analyzer strips qdx pro uro analyser dia sys 200 analysermade , pm assembly kit for dia sys 200 analyser200 machine , haloegen lamp dia sys 200 analysermachine , wash solution 1 for dia sys 200 analyser , wash solution 2 for dia sys 200 analyser , c1 solution dia sys 200 analyser , cups dia sys 200 auto analysermade , dia sys 200 auto analyser made alicat , dia sys 200 auto analyser made cups , calibration solution kit 3dia sys 200 analyser , control solution dia sys 200 analyser , serum hdl calibration dia sys 200 analyser , serum ldh calibration dia sys 200 analyser , serum procalcitonin sys 200 auto analyser , horiba abx minidil20 lit , horiba abx lysebio 1 lit , horiba abx cleaner 1 lit , horiba minoclear 500 ml , horiba control ( n m h ) , horiba cbcprinter roll , carestream c r cassette size 10x12 , carestream c r cassette size 14x 17 , carestream c r cassette size 8x10 , carestream dryview 6850 laser imager 08x10 , carestream dryview 6850 laser imager 10x12 , carestream dryview 6850 laser imager 14x17 , konica minolta dry pro sigma size 14x17 , konica minolta dry pro sigma size 10x12 , konica minolta dry pro sigma size 08x10 , konica minolta dry pro sigma c r cassette size 10x12 , konica minolta dry pro sigmac r cassette size 14x17 , konica minolta dry pro sigmac r cassette size 8x10 , manual blue base x ray films 10 x12 , manual blue base x ray films 8x10 , manual blue base x ray films12 x15 , manual blue basex ray cassette size 12x15 , manual blue basex ray cassette size 08x10 , manual blue basex ray cassette size 10x012 , lead appron , lead barrier , lead marker , lead sheet 2 mm , lead sheet 4 mm , lead sheet 6 mm , x ray fixer 22.5 lit. , barium sulphate paste / powder 500 gm , x ray film hangers ( mention rate of all sizes ) , x ray developer 22.5 liter , dental x ray fils , daily cleasning solution kit electrolyte analyser prolyte , potassium electrodeelectrolyte analyser prolytemade diamond diagnostics , fluid pack na / k / cl electrolyte analyser prolytemade diamond diagnostics , printer roll 2118delectrolyte analyser prolytemade diamond diagnostics , sodium electrodeelectrolyte analyser prolytemade diamond diagnostics , potassium electrodeelectrolyte analyser prolytemade diamond diagnostics , chloride electrodeelectrolyte analyser prolytemade diamond diagnostics , remi bbr 300 deep freeze graph , remi bbr 70old deep freeze graph , remi bbr 70second deep freeze graph , remi bbr 70 deep freeze graph , remi deep freeze graphs various types , swelab alpha plus 3 part analyser diluent 20 liter , swelab alpha plus 3 part analyser lyse 5 liter , swelab alpha plus 3 part analyser control ( h l m ) , swelab alpha plus cleaner , medonic 5 part hemo analyserdiluent 20 liter , medonic 5 part hemo analyserlyse 500 ml , medonic 5 part hemo analyserlyse 200 ml , medonic 5 part hemo analysercleaner boule , medonic 5 part hemo analyser control ( h l m ) , ft3 maglumi 800 sinbe diagnostics , ft4 maglumi 800 sinbe diagnostics , tsh maglumi 800 sinbe diagnostics , fsh maglumi 800 sinbe diagnostics , lh maglumi 800 sinbe diagnostics , prl maglumi 800 sinbe diagnostics , anti thyroidperoxidase ( a tpo ) maglumi 800 sinbe diagnostics , ferritin maglumi 800 sinbe diagnostics , folicacid ( fa ) maglumi 800 sinbe diagnostics , vitaminb12 ( vb12 ) maglumi 800 sinbe diagnostics , dehydroepiandrosteronesulphate ( dhea s ) maglumi 800 sinbe diagnostics , afp maglumi 800 sinbe diagnostics , ca125 maglumi 800 sinbe diagnostics , f psa maglumi 800 sinbe diagnostics , psa maglumi 800 sinbe diagnostics , maglumitoxoplasma igg maglumi 800 sinbe diagnostics , maglumirubellaigg maglumi 800 sinbe diagnostics , maglumicmvigg maglumi 800 sinbe diagnostics , maglumihsv 1+2igg maglumi 800 sinbe diagnostics , maglumitoxoplasma igm maglumi 800 sinbe diagnostics , maglumirubellaigm maglumi 800 sinbe diagnostics , maglumicmvigm maglumi 800 sinbe diagnostics , maglumihsv 1+2igm maglumi 800 sinbe diagnostics , insulin maglumi 800 sinbe diagnostics , crp maglumi 800 sinbe diagnostics , ddimer maglumi 800 sinbe diagnostics , il 6 maglumi 800 sinbe diagnostics , calcitonin ( ct ) maglumi 800 sinbe diagnostics , procalcitonin ( pct ) maglumi 800 sinbe diagnostics , creatinekinase mb ( ck mb ) maglumi 800 sinbe diagnostics , troponinimaglumi 800 sinbe diagnostics , ige maglumi 800 sinbe diagnostics , vitamin d maglumi 800 sinbe diagnostics , ana screen maglumi 800 sinbe diagnostics , starter kits ( 1+2 ) maglumi 800 sinbe diagnostics , washbuffer maglumi 800 sinbe diagnostics , reaction modules maglumi 800 sinbe diagnostics , lightcheck maglumi 800 sinbe diagnostics , epo test kit maglumi 800 sinbe diagnostics , ttg igg igm kit maglumi 800 sinbe diagnostics , absolute alcohol 95 % 500 ml , acetic acid 500 ml lr grade , acetoneliquid lr grade 500 ml , alpha bbr 70 deep freeze graph , anti d blood group serum , anti ablood group serum , anti abd combo blood group serum j mitra , anti abd combo blood group serum , anti abblood group sera , anti bblood group serum , anti d poly specific igg igmsera j mitra , anti d poly specific igg igmsera , anti human globin sera , aso rapid test card , band aid round , blood bag 100 ml cpda , blood bag 350 ml cpda , bovine sera , capillary tube bt ct , cd4 vials , chiken guinaigg elisa test kit , chiken guinaigm elisa test kit , chikengunia ( igm / igg ) rapidtest card , coomb s sera , cos cos speculammedium , cos cos speculam large , cos cos speculam small , cover slip , cover slip microscopic blue star 22x 5010 gm , covid 19 combination strainrapid test card , crplatex slide test kit , crp rapid test card , culture tube for blood bag , dengue combo ( igg igm ns1 ) rapid test card , diamond slide marker , disposable esr tubes , dpx for mounting , ecg gel 250 ml , ecg roll 20x 20 , ecg roll bpl 50x 20 , ecg roll various sizes , edta solution 500 ml , elisa kit igg for degue 4 gen , elisa kit igm for degue 4 gen , elisa kit ns 1 for degue 4 gen , eosin stain , eppendorf 8 channel pippete , esr stand , ethanollr grade 500 ml , filter paper for reagent circular , gel card for corss match , gel and clot activator vials , giemsa stain 1000 ml , giemsa stain 500 ml , glass jar for stain , glass slidelarge size , glass slide with marker , glucometer strip accusure , glucometer strip accusure plus , glucometer strip sd biosensor , glucometer strip siemens , hbs ag elisa kit 4 generation , hbs ag elisa kit 4 generationjmitra , hbs ag rapid test card , hbs ag rapid test cardj mitra , hcg urine pregnancy card , hcl acid for staining 500ml , hcv elisa kit 4 generation , hcv elisa kit 4 generationj mitra , hcv rapid test card , hcv rapid test card j mitra , hematoxillin stain , hemocue hb 301 aspion biosciences made , hemocue hb 301 diaspect made , hiv 1, 2elisa kit4 generation , hiv 1, 2elisa kit4 generationj mitra , hiv rapid test card , hiv rapid test card j mitra , hiv tri dot rapid test card , jsb 1 stain500 ml , jsb 2stain500 ml , k3 edta test tube with cap , lancet blood pricking with plastic holder handle , lectin h sera , leishmannian stain , lugols iodine solution , malaria pf pv rapid test card , measuring jar 50 200 500 1000 2000 mlvarious sizes , methenollr grade , micro glass slideplaza size 75x 25 x 1.35 , micropippetefor 500 500 mcl single channel , micropippete 10 100 mcl single channel , micropippete 100 1000 mclsingle channel , micropippete 20 200 mcl single channel , micropippete 30 300 mcl multichannel ( eight ) , micropippete 5 50 mcl multichannel ( eight ) , microtips up to 100 microliter , microtips up to 1000 microliter , microtips upto 200 microliter , milk bottle 60 ml for mother milk bank system , mother milk round shape graph paper , neubauer chamber , pap smear wooden cytobrush kit , pap smear kit rapid biplab , paraffin oil 500 ml , parafilm 22 n , pippete droppper plastic 3 ml size , plain test tube with cap , polypropylene tube 5 ml , ra factor slide test kit , ra rapid test card , saliva sample collection bottle , slide cover , slide staining tray , sodium citrate coated tubes 3.2 , sodium citrate coated tubes 3.8 , space coplin jar for slide , staining rack small size , sterile water jar 5 liter , storage vial 5ml , swab culture tube , termumo pen fall bbr graph paper , termumo pen fall bbr graph paper , test tube glass 12 x 75 mm , test tube glass 5 ml , test tube plastic without cap for cross match , test tube stand small size , thermacol box 40, 50, 60.liter , tissue paper roll , transfer pippete 3 ml , typhoid test rapid kit , urine glucose protein ( albumin sugar ) strip , urine keton body strip , urine sample container with screw cap , usg gel 250 ml , vaccutainer needle for blood sample collection , vdrl rapid test card , vdrl rapid test cardj mitra , vtm sample collection for covid sample , widal rapid test card , xylene sulphur free500 ml lr grade , exias electrloyte e / 1 catridge 300 test for exias gyro medisys elctrolyte analyser , exias priter rolls gyro medisys , medisky dry film gyro medisys8 x10 , medisky dry film gyro medisys10x12 , lead number ( a to z ) , lead number ( 0 9 ) ...

Rajasthan University Of Health Science - Rajasthan

39638085 supply of various chemicals reagents consumable items for department of microbiology supply of various chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , disposable test tube 20ml , antids dna elisa kit , antinuclear antibody ( ana ) elisa kit , dengue igm elisa kit , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , citrat agar , phenyl alanin agar , hiv tri dot testcard hiv 1 / 2ab , hiv ( rapid ) test card whole blood finger prick hiv 1 / 2ab 3rd generation , sims agar , hcv rapid card , test tube dispo. 5ml , test tube dispo. 10ml , salmonella typhianti toxin , polyvalent o , polyvalent h , salmonella ta , salmonella tb , salmonella td , vibrio choleraanti toxin , ogama , inaba , hikojima , thrmacol box...

Medical And Health Services - Rajasthan

39602847 tender for lab regent item supply work 1 alkaline phosphate kit billirubin test kit ( transasia ) 2 3 cholesterol test kits ( transasia ) creatinene test kit ( transasia ) 5 cover slip packets 6 hdi. cholesterol kit 7 vldl cholesterol kit ssgot test kit ( transasia ) sgpt test kit ( transasia ) 10 triglyceride kits ( transasia ) 11 tissue paper roll 12 total protien kit 13 tourniqest 14 urea test kit ( transasia ) 15 uric acid kit 16 crp test kit 17 aslo body kit 18 hbsag kit 19 vdrl strip 20 ketone strips 21 urine pregancy test strip 22 dispo. plasite tip ( blue ) 23 dispo. plasite tip ( yellow ) 24 distilled water ( 5 liter can ) 25 edta k3 vial with double cap 26 sample vial plain with double cap ( clot activector ) 27 fluride vial ( sugar vial ) with duoble cap 28 esr tube disposable 29 formaline solution 30 glass marking pencil 31 glass test tube 3 inch ( borosil ) 32 glucose test kit ( sugar solution ) 33 hb tube glass ( square ) , 37 dengu card ( combo ns 1 and igg & igm ) 38 chikengunia rapid test kit 39 n / 10 hel ( 500 ml ) 40 sodium citrate solution 500 ml 41 spirit 5 lit. 42 uristix albumine and sugar 43 uristix in ten parameter 44 widal test 45 xylene solution 500 mi 46 glass slide paket 47 test tube washing brush 48 blood group reagant ( anti a antisera ) 49 blood group reagant ( anti b antisera ) 50 blood group reagant ( anti d antisera ) 51 priking needle 52 ra factor kit 53 hemocue hb strip 54 cbc print roll 55 urine container labelld 56 anti human globulile 5 ml ( j mitra ) , etc....

Government Medical College - Rajasthan

39396928 rate contract for chemicals, test kits, reagents, media and glassware for microbiology department , antibiotic sensitivity disc , amikacin ( 30?g ) , aztreonam ( 30?g ) , ampicillin ( 10 ?g ) , ampicillin + sulbactam ( 10 / 10?g ) , azithromycin ( 15?g ) , amoxicillin + clavulanic acid ( 20 / 10?g ) , bacitracin ( 10 ?nit ) , colistin ( 10mcg ) , cefoperazone ( 75?g ) , ceftazedime ( 30?g ) , cefepime ( 30?g ) , cefepime + tazobactan ( 30?g ) , cefadroxyl ( 30?g ) , carbenicillin ( 100?g ) , ciprofloxacin ( 10?g ) , co trimoxazole ( 25?g ) , cefoperazone + sµlbactam ( 75?g ) , cefotaxime / clavµlanic acid ( 30 / 10?g ) , ceftazidime / tazobactum ( 30 / 10?g ) , cephalothin ( 30?g ) , cefµroxime ( 30?g ) , cefotaxime ( 30?g ) , ceftriaxone ( 30?g ) , chloramphenicol ( 30?g ) , clindamycin ( 2?g ) , cefaclor ( 30?g ) , cefotetan ( 30?g ) , cefpodoxime ( 10?g ) , ceftizoxime ( 30?g ) , cefixime ( 5?g ) , cefoxitin ( 30?g ) , cefalexin ( 30?g ) , cefazolin ( 30?g ) , cefprozil ( 30?g ) , cefixime / clavµlanic acid ( 5 / 10?g ) , ceftrixone / sµlbactam ( 30 / 15?g ) , ceftriazone / tazobactam ( 30?g ) , doxycyline ( 10?g ) , dicloxacilline ( 1?g ) , erythromycin ( 15?g ) , fµrazolidone ( 50?g ) , feropenem 5?g , fosfomycin ( 50?g ) , gentamicin ( 10?g ) , high level gentamicin ( 120?g ) , gemifloxacin ( 5?g ) , imipenam ( 10?g ) , imipenam + cilastin ( 10 / 10?g ) , levofloxacin ( 5?g ) , lincomycin ( 15?g ) , linezolid ( 30?g ) , meropenam ( 10?g ) , mezlocilin ( 75?g ) , moxifloxacin ( 5?g ) , netilmicin ( 30?g ) , norfloxacin ( 10?g ) , nalidixic acid ( 30?g ) , nitrofurantoin ( 200?g ) , novobiocin ( 5?g ) , oxytetracyclin ( 30?g ) , oxacillin ( 5?g ) , ofloxacin ( 2?g ) , onpg , optochin ( 5?g ) , polymyxin b ( 10 ?nit ) , polymyxin b ( 300 ?nit ) , prµlifloxacin ( 5?g ) , piperacillin ( 100?g ) , piperacillin +tazobactam ( 100 / 10?g ) , pristinomycin ( 15?g ) , rifampicin ( 5?g ) , roxithromycin ( 30?g ) , sisomicin ( 10?g ) , ticarcillin ( 75?g ) , ticarcillin + clavµlanic acid ( 75 / 10?g ) , tetracycline ( 30?g ) , tecoplanin ( 30?g ) , tigecycline , tobramycin ( 10?g ) , vancomycin ( 30?g ) , anti fungal , ketoconazole , itraconazole , amphotericin b , nystatin , clotrimazole , miconazole , sugar , adonitol , arabinose , cellobiose , dextrose , dulcitol , fructose , galactose , inositol , inulin , lactose , maltose , mannitol , mannose , melibiose , raffinose , rhamnose , salicin , sorbitol , sucrose , trehalose , xylose , culture media , alkaline peptone water , agar powder bacteriological , air sampler agar strip ( a ) tsa agar for total count sd ( b ) sabourund dextrose agar sb , andrade peptone water , anaerobic indicator tablet , arginine dihydrolase broth , bacttec myco / f lytic , bacttec peds plus / f , bacttec plus aerobic / f+ , bacttec plus+ anaerobic , bacttec standard 10 aerobic / f , bacttec lytic / 10 aanerobic / f , bbl mgit tubes , beef extract agar , beef extract broth , bile esculin agar , bile salt agar , bird seed agar diphenyl supplement , blood agar base , brain heart infusion broth , cary blair medium , cetrimide agar , cled media , congo red agar , cooked meat medium r.c.medium , corn meal agar , decarboxylase base without amino acids , deoxycholate citrate agar , dermatophyte base without amino acid , emb agar levine , glucose broth , glucose phosphate broth , uti agar , hichrome improved salmonella agar , salmonella shigella agar , candida differental agar , lactose monohydrate bacteriological grade , loeffler serum medium base , lowenstein – jensen media base , lysine decarboxylase broth , lysine iron agar , mac conkey agar , muellar hinton agar , mannitol salt agar , mueller hinton agar , nnn medium , nutrient agar , nutrient broth , of basal medium , omthine decarboxylase broth , peptone bacteriological , peptone water , phenolphthalein phosphate agar , phenyl alanine agar , potassium tellurite agar , potato dextrose agar , rpmi 1640 agar w / mops & 2% glucose w / o sodium carbonet ( twin pack ) , sabouraud chloramphemcol agar , sabouraud dextrose agar , sda with cycloheximide chloramphenicol , selenite f broth twin pack ( medium 11 ) , simmons citrate agar , sulphide lndole motility ( sim ) medium , stuart transport medium , tcbs agar , tetra thionate broth , throglycollate medium fluid , throglycollate agar , trichophyton agar 1 , triple sugar iron agar , trypticase soy broth , tyi s 33 medium ( trypaticase yeast ) , urea agar base christensen , uti chrome agar , wilson & blair’s bbs agar medium 9 , xld agar , yeast carbon base agar , yeast nitrogen base agar , vitek 2 , gn test kit vtk2 , gp test kit vtk2 , yst test kit vtk2 , nh test kit , anc test kit , ast st03 test kit , ast p628 test kit , ast ys08 test kit , ast n235 urine card , kit densichek plus standards , ast n405 , ast n406 , ast n407 ( critical care card ) , unsensitized tubes 1x2000 , suspension solution 3x500 ml , antiseras , shigella dysenteriae polyvalent , vibrio cholera 01 antiserum polyvalent , subtype b ( ogawa ) , c ( inaba ) , 0:139 , salmonella o antiserum polyvalent ( a z & vi ) , o factor antiserum 0:2 ( a ) , 0:4 ( b ) , 0:7 ( c1 ) , 0:9 ( d ) , 0:13 ( g ) , vi , h factor antiserum h:a, h:b, h:i, h:g, h:m, h:z , polyvalent o antiserum for enterotoxigenic strains of e.coli , chemicals , absolute alcohol / ethanol , absolute alcohol / ethanol , acetamide , acetic acid glacial , acetone , acridine orange , aerogas pack , agarose , albert stain kit , ammomum oxalate ar , ammonia , andrade indicator , aniline , b. sterothermophilus spore strips , basic fuchsin , benzamide , buffer tablets 7.0 ph , buffer tablets 9.2 ph , calcofluor white m2r , carbamide , carbol fuchsin , catalase peroxidase test kit for mycobacterium , catalase test kit for mycobacterium , catechol , cedar wood oil , charcoal powder , chlorazole black e , chromotrope zr , conc. hydrochloric acid about 37% , conc. sulfuric acid about 98% , copper ii chlonde dihydrate , crystal violet , ctab , cycloheximide ( actidione ) , cynogen bromide , disinfectant solution surface cleaning , di sodium hydrogen phosphate anhydrous , distilled water , dntps ( datp, dgtp, dctp, dttp ) , dpx mount , edta mb grade , edta ar , eosin 2% , ethyl acetate ar , fast green , ferric chloride ar , field stain a , field stain b , formaldehyde solution min 37% , formalin tablets , formamide , gelatin , giemsa stain , glassware cleaning solution , glycerol ar , hand sanitizer , hydrogen peroxide 30% , iodine crystals ar , iso amyl alcohol , iso propanol , iso amyl alcohol , koh , kovac indole reagent , lactophenol cotton blue , leishman stain , light green sf , liquid paraffin heavy , liquid paraffin light , loeffler methylene blue , lugol iodine , lysol 5% , malachite green 1% w / v , mangnese sulphate ar , merecurous chloride ( mgcl2 ) , methyl alcohol , methyl red indicator , methylated spirit , methylene blue pure , n n dimethyl formamide , neutral red , niacin detection kit w / syringe , nigrosine , nitrate reduction test kit for mycobacterium , normal saline , nuclease eliminator for rnase / dnase , nuclease free water , nuclease free water , omeara reagent , p. nitrobenzonic acid , paraffin wax , ph paper 1 14 , phenol crystals ar , phenol red certified , phosphotungestic acid , polyvinyl alcohol a cold water soluble b hot water soluble , potassium acetate , potassium di sodium hydrogen phosphate anhydrous , potassium dichromate ar , potassium iodide ar , potassium nitrate , potassium permangnate ar , proteinase k , pyrazinamidase test kit for mycobacterium , pyrazinamide , rnase a , saffranine crystals , schaeffer & fulton’s spore stain kit , schaeffer fuchsin sulph reagent , sds , silverised h2 o2 ( h2, o2 11% w / v with silver nitrate sol.0.01% w / v compatible for fumigation with aerosol generator fogging machine , sodium acetate , sodium acetate anhydrous mb grade , sodium chloride mb grade , sodium chloride ar , sodium dihydrogen phosphate anhydrous , sodium hydroxide ar , sodium hypochlorite 4% , sodium hypochlorite 10% , sodium polyanetholesulphonate ( sps ) , sodium taurocholate , sulphanilic acid ar , sulphuric acid , taq polymerase , teepol , tetramethyl p phenylene diamine dihydrochloride ( oxidase reagent ) , thiomersal , thiophene carboxylic hydrazide test kit for mycobacterium , toluidine blue , tri potassium phenophthlin di sulphate , tris base , tris cl buffer , twine 80 , twine 20 , urea powder ar , xylene ar , zinc dust , zinc sulphate heptahydrate , ? nephthol ar , ? nephthylamine ar , plastic & consumables , aluminium foil , aspirator bottle with stopcock , aspirator bottle with stopcock , autoclavable bags non printed , autoclavable bags non printed , autoclavable bags non printed , beaker , beaker , beaker , beaker , beaker , bmw disposal bags red , bmw disposal bags red , bmw disposal bags yellow , bmw disposal bags yellow , bmw container , biohazardous waste container , blotting sheet , cellophane tap 33 x 22 mm , centrifuge tubes , centrifuge tubes , cooler box 12 places 1.5 / 2 ml , cooler box 32 places 1.5 / 2 ml , cooler rack ( pcr plate ) , cotton role , cryo storage boxes , cryo storage boxes , cryo tape ( label ) , cryo tubes ( vials ) , daimond pencil for glass slide , deep well plate 96 , deep well plate gf 96 well , deep well tube strip 8 well , deep well tube strip of 8 cap , disinfectant solution , disposable gloves 7.5 , elisa plate 96 wells , elisa plate 96 wells , falcon tubes 50 ml , filter paper sheets , filter papers wattmen no 1 , glass marking pencil ( white , blue, red ) , gloves acid resistant , gloves acid resistant , gloves acid resistant , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , ice buckets , kling film , lab slippers , lab wash , laboratory apron / coat , laboratory fresh deodorising pearls , laboratory head cap , laboratory shoes cover , liquid hand wash soap , mask , mask n95 , match box , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tube stand , micro centrifuge tubes 0.5 ml , micro centrifuge tubes 1.5 ml , micro centrifuge tubes 2 ml , micro pipettes , micro pipettes , micro pipettes , micro pipettes , micropipette filter tips reload , micropipette filter tips reload , micropipette filter tips reload , micropipette tips , micropipette tips , micropipette tips , micropipette tips , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips dual filter boxes , micropipette tips low retention , micropipette tips low retention , micropipette tips low retention , multi channel pipette 100 to 1000 ul , multi channel pipette 10 to 100 ul , multi channel pipette 0.5 to 10 ul , nichrome loop wire d 4 ( hendal with 10 loop ) , nichrome straight wire ( hendal with 10 wire ) , nitrile powder free gloves , nitrile powder free gloves , nitrile powder free gloves , oak ridge centrifuge tubes , oak ridge centrifuge tubes , parafilm , pcr cap ( 1x8 ) , pcr plate 96 well non skirted , pcr plate 96 well non skirted , pcr plate 96 well semi skirted , pcr plate 96 well semi skirted , pcr plate seal ( microseal b ) , pcr rack with cover , pcr tube strip 0.1 ml ( 1x8 ) , pcr tube strip 0.2 ml ( 1x8 ) , permanent marker pen , pipette 0.1 to 2.5 ul , pipette 0.5 to 10 ul , pipette 10 to 100 ul , pipette 100 to 1000 ul , pipette 2 to 20 ul , pipette 20 to 200 ul , pipette pump , plastic dropper , ppe kit ( with goggle, faceshield, shoecover and hood ) , reagent droping bottles , reagent pipettes bulb , reversible rack with cover , rnase / dnase free multichannel reagent reservoirs, disposable , rubber teats , sample tray 96 holes , screw cap tube , self adhesive autoclave tapes , self adhesive dry heat la 412 , slide staining stand , soap ( 125 gm per piece ) , spatula spoon 12 , spatula spoon 6 , specimen container , specimen container , stainless steel forceps pointed , stainless steel forcepsblunt 8 inch , sterile container , sterile disposable petri plates 120 mm. , sterile disposable petri plates 150 mm. , sterile disposable petri plates 90 mm. , sterile disposable swab stick with container , sterile scalpal blade , string sleeves ( tip combs ) gf , surf ( washing powder ) , teasing needles , test tube holder , test tube rack ( 12 holes ) for medium sized tubes , tharmocol box medium size 18x18x18 , thumbpress dropper , tissue lint free , tissue roll , uncoated micro titre plates ( 96 wells ) , utility tray , utility tray , utility tray , utility tray , vacutainer plain vial 4 ml , vtm with sterile swab stick , vtm storage rack 50 hole , wash bottle , wash bottle , waste bags black , waste bags black , waste container blue colour , waste container whitecolour , zip lock ( 4x6 inch ) , zip lock ( 10x14 inch ) , glassware , beaker with spout , beaker with spout , beaker with spout , beaker with spout , beaker with spout , borosilicate glass rods , candle jar , conical flask , conical flask , conical flask , conical flask , durham tube , funnels , funnels , glass rods 10 mm x 60 cm , glass test tube ( 12mmx75mmx1.0mm ) , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , graduated cylinders , mac cartney bottle 100 ml , micro cover slip , micro glass slide , oil bottle with glass rods , petridish 90mm diameter , petridish 75mm diameter , petridish 150mm diameter , reagent bottle with dropper rubber teats , reagent bottle with dropper rubber teats , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( amber colour ) , reagent bottles ( clear ) , reagent bottles ( clear ) , reagent bottles ( clear ) , reagent bottles ( clear ) , testube without rim , testube without rim , thermometer mercury 20° to 50° , thermometer mercury 0° to 4° , thermometer mercury 30° to 250° , widal test tube round bottom , widal test tube conical bottom , serology & elisa , crp – latex kit ( latex agglutination method ) , ra – factor kit ( latex agglutination method ) , widal test tube method , widal test slide method , aslo titrekit ( latex agglutination method ) , hbs ag card test , rpr test for syphilis , hcv kit ( rapid test ) , hiv tri dot test , hiv rapid test , hiv comb test , vdrl rapid test ( dip stic ) , torch panel rapid test , elisa kit toxoplasma igg , elisa kit toxoplasma igm , elisa kit rubella igg , elisa kit rubella igm , elisa kit cytomegalovirus igm , elisa kit cytomegalovirus igg , elisa herpes simplex igg , elisa herpes simplex igm , elisa kit brucella igg , elisa kit brucella igm , elisa kit ttg igm , elisa dengue kit igg , elisa dengue kit igm , elisa dengue kit ns 1 , elisa kit chikungunya igm , elisa kit scrub typhus igm , elisa kithav igm , elisa kithev igm , elisa kithbsag , elisa kitrota virus antigen , tpha ( syphilis ) , elisa anti ccp , elisa antichlamydia , elisa hiv , japanese encephalitisigm , ana elisa , anti ds dna igg elisa , ebstein barr virus ( ebv ) igm elisa , hbc igm elisa , hbcab elisa , hbeab elisa , hbeagelisa , hcvigm elisa , measles igg elisa , measles igm elisa , leptospirosis igm elisa , leptospirosis igg elisa , chlamydia trachomatis igg elisa , chlamydia trachomatis igm elisa , hpv elisa igg , sars cov 2 antibody elisa , fungal marker galactomannan elisa , fungal marker 1 3 beta d glucan elisa , anti echinococcus igg elisa , anitbody detection cd4 cd3 facs count , serum pct , molecular , flu panel with rsv detection kit , neuro panel kit , uti id panel , respiratory pathogen panel kit [ 33 different pathogens ] , gastrointestinal panel , transplant panel kit , hiv viral load , hpv hr with 16 / 18 genotyping kit , dengue virus serotyping , cmv qt kit , rifampicin & isoniazid drug resistant mtb detection kit , mtbc one step nested kit ( mtbc and ntm ) , torch panel kit , viral rna extraction kit complete , viral rna extraction kit , dna extraction kit , covid seq assay 3 boxes , miseq reagent kit v3 ( 150 cycle ) 2 boxes , idt for illumina pcr indexes set 1 4 , illumina covidseq v4 primer pools , covidseq positive control ( cpc ) , miseq reagent micro kit v2 ( 300 cycles ) , miseq reagent kit v3 ( 600 cycle ) , miseq reagent kit v2 ( 500 cycles ) , miseq reagent kit v2 ( 300 cycles ) , miseq reagent nano kit v2 ( 300 cycles ) , idt ilmn pcr index set 1 ( 96 idx ) , idt ilmn pcr index set 2 ( 96 idx ) , idt ilmn pcr index set 3 ( 96 idx ) , idt ilmn pcr index set 4 ( 96 idx ) , viral surveillance panel, ruo 96 rxns , pan coronavirus panel, ruo 96 rxns , flex lysis reagent kit , s2 standard cartridge , s1 high resolution cartridge , s2 standard cartridge quantitive kit , s1 high resolution cartridge quantitive kit , quantifluor® dsdna system...

Government Medical College - Rajasthan

39383576 rate contract for chemicals, test kits, reagents, media and glassware for anatomy department , absolute alcohol / ethanol absolute ar , ( mono ) ethylene glycol 10% , acetonometer , acetic acid glacial ar , acetone ar , adhesive tape / micropore , albumin egg flakes , alcoholmeter , aluminium potassium sulphate ( alum ) , ammonium nitrate 10% , anti microbial hand rub , anti microbial hand rub , basic fuchsin m.s / certified , bees wax ( yellow ) for histology , boric acid ar , camphor , charcoal activated ar , cotton bed sheet white ( single bed ) , cotton roll ( big ) , cover slip 22 mm , d.p.x. mountant , diamond pencil export quality , disposable surgical gloves latex rubber 7.0 , disposable surgical gloves latex rubber 7.5 , distil water , eosin water soluble , filter papers ( whatman ) no 1 , formaldehyde ( 37 41 % w / v ) ar , funnel ( big ) , funnel ( medium ) , glass marking pencil red , glycerol ar , hand wash soap , hematoxyline powder ms / certified , histopathology slide sticker , hydrochloric acid ( concentrated ) , hydrogen peroxide ( 6% ) , isopropyl alcohol ar , laboratory detergent labogent , liquid paraffin oil heavy , lithium carbonate ar , low profile microtome disposable blade ( 50 blade each pkt. ) , mercuric oxide red purified , methyline blue ms / certified , micro glass slides, polished edges, lint free ( transparent ) size 75x25x1.0 mm , museum jars ( acrylic, clear transparent with inner plate & molded lid ) size 15x10x20cm , museum jars ( acrylic, clear transparent with inner plate & molded lid ) size 15x12x20cm , museum jars ( thick glass , clear transparenet , round diameter approx 20cmx20 cm approx , museum jars ( thick glass , clear transparenet , round diameter approx 20cmx35 cm approx , nitric acid ar , paraffin wax with cerasin, in block form ( 60o 62o ) , periodic acid m.s / certified , phenyle , phloxin bm.s / certified , plastic bucket 50 lit with lid , polythene bagsyellow, blue, black for bmw , potassium meta bisulphite ar , potassium permangnate purified , rim / zerox paper ( legal 215mmx345mm ) , silver nitrate ep , slide box ( plastic ) 100 slides capacity product size slide capacity100 color white height ( english ) 1.25 in.height ( metric ) 2.8cmlength ( english ) 8.25 in.length ( metric ) 21cmmaterialabs plasticwidth ( english ) 6.275 in.width ( metric ) 16cmitem description100 slide box;dimensions ( l x w x h ) 8.25 x 6.275 x 1.25 in. ( 21 x 16 x 2.8cm ) , slide box ( plastic ) 50 slides capacity .product size slide capacity50colorwhiteheight ( english ) 1.25 in.height ( metric ) 2.8cmlength ( english ) 8.25 in.length ( metric ) 21cmmaterialabs plasticwidth ( english ) 2.275 in.width ( metric ) 8.2cmitem description50 slide box;dimensions ( l x w x h ) 8.25 x 2.275 x 1.25 in. ( 21 x 8.2 x 2.8cm ) , sodium chloride ep , sodium hypochlorite , sodium hypochlorite solution 4% , spirit , stop watch , sulphuric acid pure , washing powder , xylene ar , turpentine...

Indian Bureau Of Mines - Rajasthan

39009801 bids are invited for chemical araldite , hardner , aceton , carbon tetrachloride , diiodomethane , tetra bromo ethane , magnesium oxide , canada balsam , high vacuum silicon grease , carborundum powder , hifin diamond compound , microcover glases , blue star microslides , xylene , tissuepaper total quantity : 155...

National Institute Of Ayurveda - Rajasthan

38861864 rate contract for supply of chemicals , 1 butanol ( n butyl alcohol ) , grade lr ( merck / rankem / himedia / sigma ) 500 ml , 1 naphthol, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 100 gm , 1 naphthol, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , 2, 2 diphenyl 1 picrylhydrazyl, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , 7, 12 dimethylbenz [ a ] anthracene, grade merck, ( cdh, himedia, avantor, merck, research lab ) 100 gm , abd ( blood group antisera ) , pkt , acacia gum, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , acetic acid glacial, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , acetic acid glacial, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr. , acetic acid glacial, grade lr ( merck / rankem / himedia / sigma ) 500 ml , acetone, grade ar, ( cdh, himedia, rankem, merck, research lab ) 2.5 ltr , acetone, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr. , acetone, grade lr ( merck / rankem / himedia / sigma ) 500 ml , acetonitril, grade lr ( merck / rankem / himedia / sigma ) 500 ml , acetonitrile, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr. , acetophenone, grade lr ( merck / rankem / himedia / sigma ) 500 g , acetylcholine chloride, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , acid fuchsin, grade ar, ( cdh, himedia, avantor, merck, research lab ) 25 gm , afb staining kit ( himedia / rankem / qualigens / biolab / tulip / merck ) , 01 kit , aflatoxin b1 tablet, grade std. ( sigma, rankem, himedia, qualigens ) 1 mg , aflatoxin b2 tablet, grade std. ( rankem, sigma, himedia, qualigens ) 1 mg , aflatoxin g1 tablet, grade std. ( rankem, sigma, himedia, qualigens ) 1 mg , aflatoxin g2 tablet, grade std. ( rankem, sigma, himedia, qualigens ) 1 mg , agarose, grade ar, ( cdh, himedia, avantor, merck, research lab ) 25 gm , aliquot / eppendorf tube 1.5 ml, 1 pack of 200 aliquot ( tarsons / corning / bd / merck ) , allantoin, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , almond oil , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500 gm , aluminium chloride, grade ar, ( cdh, himedia, avantor, merck, research lab ) ) 500 gm , aluminium hydroxide gel, grade lr, ( cdh, himedia, avantor, merck, research lab ) 250 gm , amberlite ira 400 exchange resin, grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , amfm buffer ph 3, grade lr ( cdh, himedia, avantor, merck, research lab ) , 500ml , amikacin ( himedia / sigma / biomerieux / bd ) , 1 vial , ammonia buffer solution 9.5 ph, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ammonia solution 25%, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500ml , ammonia, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ammonium acetate, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium carbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium chloride, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , ammonium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium dihydrogen orthophosphate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , ammonium ferricsulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium meta vendate, grade lr ( merck / rankem / himedia / sigma ) 200 g , ammonium molybdate, grade lr ( merck / rankem / himedia / sigma ) 200 g , ammonium nitrate, grade lr ( merck / rankem / himedia / sigma ) 200 g , ammonium oxalate, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , ammonium oxalate, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium sulphate lr ( himedia, merck, rankem, sigma, qualigens ) , 500 gm , ammonium sulphate, grade ar, ( rankem, himedia, avantor, merck ) 500 gm , ammonium sulphide, grade lr ( merck / rankem / himedia / sigma ) 500 g , ammonium thiocyanate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , ammonium thiocynate, grade lr ( merck / rankem / himedia / sigma ) 500 g , amoxyclav acid ( himedia / sigma / biomerieux / bd ) , 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) , 1 vial , ampicillin / sulbactam ( himedia / sigma / biomerieux / bd ) , 1 vial , aniline, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , aniline, grade lr ( merck / rankem / himedia / sigma ) 25 g , anisaldehyde, grade lr ( merck / rankem / himedia / sigma ) 250 ml , anthrone, grade lr ( merck / rankem / himedia / sigma ) 25 g , apricot oil , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , karl fischer reagent, grade lr, ( himedia, rankem, merck, research lab ) 500 ml , argan oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 500 ml , arsenic oxide, grade lr ( merck / rankem / himedia / sigma ) 500 g , arsenic solution, grade std. ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 ml , ascorbic acid, grade ar ( merck / rankem / himedia / sigma ) 100 g , ascorbic acid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , autoclavable begs, size ( tarsons / bd / himedia / vwr ) 100 nos , avocado butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , avocado oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , azithromycin ( himedia / sigma / biomerieux / bd ) , 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) , 1 vial , bacillocid extra, ( raman / deepak / himedia ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) , 1 vial , barfoed reagent, grade lr ( galaxy / igl / godrej / makingcosmetics / rchem ) 250 ml , barium chloride 10% solution ( himedia, merck, rankem, sigma, qualigens ) , 500 ml , barium chloride dihydrate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , barium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , barium nitrate, grade ar, ( ( cdh, himedia, avantor, merck, research lab ) 500 gm , barium sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , bees wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , benedict reagent, grade lr ( merck / rankem / himedia / sigma ) 250 ml , bentonite, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , benzalkonium chloride, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , benzalkonium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 ml , benzene, grade ar, ( cdh, himedia, avantor, merck, research lab ) 2.5 ltr , benzene, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , benzene, grade lr ( merck / rankem / himedia / sigma ) 500 ml , benzidine powder ( himedia / rl / merck / sigma / rl ) ( 100gm ) , bottle , benzoic acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , benzoic acid, grade lr ( merck / rankem / himedia / sigma ) 500 g , benzophenone 3, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , benzophenone 4, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , benzyl alcohol, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , benzyl alcohol dha, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , bht, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , bile esculin agar ( himedia / sigma / biomerieux / bd ) , 500 gm , bile salt ( smith’s reagent ) ( merck / rankem / himedia / sigma / rl ) ( 500 gms each ) , bismuth nitrate, grade lr ( merck / rankem / himedia / sigma / rl ) 100 g , black cumin oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , bleaching powder, grade lr ( merck / rankem / himedia / sigma ) 500 g , blue tetrazolium, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 1 gm , borax , grade lr ( merck / rankem / himedia / sigma ) 500 g , borax, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , boric acid , grade lr ( merck / rankem / himedia / sigma ) 500 g , boric acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) ) 500 gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) , 500 gm , bromine , grade lr ( merck / rankem / himedia / sigma ) 500 ml , bromine water, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 ml , bromophenol blue , grade lr ( merck / rankem / himedia / sigma ) 50 g , buffer solution ( 1000 ml each ) , bottle , buffer tablet ph 4.0 , grade lr ( merck / rankem / himedia / sigma ) 10 tab. , buffer solution ph 4.0, grade std. ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , buffer tablet ph 7.0 , grade lr ( merck / rankem / himedia / sigma ) 10 tab. , buffer solution ph 7.0, grade std. ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , buffer tablets 6.8 ph, grade ar, ( cdh, himedia, avantor, merck, research lab ) 20 tab. , buffer tablets 9.2 ph, grade ar, ( cdh, himedia, avantor, merck, research lab ) 20 tab. , butyl alcohol , grade lr ( merck / rankem / himedia / sigma ) 500 ml , butylated hydroxytoluene, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , cadmium chloride, grade ar, ( cdh, himedia, avantor, merck, research lab ) 100 gm , caffeine, grade ar, ( cdh, himedia, avantor, merck, research lab ) ) 100 gm , calcium bi carbonate, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , calcium carbonate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , calcium carbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , calcium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , calcium hydroxide, grade lr ( merck / rankem / himedia / sigma ) 500 g , calcium oxalate, grade lr ( merck / rankem / himedia / sigma ) 500 g , calcium oxide, grade lr ( merck / rankem / himedia / sigma ) 500 g , camelina oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , camphor 95%, grade std. ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 gm , camphor, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , canada balsam ( synthetic ) , grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 ml , candelilla wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , caramel colorant, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , carbol fuschin strong ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , carbon tetrachloride99.5%, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 ml , carbon tetrachloride, grade lr ( merck / rankem / himedia / sigma ) 500 ml , carbopol 940, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , carboxy methyl cellulose, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , carboxy methyl cellulose, grade lr ( merck / rankem / himedia / sigma ) 500 g , carnauba wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , castor oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , cedar wood oil / oil immersion ( himedia, avantor, merck, rl, rchem ) ( 30 ml ) , bottle , cefazolin ( himedia / sigma / biomerieux / bd ) , 1 vial , cefipime ( himedia / sigma / biomerieux / bd ) , 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) , 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) , 1 vial , cefoxitin ( himedia / sigma / biomerieux / bd ) , 1 vial , cefpodoxime ( himedia / sigma / biomerieux / bd ) , 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) , 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) , 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) , 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) , 1 vial , ceteareth group, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , cetostearyl alcohol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , cetrimide, molecular formula: ( c17h38brn ) , purity 99 %, grade – preservative / laboratory grade, physical appearance – powder, packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , cetrimonium chloride, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , cetyl alcohol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , cetyl palmitate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , cetyl phosphate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , charcoal ( activated ) , grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , charcoal activated, grade lr ( merck / rankem / himedia / sigma ) 500 g , charcoal powder, usp, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , chloral hydrate, grade ar ( reidel, rankem, sigma, himedia, qualigens ) 500 gm , chloral hydrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , chloroform, grade ar / gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500ml , chloroform, grade ar / gr ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , chloroform, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 500 ml , chloroform, grade lr ( merck / rankem / himedia / sigma ) 500 ml , christensen urea agar base ( himedia / sigma / biomerieux / bd ) , 500 gm , chromazurol s, grade lr ( merck / rankem / himedia / sigma ) 20 g , chromium oxide ( chromic acid ) , grade lr ( merck / rankem / himedia / sigma ) 500 g , chromotropic acid, grade lr ( merck / rankem / himedia / sigma / rl ) 50 g , ciprofloxcin ( himedia / sigma / biomerieux / bd ) , 1 vial , citric acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , citric acid, grade lr ( merck / rankem / himedia / sigma ) 500 g , cled agar ( bromothymol blue ) ( himedia / sigma / biomerieux / bd ) , 500 gm , clindamycin ( himedia / sigma / biomerieux / bd ) , 1 vial , cobalt chloride, grade lr ( merck / rankem / himedia / sigma ) 100 g , coco amido propyl betaine ( capb ) , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 l , coco betaine, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 10 l , coco di ethanol amide ( cdea ) , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 l , coco mono ethanol amide ( cmea ) , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 l , cocoa butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , coconut oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 l , colistin ( himedia / sigma / biomerieux / bd ) , 1 vial , copper acetate, grade lr ( merck / rankem / himedia / sigma ) 500 g , copper sulfate, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , co trimoxazole ( himedia / sigma / biomerieux / bd ) , 1 vial , cotton absorbent roll, 1 roll ( himedia / vinayak / vwr ) ( 500 gm ) , crisol red, grade lr ( merck / rankem / himedia / sigma ) 500 ml , cupric acetate, grade lr ( merck / rankem / himedia / sigma ) 500 g , cupric carbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , cupric sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , cyclohexane, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , cyclohexane, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , cyclohexane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , cyclomethicone, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , d ( ) fructose, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 gm , d.p.x. mountant, grade lr, ( ( cdh, himedia, avantor, merck, research lab ) 250 ml , dextrose ( anhydrous ) , ( himedia / rankem / bd ) 500 gm , dextrose, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , di ethyl ether, grade lr ( merck / rankem / himedia / sigma ) 2.5 liter , di ammonium hydrogen phosphate, grade ar, ( ( cdh, himedia, avantor, merck, research lab ) 500 ml , diatomite, grade lr ( merck / rankem / himedia / sigma ) 500 g , dichloromethane, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , dicholoro methane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , diethyl ether, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , dimethicone, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , dimethyl sulfoxide, grade lr ( merck / rankem / himedia / sigma ) 500 ml , dimethyl yellow indicator, grade lr ( merck / rankem / himedia / sigma ) 50 g , dinitro phenyl hydrazine, grade lr ( merck / rankem / himedia / sigma ) 500 g , diphenyl picryl hydrazil, grade lr ( merck / rankem / himedia / sigma ) 1 g , disodium hydrogen orthophosphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , distilled water ( 1000 ml each ) , bottle , distilled water for microbiology, ( merck / himedia / rchem / vwr ) 5 litr , dopamine, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , doripenem ( himedia / sigma / biomerieux / bd ) , 1 vial , doxycline ( himedia / sigma / biomerieux / bd ) , 1 vial , dpx mount, grade ar ( himedia / sigma / biomerieux / bd ) , 250 ml , dragandorff reagent, grade lr ( merck / rankem / himedia / sigma ) 500 ml , e.d.t.a., grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , ecg gel , edta, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , edta, grade lr ( merck / rankem / himedia / sigma ) 500 g , egg albumin flakes, ( himedia / sigma / rankem / bd ) 500 gm , egg albumin powder ( 500 gms each ) , ehrlich reagent ( nice chemical / labchem / ) , 125 ml , emulsifying wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , eosin solution ( dye ) , molecular formula:c20h6br4na2o5 preservative / laboratory grade, packing size 125 ml ( merck, rankem, sigma, himedia, qualigens / rl ) , eosin yellowish, grade indicator, ( cdh, himedia, avantor, merck, research lab ) 100 gm , eosin, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 125 ml , eosin, grade lr ( merck / rankem / himedia / sigma ) 50 g , erichrome black t metal indicator powder, grade ar, ( cdh, himedia, avantor, merck, research lab ) 25 gm , eriochrome black t indicator, grade lr ( merck / rankem / himedia / sigma ) 100 g , ertapenem ( himedia / sigma / biomerieux / bd ) , 1 vial , erythromycin ( himedia / sigma / biomerieux / bd ) , 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , ethanol, grade lr ( merck / rankem / himedia / sigma / reserch lab ) 500 ml , ethyl acetate, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , ethyl acetate, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , ethyl acetate, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ethyl salicylate, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ethylene glycol monostearate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , ethylene glycol, grade ar, ( ( cdh, himedia, avantor, merck, research lab ) 500 gm , eucalyptus oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , ez cleanser, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 ml , fast green, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 25 gm , fehlings solution a, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , fehlings solution b, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , ferric ammonium sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ferric chloride anhydrous emplura, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , ferric chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , ferrous ammonium sulphate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , ferrous sulphate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , ferrous sulphate, grade lr ( merck / rankem / himedia / sigma ) 500g , filter paper 125mm ( no. 1 ) ( himedia, merck, rankem, sigma, qualigens ) , 1 pc ( 100 circle ) , flax seed oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , fochets reagent ( himedia, merck, rankem, sigma, qualigens ) , 500 ml , folinciocalteaureagenr, grade lr ( merck / rankem / himedia / sigma ) 500 ml , folin ciocalteus phenol reagent, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 ml , forceps ( himedia / sigma / biomerieux / bd ) , 1 pc , formaldehyde solution, 37 41% w / v, grade ar, ( cdh, himedia, avantor, merck, research lab ) 2.5 ltr , formaldehyde, grade lr ( merck / rankem / himedia / sigma ) 500 ml , formic acid 100%, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , formic acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , fosfomycin ( himedia / sigma / biomerieux / bd ) , 1 vial , fouchets reagent ( pallav / ranken / qualigens / merck ) , 100 ml , fuchsin acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 25 gm , gallic acid, grade ar ( merck / rankem / himedia / sigma ) 200 g , gallic acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , gelatin powder, grade lr ( merck / rankem / himedia / sigma ) 500 g , gelatin, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , gentamycin ( himedia / sigma / biomerieux / bd ) , 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) , 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) , 1 strip , giemsa stain ( ranken / qualigens / biolab / tulip / merck, 125 ml , glacial acetic acid ( ranken / qualigens / biolab / tulip / merck ) ( 500 ml each ) , bottle , glass beads, grade lr ( merck / rankem / himedia / sigma ) 500 g , glucose, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , glutamine, grade lr ( cdh, himedia, avantor, merck, research lab ) , 1 gm , glycerin, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 2.5ltr , glycerine, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 l , glycerol mono stearate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , glycerol, grade lr ( merck / rankem / himedia / sigma ) 500 ml , glycerol / glycerine, grade preservative / laboratory gradepacking size 2.5 lit. ( merck, rankem, sigma, himedia, qualigens / rl ) , gram crystal voilet ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , gram’s decolorizer ( rankem / qualigens / biolab / tulip / merck / rchem ) , 500 ml , gram’s staining kit ( himedia / ranken / qualigens / tulip / merck ) , grams iodine ( ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , grape seed oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , green tea butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , gum acacia, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , haematology divalent, grade lr, ( genrui, cdh, himedia, avantor, merck, research lab ) 5 ltr , heamatoxylin ( ranken / qualigens / biolab / tulip / merck ) , 125 ml , hemp seed oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , hexane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , hicrome candida differential agar ( himedia / sigma / biomerieux / bd ) , 500 gm , hydrazine sulfate, grade lr ( merck / rankem / himedia / sigma ) 500 g , hydrochloric acid ( 37% ) , grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , hydrochloric acid n / 10 solution ( himedia, merck, rankem, sigma, qualigens ) , 500 ml , hydrochloric acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , hydrogen peroxide 30% ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , hydrogen peroxide 30%, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , hydroquinone, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 gm , hydroxylamine hydrochloride, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 gm , hydroxypropyl methylcellulose, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , hypophosphorous acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , imidazole, grade lr, ( cdh, himedia, avantor, merck ) 100 gm , imidazolidinyl urea, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , imipenem ( himedia / sigma / biomerieux / bd ) , 1 vial , indigo carmine, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 25 gm , indigo carmine, grade lr ( merck / rankem / himedia / sigma ) 50 g , iodine ( resublimed ) , grade pure, ( cdh, himedia, avantor, merck, research lab ) 100 gm , iodine monochloride, grade lr ( merck / rankem / himedia / sigma ) 25 g , iodine resublimed, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 100 gm , iron oxide black, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , iron oxide black, liquid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , iron oxide brown, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , iron oxide brown, liquid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , iron oxide red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , iron oxide red, liquid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , iron oxide yellow, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , iron oxide yellow, liquid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , iron powder, grade lr ( merck / rankem / himedia / sigma ) 500 g , iso propyl alcohol 70% ( ( ranken / qualigens / biolab / tulip / merck / rchem ) , 500 ml , iso propyl alcohol 99.9% ( ( ranken / qualigens / biolab / tulip / merck, himedia / deepak ) , 500 ml , iso butyl alcohol, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , iso butyl alcohol, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , isooctane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , iso propyl alcohol, grade ar, ( ( cdh, himedia, avantor, merck, research lab ) 500 gm , iso propyl alcohol, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , isopropyl myristate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 35 kg , jojoba oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , kaolin clay, green, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin clay, olive, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin clay, purple, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin clay, red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin clay, rosa, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin clay, yellow, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , kaolin, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , karl fisher reagent, grade ar ( merck / rankem / himedia / sigma ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , koh pallet ( himedia / sigma / biomerieux / bd ) , 500 gm , kovacs indole reagent ( ranken / qualigens / biolab / tulip / merck ) , 125 ml , lactic acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , lancet, 1 box ( 100 ) , lancet strip, 1 pc ( 200 pcs ) , lanolin anhydrous, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , laureth group, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , lavender essential oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , l cysteine hydrochloride, grade lr, ( ( cdh, himedia, avantor, merck, research lab ) 25 gm , lead acetate trihydrate, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , lead acetate, grade lr ( merck / rankem / himedia / sigma ) 500 g , lead nitrate, grade ar, ( cdh, himedia, avantor, merck, research lab ) ) 250 gm , lead nitrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , lead oxide, grade lr, ( ( cdh, himedia, avantor, merck, research lab ) 500 gm , lead solution standard, grade lr ( rankem, sigma, himedia, qualigens ) 100 ml , lecithin, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 500 g , leishman stain with buffer ( ( ranken / qualigens / biolab / tulip / merck / arkary ) , 500 ml , leishman stain powder, grade indicator, ( cdh, himedia, avantor, merck, research lab ) 25 gm , levofloxacin ( himedia / sigma / biomerieux / bd ) , 1 vial , light liquid paraffin, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 10 kg , linezolid ( himedia / sigma / biomerieux / bd ) , 1 vial , liquid paraffin heavy, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 ml , liquid paraffin light, grade lr, ( ( cdh, himedia, avantor, merck, research lab ) 500 ml , liquor ammonia ( 500 ml each ) , bottle , lubricant jelly ( sterile ) neon , lugol’s iodine ( himedia / ranken / qualigens / biolab / tulip / merck ) , 125 ml , lyses solution, grade lr, ( genrui, himedia, avantor, merck, research lab ) 200ml , m phosphoric acid, grade lr ( merck / rankem / himedia / sigma ) 500 g , mac cartney bottle 30ml w / aluminium ( borosil / vwr / himedia / rchem ) cap, 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) , 500 gm , magnesiumchloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , magnesiumnitrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , magnesium chloride, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 mg , magnesium dioxide, grade lr ( merck / rankem / himedia / sigma ) 500 g , magnesium metal turning, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , magnesium oxide, grade lr ( merck / rankem / himedia / sigma ) 500 g , magnesium sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , magnesium, grade lr ( merck / rankem / himedia / sigma ) 500 g , malondialdehyde, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , mango butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , mannitol salt agar ( himedia / sigma / biomerieux / bd ) , 500 gm , mantoux tuberculin 10 tu ( arkray ) , 1 vial , mantoux tuberculin 5 tu ( arkray ) , 1 vial , may grunward stain ( himedia / ranken / qualigens / merck ) , 125 ml , mayers reagent, grade lr ( merck / rankem / himedia / sigma ) 500 ml , menthol crystals, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , mercuric chloride, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 100 gm , mercuric chloride, grade lr ( merck / rankem / himedia / sigma ) 100 g , mercuric iodide, grade lr ( merck / rankem / himedia / sigma ) 100 g , mercuric nitrate, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 gm , mercuric sulphate, grade lr ( merck / rankem / himedia / sigma ) 100 g , mercuric thiocyanate, grade lr ( merck / rankem / himedia / sigma ) 100 g , mercury, grade lr ( merck / rankem / himedia / sigma ) 250 g , meropenem ( himedia / sigma / biomerieux / bd ) , 1 vial , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) , 1 holder , methanol ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , methanol, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , methanol, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 500 ml , methanol, grade lr ( merck / rankem / himedia / sigma ) 25 liter , methanol, grade lr, ( cdh, himedia, avantor, merck, research lab ) 2.5 liter , methyl orange, grade lr ( merck / rankem / himedia / sigma ) 125 ml , methyl red solution, grade lr ( merck / rankem / himedia / sigma ) 125 ml , methyl red, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 25 gm , methylene blue ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , mica blackstar red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica bronze, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica carmine red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica coral red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica fine silver, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica light blue, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica luster black, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica magenta, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica pearl white, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica powder, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica red, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , mica sand gold, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 100 g , millions reagent, grade lr ( merck / rankem / himedia / sigma ) 500 ml , mineral oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , mitochondrial assay, test kit, 90 to 100 tests , mps, 5 kg, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , mueller hinton agar ( himedia / sigma / biomerieux / bd ) , 500 gm , multipurpose stand, ( himedia / tarsons / vwr ) 1 pcs , myristic acid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , naphthole, grade lr ( merck / rankem / himedia / sigma ) 100 g , natural gel wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , n butyl alcohol, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml. , n butyl alcohol, grade hplc, ( ( cdh, himedia, avantor, merck, research lab ) 1 ltr. , neem oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , nesslers reagent, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 ml , netilmicin ( himedia / sigma / biomerieux / bd ) , 1 vial , n hexane, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , n hexane, grade hplc, ( ( cdh, himedia, avantor, merck, research lab ) 1 ltr , n hexane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , nichrome straight wire ( himedia ) , nicotinic acid, grade pure, ( cdh, himedia, avantor, merck, research lab ) 100 gm , nihcrome loop ( d 4 ) diameter = 4mm, 1 loop ( himedia ) , nihcrome loop d 1 ) diameter = 1.3mm, 1 loop ( himedia ) , ninhydrin, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , ninhydrin, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 25 gm , ninhydrine, grade lr ( merck / rankem / himedia / sigma ) 25 g , nitric acid ( 69% ) , grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , nitric acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , nitroblue tetrazolium, lr ( cdh, himedia, avantor, merck, research lab ) , 200 gm , nitrofurantoin ( himedia / sigma / biomerieux / bd ) , 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) , 1 vial , novoabiocin ( himedia / sigma / biomerieux / bd ) , 1 vial , n propyl alcohol, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , n propyl alcohol, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , nutrient agar ( himedia / sigma / biomerieux / bd ) , 500 gm , oat protein, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , ofloxacin ( himedia / sigma / biomerieux / bd ) , 1 vial , oleic acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 ml , olive oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , optochin ( himedia / sigma / biomerieux / bd ) , 1 vial , orange peel butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , ortho phosphoric acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , ortho phosphoric acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 ml , ova albumine, grade lr, ( ( cdh, himedia, avantor, merck, research lab ) 50 gm , oxalic acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , oxidase discs ( himedia / sigma / biomerieux / bd ) , 1 vial , p anisaldehyde, grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 250 ml , p anisidin reagent, grade lr ( merck / rankem / himedia / sigma ) 500 g , paraffin wax 60°c with cerecen, grade lr, ( cdh, himedia, avantor, merck, research lab ) 2 kg , paraffin wax, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , patton and readers reagent, grade lr ( merck / rankem / himedia / sigma ) 250g , penicillin g ( himedia / sigma / biomerieux / bd ) , 1 vial , peppermint, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , peptone water ( himedia / sigma / biomerieux / bd ) , 500 gm , perchloric acid ( 60% ) , grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , perchloric acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , petroleum ether 60 80c, grade ar, ( cdh, himedia, avantor, merck, research lab ) 2.5 ltr , petroleum ether, grade lr ( merck / rankem / himedia / sigma ) 2.5 liter , petroleum jelly, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 kg , ph indicator paper, grade lr ( merck / rankem / himedia / sigma ) 10 book , phasphate buffer solution, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 ml , phenazine methosulphate, grade lr ( cdh, himedia, avantor, merck, research lab ) , 200 mg , phenol red, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 5 gm , phenol red, grade lr ( merck / rankem / himedia / sigma ) 500 ml , phenol, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , phenol, grade lr ( merck / rankem / himedia / sigma ) 500 ml , phenolphthalein, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 50 gm , phenolphthaline, grade lr ( merck / rankem / himedia / sigma ) 500 ml , phenoxy ethanol, grade lr ( merck / rankem / himedia / sigma ) 500 ml , phenoxyethanol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , phenoxyethanol, synonym–2 phenoxyethanol, molecular formula: c8h10o2 grade preservative / laboratory grade, packing size :2.5 litre ( merck, rankem, sigma, himedia, qualigens / rl ) , phenylalanine agar ( himedia / sigma / biomerieux / bd ) , 500 gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) , 1 pkt , phloraglucinol, grade lr ( merck / rankem / himedia / sigma ) 50 g , phloroglucinol, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 25 gm , phosphate test kit ( for rats / mice ) , test kit, 90 to 100 tests , phosphomolybdic acid, grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 25 gm , phosphoric acid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , picric acid, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , picric acid, grade lr ( merck / rankem / himedia / sigma ) 100 g , pipera + tazo ( himedia / sigma / biomerieux / bd ) , 1 vial , pipette tips 1000 microlitre, 1 pkt ( 1000 nos ) , pipette tips 200 microlitre, 1 pkt ( 1000 nos ) , plastic bottle dropper, 1 bottle , polyethylene glycol, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , polymyxin b ( himedia / sigma / biomerieux / bd ) , 1 vial , polyquaternium, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , polysorbate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , potassium acetate, molecular formula: ( ch3co2k ) , physical appearance – white crytaline powder, grade preservative / laboratory grade, packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , potassium bromide, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium carbonate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium carbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium chlorate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium chlorate, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , potassium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium chromate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium citrate, lr ( cdh, himedia, avantor, merck, research lab ) , 250 gm , potassium di hydrogen phosphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium dichromate, gradeacs ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , potassium dichromate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium ferricyanide, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium ferrocyanide, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium hydrogen phthalate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium hydroxide , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , potassium hydroxide pellets, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium hydroxide pellets, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium iodide, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 100 gm , potassium iodide, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium iodo bismuth, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium iodobismuth solution, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 ml , potassium mercuri iodide, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 gm , potassium meta bisulphite, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium meta sulphite, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium nitrate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium nitrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium oxalate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium per iodate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium permanganate, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , potassium permanganate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium phosphate dibasic, grade ar, ( cdh, himedia, avantor, merck, research lab ) 25 gm , potassium phosphate monobasic, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium pyro sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium sodium tartarate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium sodium tarterate tetrahydrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium sulphate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , potassium sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , potassium thiocyanate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , pps, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , probe cleanser, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 ml , propane 2 ol ( ipa ) , grade lr ( merck / rankem / himedia / sigma ) 25 liter , propionic acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 ml , propylene glycol, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , propylene glycol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 10 l , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , pumic stone, grade lr ( merck / rankem / himedia / sigma ) 500 g , pyridine solution, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , quaternium, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , quinizarine, grade lr ( merck / rankem / himedia / sigma ) 100 g , quinoa protein, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , rbc diluting fluid ( 500 ml each ) , bottle ( arkary / himedia / rchem / rankem ) , readymade 5% sheep blood agar plate ( himedia / sigma / biomerieux / bd ) , 01 plates , red oxide, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , resorcinol, grade lr ( merck / rankem / himedia / sigma ) 250 g , reticulocyte count stain ( ranken / qualigens / biolab / tulip / merck / nice ) , 100 ml , ria vials ( himedia / sigma / biomerieux / bd / rchem ) , 1 pack ( 100 vials ) , rice bran oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , rochelle salt, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , ruthenium red 99%, grade lr ( merck / rankem / himedia / sigma ) 1 g , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) , 500 gm , safranin, grade lr ( merck / rankem / himedia / sigma ) 25 g , safranine 0.5% ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , safranine 90%, grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 25 gm , salicylic acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) , 100 gm , seliwanoffs reagent ( anamol / nice / lab chemical ) , 100 ml , semen diluting fluid ( himedia / sigma / biomerieux / bd / nice ) , 125 ml , serotnin, grade lr ( cdh, himedia, avantor, merck, research lab ) , 1 gm , shea butter, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , silica gel self indicating, grade lr ( merck / rankem / himedia / sigma ) 500 g , silica gel g for tlc, grade lr ( merck / rankem / himedia / sigma ) 500 g , silver nitrate, grade ar, ( cdh, himedia, avantor, merck, research lab ) 25 gm , silver nitrate, grade lr ( merck / rankem / himedia / sigma ) 25 g , sim media ( himedia / sigma / biomerieux / bd ) , 500 gm , simmons citrate agar ( himedia / sigma / biomerieux / bd ) , 500 gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) , 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) , 1 pcs , soap flakes , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , sodiumsulphite, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium acetate, molecular formula: ( c2h3nao2 ) preservative / laboratory grade packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , sodium arsenate, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 250 gm , sodium arsenate, grade lr ( merck / rankem / himedia / sigma ) 200 g , sodium benzoate, grade ar, , ( cdh, himedia, avantor, merck, research lab ) 500 gm , sodium benzoate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , sodium bicarbonate, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium bicarbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium bisulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium borate, molecular formula: ( na2 [ b4o5 ( oh ) 4 ] .8h2o, grade preservative / laboratory grade packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , sodium carbonate, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium carbonate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium chloride, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium chloride, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sodium chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium citrate 3.8% ( span, himedia, merck, rankem, sigma, qualigens ) , 500 ml , sodium citrate, molecular formula: ( na3c6h5oh ) preservative / laboratory grade packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , sodium cocoyl isethionate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sodium dichromate, grade ar, , ( cdh, himedia, avantor, merck, research lab ) 500 gm , sodium diethyldithiocarbamate, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 100 gm , sodium dihydrogen phosphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium fluoride, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium gluconate, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sodium hydroxide , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) , 500 gm , sodium hydroxide, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium hypochlorite 10 % ( ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , sodium hypochlorite solution, molecular formula: naocl packing size 2.5 lit. ( merck, rankem, sigma, himedia, qualigens / rl ) , sodium hypophosphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium lauryl ether sulphate ( sles ) , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 kg , sodium lauryl sulphate ( sls ) , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , sodium lauryl sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium molybdate, grade lr ( merck / rankem / himedia / sigma ) 100 g , sodium nitrate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium nitroprusides, grade lr ( merck / rankem / himedia / sigma ) 100 g , sodium oxalate, grade lr, ( merck / rankem / himedia / sigma ) 100 gm , sodium peroxide, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , sodium peroxide, grade lr ( merck / rankem / himedia / sigma ) 100 g , sodium phosphate dibasic, grade ar ( rankem, rankem, sigma, himedia, qualigens ) 500 gm , sodium phosphate dibasic, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium phosphate monobasic, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium pyrophosphate buffer, grade lr , ( cdh, himedia, avantor, merck, research lab ) , 500 ml , sodium sachrrin, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sodium sulfate, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium sulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium sulphide, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium sulphite, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium thiosulfate, grade gr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium thiosulphate, grade lr ( merck / rankem / himedia / sigma ) 500 g , sodium tungstate, grade lr ( merck / rankem / himedia / sigma ) 100 g , solochrome black – t ( eriochome black – t ) , grade lr ( merck / rankem / himedia / sigma ) 100 g , sorbic acid, grade ar, , ( cdh, himedia, avantor, merck, research lab ) 1000 gm , sorbic acid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sorbitol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , sorbitol, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 10 l , soyabean casein digest ( himedia / sigma / biomerieux / bd ) , 500 gm , span 60, grade lr ( merck / rankem / himedia / sigma ) 500 g , sperm function vitality kit ( bread life science / renata / himedia ) , 25 ml , spirit ( for lamp ) ( 500 ml each ) , ( himedia / vwr / rchem ) bottle , stannous chloride dehydrate, grade lr ( merck / rankem / himedia / sigma ) 250g , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) , 1 pkt ( 2 sticks ) , starch indicator, indicator ( cdh, himedia, avantor, merck, research lab ) ) , 100 gm , starch, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , starch, grade lr ( merck / rankem / himedia / sigma ) 500 g , steam indicator tape ( himedia / sigma / biomerieux / bd ) , 1 roll , stearic acid, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 25 kg , stearic acid, grade lr ( merck / rankem / himedia / sigma ) , sterile cotton swab sticks with plastic tubes, ( himedia / tarsons / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( 5 ml ) , 1 box ( himedia / tarsons / bd ) ( 100 tubes ) , sterile urine container, 1 pack ( 500 container ) ( himedia / tarsons / bd ) , streptozotocin, grade lr, ( cdh, himedia, avantor, merck, research lab ) 1 gm , succinic acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 500 gm , sucrose, grade ar, ( ( cdh, himedia, avantor, merck, research lab ) 500 gm , sucrose, grade lr ( merck / rankem / himedia / sigma ) 500 g , sudan red iii, grade lr ( merck / rankem / himedia / sigma ) 100 g , sugar maltose ( 1000 gms each ) , sulfuric acid, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , sulphanilamide, grade lr ( merck / rankem / himedia / sigma ) 100 g , sulphuricacid, grade lr ( merck / rankem / himedia / sigma ) 500 ml , sulphuric acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , suphur powder ( fine / ranken / merck ) , 500 gm , talcum powder, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 5 kg , tannic acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 100 gm , tannic acid, grade lr ( merck / rankem / himedia / sigma ) 100 g , tartaric acid, grade lr ( merck / rankem / himedia / sigma ) 500 g , tea tree oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , teicoplanin ( himedia / sigma / biomerieux / bd ) , 1 vial , ten 20 gel , tert butanol, grade lr ( merck / rankem / himedia / sigma ) 500 ml , tert butyl alcohol, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 1 ltr , tertiary butyl alcohol, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , test tube stand, ( himedia / tarsons / vwr ) 1 stand , tetracyclin ( himedia / sigma / biomerieux / bd ) , 1 vial , tetrahydro furane, grade lr ( merck / rankem / himedia / sigma ) 500 ml , tetramethylammonium hydroxide, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 250 ml , thio urea, grade lr ( merck / rankem / himedia / sigma ) 500 g , thioacetamide, grade lr ( merck / rankem / himedia / sigma ) 100 g , thiobarbituric acid, grade lr, ( cdh, himedia, avantor, merck, research lab ) 25 gm , thioglycolic acid, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , thioglycollic acid ( 80% ) , grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 ml , thymol blue indicator powder, grade indicator, ( cdh, himedia, avantor, merck, research lab ) 25 gm , thymol blue, grade lr ( cdh, rankem, sigma, himedia, qualigens / rl ) 125 ml , thymol crystals, molecular formula: c10h14o, grade preservative / laboratory grade, packing size 500 gm ( merck, rankem, sigma, himedia, qualigens / rl ) , ticar + clav acid ( himedia / sigma / biomerieux / bd ) , 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) , 1 vial , titanium dioxide, grade ar, ( cdh, himedia, avantor, merck, research lab ) 100 gm , titanium dioxide, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , titanium tri chloride, grade lr ( merck / rankem / himedia / sigma ) 100 ml , tlc silica gel plate, grade lr ( merck / rankem / himedia / sigma ) 01box ( 25 sheet ) , tnf alpha ( for rats / mice ) , test kit, 90 to 100 tests , tobramycin ( himedia / sigma / biomerieux / bd ) , 1 vial , toluene, grade gr / ar ( merck, rankem, sigma, himedia, qualigens / rl ) 2.5 ltr , toluene, grade hplc, ( cdh, himedia, avantor, merck, research lab ) 2.5 ltr , toluene, grade lr ( merck / rankem / himedia / sigma ) 500 ml , trichloroacetic acid, grade lr ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , triethanilamine, grade lr ( merck / rankem / himedia / sigma ) 500 ml , triethanolamine, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , triglyceride, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) , 500 gm , tris buffer, grade ar, ( cdh, himedia, avantor, merck, research lab ) 500 gm , tris hcl buffer, grade lr ( merck / rankem / himedia / sigma ) 500 g , tween 20 , grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 l , tween 80, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 50 l , twin 80, grade lr ( merck / rankem / himedia / sigma ) 500 ml , urea crystal, grade lr ( merck / rankem / himedia / sigma ) 500 g , urea solution 40% ( ranken / qualigens / biolab / tulip / merck ) , 1 vial ( 5 ml ) , urea, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , vancomycin ( himedia / sigma / biomerieux / bd ) , 1 vial , vaniline, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 gm , vanillin, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 100 gm , vitamin e, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , walnut shell powder, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , wash bottle 500ml, ( tarsons / himedia / vwr ) 1 bottle , water ( distilled ) , grade lr, ( cdh, himedia, avantor, merck, research lab / rchem ) 2.5 ltr , water, grade ar, ( cdh, himedia, avantor, merck, research lab / rchem ) 2.5 ltr , wbc diluting fluid ( ranken / qualigens / biolab / tulip / merck / rchem ) , 500 ml , wheat germ oil, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 l , wright geimsa stain, grade lr, ( cdh, himedia, avantor, merck, research lab ) 250 gm , xanthan gum, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , xylene, grade ar ( ranken / qualigens / biolab / tulip / merck ) , 500 ml , xylene, grade lr ( merck / rankem / himedia / sigma ) 500 g , xylenol orange, grade lr ( merck / rankem / himedia / sigma ) 200 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) , 500 gm , zinc acetate, grade ar ( merck, rankem, sigma, himedia, qualigens / rl ) 500 gm , zinc acetate, grade lr ( merck / rankem / himedia / sigma ) 500 g , zinc chloride, grade lr ( merck / rankem / himedia / sigma ) 500 g , zinc dust, grade lr ( merck / rankem / himedia / sigma ) 500 g , zinc metal, grade ar ( cdh, rankem, sigma, himedia, qualigens / rl ) 500 gm , zinc oxide, grade ig ( galaxy / igl / godrej / makingcosmetics / rchem ) 1 kg , zinc sulphate, grade lr, ( cdh, himedia, avantor, merck, research lab ) 100 gm , ammoinium sulphate powder ( rankem, sigma, himedia, qualigens / rl ) 500 gm , sodium nitroprusside dehydrated ( rankem, sigma, himedia, qualigens / rl ) 500 gm , hcl ( n / 10 ) ( rankem, sigma, himedia, qualigens / rl ) 500 ml , sodium hypochlorite 4% , ( ranken / qualigens / biolab / tulip / merck ) 05 lit , chromic acid , ( merck / rankem / himedia / sigma ) 500 gm , sulfosalicylic acid ( 3% ) , ( merck / rankem / himedia / sigma ) 100gm...

Medical Health And Family Welfare - Rajasthan

38842725 lab reagent purchase in district hospital hanumangarh , lab reagent items ( must see instruction in technical part before filling this boq ) , anti a, b antibody , anti a1 ( dolichos biflorus ) lectin , anti d biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d monoclonal ( igg ) blood grouping sera, 10 ml pack , anti h ( ulex europeus ) lectin, 10 ml pack , antibody elution kit, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 mlcpda ( double ) , blood bag 350 ml cpda ( single ) , blood bag 350 ml sagm ( triple ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , blood grouping antisera ( anti ab sera ) , 10 ml pack , blood grouping antisera ( anti abd ) , 10 ml pack , blood grouping antisera ( anti h sera ) , 10 ml pack , blood grouping antisera ( bovine albumin 22% ) , 10 ml pack , blood grouping antisera ( liss blood grouping ) , 10 ml pack , blood grouping antisera ( liss card ) , 10 ml pack , blood grouping antisera ( liss coombs ) , 10 ml pack , blood grouping antisera ( liss diluent ) , 10 ml pack , blood grouping antisera, coombs sera ( ahg ) 10 ml pack , blood grouping gel card ahg c3d card ( crossmatch ) , 24 card ( biorad ) , blood grouping gel card forward & reverse grouping, 24 card ( biorad ) , blood grouping gel card forward grouping, 24 card , calcium chewable tablets ( 10 tablets / per pack ) , check cells ( coombs control cell ) , 10 ml pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge machine , gel card for gel card centrifuge, 24 card , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , haemo cue microcuvette , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss ( low ionoc strength saline solution ) 500ml pack , lyoplastin kit. , ph calibration fluids of ph 4.01, 7 and 10.01; 10 ml pack , phenotyping anti sera kit, 10 ml pack , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , reagentredcellpanels ( elevencellpanel ) forantibody identifiction ) , 10 ml pack , reagent red cells for antibody screen ( three or two cell panel ) , 10 ml pack , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) , calibration kit for biochemistry semi auto analyzer , s. albumin kit ( for semi auto analyzer ) , s. alkaline phosphate ( for semi auto analyzer ) , s. amylase kit ( for semi auto analyzer ) , s. aptt kits ( for semi auto analyzer ) , s. aslo kit ( for semi auto analyzer ) , s. bilirubin direct kit ( for semi auto analyzer ) , s. bilirubin total kit ( for semi auto analyzer ) , s. calcium kit ( for semi auto analyzer ) , s. chloride kit ( for semi auto analyzer ) , s. ck nac kit ( for semi auto analyzer ) , s. ck mb kit ( for semi auto analyzer ) , s. creatinine kit ( for semi auto analyzer ) , s. crp quantitative kit ( for semi auto analyzer ) , s. glucose kit ( for semi auto analyzer ) , s. hdl kit ( for semi auto analyzer ) , s. ldh kit ( for semi auto analyzer ) , s. magnesium kit ( for semi auto analyzer ) , s. potasium kit ( for semi auto analyzer ) , s. pt test kit ( for semi auto analyzer ) , s. ra / rf ( rheumatoid factor ) kit ( for semi auto analyzer ) , s. sgot kit ( for semi auto analyzer ) , s. sgpt kit ( for semi auto analyzer ) , s. sodium kit ( for semi auto analyzer ) , s. total cholsterol kit ( for semi auto analyzer ) , s. total protein kit ( for semi auto analyzer ) , s. triglyceride kit ( for semi auto analyzer ) , s. urea kit ( for semi auto analyzer ) , s. uric acid kit ( for semi auto analyzer ) , s.ldl kit ( for semi auto analyzer ) , s.vldl kit ( for semi auto analyzer ) , s.ggt kit ( for semi auto analyzer ) , absorbent cotton wool ( 5 / pack ) , amies media 500 gm / pack , anaerobic gas pack 6 set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , autoclave biological indicator 250 / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar 500gm / pack , blood agar plate , blood culture bottle , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 70 ml. adult for blood culture , cary blair’s transport media 500 gm / pack , cavity slide ( 10 per pack ) , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , handrub ( alcohol hand rub with moisturizer ) 500 ml , hbv viral load kit , hcv viral load kit , hiv diagnostic rt pcr kit , hot plate , hsv viral qualitative rt pcr kit , loeffler’s medium 500 gm / pack , lowenstein jensen media. 500 gm / pack , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilm d m250 , peptone water , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , raffinose 10gm / pack , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , stained salmonella antigen set for widal tests ( tube ) , sterile cotton swab with wooden stick , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vibrio tcbs agar 500gm , vtm vial , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , crystal violet stain 100 gm pack , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , giemsa stain solution ( 500ml bottle ) , gram stain kit , india ink stain , j.s.b. stain 1 for malaria parasite, 500ml / bottle , j.s.b. stain 2 for malaria parasite, 500ml / bottle , leishman stain 250 ml pack , lpcb stain 1 kit , new methylene blue stain for recticulocute count , nucleic acid stain , pap stain kit ( 1x250 test ) , rapid h&e stain kit 250 smear / kit , trichrome stain solution , z.n. stain for afb , sudan black stain solution ( 500ml / pack ) , 3.8% sodium citrate solution for esr, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute ethanol 500ml pack , absolute methanol ( 95% ) 500ml pack , acetic acid 100ml / pack , acetone ar 500 ml pack , ammonia , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , amonium sulphate , bacl2 ( barium chloride ) 10%, 500ml / pack , barium chloride 500gm pack , benedicts reagent 500 ml pack , bouins liquid 1 liter pack , buffer solution 500ml pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , deionised water 20 liter pack , di ethyl ether 500ml pack , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , drabkins solution 500 ml pack , edta powder 100gm pack , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs reagent ( 125ml pack ) , ferric chloride 100 gm pack , fouchet reagent ( 100ml / pack ) , glacial acetic acid 10 % solution, 500ml pack , glutaraldehyde ( 5 liter / pack ) , gluteraldehyde 100ml / pack , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hi chrome uti 500gm , iodine 100 gm pack , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , leishman powder 25gm pack , liquid ammonia 500 ml pack , lugols iodine 100 ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methyl red 125ml / pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro protien reagent ( csf ) 25ml pack , nitric acid ( 250 ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , rbc diluting fluid ( 100 ml / pack ) , semen diluting fluid 125 ml pack , sodium chloride 500gm / pack , sodium hydroxide 250ml / pack , sodium hydroxide 500gm / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 500 ml / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sodium nitropruside crystal 50gm pack , sorbitol 500gm / pack , sprit rectified clinical / surgical sprit ( 500ml / pack ) , sulfosalicylic acid 3% , tincher iodine ( 5 liter / pack ) , total eosinophil count fluid 125 ml / pack , w.b.c diluting fluid 500ml pack , xylene ( sulphur free ) ar 2.5 liter pack , clot activator vial, non vacume, double cap, red cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , plain serum vial, non vacume, double cap, red cap 4 ml , ria vial, non vacume 4 ml , sodium citrate vial, non vacume, double cap, black cap ( 3.8% ) 2 ml , sodium citrate vial, non vacume, double cap, blue cap ( 3.2% ) 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , elisa borrelia igg kit ( 96 test / kit ) , elisa borrelia igm kit ( 96 test / kit ) , elisa chickungunya kit ( 96 test / kit ) , elisa cmv igg kit ( 96 test / kit ) , elisa cmv igm kit ( 96 test / kit ) , elisa dengue igg kit ( 96 test / kit ) , elisa dengue igm kit ( 96 test / kit ) , elisa dengue ns 1 kit ( 96 test / kit ) , elisa dengue ns1, igg & igm kit ( 96 test / kit ) , elisa hav igm kit ( 96 test / kit ) , elisa hbsag kit ( 96 test / kit ) 3rd generation , elisa hbsag kit ( 96 test / kit ) 4th generation , elisa hcv kit ( 96 test / kit ) 3rd generation , elisa hcv kit ( 96 test / kit ) 4th generation , elisa hiv kit ( 96 test / kit ) 3rd generation , elisa hiv kit ( 96 test / kit ) 4th generation , elisa hsv 1 / 2 igm kit ( 96 test / kit ) , elisa hsv1 / 2 igg kit ( 96 test / kit ) , elisa igg for measles kit ( 96 test / kit ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e kit ( 96 test / kit ) , elisa igm for leptospirosis kit ( 96 test / kit ) , elisa igm for measles kit ( 96 test / kit ) , elisa leptospira igm kit ( 96 test / kit ) , elisa rotavirus antigen kit ( 96 test / kit ) , elisa rubella igg kit ( 96 test / kit ) , elisa rubella igm & igg kit ( 96 test / kit ) , elisa rubella igm kit ( 96 test / kit ) , elisa scrub typhus kit ( 96 test / kit , elisa toxoplasma igg kit ( 96 test / kit ) , elisa toxoplasma igm kit ( 96 test / kit ) , elisa varicella zoster virus igg kit ( 96 test / kit ) , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , rapid ag test for backterial meningitis ( menigococci ) , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card test for chalmydia antigen , rapid card test for chickungunya igm , rapid card test for covid 19 antigen card , rapid card test for cryptococcal antigen , rapid card test for dengue day 1 test , rapid card test for dengue lgg & lgm , rapid card test for dengue ns1 antigen , rapid card test for h.pylori , rapid card test for dengue ns1, igg, igm , rapid card test for hbsag , rapid card test for hcv , rapid card test for hcv tri dot , rapid card test for hiv , rapid card test for hiv 4th generation , rapid card test for hiv combaids , rapid card test for hiv tri dot , rapid card test for hiv tri dot+ag , rapid card test for igg / igm ab , rapid card test for kala azar ( 2k39 ) , rapid card test for leptospira igm / igg , rapid card test for malaria ( pv & pf ) , rapid card test for microfilaria antigen , rapid card test for occult blood in stool ( guaiac method ) , rapid card test for rotavirus antien , rubella igm / igg rapid , rapid card test for scrub typhus , rapid card test for sickle cell anaemia , rapid card test for toxoplasma , rapid card test for treponema screening , rapid card test for troponin i , rapid card test for troponin t , rapid card test for typhoid igm & igg , rapid card test for varicella zoster virus ( igm ) , rapid card test for vdrl / rpr ( syphilis ) card , rapid card test for widal test kit ( slide method ) 4x5ml , rapid card test for widal test kit ( tube method ) 4x5ml , rapid combi card test for hiv & hcv , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid latex slide test for aso kit , rapid latex slide test for crp kit , rapid latex slide test for rf / ra kit , rapid pregnancy ( hcg ) test card , rapid pregnancy ( hcg ) test strip , rapid strip test for vdrl , rpr ( rapid plasma reagin ) for syphilis , test for iodine in salt kit , urine ketone strips ( 100 strips / pack ) , urine micro albumin strip ( 100 / pack ) , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multi parameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , uristicks ( albumin sugar ) ( 100 / pack ) , water testing by strip method kit , amikacin 30 ?g ( antibiotic disks ) , amoxicillin + clavulanic acid 20 +10 ?g ( antibiotic disks ) , amoxicillin 25 ?g ( antibiotic disks ) , ampicillin + sulbactam 10 +10 ?g ( antibiotic disks ) , ampicillin 10 ?g ( antibiotic disks ) , ampicillin 2 ?g ( antibiotic disks ) , azithromycin 15?g ( antibiotic disks ) , aztreonam 30 ?g ( antibiotic disks ) , bacitracin 130 ?g / 10 ui ( antibiotic disks ) , carbenicillin 100 ?g ( antibiotic disks ) , cefaclor 30 ?g ( antibiotic disks ) , cefalexin 30 ?g ( antibiotic disks ) , cefamandole 30 ?g ( antibiotic disks ) , cefazolin 30 ?g ( antibiotic disks ) , cefepime 30 ?g ( antibiotic disks ) , cefixime sµg 10 ?g ( antibiotic disks ) , cefoperazone + sulbactam 75 +30 ?g ( antibiotic disks ) , cefoperazone 30 ?g ( antibiotic disks ) , cefoperazone 75 ?g ( antibiotic disks ) , cefotaxime 30 ?g ( antibiotic disks ) , cefotaxime 5 ?g ( antibiotic disks ) , cefotetan 30 ?g ( antibiotic disks ) , cefoxitin 30 ?g ( antibiotic disks ) , cefpirome 30 ?g ( antibiotic disks ) , cefpodoxime 10 ?g ( antibiotic disks ) , cefprozil 30 ?g ( antibiotic disks ) , cefsulodin 30 ?g ( antibiotic disks ) , ceftazidime 10 ?g ( antibiotic disks ) , ceftazidime 30 ?g ( antibiotic disks ) , ceftibuten 30 ?g ( antibiotic disks ) , ceftriaxone 30 ?g ( antibiotic disks ) , cefuroxime 30 ?g ( antibiotic disks ) , cephalotin 30 ?g ( antibiotic disks ) , chloramphenicol 30 ?g ( antibiotic disks ) , ciprofloxacin 5 ?g ( antibiotic disks ) , clarithromycin 15 ?g ( antibiotic disks ) , clindamycin 2 ?g ( antibiotic disks ) , colistin 10 ?g ( antibiotic disks ) , colistin 50 ?g ( antibiotic disks ) , doripenem 10 ?g ( antibiotic disks ) , doxycycline 30 ?g ( antibiotic disks ) , ertapenem 10 ?g ( antibiotic disks ) , erythromycine 15 ?g ( antibiotic disks ) , flumequine 30 ?g ( antibiotic disks ) , fosfomycin 200?g ( antibiotic disks ) , fosfomycin 50 ?g ( antibiotic disks ) , fusidic acid 10 ?g ( antibiotic disks ) , gentamicin ( high load ) 120 ?g ( antibiotic disks ) , gentamicin ( high load ) 500 ?g ( antibiotic disks ) , gentamicin 10 ?g ( antibiotic disks ) , gentamicin 15 ?g / 10 ui ( antibiotic disks ) , gentamicin 30 ?g ( antibiotic disks ) , imipenem 10 ?g ( antibiotic disks ) , isepamicin 30 ?g ( antibiotic disks ) , kanamycin ( high load ) 1mg ( antibiotic disks ) , kanamycin 30 ?g ( antibiotic disks ) , levofloxacin 5 ?g ( antibiotic disks ) , lincomycin 15 ?g ( antibiotic disks ) , linezolid 10 ?g ( antibiotic disks ) , linezolid 30 ?g ( antibiotic disks ) , mecillinam 10 ?g ( antibiotic disks ) , meropenem 10 ?g ( antibiotic disks ) , metronidazole 4 ?g ( antibiotic disks ) , mezlocillin 75 ?g ( antibiotic disks ) , minocycline 30 ?g ( antibiotic disks ) , moxalactam 30 ?g ( antibiotic disks ) , moxifloxacin 5 ?g ( antibiotic disks ) , mupirocin 5 ?g ( antibiotic disks ) , nalidixic acid 30 ?g ( antibiotic disks ) , neomycin 30 ui ( antibiotic disks ) , netilmicin 10 ?g ( antibiotic disks ) , netilmicin 30 ?g ( antibiotic disks ) , nitrofurantoin 100 ?g ( antibiotic disks ) , nitrofurantoin 300 ?g ( antibiotic disks ) , nitroxolin 20 ?g ( antibiotic disks ) , norfloxacin 10 ?g ( antibiotic disks ) , norfloxacin 5 ?g ( antibiotic disks ) , ofloxacin 5 ?g ( antibiotic disks ) , oxacillin 1 ?g ( antibiotic disks ) , oxacillin 5 ?g ( antibiotic disks ) , oxolinic acid 10 ?g ( antibiotic disks ) , pefloxacin 5 ?g ( antibiotic disks ) , penicillin 1 iu ( antibiotic disks ) , penicillin 6 ?g / 10 iu ( antibiotic disks ) , pipemidic acid 20 ?g ( antibiotic disks ) , piperacillin + tazobactam 100 + 10 ?g ( antibiotic disks ) , piperacillin + tazobactam 30 + 6 ?g ( antibiotic disks ) , piperacillin + tazobactam 75 + 10 ?g ( antibiotic disks ) , piperacillin 100 ?g ( antibiotic disks ) , piperacillin 30 ?g ( antibiotic disks ) , piperacillin 75 ?g ( antibiotic disks ) , polymixin 50 ?g / 300 ui ( antibiotic disks ) , pristinamycin 15 ?g ( antibiotic disks ) , quinupristin dalfopristin 15 ?g ( antibiotic disks ) , rifampicin 30 ?g ( antibiotic disks ) , rifampicin 5 ?g ( antibiotic disks ) , sparfloxacin 5 ?g ( antibiotic disks ) , spectinomycin 100 ?g ( antibiotic disks ) , spiramycin 100 ?g ( antibiotic disks ) , streptomycin ( high load ) 300 ?g ( antibiotic disks ) , streptomycin ( high load ) 500 ?g ( antibiotic disks ) , streptomycin 10 ?g ( antibiotic disks ) , sulfonamides 200 ?g ( antibiotic disks ) , sulfonamides 300 ?g ( antibiotic disks ) , teicoplanin 30 ?g ( antibiotic disks ) , telithromycin 15 ?g ( antibiotic disks ) , tetracycline 30 ?g ( antibiotic disks ) , ticarcillin + clavulanic acid 75 + 10 ?g ( antibiotic disks ) , ticarcillin 75 ?g ( antibiotic disks ) , tigecycline 15 ?g ( antibiotic disks ) , tobramycin 10 ?g ( antibiotic disks ) , tobramycin 30 ?g ( antibiotic disks ) , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g ( antibiotic disks ) , trimethoprim 5 ?g ( antibiotic disks ) , vancomycin5 ?g ( antibiotic disks ) , vancomycin 30 ?g ( antibiotic disks ) , 100x lens for binocular microscope , 10x lens for binocular microscope , 40x lens for binocular microscope , blood cell counter 8 key + 1 totaliser , blood mixer / roller / rotator / shaker , bone marrow aspiration needle , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , electonic analytical balance for laboratory, capacity 200gm , esbachs albuminometer , esr fluid ( 500ml pack ) , esr pipette with vaccum plug, 100 / pack , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , filter paper ( round ) 125 mm ( 1x50 pack ) , funnel ( conical ) keep plastic transparent , funnel conical, 250 gram capacity , funnel conical, 500 gram capacity , glass slide box ( 75x25x1.35 mm ) ( 100 slides / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strip ( 100 / pack ) , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hydrometer ( for specific gravity ) , immersion oil for binoculer microscope ( 30ml / pack ) , immersion oil for binoculer microscope ( 30ml / pack ) , lancet ( 100 / pack ) , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , pasteur pipette ( dropper ) glass , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter , ph paper packet ( 20 piece / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , ppd syringe 100 / pack , r.b.c pipette , semen / sputum / urine / stool container plastic with cap 30 ml , semen / sputum / urine / stool container plastic with cap 50 ml , spatula with brush , spirit lamp , staining jar trough glass for 10 slides each , syringe holder for fnac ( 20ml syringe ) , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , urinometer , vaccutainer 10 ml plain , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , w.b.c pipette , wooden slide storage box for 50 slides , zip lock plastic bag 4*6 inch ( 100 piece / pack ) , zip lock plastic bag 6*8 inch ( 100 piece / pack ) , zip lock plastic bag 8*10 inch ( 100 piece / pack ) , band aid adhesive strip , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , cuscos speculum large , cuscos speculum medium , cuscos speculum small , disposable abg syringe without needle 3 ml , disposable glove with powder size 6 , disposable glove with powder size 6.5 , disposable glove with powder size 7 , disposable glove with powder size 7.5 , disposable glove without powder ( nitrile ) size 6 , disposable glove without powder ( nitrile ) size 6.5 , disposable glove without powder ( nitrile ) size 7 , disposable glove without powder ( nitrile ) size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 3 ml , disposable syringe 5 ml , dropper glass 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , hand wash liquid soap ( 100ml / pack ) , hitachi sample cup 2 ml 500 / pack , hitz cuvatte , hypodermic needle, 21g, 1.5 , icebox ( 2liter capacity ) , lens paper kit ( 50 sheets pack ) , liquid soap ( 1liter / pack ) , measuring cylinder 0 to 100 ml graduated glass , measuring cylinder 0 to 1000 ml graduated glass , measuring test tube glass 0 10 ml graduated conical , micro tips blue, 100 1000 micro liter ( 1000 / pack ) , micro tips blue, 10 200 micro liter ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , microcentifuge tude 0.5 ml , microcentifuge tude 1.5 ml , microcentifuge tude 2.0 ml , micropipette 0 10 ul capacity , micropipette 100 ul fix volume , micropipette 100 1000 ul capacity , micropipette 10 100 ul capicity , micropipette 50 ul fix volume , micropipette 5 50 ul capacity , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , pasteur pipettes 0.25 ml capacity 500 / pack , pasteur pipettes 0.50 ml capacity 500 / pack , pasteur pipettes 1 ml capacity 500 / pack , pasteur pipettes 10 microliter capacity 500 / pack , pasteur pipettes 3 ml capacity 500 / pack , pasteur pipettes 5 ml capacity 500 / pack , petridish 90 mm diameter, 15 mm height 1 piece , pipette stand plastic for 5 pipette , pipette stand plastic vertical 28 holes 12 mm , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , smear for filaria ( kit ) , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush , thermocal box ( 5 liter capacity ) , tissue paper ( 10 roll / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , tuberculine syringe , urine container, plastic, 30 ml, sterilized , urine container, plastic, 50 ml, sterilized , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Indian Army - Rajasthan

38839680 procurement of drugs , fexofenadine hydrochloride 120mg tab , glucosamine 250 mg+ chondroitin sulphate 200 mg cap , leflunamide 10 mg tab , inj ethamsylate 125 mg/ml , tab amoxycillin 875 mg + clavulanic acid 125 mg , syp cefuroxime 125mg/5ml, 30ml , tab nitrofurantoin 100 mg , tab thyroxine 75 mcg , soft gelatin cap antioxidant containing + multivitamin , tab ranolazine 500 mg , antacid syp gel each 5ml containing dried aluminium hydroxide gel ip 250mg, magnesium hydroxide nf 250mg and methyl polysiloxane 50mg bott of 170ml , tab divalprox 500 mg sr , inj. methylcobalamin1500mcg2ml , inj acyclovir 500 mg , lotion calamine, 100 ml , ot disinfectant soln bottle of 500ml (ot shield) , oint clotrimazole (vaginal use) tube of 30gm , oint neosporine eye tube of 5gm , syp calcium 250mg with vit d3 125iu paed drop bottle of 200ml , syp antispasmodic containing simethicone bot of 15ml for paed , syp ibuprofen + paracetamol 60 ml , syp norflox + tinidazole, 60 ml , syp ofloxacin + metronidazole bott of 60 ml , tab alprazolam 0.5 mg , tab clobazam 10mg , tab isosorbide di nitrate 5 mg , tab losartan 50mg + hydrochlorthiazide 12.5mg , tab mifepristone+ misoprostol kit , tab olmesartan 40 + hydrochlorthiazide 12.5 , tab olmisartan 20 mg , tab oxcarbazepine 600 mg , tab rosuvastatin 10 mg , tab telmisartan 20 mg , tab trazer f forte , tab trazer m forte , tab trimetazidine mr 35 mg , tab voglibose 0.3 mg , mirena levonorgesterol iucd , obstestric cream containing chlorhexidine 1% jar of 500gm , cap rifampicin 600 mg , cap duloxetin 30 mg , tab telmisartan 40 mg +clinidipine 10 mg+chlorthalidone 6.25 mg , tab dabigartan 110 mg , tab dabigartan 150 mg , tab dapagliflozin 5 mg , tab sacurbitril 24 mg + valsartan 26 mg , tab dydrogesterone 10 mg , tab isoniazide 100 mg , oint ketoconazole2% w/w tube of 30gm , naproxen 500 mg + domperidon 10mg tab , human papiloma virus quadrivalent(types 6,11,16,18) vaccine recombinant vial of 0.5ml , tab donepezil 5mg + memantine 5mg , tab amantadine100mg , tab levodopa 100+ carbidopa 25mg , tab telmisartan 40mg + hydrochlorthiazide 12.5mg + amlodipine 5mg , inhaler salbutamol 100mcg/dose, 200 metered dose , oint framycetin 1% tube of 30 gm , oint hydroquinone + tretenoin + mometasone tube of 18gm , syp oxetacaine 10mg containing aluminium hydroxide, magnesium hydroxide bott of 200ml , inj vasopressin 20iu/ml , inj oxytocin amp of 0.5ml , syp cough expectorent each 5ml containing diphenhydramine 14.08mg, ammonium chloride 138mg, sodium citrate 47.03mg bott of 100ml , sgpt kit , mac conkey agar bott of 500 gm , mulear hinton agar base bott of 500 gm , peptone water , stain brilliant cresyl blue bott of 200ml , stain fuchsin acid , stain fuchsin basic , stain giemsa , stain leishmans powder. , stain methylene blue , afb stain kit , albumin + glucose test kit (uristicks) , kit bilirubin , xylene , viral transport media with two swab , triglyceride test kit , calcium test kit , kit amylase 12 x 5 ml , prothrombin timekit , abst disc amikacin , abst disc ampicillin , abst disc augmentin , abst disc azithromymycin , abst disc carbencillin , abst disc cefalexin , abst disc cefoperazone , abst disc cefotaxime , abst disc cefoxitin , abst disc ceftazidime , abst disc ceftriaxone , abst disc chlorophenicol , abst disc ciprofloxacin , abst disc clindamycin , abst disc colistin , abst disc erythromycin , abst disc gentamicin , abst disc imipenem , abst disc levofloxacin , abst disc meropenem , abst disc methicillin , abst disc nalidixic acid , abst disc netilmicin , abst disc nitrofurantion , abst disc norfloxocin , abst disc ofloxacin , abst disc piperacilin tazobactum , abst disc piperacillin , abst disc polymycin , abst disc sulphamethaxazole , abst disc teichoplanin , abst disc tetracycline , abst disc trimethoprim , abst disc vancomycin , accucheck active glucostrips bott of 50 strips , aec diluting fluid (rtu) bott of 100 ml , biorad liquicheck cardic marker 3 level , biorad lyphocheck assayed chemistrycontrol , biorad lyphocheck immmunoassay plus control level 1,2,3 , blood grouping sera a, b & rh d , brain heart infusion broth supplemented with 0.5% sps (sodium polyantenthol sulphonate) for adult use (himedia) , brain heart infusion broth supplemented with 0.5% sps (sodium polyantenthol sulphonate) for paed use (himedia) , dpx mounting med 250 ml , kit for chikungunia , kit for occult blood , kit ldh , kit lipase , kit microprotein (1 x 50 ml) , ldl cholesterol , leishman stain bott of 500 ml , liquid formaldehyde bott of 5 ltr , liquid paraffin bott of 1 ltr , combined microbial sensitivity discs for gram positive isolates (gp1) , combined microbial sensitivity discs for resistant gram positive isolates (gp2) , combined microbial sensitivity discs for gram negatives isolates /uti (gn1) , combined microbial sensitivity discs for resistant gram negative isolates/uti (gn2) , montex test => limited...

Rajasthan Rajya Vidyut Utpadan Nigam Limited - Rajasthan

38719658 supply of annual requirement of lab chemicals at stps, rvun, suratgarh 1 401010053 1 amino 2 naphthol 4 sulphonic acid ( 1 pkt = 25 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 5 2 401010059 ammonium chloride ( 1 pkt =500gm ) , grade: ar / sq / excel r / er / purified / gr pkt 2 3 401010060 ammonium molybdate ( 1 pkt =500gm ) , grade: ar / sq / excel r / er / purified / gr pkt 25 4 401010200 ammonium perpurate ( 1pkt= 5gm ) pkt 3 5 401010002 acetone ( 1pkt= 500ml ) grade: ar / sq / excel r / gr pkt 2 6 401010014 ammonia solution 25% ( 1pkt= 2.5 ltr ) grade: ar / sq / excel r / gr pkt 5 7 401010171 bromo cresol green 0.04% indicator ph 3.6 5.2 yellowish green ( 1pkt= 125 ml ) grade: ar / sq / excel r / gr / er / purified pkt 3 8 401010062 bleaching powder ( 1 pkt =500gm ) , grade: ar / sq / excel r / er / purified / gr pkt 4 9 401010102 conc. hydrochloric acid ( 1pkt=500ml ) grade: ar / sq / excel r / er / purified / gr pkt 35 10 401010054 1 n hydrochloric acid ampule ( 1 pkt = 06 nos. ) pkt 2 11 401010069 chlorotex reagent ( 1 pkt =125 ml ) , pkt 14 12 401010072 ethanol ( 1 pkt =500 ml ) , pkt 6 13 401010202 etylene diamine tetra acetic acid ( 1pkt= 500gm ) grade: ar / sq / excel r / gr / er / purified pkt 2 14 401010223 eriochrome / solochrome black t ( 1pkt= 25gm ) 15 401010074 glycerol anhydrous ( 1 pkt =2.5 ltr ) , grade: ar / sq / excel r / er / purified / gr pkt 2 16 401010179 hexamine ( 1 pkt = 500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 2 17 401010204 isopropyl alcohol ( 1pkt= 2.5ltr ) grade: ar / sq / excel r / gr / er / purified pkt 2 18 401010127 indigo carmine indicator ( 1pkt= 25gm ) nos 2 19 401010176 n / 10 iodine ampule ( 1 pkt = 06 nos. ) grade: lr cvs pkt 2 20 401010195 karl fischer reagent pyridine free ( 1pkt= 500ml ) pkt 2 21 401010182 lead nitrate ( 1 pkt = 500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 2 22 401010080 methanol ( 1 pkt =2.5 ltr ) , grade: ar / sq / excel r / er / purified / gr pkt 6 23 401010172 methyl red 0.01% indicator solution ph 4.3 6.3 red yellow ( 1pkt= 125 ml ) grade: ar / sq / excel r / gr / er / purified pkt 2 24 401010083 oxalic acid ( 1 pkt =500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 10 25 401010159 o toludine ( 1pkt= 500gm ) grade: ar / sq / excel r / gr / er / purified nos 1 26 401010084 para dimethyl amino benzaldehyde ( 1 pkt =500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 3 27 401010087 potassium hydroxide pellets ( 1 pkt =500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 10 28 401010088 pyrogallol ( 1 pkt =100 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 10 29 401010206 1, 10 phenenthroline ( 1pkt= 5gm ) grade: ar / sq / excel r / gr / er / purified pkt 3 30 401010170 phenophthalein indicator ( 1 pkt =125 ml ) , pkt 5 31 401010093 sodium meta bisulphite ( 1 pkt =500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 10 32 401010095 sodium sulphite ( 1 pkt =500 gm ) , grade: ar / sq / excel r / er / purified / gr pkt 2 33 401010097 sulphuric acid ( 1 pkt =2.5 ltr ) , grade: ar / sq / excel r / er / purified / gr pkt 8 34 401010208 sodium acetate ( 1pkt= 500gm ) grade: ar / sq / excel r / gr / er / purified / emplura pkt 1 35 401010209 sodium hydroxide pellets ( 1pkt= 500gm ) 36 401010153 starch soluble ( 1pkt= 500gm ) grade: ar / sq / excel r / gr / er / purified nos 1 37 401010210 sodium nitrite ( 1pkt= 500gm ) grade: ar / sq / excel r / gr / er / purified pkt 1 38 401010165 silicone high vaccum grease ( lab ) ( 1pkt= 50 gm ) grade: ar / sq / excel r / gr / er / purified pkt 2 39 401010056 1 n sodium hydroxide ampule ( 1 pkt = 06 nos. ) grade: lr cvs pkt 2 40 401010094 sodium potassium tartarate ( 1pkt=500gm ) grade: ar / sq / excel r / gr / er / purified pkt 1 41 401010167 toluene ( 1pkt= 2.5 ltr ) grade: ar / sq / excel r / gr / er / purified pkt 2 42 401010098 universal indicator ph 4 11 indicator with colour chart ( 1 pkt =500 ml ) , grade: ar / sq / excel r / er / purified / gr pkt 14 43 401010104 xylene ( sulphur free ) ( 1 pkt= 2.5ltr ) grade: ar / sq / excel r / er / purified / gr pkt 4 44 401010224 xylenol orange indicator ( 01 pkt=10 gm ) , etc....

Sms Medical College - Rajasthan

38424547 tender for rate contract for chemicals ( nit 49 ) i. i isopropyl alcohol ar 2. dionised water — 3. i glycerin ar 4. [ xylene s / f ar 5. j cytromntrix embedding medium....

Medical College - Rajasthan

38424002 rate contract for chemicals , rate contract of chemicals for pathology department , isopropyl alcohol ar , dionised water , glycerin ar , xylene s / f ar , cytromatrix enbedding medium...

Medical Health And Family Welfare - Rajasthan

38102163 supply of testing, regents equipment, cards and kits items at jln govt. hospital nagaur , a.s.o. 100 test sd/j. mitra/tulip , acetic acid bdh 500 ml , acetone 5 ltr. , albumin klt 5*50 ml erba , alkaline phasp (auto span) 20 ml/erba , alkaline phasp (erba) , amylase kit 6*6 ml erba/j.mitra/tulip , anti sera group a,b,d kits ml j.mitra/tulip 10 ml , australia antigen per kit rapid , auto pipette 100 1000 ul , auto pipette 10 ul , auto pipette 500 ul , auto pipette 50 ul , auto pipette 50 ul , band aid per piece , benedicts qualitative reagent 5 ltr , bilirubin 4*60 ml. erba , bovine albumin sera 5 ml. jmitra/tulip etc , brillint cresyl bule 100 ml , brush for claning test tube per piece , c.r.p. 100 test sd/j. mitra/tulip etc , calcium kit 2*50 ml erba , capillary tube per tube , chikangunia rapid test sd/i. mitra/ tulip etc per test , cholestol kit 5*20 ml. erba etc , ck nac kit 2*10 ml. erba/j.mitra/tulip etc , ck mb kit 2*8 ml 2*2 nil erba/ j. mitra/tulip etc , combs sera 5 ml. j.mitra/tulip etc , cotton tape &3 4 per piece , cover slip glss 18 mm 1*100 , cover slip glass chember 1*100 , creatinine kit 4*60 ml. erba , dengue card igg/igm/ns 1 sd/j. mitra/ tulip etc , dengue elisa kit sd/ j. mitra/ tulip per kit , diastix bayer 100 strips , disposable esr pipette with tube per tube , distil water 5 lit gallan h2so4 reg , dropper big size 9 per piece , earba wash kit cat no. 1921 4*50 ml , edta vials (k3) 13*75 mm double cape per piece , edta vials (k3) 13*75 mm single cape per piece , ehrlichs reagent 500 ml , eosinophil solution 500 ml , eosinophil counting fluid 500 ml , erba cim 5 semi auto analiser pm kit , erba roll paper 2.5 p th. paper per roll , erba roll paper 3 plan tharmal paper per roll , erba roll paper 4 per roll , esr pipette gdr each , ethyl alcohol 500 ml , auto pipette 100ul , filter paper pe piece , gention fluid 500 ml , giemsa stain 500 ml , glass slide 50 pcs. , glucose kit 2*200 ml erba , grams crytal violet per piece , grams iodine 500 ml , grams (stain) 500 ml , hb pipetle top per piece , hb tube top per piece , hbs ag kit rapid sd/j. mitra/ tulip etc , hbs ag kit elisa 96 test sd/j. mitra/tulip etc , hcv elisa 96 test sd/j. mitra/tulip etc , hcv kit rapid sd/ j. mitra/tulip etc , hdl cholesterol 2*50 ml. erba , hiv kit (elisa) 96 test sd/j. mitra/tulip etc , hiv kit (rapid) sd/j. mitra/tulip etc , hiv tridot sd/tulip/ j. mitra etc , hiv elisa 4th gen. , hydrochloric acid bdh 500 ml , jsb stain i malaria , jsb stain ii malaria , ldh (p l) kit 25 ml 4*8/1*8 ml erba/j.mitra/tulip etc , leishman stain 500 ml , methyl alcohol 500 ml , methyleneblue 500 ml , micro protein 1*50 liqued , multistix bayer 100 strip , neuber counting chamber rohan india brigh line , nitric acid bdh 500 ml , occult blood test kit , pasture pipette glass , pipette glass 10 ml , pipette glass 1 ml , pipette glass 20 ml , plastic urine containers per piece , potassium hydroxide 500 ml , pregnancy colour card acon/hicks/mainkind etc , pt kit (agappe) ivd , pt kit (uniplastin) , ra kit 100 test , rmt antigen set sd/ j. mitra/tulip etc , scrub tiphus rapid test sd/ j. mitra/ tulip etc , seminal fluid 500 ml , serum cap test tube 4 screq cap , serum sample cup , sgot kit 5*20 ml. erba etc , sgpt kit 5*20 ml erba etc , sulfuric acid 500 ml , sulphuric acid bdh 500 ml , sulpur flower (powder) 500 gm , test tube 3 glass , test tube 3 plastic , test tube 4 glass , test tube 4 plastic , test tube stand 48 , test tube stand 96 , test tube with screw cap 3 , test tube with screw cap 4 , tips blue 1x500 pack , tips yellow 1x1000 pack , total protein test kit 5*50 ml erba , triglyceride 5*50 ml erba , unnas polychrone methyne blue , urea kit 5*20 ml erba , uric acid test kit 5*20 ml. erba , uric acid test kit 5*50 ml. erba , uristix bayer 100 strips/seimens/bayer etc , vdrl card sd/acon/tulip , wbc pipette gdr , widal test kit 100 test sd/j. mitra/tulip etc , xylene 500 ml , blood suger erba kit , anti ab (group) j. mitra/tulip etc , sodium hypocloride 5 ltr. , blood bag 350 ml , blood beg (pedia) , needle 22/23 no. 1x100 pack , chikangunia elisa test kit 1*96 , keto distix , test tube jelly 4 , anti d polyclonal igg+igm , anti h polyclonal igg+igm , anti a polyclonal igg+igm , sensitized o cells , scrub typhus elisa test kit 1*96 , hav igm elisa testkit 1*96 , hev igm elisa testkit 1*96 , typhid elisa testkit for typhoid 1*96 , typhid rapid test fortyphoid , tube agglutination test kit fortyphoid , modified carry blair medium , brain heart infusion medium (bhi) , deoxycholate citrate agar(dca) , phenolphthalein phosphate agar(ppa) , blood culture bottles with brain heart infusion broth(20ml) , blood culture bottles with brain hear tinfusion broth(70ml) , sim agar , ss agar , blood aga rbase , cled media , nutrient agar , macconkey agar , muller hinton agar , thiosulphate citrate bile salt agar(tcbsagar) , mannitol agar , salanite broth , sorbitol macconkey agar , chrome agar (hicromeutiagar) , xld agar , sabouraud dextrose agar(sda) , alkaline peptone water , amies/stuart media for sample , carry blair media for stool transport , triple sugar iron agar , simmon citrate agar , urea agar base for urea test , urea solution for urea test , kovac’sreagent(indolereagent) , glucose phosphate broth , methylred indicator solution , alpha napthol for vptest(barrita) , 40% koh (barritb) , 30% hydrogenperoxide (h2o2) , oxidase reagent , optochin , bacitracin , novobiocin , sodium deoxycholate , ph paper1to14 , ph paper 2to10.5 , ferric chloride , tryptone broth for indole test , glass marking pencil , of medi a(glucose) , vials for storage(cryo,eppendores)b , bile e sculin agar , tsb[tryptonesoyabroth] , glycerol , gram’sstainkit , afb(zn)stainkit , albertstainkit , lugol’siodine , indianink , glasspetriplates (100mm) , disposable petriplates(100mm) , measuring cylinder 50ml , measuringcylinder100ml , measuringcylinder250ml , conical flasks 100ml , conical flasks 250ml , conical flasks 500ml , test tube10ml , maccartney bottle(100ml) , glassrod , slide trays , multichannel micropipette (30?l– , micropipette(10 100microlitre) , micropipette(100 1000microlitre) , 70%ethanol , 70%ethlyalcohol , 10%koh , sterile stool container with spoon , pre sterile cottons wabs , swabsticks(withtube) , blood culture bottle with out media(forbhimedia)30ml , blotting paper sheet , ceedar woodoil , staining rack(rodwithstand) , reagent bottle (narrow mouth)125ml , plastic infor hanging drop preparation , plastic droper1*100 , discardingjar , inoculation loop (10microlitre) , inoculation loop (standard for urine culture0.001ml) , inoculation loop holder , stop watch , diamond marke rpencil , tissue paper roll , aluminum foil , filter paper sheet , bun senburner with small gas cylinder , spirit lamp , paraffin tape2x250 , analyticalweighing balances(cap.0.01gm 220gm) , electric heater for water boiling[waterbath] , thermometer110c,mercuryfilled , autoclave thermophilus strip for internal quality check , incubator thermophilus strip for internal quality check , 0.5macfarlandsolution , 0.5macfarlandunitpaper , vibriocholerae antisera,polyo1 , vibriocholerae antisera,o139bengal , fecaloc cul tblood testkit , amikacin(30mcg) , augmentin(20/10mcg) , ampicillin(10mcg) , cefepime(30mcg) , cefoxitin(30mcg) , ceftazidime(30mcg) , ceftriaxone(10mcg) , cefuroxime(30mcg) , chloramphenicol(30mcg) , ciprofloxacin(10mcg) , clindamycin(2mcg) , cotrimoxazole(25mcg) , doxycycline(10mcg) , erythromycin(10mcg) , gentamycin(10mcg) , imipenem(10mcg) , levofloxacin(5mcg) , linezolid(30mcg) , meropenem(10mcg) , nalidixicacid(30mcg) , netilmicin(10mcg) , nitrofurantoin(300mcg) , norfloxacin(10mcg) , ofloxacin(5mcg) , oxacillin(1mcg) , penicillin(10mcg) , peperacillin/tazobactam(100/10mcg) , teicoplanin(30mcg) , tetracycline(30mcg) , vancomycin(30mcg) , gluco strips sd code free...

Medical Health And Family Welfare - Rajasthan

38101740 lab reagent purchase in district hospital hanumangarh , lab reagent items (must see instruction in technical part before filling this boq) , anti a, b antibody , anti a, b antibody , anti a1(dolichos biflorus) lectin , anti a1(dolichos biflorus) lectin , anti a1(dolichos biflorus) lectin , anti d biclonal (igg+igm) blood grouping sera, 10 ml pack , anti d biclonal (igg+igm) blood grouping sera, 10 ml pack , anti d monoclonal (igg) blood grouping sera, 10 ml pack , anti d monoclonal (igg) blood grouping sera, 10 ml pack , anti h (ulex europeus) lectin, 10 ml pack , anti h (ulex europeus) lectin, 10 ml pack , antibody elution kit, 10 ml pack , antibody elution kit, 10 ml pack , banchtop blood bag tube sealer with battery backup , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 100 ml cpda , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 mlcpda (double) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml cpda (single) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml sagm (triple) , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 350 ml triple (without sagm) cpda , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (sagm) tripple bag , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood bag 450ml (without sagm) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti ab sera), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti abd), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (anti h sera), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (bovine albumin 22%), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss blood grouping), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss card), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss coombs), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera (liss diluent), 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping antisera, coombs sera (ahg) 10 ml pack , blood grouping gel card ahg c3d card (crossmatch), 24 card , blood grouping gel card forward & reverse grouping, 24 card , blood grouping gel card forward grouping, 24 card , calcium chewable tablets (10 tablets/ per pack) , check cells (coombs control cell), 10 ml pack , check cells (coombs control cell), 10 ml pack , copper sulphate of 1.053 specific gravity, 100gm/pack , copper sulphate solution of 1.053 specific gravity, 500ml/pack , copper sulphate solution of 1.053 specific gravity, 500ml/pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate reader , elisa plate washer , elisa reader printer roll (multiscan) , elisa reader printer roll (robonic) , elisa reader printer roll (robonic) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , fully automated elisa plate reader with washer , gel card centrifuge machine , gel card for gel card centrifuge, 24 card , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , haemo cue microcuvette , hb strips of hemocue (per strip) , hb strips of mission (per strip) , insulated box , insulated box , liss (low ionoc strength saline solution) 500ml pack , lyoplastin kit , lyoplastin kit , ph calibration fluids of ph 4.01, 7 and 10.01; 10 ml pack , phenotyping anti sera kit, 10 ml pack , phenotyping anti sera kit, 10 ml pack , plasma expressor , plasma expressor , platelet agitator cum incubator , platelet agitator cum incubator , portable tube sealer with battery backup , reagentredcellpanels(elevencellpanel)forantibody identifiction), 10 ml pack , reagent red cells for antibody screen (three or two cell panel), 10 ml pack , red circuler chart recorder pen (10 piece per pack) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , semi automated elisa plate reader & washer , squeeze ball for donors (per piece) , tscd cutting blade / wafers (10/pack) , tscd cutting blade / wafers (10/pack) , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , calibration kit for biochemistry , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. albumin kit , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. alkaline phosphate , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. amylase kit , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aptt kits , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. aslo kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin direct kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. bilirubin total kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. calcium kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. chloride kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck nac kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. ck mb kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. creatinine kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. crp quantitative kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. glucose kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. hdl kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. ldh kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. magnesium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. potasium kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. pt test kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. ra/rf (rheumatoid factor) kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgot kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sgpt kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. sodium kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total cholsterol kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. total protein kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. triglyceride kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. urea kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , s. uric acid kit , absorbent cotton wool (5/ pack) , amies media (500 gm / pack) , amies media (500 gm / pack) , amies media (500 gm / pack) , anaerobic gas pack (6 piece/pack) , anaerobic system mark ii , andrades (indicator) 125ml / pack , arabinose (10gm/pack) , arabinose (10gm/pack) , arabinose (10gm/pack) , autoclave biological indicator (250 piece/pack) , bacteroides bile esculin agar (500 gm/pack) , bacteroides bile esculin agar (500 gm/pack) , bacteroides bile esculin agar (500 gm/pack) , blood agar 500gm / pack , blood agar 500gm / pack , blood agar 500gm / pack , blood agar plate , blood agar plate , blood agar plate , blood culture bottle , blood culture bottle , blood culture bottle , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 20 ml. paed for blood culture , brain heart infusion 70 ml. adult for blood culture , brain heart infusion 70 ml. adult for blood culture , brain heart infusion 70 ml. adult for blood culture , cary blair’s transport media 500 gm / pack , cary blair’s transport media 500 gm / pack , cary blair’s transport media 500 gm / pack , cavity slide (10 per pack) , cetrimide agar 500 gm / pack , cetrimide agar 500 gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , chocolate agar 500 gm / pack , chocolate agar 500 gm / pack , cryo precipitate plasma thawing bath , cryo precipitate plasma thawing bath , cryo water bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , deoxycholate agar 500 gm / pack , deoxycholate agar 500 gm / pack , durham tube 100 piece/box , durham tube 100 piece/box , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 20ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , falcon tube 50ml (1x100 pack) , hot plate , loeffler’s medium 500 gm / pack , loeffler’s medium 500 gm / pack , loeffler’s medium 500 gm / pack , lowenstein jensen media. 500 gm / pack , lowenstein jensen media. 500 gm / pack , lowenstein jensen media. 500 gm / pack , mac cartney bottle 100ml (for blood culture) / pack , mac cartney bottle 100ml (for blood culture) / pack , mac cartney bottle 100ml (for blood culture) / pack , mac conkey agar plate , mac conkey agar plate , mac conkey agar plate , mannitol 25 gm / pack , mannitol 25 gm / pack , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set (each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard) , mcfarland standard set (each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard) , metal loops holder ( (w/o loop) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted) 1 x 8 / pack , metal loops holder ( (w/o loop) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted) 1 x 8 / pack , mueller hinton agar 500 gm / pack , mueller hinton agar 500 gm / pack , mueller hinton agar 500 gm / pack , nichrome loop d 4 (diameter : 4 mm, double wound, calibrated to 0.01ml.) 10x10 /pack , nichrome loop d 4 (diameter : 4 mm, double wound, calibrated to 0.01ml.) 10x10 /pack , nutrient agar 500 gm / pack , nutrient agar 500 gm / pack , nutrient agar 500 gm / pack , parafilm d m250 , parafilm d m250 , parafilm d m250 , peptone water , peptone water , peptone water , ph paper (range 2 to 10.5) 200 /pack , ph paper (range 2 to 10.5) 200 /pack , phenol red indicator 125ml /pack , phenol red indicator 125ml /pack , ppa broth and ppa reagent 500gm / pack , ppa broth and ppa reagent 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr broth500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , pyr reagent 500gm / pack , pyr reagent 500gm / pack , raffinose 10gm / pack , raffinose 10gm / pack , raffinose 10gm / pack , rcm broth 100gm / pack , rcm broth 100gm / pack , rcm broth 100gm / pack , safranin 0.5% w/v 500ml / pack , safranin 0.5% w/v 500ml / pack , safranin 0.5% w/v 500ml / pack , salmonella shigella agar 500gm / pack , salmonella shigella agar 500gm / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , sda agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , selenite f broth 500gm / pack , selenite f broth 500gm / pack , stained salmonella antigen set for widal tests (tube) , stained salmonella antigen set for widal tests (tube) , stained salmonella antigen set for widal tests (tube) , sterile cotton swab with wooden stick , sterile disposable petri plates polystyrene, size 120x15 mm 100 /pack , stock vial 5ml 50 / pack , stock vial 5ml 50 / pack , sucrose500gm/pack , sucrose500gm/pack , sucrose500gm/pack , tcbs agar 500gm / pack , tcbs agar 500gm / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thioglycolate broth 500gm / pack , thioglycolate broth 500gm / pack , tinsdale agar for diphtheria500gm , tinsdale agar for diphtheria500gm , tinsdale agar for diphtheria500gm , tissue roll 6/pack , tissue roll 6/pack , toothpick 100/pack , vdrl rotator/shaker , vibrio tcbs agar 500gm , vibrio tcbs agar 500gm , vibrio tcbs agar 500gm , vtm vial , vtm vial , zinc dust 500gm/pack , zinc dust 500gm/pack , ? napthol 100gm/pack , ? napthol 100gm/pack , ? napthol 100gm/pack , ? napthylamine 25gm/pack , ? napthylamine 25gm/pack , ? napthylamine 25gm/pack , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain a 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , albert’s stain b 500ml pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , crystal violet stain 100 gm pack , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain a (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , field stain b (500ml pack) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , giemsa stain solution (500ml bottle) , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , gram stain kit , india ink stain , india ink stain , india ink stain , india ink stain , india ink stain , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 1 for malaria parasite, 500ml/bottle , j.s.b. stain 2 for malaria parasite, 500ml/bottle , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , leishman stain 250 ml pack , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , lpcb stain 1 kit , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , new methylene blue stain for recticulocute count , nucleic acid stain , nucleic acid stain , nucleic acid stain , nucleic acid stain , nucleic acid stain , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , pap stain kit (1x250 test ) , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , rapid h&e stain kit 250 smear / kit , trichrome stain solution , trichrome stain solution , trichrome stain solution , trichrome stain solution , trichrome stain solution , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , z.n. stain for afb , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , sudan black stain solution (500ml/pack) , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , 3.8% sodium citrate solution for esr, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute alcohol 99.5%, 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute ethanol 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , absolute methanol (95%) 500ml pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetic acid 100ml / pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium oxalate 100 gm pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , ammonium solution (25%), 500ml pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , amonium sulphate 100 gm pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , bacl2 (barium chloride)10%, 500ml /pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , barium chloride 500gm pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , benedicts reagent 500 ml pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , buffer solution 500ml pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (powder) 100gm pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , carbol fuchsin (strong) 500ml pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , deionised water 20 liter pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , di ethyl ether 500ml pack , distilled water 10 ml pack , distilled water 10 ml pack , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ltr. pack , distilled water 5 ltr. pack , distilled water 5 ml pack , distilled water 5 ml pack , distilled water 5 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , drabkins solution 500 ml pack , edta powder 100gm pack , edta powder 100gm pack , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosin 2% (125ml / pack) , eosinophil diluting fluid (100 ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , esbachs reagent (125ml pack) , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , ferric chloride 100 gm pack , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , fouchet reagent (100ml/pack) , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , glutaraldehyde (5 liter / pack) , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , gluteraldehyde 100ml / pack , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 25% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , h2so4 5% (100ml/pack) , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl (3%) 100ml pack , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl concentrated (100ml/pack) , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hcl n/10 500ml/pack , hi chrome uti 500gm , hi chrome uti 500gm , iodine 100 gm pack , iodine 100 gm pack , koh 500gm pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , kovacs’ indole reagent 100ml / pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , leishman powder 25gm pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , liquid ammonia 500 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , lugols iodine 100 ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methyl red 125ml / pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue (0.3%, w/v, aqueous) 25gm pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , methylene blue 100ml pack , micro protien reagent (csf) 25ml pack , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , naoh concentrated (250ml/pack) , nitric acid , nitric acid , nitric acid , nitric acid , nitric acid , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline solution (0.9%)(500ml/pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , normal saline technical (5 liter / pack) , phenol (5%w/v, aqueous) 500 gm/pack , phenol (5%w/v, aqueous) 500 gm/pack , platelet diluting fluid 100ml/pack , platelet diluting fluid 100ml/pack , platelet diluting fluid 100ml/pack , potassium iodide 50 gm pack , powder sulphur (500gm/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , rbc diluting fluid (100 ml/pack) , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , semen diluting fluid 125 ml pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 10%, 500 ml/ pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochloride 5%, 500 ml / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium hypochlorite (4% w/v solution) 5 litre / pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sodium nitropruside crystal 50gm pack , sorbitol 500gm / pack , sorbitol 500gm / pack , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sprit rectified clinical / surgical sprit (500ml/pack) , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , sulfosalicylic acid 3% , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , tincher iodine (5 liter / pack) , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , total eosinophil count fluid 125 ml/pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , w.b.c diluting fluid 500ml pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , xylene (sulphur free) ar 2.5 liter pack , clot activator vial, non vacume, double cap, red cap 4 ml , clot activator vial, non vacume, double cap, red cap 4 ml , clot activator vial, non vacume, double cap, red cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , gel with clot activator vial, non vaccume, double cap, yellow cap 4 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 2 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , k3 edta vial, non vacume, double cap, lavender cap 6 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , lithium heparin vial, non vacume, double cap, grey cap 2 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 0.5 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric k3 edta vial, non vacume, double cap, lavender cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric lithium heparin vial, non vacume, double cap, grey cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric plain serum vial, non vacume, double cap, red cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium flouride vial, non vacume, double cap, black cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , pediatric sodium heparin vial, non vacume, double cap, green cap 1 ml , plain serum vial, non vacume, double cap, red cap 4 ml , plain serum vial, non vacume, double cap, red cap 4 ml , plain serum vial, non vacume, double cap, red cap 4 ml , ria vial, non vacume 4 ml , ria vial, non vacume 4 ml , ria vial, non vacume 4 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, black cap(3.8%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium citrate vial, non vacume, double cap, blue cap(3.2%) 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium flouride vial, non vacume, double cap, black cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , sodium heparin vial, non vacume, double cap, green cap 2 ml , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igg kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa borrelia igm kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa chickungunya kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igg kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa cmv igm kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igg kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue igm kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns 1 kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa dengue ns1, igg & igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hav igm kit (96 test/kit) , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 3rd generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hbsag kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 3rd generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hcv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 3rd generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hiv kit (96 test/kit) 4th generation , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv 1/2 igm kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa hsv1/2 igg kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igg for measles kit (96 test/kit) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis a (96 test) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for hepatitis e kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for leptospirosis kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa igm for measles kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa leptospira igm kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rotavirus antien kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm & igg kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa rubella igm kit (96 test/kit) , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa scrub typhus kit (96 test/kit , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igg kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa toxoplasma igm kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , elisa varicella zoster virus igg kit (96 test/kit) , g 6 pd dificiency quantitative test kits (12 tests / kit) , glucometer strips, 100 strips per pack , glucometer strips, 100 strips per pack , rapid haem test for ocult blood in stool (guaiac test) , rapid haem test for ocult blood in stool (guaiac test) , rapid haem test for ocult blood in stool (guaiac test) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid ag test for backterial meningitis (menigococci) , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card positive & negative control sera for hiv, hcv, hbsag , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chalmydia antigen , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for chickungunya igm , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for covid 19 antigen card , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for cryptococcal antigen , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue day 1 test , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue lgg & lgm , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1 antigen , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for dengue ns1, igg,igm , rapid card test for filariasis , rapid card test for filariasis , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hbsag , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hcv tri dot , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv 4th generation , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv combaids , rapid card test for hiv tri dot , rapid card test for hiv tri dot , rapid card test for hiv tri dot+ag , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for igg/igm ab , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for kala azar (2k39) , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for leptospira igm/igg , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for malaria (pv & pf) , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for microfilaria antigen , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for occult blood in stool (guaiac method) , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for rotavirus antien , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for scrub typhus , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for sickle cell anaemia , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for toxoplasma , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for treponema screening , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin i , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for troponin t , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for typhoid igm & igg , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for varicella zoster virus (igm) , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for vdrl/rpr (syphilis) card , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (slide method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test for widal test kit (tube method) 4x5ml , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid card test single for hiv & hcv , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid combi card test for hiv, hbsag, hcv, syphilis , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for aso kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for crp kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid latex slide test for rf/ra kit , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid pregnancy (hcg) test card , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rapid strip test for vdrl , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , rpr (rapid plasma reagin) for syphilis , test for iodine in salt , test for iodine in salt , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine ketone strips (100 strips/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine micro albumin strip (100/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 11 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 12 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 13 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips 14 parameter(100 strips/pack) , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips for albumin and sugar , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips multi parameter for sd urometer 120 (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 10 parameter (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 2 parameter glucose & protein (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 3 parameter glucose, protein & ketons (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , urine strips with 4 parameter glucose, protein, ph & sg (100 strips/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , uristicks (albumin sugar) (100/pack) , water testing by strip method , water testing by strip method , amikacin 30 ?g , amikacin 30 ?g , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , amoxicillin 25 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , ampicillin 2 ?g , ampicillin 2 ?g , azithromycin 15?g , azithromycin 15?g , azithromycin 15?g , aztreonam 30 ?g , aztreonam 30 ?g , aztreonam 30 ?g , bacitracin 130 ?g/10 ui , bacitracin 130 ?g/10 ui , bacitracin 130 ?g/10 ui , carbenicillin 100 ?g , carbenicillin 100 ?g , carbenicillin 100 ?g , cefaclor 30 ?g , cefaclor 30 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefalexin 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefamandole 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefazolin 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefepime 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefixime sµg 10 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefoperazone 75 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 30 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotaxime 5 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefotetan 30 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefoxitin 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpirome 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefpodoxime 10 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefprozil 30 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , cefsulodin 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 10 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftazidime 30 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftibuten 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , ceftriaxone 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cefuroxime 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , cephalotin 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , chloramphenicol 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , ciprofloxacin 5 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clarithromycin 15 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clindamycin 2 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 10 ?g , colistin 10 ?g , colistin 50 ?g , colistin 50 ?g , colistin 50 ?g , doripenem 10 ?g , doripenem 10 ?g , doripenem 10 ?g , doxycycline 30 ?g , doxycycline 30 ?g , doxycycline 30 ?g , ertapenem 10 ?g , ertapenem 10 ?g , ertapenem 10 ?g , erythromycine 15 ?g , erythromycine 15 ?g , erythromycine 15 ?g , flumequine 30 ?g , flumequine 30 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 200?g , fosfomycin 200?g , fosfomycin 50 ?g , fosfomycin 50 ?g , fosfomycin 50 ?g , fusidic acid 10 ?g , fusidic acid 10 ?g , fusidic acid 10 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 120 ?g , gentamicin (high load) 500 ?g , gentamicin (high load) 500 ?g , gentamicin (high load) 500 ?g , gentamicin 10 ?g , gentamicin 10 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 15 ?g / 10 ui , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , gentamicin 30 ?g , gentamicin 30 ?g , imipenem 10 ?g , imipenem 10 ?g , imipenem 10 ?g , isepamicin 30 ?g , isepamicin 30 ?g , isepamicin 30 ?g , kanamycin (high load) 1mg , kanamycin (high load) 1mg , kanamycin (high load) 1mg , kanamycin 30 ?g , kanamycin 30 ?g , kanamycin 30 ?g , levofloxacin 5 ?g , levofloxacin 5 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , lincomycin 15 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 10 ?g , linezolid 10 ?g , linezolid 30 ?g , linezolid 30 ?g , linezolid 30 ?g , mecillinam 10 ?g , mecillinam 10 ?g , mecillinam 10 ?g , meropenem 10 ?g , meropenem 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , metronidazole 4 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , mezlocillin 75 ?g , mezlocillin 75 ?g , minocycline 30 ?g , minocycline 30 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxalactam 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , moxifloxacin 5 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , mupirocin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , nalidixic acid 30 ?g , nalidixic acid 30 ?g , neomycin 30 ui , neomycin 30 ui , neomycin 30 ui , netilmicin 10 ?g , netilmicin 10 ?g , netilmicin 10 ?g , netilmicin 30 ?g , netilmicin 30 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 100 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitrofurantoin 300 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , nitroxolin 20 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 10 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , norfloxacin 5 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , ofloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 1 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxacillin 5 ?g , oxacillin 5 ?g , oxidase discs , oxidase discs , oxidase discs , oxolinic acid 10 ?g , oxolinic acid 10 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , pefloxacin 5 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 1 iu , penicillin 1 iu , penicillin 6 ?g / 10 iu , penicillin 6 ?g / 10 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , pipemidic acid 20 ?g , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 100 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 30 ?g , piperacillin 30 ?g , piperacillin 75 ?g , piperacillin 75 ?g , piperacillin 75 ?g , polymixin 50 ?g/ 300 ui , polymixin 50 ?g/ 300 ui , polymixin 50 ?g/ 300 ui , pristinamycin 15 ?g , pristinamycin 15 ?g , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , quinupristin dalfopristin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 30 ?g , rifampicin 30 ?g , rifampicin 5 ?g , rifampicin 5 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , sparfloxacin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spectinomycin 100 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , spiramycin 100 ?g , spiramycin 100 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 300 ?g , streptomycin (high load) 500 ?g , streptomycin (high load) 500 ?g , streptomycin (high load) 500 ?g , streptomycin 10 ?g , streptomycin 10 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 200 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , sulfonamides 300 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , teicoplanin 30 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , telithromycin 15 ?g , telithromycin 15 ?g , tetracycline 30 ?g , tetracycline 30 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , ticarcillin 75 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tigecycline 15 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 10 ?g , tobramycin 10 ?g , tobramycin 30 ?g , tobramycin 30 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , trimethoprim 5 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin5 ?g , vancomycin5 ?g , vancomycin 30 ?g , vancomycin 30 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 100x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 10x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , 40x lens for binocular microscope , blood cell counter 8 key + 1 totaliser , blood cell counter 8 key + 1 totaliser , blood mixer/roller/rotator , bone marrow aspiration needle (metal, salah type) , bone marrow aspiration needle (metal, salah type) , bone marrow biopsy needle (jamshidi) , bone marrow biopsy needle (jamshidi) , bt/ct capillary tube, 100/pack , centrifuge machine (08 tubes) , centrifuge machine (08 tubes) , centrifuge machine (08 tubes) , centrifuge machine (16 tubes) , centrifuge machine (16 tubes) , centrifuge machine (16 tubes) , centrifuge machine (24 tubes) , centrifuge machine (24 tubes) , centrifuge machine (24 tubes) , centrifuge machine (36 tubes) , centrifuge machine (36 tubes) , centrifuge machine (36 tubes) , conical flask glass 250ml , conical flask glass 500ml , container (plastic), 1 liter , coplins jar (vertical) glass with cap , coplins jar (vertical) plastic with cap , cotton swab (50 piece pack) , cover slip 18x18 mm (50/pack) , cover slip 18x18 mm (50/pack) , cover slip 18x36 mm (50/pack) , cover slip 18x36 mm (50/pack) , cover slip 22x22 mm (50/pack) , cover slip 22x22 mm (50/pack) , cover slip 22x50 mm (50/pack) , cover slip 22x50 mm (50/pack) , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling (30 ml / pack) , dpx mount for sickling (30 ml / pack) , dropper plastic 1 ml, (100/pack) , dropper plastic 2 ml, (100/pack) , dropper plastic 3 ml, (100/pack) , dropper plastic 5 ml, (100/pack) , esbachs albuminometer , esr fluid (500ml pack) , esr fluid (500ml pack) , esr fluid (500ml pack) , esr fluid (500ml pack) , esr pipette with vaccum plug, 100/pack , esr pipette with vaccum plug, 100/pack , esr pipette with vaccum plug, 100/pack , esr stand (westergreen iron 6 key) , esr stand (westergreen iron 6 key) , esr stand (westergreen iron 6 key) , esr stand (westergreen plastic 6 key) , esr stand (westergreen plastic 6 key) , esr stand (westergreen plastic 6 key) , esr tube (0 200) westergreen glass, 2ml , esr tube (0 200) westergreen glass, 2ml , esr tube (0 200) westergreen glass, 2ml , esr tube (disposable) , esr tube (disposable) , esr tube (disposable) , esr tube with cap , esr tube with cap , esr tube with cap , esr tube with cap reusable , esr tube with cap reusable , esr tube with cap reusable , funnel (conical ) keep plastic transparent , funnel conical, 250 gram capacity , funnel conical, 500 gram capacity , glass slide box (75x25x1.35 mm) (100 slides/pack) , glass slide box (75x25x1.35 mm) (100 slides/pack) , glass stirring rod , glass test tube (12x100 mm) , glass test tube (12x75 mm) , glass test tube (15x100mm) , glass test tube (15x150mm) , glucometer , glucometer , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb estimation kit ( drabkin solution with standard solution by colorimter method, sahlis hemoglobinometer ) , hb meter(top square) , hb pipette top square , hb tube round , hb tube square , hydrometer (for specific gravity) , hydrometer (for specific gravity) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , immersion oil for binoculer microscope (30ml/pack) , lancet (100/pack) , lancet (100/pack) , litmus paper (acidic & basic) (20 piece / pack) , litmus paper (acidic & basic) (20 piece / pack) , microscope binocular with led illumination with battery backup , microscope binocular with led illumination with battery backup , microscope binocular with led illumination with battery backup , microscope bulb (low voltage halogen lamp & led) , microscope bulb (low voltage halogen lamp & led) , microscope bulb (low voltage halogen lamp & led) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , pasteur pipette (dropper) glass , pcv tube (wintrobe tube) , pcv tube (wintrobe tube) , ph meter , ph paper packet (20 piece / pack) , ph paper packet (20 piece / pack) , plastic slide storage box for 50 slides , plastic slide storage box for 50 slides , plastic test tube 3 inch (100/pack) , plastic test tube 3 inch (100/pack) , plastic tray for lab , plastic tray for lab , ppd syringe 100 / pack , ppd syringe 100 / pack , r.b.c pipette , r.b.c pipette , semen/ sputum/ urine / stool container plastic with cap 30 ml , semen/ sputum/ urine / stool container plastic with cap 50 ml , spatula with cytobrush , spirit lamp , spirit lamp , staining jar trough glass for 10 slides each , staining jar trough glass for 10 slides each , storage vial , syringe holder for fnac (20ml syringe) , syringe holder for fnac (20ml syringe) , syringe holder for fnac (20ml syringe) , thermal printer roll for 3 part cbc horiba (57mm x 10 meter) , thermal printer roll for 3 part cbc vector (50mm x 20 meter) , thermal printer roll for sd 120 urine analyzer (55mm x 20 meter) , thermal printer roll for stago coagulation analyzer (110mm x 25 meter) , urinometer , urinometer , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 10 ml plain , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vaccutainer needle , vaccutainer needle , vaccutainer needle , vacutainer pack , vacutainer pack , vacutainer pack , vacutainer pack , w.b.c pipette , whatman filter paper (round) 125 mm (1x50 pack) , whatman filter paper (round) 125 mm (1x50 pack) , wooden slide storage box for 50 slides , wooden slide storage box for 50 slides , zip lock plastic bag 4*6 inch (100 piece / pack) , zip lock plastic bag 4*6 inch (100 piece / pack) , zip lock plastic bag 6*8 inch (100 piece / pack) , zip lock plastic bag 6*8 inch (100 piece / pack) , zip lock plastic bag 8*10 inch (100 piece / pack) , zip lock plastic bag 8*10 inch (100 piece / pack) , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 4.0 8.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , buffer tablets, ph 6.8 7.0, 10 tablets/pack , disposable abg syringe without needle 3 ml , disposable abg syringe without needle 3 ml , disposable abg syringe without needle 3 ml , disposable glove without powder (nitrile) size 6 , disposable glove without powder (nitrile) size 6.5 , disposable glove without powder (nitrile) size 7 , disposable glove without powder (nitrile) size 7.5 , disposable needle no. 22 , disposable needle no. 22 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 23 , disposable needle no. 23 , disposable needle no. 24 , disposable needle no. 24 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 10 ml , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 2 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 20 ml , disposable syringe 20 ml , disposable syringe 3 ml , disposable syringe 3 ml , disposable syringe 3 ml , disposable syringe 5 ml , disposable syringe 5 ml , disposable syringe 5 ml , dropper glass 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , hand wash liquid soap (100ml / pack) , hitachi sample cup 2 ml 500/pack , hitz cuvatte , hitz cuvatte , hypodermic needle, 21g,1.5 , icebox (2liter capacity) , measuring cylinder 0 to 100 ml graduated glass , measuring cylinder 0 to 1000 ml graduated glass , measuring test tube glass 0 10 ml graduated conical , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 100 1000 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips blue, 10 200 micro liter (1000/pack) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (large) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips stand plastic (small) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips white (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , micro tips yellow (1000/pack) , microcentifuge tude 0.5 ml , microcentifuge tude 1.5 ml , microcentifuge tude 2.0 ml , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 0 10 ul capacity , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 ul fix volume , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 100 1000 ul capacity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 10 100 ul capicity , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 50 ul fix volume , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , micropipette 5 50 ul capacity , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )100 1000 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , multi channel pipette (8 key )10 100 ul , pasteur pipettes 0.25 ml capacity 500/pack , pasteur pipettes 0.50 ml capacity 500/pack , pasteur pipettes 1 ml capacity 500/pack , pasteur pipettes 10 microliter capacity 500/pack , pasteur pipettes 3 ml capacity 500/pack , pasteur pipettes 5 ml capacity 500/pack , cd/dvd/ohp fine tip marker pen, red , cd/dvd/ohp fine tip marker pen, red , cd/dvd/ohp fine tip marker pen, black , cd/dvd/ohp fine tip marker pen, black , petridish 90 mm diameter, 15 mm height 1 piece , pipette stand plastic for 5 pipette , pipette stand plastic for 5 pipette , pipette stand plastic vertical 28 holes 12 mm , pipette stand plastic vertical 28 holes 12 mm , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide staining rack for 25 slides(swing handlr, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain stand (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , slide stain tray (20 slide, ss) , sticker (50/pack) , stop watch racer (plastic ) , test tube holder , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand for blood collection plane 96 hole, 12mm plastic , test tube stand stainless steel ( 12x75 mm) , test tube stand stainless steel ( 12x75 mm) , test tube stand stainless steel ( 15x100 mm) , test tube stand stainless steel ( 15x100 mm) , test tube stand stainless steel ( 15x150 mm) , test tube stand stainless steel ( 15x150 mm) , thermocal box (5 liter capacity) , torniquet , torniquet , tube holder for 10 ml tubes , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , tube holder for 5ml tubes , urine container, plastic, 30 ml, sterilized , urine container, plastic, 30 ml, sterilized , urine container, plastic, 50 ml, sterilized , urine container, plastic, 50 ml, sterilized...

Government Dental College - Rajasthan

37867416 tenders are invited annual rate contract for supply of oral pathology items for hospital use. 1 isopropyl alcohol 99.9% 5 ltr 2 xylene max limit of impurities <_0.01% 5 ltr 3 acetone weight / ml at 20 degree centigrade is 0.789 0.791gm 5 ltr 4 eosin stain ready to use 500 ml 5 haematoxylin stain ready to use 500 ml 6 paraffin wax paraffin wax with ceresin at 60 degre 7 hydrochloric acid ar ( hcl ) 500 ml 8 acetic acid max limit of impurities 0.01% weight per ml at 20 degree is 1.048 1.0519 500 ml 9 dpx ( mounting agent ) refractive index 1.515 to 1.525 250 ml 10 formaldehyde ( 4% of formaldehyde ) 11 pap stain kit 3 minute rapid kit 1 kits with reagents 12 hematoxylin powder passes performance test 5gm 13 mercuric oxide 250gm 14 eosin powder eosin y power 25gm 15 tissue paper roll 6 rolls / packet 16 filter paper 12.5 cm diameter 1pkt 17 glass slides marker slide on the side 25x75 ± 1mm 1box 18 glass cover slips 22”x50” rectangular 10 / box 19 microtome blade high profile disposable, high profile, stainless steel 50 blades / box 20 congo red stain ready to use 1kit 21 masson trichrome stain ready to use 1kit 22 sudan black stain ready to use 1 kit 23 measuring beaker 200 ml borosil glass with marking unit 24 measuring beaker 50 ml borosil glass with marking unit 25 measuring beaker 500 ml borosil glass with marking unit 26 processing jars 1 litre borosil glass jars with screwed metal cap 1 piece 27 pas stain ready to use 1kit 28 diamond marker 1 piece 29 camel pen stain solution 1 piece 30 geimsa stain solution ready to use 500ml 31 ethyl alcohol 500ml 32 deionized water 5000 ml 33 glycerol refractive index 1.471 1.473 500ml 34 permanent marker pen thin black 1piece 35 aluminum postassium 36 distilled water 5 lit. 37 gram stain kit 1 kit 38 culture media nutrient agar 500gm each 39 antibiotic sensitivity test kit 1 kit 40 surgical blade holder 1 pieces 41 disposable plastic tubes 10 packets 10 ml 7 packets5ml 42 micropipette tips small units 43 tournicate units 44 capillary tube’s 1pkt x 10 pieces 45 bd vacutainer needle unit 46 vacutainer tubes plain ( glass ) 3ml 47 vacutainer tubesedta ( glass ) 3ml 48 leishmann stain 500ml 49 plain test tubes ( glass ) 5ml 50 plain test tubes 10ml 51 rbc fluid 500ml 52 wbc diluting fluid 500ml 53 cbc reagent kit abx minidil 20 lts lysebio 1lts abx cleaner l lts 54 n / 10hcl 500ml 55 leishmann buffer 500ml 56 esr solutions 3.8% sodium 500ml 23 citrate 57 neubuer chamber cover slip 1pkts 58 cell counting chamber units 59 tissue specimen bottles 1k piece 60 floxin b powder 250gm 61 sugar vail vacutainer ( floride vail ( glass ) 2ml 62 pt tubes ( vacutainer vail ) ( glass ) 2ml 63 printing paper roll for cbc machine units 64 black marker 15 pen 65 test tubes 5ml 66 test tubes 2 ml 67 block boxes...

Department Of Atomic Energy - Rajasthan

37860858 bids are invited for chemicals 1 53 sulfuric acid 98 percent , methyl orange indicator , xylene cyanol ff , hydrochloric acid min. 35 percent , sodium hydroxide pellets , phenolphthalein , silver sulfate , ammonium iron ii sulfate hexahydrate , mercury ii sulfate , potassium dihydrogen ortho phosphate , di potassium dihydrogen ortho phosphate anhydrous , di sodium hydrogen phosphate heptahydrate , ammonium chloride , magnesium sulfate heptahydrate , calicium chloride dihydrate , iron iii chloride hexahydrate , d glucose, anhydrous, dextrose , l glutamic acid hydrochloride , sodium azide , sodium chloride , silver nitrate , potassium chromate , aluminium potassium sulfate dodecahydrate , aluminium ammonium sulfate dodecahydrate , bromo phenol blue indicator , hydroquinone , barium perchlorate anhydrous , perchloric acid 60 percent , thorin indicator , eriochrome black t indicator , total hardness indicator tab , sodium sulfite anhydrous , edta acid , edta disodium salt dihydrate , magnesium chloride hexahydrate , calcium carbonate precipitated , methyl red indicator , calcon metal indicator , methanol , potassium bromate , dodecyl sulfate sodium salt , potassium iodide , starch soluble , manganese ii sulfate monohydrate , starch 1 percent aqueous solution stabilized , sodium carbonate anhydrous , potassium hydroxide pellets , whatman filter paper , alkali blue indicator , toluene , acetic acid glacial , bromothymol blue indicator , d sorbitol 98 percent , hexamythylenetetramine , xylenol orange indicator , 4 dimethyl amino benzaldehyde , hydronium sulfate , anode solution for coulomatric kf titration , cathode solution for coulomatric kf titration total quantity : 9865...

Government Medical College - Rajasthan

37860249 rate contract for chemicals, test kits, reagents, media and glassware , (a)chemicals preferred make: merck, cdh, qualigens, srl, himedia, thermofisher , absolute alcohol /ethanol absolute ar , acetic acid glacial ar , acetone ar , acid fuchsin m.s/ certified , agar agar powder , albumin egg flakes , alcian blue m.s/ certified , amido black stain , aluminum sulphate ar , aluminum chloride , alkaline haematin d regentwith haemoglobin standard 9.0 g/dl , alkaline haematin d regentwith haemoglobin standard &15.0 g/dl , ammonia solution30% , ammonium oxalate ar , ammonium potassium sulphate (alum) , ammonium sulphate ar , aniline blue m.s/ certified , anti microbial hand rub , anti sera a, anit sera b and anti sera d one set of blood group antiseras containing each of 10ml. all antisera must be monoclonal must be able to deduct weakerblood groups , avidity nust be less than 5 second , barium chloride ar , basic fuchsin m.s/ certified , agar agar bacteriological , bees wax, yellow , benedict’s reagents qualitative lr , benzidine powder , benzidine powder dihydrochloride , biebrich scarlet m.s certified , bouin’s fluid fixing solution , brilliant cresyl blue m.s/ certified , bromophenol blue , boric acid ar , borate buffer ph 9.0 , borax powder ep , buffer tablets6.2 ph , buffer tablets7.0 ph , buffer tablets9.2 ph , calcium chloride ar , congo red m.s/ certified , carbol fuchsin dilute , carbol fuchsin strong , carmine m.s./certified , cedar wood oil , charcoal activated ar , citric acid ar , crystal violet m.s/ certified , csf diluting fluid , dextrose ndhydrous /d glucose , d.p.x. mountant , darbkin’s solution , deionised water , distilled water , di sodium hydrogen ortho phosphate , diastage , emry powder no 2 , emry powder no 3 , eosin water soluble , eosinophil counting fluid , esbach’s reagent , ehrlich’s reagents solution , ethylene diamine tetra acitic acid (edta) , fast green ms , ferric ammonium sulphate , fetal hb kits , formal dehyde (37 41%) w/var , fouchet’s reagents , field staina sol’n , field stainb sol’n , gram’s iodine ms , g6pd reagent kit (qualitative) , giemsa stain powder m.s/certified , giemsa stain solution , glycerol ar , gold chloride m.s , hematoxylin powder ms/certified , hematoxylin may’s soln ms , haemoglobin standard , hemocue hb microcuvettes , hydrochloric acid (concentrated) , hydrogen peroxide (6%) , iodine powder , iso propyl alcohol ar , kaolin light ep , labogent/labklin(glass cleaning solution ) , leishman’s stain solution m.s , leishman’s stain powderm.s/ certified , light green m.s/ certified , liquid paraffin oil heavy , liquid paraffin oil light , lithium carbonate ar , lugol’s iodine , mercuric oxide red purified , metanil yellow m.s/ certified , methanol ep (acetone free) , methyl violet m.s/ certified , methyline blue m.s/ certified , myeloperoxidase stain , neutral red m.s/ certified , n/10 hcl , nitric acid ar , normal saline 0.9% , paraffin wax with ceresin, in block form (600 620) , paraffin wax with ceresin, in block form (580 600) , peanut oil , periodic acid m.s/ certified , phenol crystal , phosphomolibidic acid , phosphotungestic acid ar , picric acid (saturated) , platelet count fluid , phloxin –b m.s/ certified , phenyle , potassium dichromate , potassium ferrocynide , potassium hydroxide pellets , potassium iodine ar , sodium acetate ep(anhydrous) , sodium chloride ep , sodium citrate 3.8% , sodium carbonate , sodium dihydrogen ortho phosphate , sodium hypo chlorite solution 4% , sodium hydrogen phosphate ar , sodium di hydrogen phosphate ar , sodium nitrate ar , sodium nitropruside , sodium sulphate ar , sodium thiosulphate , sudan black , spirit , sulphosalicylic acid , potassium metabisulphite ar , potassium permangnatepurified , ponceau’s stain , rapid pap’s kit , rbc counting fluid , reticulocyte count fluid , semen diluting fluid , silver nitrate ep , xylene sulphur free , sulpher powder , sulphuricacid pure , thymol crystal , toludine blue m/s certified , tris buffer phosphate , tris sodium citrate , wbc counting flude , hexamine , chromium trioxide , sodium powder , b antibody forimmuno histochemistry (ihc test) (a) products should be mouse/rabbit monoclonal type. (b) price will be calculated on per ml basis. (c) it should have shelf life of minimum 12 months from supply. (d) due to low consumption & short expiry, small packing (1x2/6ml)preferred (e) all antibodies should be usfda/bis approved (not registered only). the certificate should be provided. , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp dab substrate buffer & dab chromogen for 100 tests or 10ml along with histozyme enzyme , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp, dab substrate buffer & dab chromogen for 250 tests or 25ml along with histozyme enzyme , hematoxyleane , adhesive for ihc/ tissue bond , alk 1 (monoclonal mouse anti human cd246, clone) , alk 1 (monoclonal mouse anti human cd246, clone) , alpha feto protein (afp) (polyclonal rabbit anti human ) , alpha feto protein (afp) (polyclonal rabbit anti human ) , amacr (monoclonal mouse anti human clone 13h4) , amacr (monoclonal mouse anti human clone 13h4) , androgen receptor (ar) , androgen receptor (ar) , antibody diluent (vidas rub igm) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 2 , bcl 2 , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , bob 1 , bob 1 , brachyury , brachyury , calcitonin (polyclonal rabbit anti human calcitonin) , calcitonin (polyclonal rabbit anti human calcitonin) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret1) , cam 5.2 , cam 5.2 , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 2 (monoclonal mouse anti –human) , cd 2 (monoclonal mouse anti –human) , cd 20 (monoclonal mouse anti –human cd20,clone ber h2) , cd 20 (monoclonal mouse anti – human cd20,clone ber h2) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 22 , cd 22 , cd 24(monoclonal mouse anti – human cd24, classii clone qbend 10) , cd 24 (monoclonal mouse anti –human cd24, classii clone qbend 10) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 56 (monoclonal mouse anti – human cd56,clone 122c2) , cd 56 (monoclonal mouse anti –human cd56,clone 122c2) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 61 , cd 61 , cd 68 (monoclonal mouse anti –human cd68,clone pgm1) , cd 68(monoclonal mouse anti – human cd68,clone pgm1) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 99 (monoclonal mouse anti – human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd11c , cd11c , cd14 , cd14 , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , chromogranin , chromogranin , citrate retrieval buffer ( ph. 6.0) , tris edta retrieval buffer (ph. 9.0) , immuno wash buffer , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 7 (monoclonal mouse anti – human cytokeratin 7,clone ov tl12/20) , ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/20) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , dab chromogen , dab substrate buffer (100ml) , delimiting pen /novo pen/pap pen , desmin (monoclonal mouse anti –human desmin,clone d22) , desmin (monoclonal mouse anti –human desmin,clone d22) , dog 1 , dog 1 , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , egfr , egfr , ema (monoclonal mouse anti – human epithelial membrane antigen,clonee29) , ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , fl i 1 , fl i 1 , galectin 3 , galectin 3 , gfap (polyclonal rabbit gfap) , gfap (polyclonal rabbit gfap) , glypican 1 , glypican 1 , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg beta , hcg beta , her 2 neu (polyclonal rabbit anti human cerb 2) , her 2 neu (polyclonal rabbit anti human cerb 2) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hmwck(monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hpv , hpv , ihc coated slides , immuno wash buffer , inhibin , inhibin , inhibin alpha , inhibin alpha , ini 1 , ini 1 , kappa light chain (polyclonal rabbit anti human kappa light chains) , kappa light chain (polyclonal rabbit anti human kappa light chains) , ki 67 (ki 67 antigen clone mib 1) , ki 67 (ki 67 antigen clone mib 1) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , melan a (monoclonal mouse anti human melan a clone a102) , melan a (monoclonal mouse anti human melan a clone a102) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , muc 2 , muc 2 , muc 5 ac , muc 5 ac , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , myo d1 , myo d1 , myogenin (monoclonal mouse anti myogenin clone f5d) , myogenin (monoclonal mouse anti myogenin clone f5d) , napsin a , napsin a , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , oct 2/4 , oct 2/4 , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 63 , p 63 , pax 8 , pax 8 , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , s 100 (polyclonal rabbit antis100) , s 100 (polyclonal rabbit antis100) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sox 11 , sox 11 , synaptophysin (monoclonal mouse antisynaptophysin sy28) , synaptophysin (monoclonal mouse antisynaptophysin sy28) , tdt , tdt , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , tle 1 , tle 1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , vimentin (monoclonal mouse antivimentin v9) , vimentin (monoclonal mouse antivimentin v9) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , c antibody for immunofluorescence microscopy , albumin, polyclonal fitc ready to use for immunofluorescence rabbit anti albumin conjugated to fluorescein isothiocyanate. , c1q complement, polyclonal fitc ready to use for immunofluorescence rabbit anti c1q complement conjugated to fluorescein isothiocyanate , c2c complement, polyclonal fitc ready to use for immunofluorescence sheep anti c2c complement conjugated to fluorescein isothiocyanate , fibrinogen, polyclonal fitc ready to use for immunofluorescence rabbit anti fibrinogen conjugated to fluorescein isothiocyanate , immunoglobulin a (iga), polyclonal fitc ready to use for immunofluorescence sheep anti iga conjugated to fluorescein isothiocyanate , immunoglobulin g (igg), polyclonal fitc ready to use for immunofluorescence sheep anti igg conjugated to fluorescein isothiocyanate , immunoglobulin m (igm), polyclonal fitc ready to use for immunofluorescence rabbit anti igm conjugated to fluorescein isothiocyanate , kappa, polyclonal fitc ready to use for immunofluorescence rabbit anti kappa conjugated to fluorescein isothiocyanate , lambda, polyclonal fitc ready to use for immunofluorescence rabbit anti lamda conjugated to fluorescein isothiocyanate , mount staining reagent , blocking reagent , c antibody for immunofluorescence microscopy , (1)cal.thromboplastin/neoplastine with solvent (sta neoptimal 5) , (2)pt neoplastin (sta neoptimal 10) , (3)aptt activated partial thromoplastin (c.k.prest 2) , (4) fib.2 fibrinogen (sta fibrinogen 5) , (5) calcium cloride (sta cacl2 0.025 m , other items for coagulometer (6)cuvette (sta cuvettes) , (7)fintips for start 4 1.25 ml , (8) steel bals (sta steel bals , (9)thermal paper size 50 mm , c antibody for immunofluorescence microscopy , (1) actime , (2) erba protime ls , (3) erba actime , (4) reaction tubes su 40 , (5) reaction tubes su 40 , (6) erba factor vii deficient plasma , (7) erba factor x deficient plasma , (8) erba factor ix deficient plasma , (9) erba factor viii deficient plasma , (10)erba factor xi deficient plasma , (11)erba factor xii deficient plasma , (12)erba thrombin reagent , (13)erba thrombin time , (14) thermal printer paper (printer paper roll kit) , (15)erba calcium chloride , (16) erba control p , (17) erba control n , (18) erba control n plus , (19) erba control p plus , (20) control plasma n , (21) erba d dimer calibrator , (22)erba d dimer control n + p , (23)erba d dimer r , (3) properiatory items/reagents/consumable for fully automated esr analyzer model: vasmatic cube 80 make:transasia , (1)vasmatic esr controls normal , (2)abnormal , (3) transponder , (4)esr vaccutainer , (4) properiatory items/reagents/consumables for electronic blood cell counter sysmex xs 800i proprietary items for make : sysmex , (1) cell pack pk dcl , (2) stromatolyser 4dl ffd 200a , (3) sulpholyser sls 220 a , (4) stromatolyser 4ds ffs 800a , (5) cell clean , (6) control xs 800i tri level , (7)pm kit & air pump assembly , (8)solenoid valve lvm11 6a2(av199859) , (9)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (10) tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (11)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (12)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (13)calibrator for 5 part hematology analyzer , (5) proprietary item for machine: reagents for fully automated diferential haematology analyzer,model: xn 10 / xn 1000 / xn 550 / xn 350 make: sysmex , (1)cell pack dcl , (2) cell pack dfl , (3)sulfolyser , (4)flurocell wdf , (5)flurocell wnr , (6)lysercell wnr , (7)lysercell wdf , (8)fluorcell ret , (9)fluorcell plt , (10)cell clean , (11)xn check (tri level) control , (12)xn check bf (l1 3.0ml: l2 3.0 ml) , (13)xn cal(calibrator) , (14)pm kit & air pump assembly for xn series , (15)solenoid valve lvm11 6a2(av199859) , (16)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (17)tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (18)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (19)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (6) rajasthan medical service corporation ltd approved items for electronic blood cell counter 3 part, model: abx micros es 60,make: horiba , (1) minidil lmg , (2) abx lyse bio , (2)abx cleaner , (4) minoclair , (5) minitrol 16(2l) , (6) minitrol 16(2n) , (7) minotrol 16(2h) , (8)minotrolcalibrator , (9) printer roll , (7)proprietary items / consumables for urine analyzersmodel: aution eleven ae 4020, make: arkray , (1) aution screen , (2) urine sticks tlt 10 a , (3) aution sticks 10 pa , (8) proprietary items strips for urine analyzers , 1 urine analyzer strips 10 parameters , 2 mas ua dip tube control bi level , 3 uro dipcheck 200 calibration strip , (9)proprietary items /consumables for histopathology slide cover slipper model: clear vuemake thermo , 1 superfrost, microscopic slides ground edge 90 deg, 76x26 mm. , 2 clear vue mountant , 3 cover slip hoppers 24 mmx50mm #1.5 , 4 gemini basket with white slide retainer , 5 gemini basket with black slide retainer , (10)proprietary kits /consumables for hplc machinelaboratories, model d 10,make: bio rad , 1 diabetic control. bi , 2 hemoglobin a2 control , 3 eqas haemoglobin prog , 4 d 10 dual reorder pack , 5 d 10 microvials 0.1x 1.5 ml , 6 d 10 printer paper,1 , 7 d 10 dual a2/f/a1c ca , 8 d 10 dual analytical , (11)proprietary items / consumables for automated cryostat (frozen microtome)model: hm525 cryostat & automated roroty microtome model 355 s, make: thermo , 1 cryomatrix , 2 cryostat oil , 3 mx 25 primer low profile disposableblades , (12) proprietary items / consumables for histopathologytssue embedding station, model: eci 350 make: myr,spain , 1 plastic embedding rings , 2 plastic tissue embedding cassettes with lid , 3 metallic base moulds , 4 histowax , (13) proprietary items / consumables kits for lbc machine model: thin prep 2000 make hologic usa marketed by m/s hemogenomics , (1)complete pack of gyn kits for lbc , (2)complete pack of non gyn kits for lbc , (3)eosin solution0.2% 5 lit , (4)hematoxilin modified( harris, gill ii pap1: 5 lit , (5)papanicolaou 2b orange ii; 5 lit , (6)papanicolaou 2b ea50; 5 lit , (14)proprietaryitemformachine:itemsreagents&consumablesforserum,urineelectrophoresis model:pretty ,make :srl , 1 serum protein kit , 2 alkaline hemoglobins kit , 3 destain solution conc: product code sre 201m , (15)proprietary items /reagents/kits for cytocentryfuge machine model: cytospin 4 make: thermo , 1 tpx reusable chamber with caps , 2 ez mega funnels with filter cards for large vol. samples , 3 double cyto funnels with filter cards , 4 single cyto funnels with brown filter cards , 5 single cyto funnels with white filter cards product code 5991040 , 6 white filter cards , 7 polysine slides for cytology , (16)proprietary reagents &consumables for urine analyzer ,m/s roche diagnostic india pvt ltd , 1 urine analyzer strip compur 10 (roshe) (propriety items for urine analyser) , 2 tharmal paper roll 110 mm , 3 control test mcalibration strip , (17) proprietary reagents / consumablesfor fully automated esr analyzer model: test 1,make : alifax ,marketed by suyog diagnostics , 1 universal card for 10000 tests , 2 universal card for 4000 tests , 3 universal card for 20000 tests , 4 latex control kit 06 test (quality control kit) , 5 latex control kit 30 test (quality control kit) , 6 latex caliber kit 6 tests , 7 pump tube for esr analyzer , 8 capillary tubes , 9 sample aspiration needle , (18) proprietary reagents /consumablesforgel electrophoresismodel: sas 1 & sas2 make : helenabio sciences marketed by suyog diagnostics , 1 rep prep , 2 disposablesample cup , 3 sas – 1 applicators , 4 sas – sp 24 kit , 5 sas – 1ife 4 kit , 6 sas – 1 urine anal sis kit , 7 sas – 1 high res 12 kit , 8 sas – 1 alk phos kit , 9 sas – 1 alk hb kit , 10 sas – 1 acid hb kit , 11 sas – 1 lipo kit , 12 sas – 1 ld vis kit , 13 sas – 1 carbon electrode , 14 sas – 1 metal electrode , 14 sas – 1 sample tray , 15 sas – 1 ife antisera template , 16 sas – 1 gel block remover , 17 electrophoresis staining tray , 18 serum fixative , 19 sas supplementarydestain , 20 sas supplementarywash additive , 21 sas barcode set , 22 lipotrol control , 23 afsa2hemo control , 24 afsc hemo control , 25 kemtrol serum control normal kit , 26 kemtrol serum control abnormal kit , 27 immunofixation control , 28 alk phos control , 29 igg ief control , 30 igd antiserum , 31 ige antiserum , 32 urinetotal antiserum , 33 urine micro antiserum , 34 urine macro antiserum , 35 gam antiserum , 36 free ka a antiserum , 37 free lambda antiserum , 38 kappa antiserum , 39 lambda antiserum , 40 staining dish , 41 incubation chamber , 42 development weight , 43 hbs solubility screening kit , (19) proprietary reagents/ consumables for electronic blood cell counter 5part differential haematology analyzermake: horiba, model: yumizen h2500 , (1) abx basolyse , (2) abx cleaner , (3) abx diluent , (4) abx fluocyte , (5) abx lysebio , (6) abx monoclair , (7) abx minocal (calibrator) , (8)abx nucedif , (9) difftrol (control) normal , (10) difftrol (control)low , (11) difftrol (control) high , (12)minotrol retic(retic control) (2n) , (13) minotrol retic (retic control) (1l1h) , (20) proprietary reagents/ consumables for automated haematology slide stainer model: aerospray haematology pro, make elitech ,marketed by suyog diagnostics , (1) hematology buffer ph 6.8/7.2 , (2) hematology thiazin stain , (3) hematology eosin stain , (4) hematology aerofix additive for methanol , (21) proprietary reagents/ consumables forfully automated haematology analyzer model:elite 580, make: transasia , (1) elite h 580 diluent , (2) elite h 580 lyse 1 , (3) elite h 580 lyse 2 , (4) elite h 580 lyse 3 , (5)h clean , (6)calibrator , (7)control l , (8)control n , (9)control h , (10) pm kit for elite 580 , (22) proprietary reagents/ consumablesfor fully automated coagulation analyser, model acl elite pro, make –instrumentation laboratory, marketed by suyog diagnostics , (1)recombiplastin 2g 8ml (pttest) , (2)synthasil (aptt test ) with cacl2 , (3)fib c (2 ml ) fibrinogen , (4)thrombin time , (5)factor deficiennt viii , (6)factor deficient ix , (7)d dimer , (8)proclot (protein c) , (9)protein s activity , (10)liquid antithrombin acl elite family , (11)factor v leiden (apcr) , (12)drvvt screen , (12)drvvt confurm , (14)vwf antigen , (15)calibration plasma , (16)special level control 1 , (17)special level control2 , (18)normal control , (19)low abnormal control , (20)high abnormal control , (21)la positive control , (22)la negative control , (22)factor diluent , (24)clean a , (25)clean b , (26)wash r (elite) , (27)rotors (elite) , (28)sample cups , (29) d dimer control , (23) proprietary reagents/ consumables for urine chemistry / sediment microscopic analyser model labureader plus 2 & urised minimodel: 77 electronica hungary, marketed by suyog diagnostics , (1)urised cuvette , (2)labustrip u11 urine strips , (3)urinalysis controls 2 levels , (4)dip tube urinalysis + micro 2 levels , (5)urinalysis + micro normal , (6)urinalysis + micro abnormal , (24) proprietary reagents/ consumables for fully automated coagulation analyzer , model: sta compact max make stago , (1)sta neoptimal 5 , (2)sta neoptimal 10 , (3)sta neoptimal 20 , (4)sta c.k.prest 5 , (5) c.k.prest 2 , (6)c.k.prest 5 , (7)fibri prest automate 2 , (8)sta liquid fib , (9)sta fibrinogen 5 , (10)fibri prest automate 5 , (11)sta thrombin 2 , (12)sta reptilase , (13)sta thrombin 10 , (14)d di test , (15)sta liatest d di , (16)sta liatest d di plus , (17)coag control n+p , (18)sta d di control , (19)sta owren koller , (20)sta cacl2 0.025m , (21)sta cleaner solution , (22)sta desorb u , (23)sta cuvettes , (24)fintipps for st art 4 1.25ml , (25)sta steel balls , (26)sta cuvettes , (27)white stirrer magnet for pt(s 0091098) , (28)red stirrer magnet for aptt (s 0091124) , (29)connected pipette , (30)liquid cooling glycol , (31)lamp halogen , (32)maintainance kit compact , (33)yearly additional maintainance kit compact , (34)yearly maintainance kit compact , (35)red stirred magnet for (s 0091124) , (36)ball dispenser , (37)connected pipette , (38)needle arm n 3 with nut b , (39)syringe and o ring , (40)photometry box fan filter , (25) proprietary reagents/ consumables abg analyzer, model nova stat profile phox plus l,make nova biomedical,usa marketed by surgitech , soaking (polishing)solution , reference line: external beze 1 each phox s , sample probe : phox & phox b , po2 sensor, 1 each: phox s , ph sensor,1 each: phox s , pco2 sensor, 1each: phox s , po2 membrance cap kit, 6/bx:phox s , waste tubing harness: external bezel , phox s , so2% calibration ampules: (ampoules) , ph(na+) conditioning solution , po2 membrance cap kit, 3/bx:phox s , reagent pack; phox coox , reagent pack harness:phox coox , glucose sensor (1 each): phox s , na sensor, 1 each: phox+/c/l , potassium sensor phox+/c/l , chloride sensor phox+/c/l , ionized calcium sensor (1 each):phox s , pump harness assembly:phox coox , sample line assy: phox coox , reference sensor,1 each phox s , w/r pump complete tubing assy phox+/c/l/m (inconnector tbgs) , lactate membrane kit (3/pkg): phox s , lactate sensor (1 each); phox s , glucose membrane kit (3/pkg):phox+s , calibrator pack b: phox plus l , calibrtaor pack c; phox plus l , phox+econo, on board qc(tri level) , tri level external qc ampoules (phox plus) , probe: phox & phox plus , lactate membrane kit , pco2 membrane caps , po2 membrane caps , w/r pump complete tubing assy (basic; no connector tubings) lea , air detector , printer paper , (26)proprietary item for machine: ihc antigen, model : montage opus , make: diagnostic biosystem , tris edta retrieval buffer ph 9 (10x) , citrate buffer ph 6(10x) , immuno wash buffer (10x) , hematoxylin kit , dp 3 1 step (10x)de paraffinization solution , proprietary item for machine : karyotyping & fish cytogenetic workstation make: metasystem, model:ikaros , cll panel , xl cll probe kit , xl 6q21/6q23/6cen , xl mdm2 , myelomapanel , xl cdkn2c/cks1b , xl dleu/lamp/12cen , xl igh ba , xl 5p15/9q22/15q22 , xl atm/tp53 , nmyc , tissue pretreatment kit , dapi + antifade , bladder cancer , xce 3/7/17 , xl cdkn2a , sarcoma panel , xl mdm2 , xl etv6 , xl ewsr1 ba , xl mycn amp , xl ddit3 ba , xl ss18 ba , xl foxo1 ba , xl fus ba , glioma , xl 1p36/1q25 del , xl 19p/19q del , xl mycn amp , aml panel , xl t(15;17) df , xl t(8;21) plus , xl mecom 3q26 , or , xl t(3;3) gata2/mecom df , xl tp53/nf1 , xl rara ba , cml panel , xl iso(17q) , or , xl tp53/nf1 , or , xl tp53/17cen , xl tet2 , mm relex fish panel , xl t(4;14) fgfr3/igh df , xl t(6;14) ccnd3/igh df , xl t(11;14) myeov/igh df , xl t(14;16) igh/maf df , xl t(14;20) igh/mafb df , mpn panel , xl fgfr1 , xl 4q12 , xl 5q32 pdgfrb ba , xl bcr/abl1 plus , xl jak2 , prenatal , xa aneuscore ii (xa 13/18/21 + xa x/y) , xa aneuscore (xa 13/21 + xa x/y/18) , all panel , xl bcr/abl1 plus , xl t(12;21) etv6/runx1 df , xl mll plus , xl abl2 ba , mds panel , xl 5q31/5q33/5p15 , xl del(7)(q22q31) , xl del(20q) plus , or , xl 20q12/20qter/8cen plus , cen 8 (if xl del(20q) is used) , lung cancer , xl alk ba , xl ros1 gopc ba , xl egfr amp , e blood collection tubes & vacutainer , clot activator for serum vaccum tube with gel 3.5 ml, 13 x 75mm with yellow cap , clot activator for serum with gel 5 ml, 13 x 100 mm with yellow cap , evacuated blood collection tube with spray dried k2edta with lavender cap , sodium citrate evacuated tube with tube in tube technology sealed from the top to avoid citrate leakage for coagulation test with vacuum (with na citrate 0.109 mi 3.2%) , evacuated tube for silica clot activator/silicon coated made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol.4.0 ml. , blood collection needle 21 or 22 gauge with cap for evacuated tube. , blood collection needle 21 or 22 gauge with cap and safety lock for evacuated tube. , evacuated tube for spray coated with sodium fluoride (3mg.), na2edta (6mg.) made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 2.0 ml. , evacuated tube needle holder , blood lancet for high blood flow. , complete blood collection kit , paediatric collection products , clot activator paediatric blood collection tubes with cap for serum , paediatric blood collection tubes with spray dried k2 edta. , safety lok blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle for paediatric and microbiology. 21g x 0.75 inch needle x 12 inch tubing. , urine sampling products , kit for routine urinalysis , urine kit for culture & amp , other items / miscellaneous items/plasticwares make accumax(p’fact), axiva,starlab,eppendrof , adhesive tape/ micropore , aluminum test tube rack (12 hole) , anti human globulin (coomb’s test) , auto pipette tips 1 ml fix , auto pipette tips 10 ?l , auto pipette tips 100 ?l , auto pipette tips 100 1000 ?l , auto pipette tips 2 ml fix , auto pipette tips 5 ml fix , auto pipette tips 10 ml fix , auto pipette tips 200 1000 ?l variable , auto pipette tips 20 200 ?lvariable , auto pipette tips 50 ?l , bone marrow aspiration needle (jamshidi) , bone marrow aspiration needle(salah’s)ss , bone marrow aspiration needle (disposable) , lumber puncture needle (disposable) , bovine albumin 4% higher titer will be preferred , diamond pencil export quality , disposable needle 22 g , disposable needle 24 g , disposable latex rubber gloves 6.5” , disposable surgical blade/ scalpel blade (22 no) , disposable surgical gloves latex rubber 6.5” , disposable surgical gloves latex rubber 7.0” , disposable surgical gloves latex rubber 7.5” , disposable syringes2 ml , disposable syringes5 ml , disposable syringes 10 ml , disposable syringes 20 ml , disposable needle 22 g , disposable needle 24 g , esr kits. 10 tubes with cups and stand , filter papers (whatman) no 1 , glass marking pencil red , glass marking pencil white , l.p.needle 22g x 2.5 inch , l.p.needle 22g x 2.5 inch , spirit lamp (ss) , litmus paper (indicator paper red ) , litmus paper (indicator paper blue) , micro pipette 1000 ?l , micro pipette40 200 ?l variable , micropipette 20?l fix , micropipette 50?lfix , micropipette 10?l fix , micropipette 100?lfix , micropipette 5ml fix , micropipette 1ml fix , micropipette 2ml fix , improved neubauer chamber , plastic bucket 50 lit with lid , reagent rack plastic , polythene bagsyellow, blue, black for bmw , pregnancy test (hcg card test) , stethoscopes , sticker for cytology size (2 x 1.5 cm) , stop watch , syringe cutter / needle destroyer isi mark , tournicates , tissue paper roll , lens cleaning tissue paper ( kimwipes) , urine container (plastic) non sterile 50 ml , urine strip for albumin & sugar , urine strip for pregnancy test , urine strip for ketone bodies & sugar , urine strip for micro albinuria (micral strips) , urine strip for multiple test (7 parameter) , urine strip for occult blood , vacutainertubes 5 ml (blood collection vial edta) , wooden spatula pap smear (ayre) , cyto brush for pap smear , thermal paper roll 75 mm , thermal paper roll 110 mm , bone marrow patient entry register , urine reporting form , cytology reporting form(fnac) , cytology entry register (fnac) , cytology fluid entry register , cytology entry register (pap’s) , cytology reporting form(pap’s) , urine test entry register , fnac sticker , hematology entry register , hematology cbc reporting form , reporting form csf , hematology reporting form stool , reporting form bone marrow , histopathology entry register , histopathology reporting form , histopathology requisition form , histopathology slide sticker , outdoor patient entry register , hand wash soap , washing powder , ream/zerox paper , duster clothe , nitrile gloves powder free length 9.5 inch, s, m, l , nitrile gloves powder free length 12.0 inch, s, m, l , (g.) list of glassware , micro glass slides, polished edges, lint free (transparent) size 75x25x1.25mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 75x25x1.0 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.25 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.0 mm 50 slides in each pkts , cover slip english glass/imported lint free smooth edges (transparent) size 22x50 no. 1 , cover slip english glass/ imported lint free smooth edges (transparent) size 22x50 no. 0 , cover slip english glass/imported lint free (transparent) size 22x22 no. 1 , cover slip english glass/imported lint free (transparent) size 22x22 no. 0 , cover slip english glass/imported lint free (transparent) size 18x18 no. 1 , cover slip english glass/imported lint free (transparent) size 18x18 no. 0 , high profile microtome disposable blade (50 blade each pkt.) , low profile microtome disposable blade (50 blade each pkt.) , rubber teat for dropper , dropper big size (glass) , dropper medium size (glass) , capillary tubes (micro) , test tube brush , beaker with spout 1000 ml , beaker with spout 500 ml , beaker with spout 50 ml , conical flask flat bottom500 ml , measuring cylinder graduated 1000 ml , measuring cylinder graduated 500 ml , measuring cylinder graduated 100 ml , funnel (big) , funnel (medium) , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x10x20cm , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x12x20cm , reagent bottle 2000 ml , reagent bottle 60 ml , reagent bottle 120 ml , reagent bottle 250 ml , reagent bottle 500 ml , reagent bottle 1000 ml , canada blossom bottle 20 ml , couplin jar , wash bottle plastic 500 ml , urino meter , esbach’s albunometer , hb tube round top/gdr,isi mark (sahli,s) , hb pipette 20? top isi mark with rubber teat (sahli) , pertidish 110 mm(glass) , rbc pipette top/gdr isi mark , wbc pipette top/gdr isi mark , stirrer for h.b.meter (sahli) , test tubes 12x75 mm(glass) , test tubes 12x100 mm (glass) , test tubes 18x150 x1.2mm with rim (glass) , bulb for microscopes halogen (6v 12 w) make; philips, labomed , h. other items with specifications , hemocytometer improved, , haemoglobbino meter ( sahali method) , slide box (plastic) 50 slides capacity . , slide box (plastic) 100 slides capacity. , slide tray (aluminium)....

Jhalawar Medical College and SRG Hospital - Rajasthan

37822348 tender for rate contract for general items for vrdl / rtpcr lab at medical college and hospital jhalawar 1 microbiology 2 absorbent paper roll 3 absorbent paper sheet 4 aluminum foil 5 autoclavable pp plastic racks for 96 places 6 bags, biohazard, (transparentautoclavable 7 cetylpyridinium chloride (cpc) for bioch emistry mw 358.01>98% 8 cold chain box (12 lit.) 9 cotton roll 10 diamond pencil 11 di sodium hydrogen phosphate 12 disposable head caps 13 disposable lab gownspp (large and medium) 14 disposable shoe cover 15 disposable syringes 5 ml (22 & 24 gauge) 16 dnase/rnasesurface decontaminant 17 dropper bottle 18 droppers, sterile, plastic 1.5 ml, graduated 19 droppers, sterile, plastic 3.0 ml, graduated,disposable 20 edta 21 ethanol 95% 22 filter paper 23 fluorescent staining kit for afb 24 formaldehyde 25 glass funnel 26 gloves nitrile, size s m l 27 gloves, latex size s m l 28 glycerol 29 hydrochloric acid, fuming (37%) 30 hydrogenperoxyde 30% 31 immersion oil 32 laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab 33 laboratory thermometer 34 l asparagine 35 lint free soft tissue 36 liquid dispensingwash bottle plastic (500ml) 37 lj medium base powder ready mix 38 loop, disposable 10 µl 39 loopholder 40 loopholder rack 41 magnesium sulphate 42 malachite green 43 mask (disposable surgical) 44 mccartney bottle 15 ml 45 mccartney bottle 7 ml 46 mcfarland standard set 47 micro pipette stand pipette stands for 5 pipettes 48 micropipette tips nuclease& pyrogen free & aerosol barrier (0.1 20µl) maximum recovery/minimum retentionfiltered, racked, sterile 49 micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery/minimum retentionfiltered, racked, sterile (100 1000µl) 50 micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery/minimum retentionfiltered, racked, sterile( 2 200µl) 51 molecular grade ethanol 52 molecular grade isopropanol 53 n95 respirators (niosh approved) 54 na acetate 55 n acetyl l cysteine (nalc) powder 56 naphthyl ethylendiamine 57 needle destroyer 58 niacin strips 59 nichrome wire 60 nicotinamide 61 parafilm 62 pcr tubes flat snap cap 0.2 ml 63 pcr tubes strip with flat cap optical for rtpcr 0.2 ml 64 phenol 65 plastic racks (15 ml tubes) 66 plastic racks for 15 ml conical falcon tubes 67 plastic racks for 2 ml mct, autoclavable, 68 plastic racks for 50 ml conical falcon tubes 69 plastic storage box for0.2 ml pcr tubes with lid 70 plastic storage box with lid for 2 mlcryovials 10x10 71 potassium dihydrogen phosphate 72 potassium permanganate 73 sample collection container sterile 74 cryovials 75 screw cap(hinged) mct tapered(1.5ml ) 76 slide drying racks 77 snap cap (hinged) mct tapered(1.5 ml ) 78 snap cap (hinged)mct roundbottom (2 ml ) 79 sodium chloride, nacl 80 sodium hydroxide, naoh 81 sodium hypochlorite solution 82 sodium nitrate 83 spray bottles sprayldpe 500 ml 84 spray bottles plastic pp 250 ml 85 sputum container 86 staining bottle 87 staining rack 88 sterile blue tips bulk (1000µl) 89 steriletips bulk (10µl) 90 sterile yellow tips bulk (100µl) 91 sulfuric acid, concentrated 92 sulphanilamide 93 test tube rack pp for vtm tubes 94 tissue roll 95 torniquet 96 tri magnesium di citrate 97 tube, centrifuge, 15 ml with screw cap 98 tube, centrifuge, 50 ml with screw cap 99 tubes cryovial, sterile with screwcap, 2 ml 100 tubes reaction, 2 ml 101 universal bottle for cultures, 28 ml 102 water molecular biology grade 103 xylene 104 zinc powder 105 zn acid fast staining kit 106 autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 ml cryovials 107 autoclavable pp racks for 1.5 ml mct 48 samples (24 pieces) ...

Medical Health And Family Welfare - Rajasthan

37421256 to purchase pathology lab reagents under the mukhymantri nishulk janch yojna ( mnjy ) , s. creatinine kit ( for semi auto ) , s. glucose , s. creatinine kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. bilirubin t kit ( for semi auto ) , s. bilirubin d kit ( for semi auto ) , s. urea kinetic , urea berthlot ( end point ) , urea berthlot ( end point ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. alkaline phosphatage kit ( for semi auto ) , s. total protien ( for semi auto ) , s. albumin ( for semi auto ) , s. ldh ( for semi auto ) , s. ldh ( for semi auto ) , s. amylase ( for semi auto ) , s. amylase ( for semi auto ) , s. uric acid ( for semi auto ) , s. calcium kit ( for semi auto ) , s. calcium kit ( for semi auto ) , s. ck nac ( for semi auto ) , s. ck mb ( for semi auto ) , s. ck mb ( for semi auto ) , s. triglyceride kit ( for semi auto ) , s. triglyceride kit ( for semi auto ) , hdl direct , s. hdl cholestrol ppt , biochemestry control , erba xl wash , chloride , gamma gt , lipase , phosphorus , cystatin c , csf protein test , hemocysteine , afb stain ( ready to use ) , autoclave tap 1 ( thermopile spors ) , acetone liquid , aluminium foil , ayer spatulla disposable ( sterile ) , absolute alcohal 99 % , adhesive tap 0.5 inch , aslo kit , anti abd , ahg ( anti human globulin ) vial , ahg ( anti human globulin ) vial , anti a1 , acetic acid galcil 5% , buffer bottle , blotting paper sheet , bleeching powder , banedict solution , blood mixer , beakar glass , beakar glass , bovine albumin , bovine albumin , bovine albumin 22% , bovine albumin 22% , bd vaccutionor blood collection needle 21, 22 , blood collection tube for esr black cap 4 ml. , capillary tube , chickengunia cards igg igm , crp kit , cover slip 22x60x.4 mm. ( blue star, gem, top only ) , cover slip 22x50x.4 mm. . ( blue star, gem, top only ) , cover slip 22x40x.4 mm. . ( blue star, gem, top only ) , cover slip 20x25x.4 mm. . ( blue star, gem, top only ) , cover slip 24x60x.4 mm ( blue star, gem, top only ) , cover slip for neubauer chamber 1mm thick , copper sulphate powder , copper sulphate powder , copper sulphate powder , chloroscope with reagent , coplin jar , cell for gluometer , cover slip 18x18 mm ( blue star, gem, top only ) , cell counter for dlc 8 key , clot activator vial red cap 4 ml. , clot activator vial red cap 6 ml. , diastix , disposable needle 22 mm , disposable needle 24 mm , disposable syringe 5 ml. , disposable syringe 10 ml. , disposable droper , disposable gloves 6 , disposable gloves 6.5 , disposable gloves 7 , disposable gloves 7.5 , dropping bottle plastick 100 ml. , dropping bottl plastick 500 ml. , dpx mount , diamond marker , drabkin’s solution and control solution , distilled water , dengue test kit ( ns1 igg igm combopack by rapid card test ) , dengue elisa test kit ( ns1 ) , dengue elisa test ( igm ) , dengue rapid card ( igg, igm ) , esr fluid ( sodium citrate ) , esr tube ( pippate ) disposable , esr ( pippate ) glass with cap disposable , edta powder , eosin stain , ethylalcohol absolute , eosinophil diliuting fluid , field stain a , field stain b , forceps ( simple ) , jsb stain i , jsb stain ii , flask glass ( borosil ) , flask glass ( borosil ) , fnac plunger , fixative for cyotology ( 99% methanol ) , filter paper , formaline , glass marking pencil ( red ) , geimsa stain , geimsa stain , glycrine , gel activator vial 4 ml. , gel activator vial 8 ml. , hypochlorite 5% solution , hbsag rapid test cards , hb tube square , hb pippate , heamatoxyline mono hydrted ms reagent , hand sanitizer , hand sanitizer , k3 ( cbc ) vial double cap , k3 ( cbc ) vial single cap , koh solution , liquid parrafin , lugols iodine , leishmen’s stain , liquid cleaning agent for glass / plastic , liquid hand soap ( savlon ) , liquid hand soap ( dettol ) , liquid hand soap ( lifeboy ) , lancet , lens paper , multi stix , micro tips 5 20 ul , micro tips 200 ?l , micro tips 1000 ?l , micro glass slide 1.33mm ( blue star, gem, top only ) , micro glass slide 1.25mm ( blue star, gem, top only ) , micro glass slide76x26 mm ( blue star, gem, top only ) , micro pippate fix volume 10?l , micro pippate fix volume 20?l , micro pippate fix volume 50?l , micro pippate fix volume 100?l , micro pippate fix volume 500?l , micro pippate fix volume 1000?l , micro pippate varible 10 100 ?l , micro pippate varible 100 1000 ?l , micro pippate stand plastick , macountoss , face mask disposable , new methehylne bluefor reticulocyte stain , methehylne blue1% , n / 10 hcl , improved neubaurs chambar ( counting chambar ) , nitric acid ( hno3 ) , oil imersion lens , pt vials , pcv tube , papnaculer stain ready to use , plastic dropper , pasture pippate , propyle alcolhal , platelet diluting fluid , ppe kits , ph paper strip , prob cleaner for cbc machine accurex , paper roll for semi auto anaylser 4.5 , reporting cbc paper roll50mm x 20m , reporting cbc paper roll57mm x 20m. , reporting cbc paper roll 57mm x 10m. , rubbur bulb b dropper , ra factor kit , rapid malaria test cards ( antigen ) , rapid malaria ( antigan , antibody ) combopack , sulphar powder , semiauto anylaser printer roll , sticker for sample vials , sample vial with cover 5 ml , sample vial with cover 10 ml. , staining reactanguler beaker , staining rack , spirt lamp , test tube glass 3 inch ( 12x75 ) borosil , test tube glass 4 inch ( 12x100 ) borosil , test tube pvc 2 inch , test tube pvc 3 inch , test tube pvc 4 inch , test tube pvc 6inch , tlc fluid , tec fluid , trbc fluid , tissue paper roll , tourniquit , test tube stand plastic for 48tubes , test tube stand plastic for 100 tubes , trop t rapid test card , thromboplastin ( pt reagent ) , test tube cleaning brush , thermacol box , digital thermomater with sensor for regrigetor , tongue depresser disposble , urine pregnancy strips , urine pregnancy cards , uristicx , urine pots with label and cover 30 ml. , urine anyalser paper roll 57mm x 10mtr , vdrl test kit , vdrl card , vdrl rapid test strip , vtm ( viral transport media ) , vacctuainer plane 4 ml. , vacctuainer plane 8 ml. , vacctuainer k2 edta 4 ml. , vacctuainer k3 edta 4 ml. , widal slide kits ( 4x5ml. ) , widal tube agglutation reagent , wbc diluting fluid , widal card , wintrobe tube esr , xylene , zeeper plastic 6 inch , zeeper plastic 8 inch , z n stain , psa kit , psa kit ( elisa method ) , aluminum ammonium sulphate hydarted , acetic a , glacial acetic a , ammonium hydride 1% , eosin yellow a , eosin yellow b , light green sf , potash alum , timer electronic , slide cabinet ( 100 slide ) , slide staning bucket with handle , slide box , measuring cylinder glass and silikon 50 ml. , measuring cylinder glass and silikon 100 ml. , measuring cylinder glass and silikon 500 ml. , measuring cylinder glass and silikon 1000 ml. , hcv card ( rapid test ) , cuscos speculun , mask n 95 , glucostrip for glucocare sence glucometer , glucostrip for bio sence glucometer , disposable pap smear kit , anit a , anit b , anti d , sargical mask 3 layer , lysol 50% , digital thermomater for refrigertor with display , sprayer bottle 500 ml. / 1000 ml. , beakar glass 100 ml. , covid 19 rapid card , pencil cell for glucometer / timer , ketostx , paper roll for pt anaylser ( 116mmx20 mtr. ) , torrniquet belt, tubler ( cotton material flexible ) , hiv rapid test card , gram stain , serum magnisium test kit , serum lithium test kit , csf protin test kit , csf chloride test kit , csf suger test kit , urine total protin test ( 24 hour ) test kit , acid phosphatase test kit , accu chek glucometer strip , glucocare sence glucometer , bio sence glucometer , ggt test kit , x press glucometer , x press glucometer strip , glucometer spark , glucometer spark strip , control d glucometer , control d glucometer strip...

Medical College - Rajasthan

37282339 tender for supply of various type of test kits and consumables for pathology department 1 syringe (5 ml) 2 syringe (10 ml) 3 syringe (2 ml) 4 glass slide 76mmx width 26mm+0/ 1mm 5 filter paper 42 no. whatman 6 cedar wood oil 7 lancet 1x 200 8 methnol 9 deionisedwater 10 ketone body strip urine 11 urine stick for alb. sugar 12 tissue paper roll 5 mtr. 13 sod. nitropurside 4% 14 eshach,s reagent 15 oil immersion lens imported can befit in existing microscope 16 capillary tube 17 tourniquet 18 xylene 19 sulphar powder 20 adhesive roll 21 disposable plain vial 12x110 mm yellow colour (label printed p.b.m. hospital, bikaner) 22 disposable plain vial 12x110 mm blue colour (label printed p.b.m. hospital, bikaner) 23 disposable plain vial 12x110 mmred colour (label printed p.b.m. hospital, bikaner) 24 halogen blub (6v 20 walt) 25 acetic acid 26 semen diluting fluid 27 thermal paper 27x54(cbc roll) 28 thermal paper 20x54(cbc roll) 29 field stain a & b 30 haemoglovino meter 31 antisera for grouping a,b,d 32 hydrochloric acid 33 disposable gloves 6.5 34 disposable gloves7 35 disposable gloves7.5 36 yellow tips 37 disinfection hand wash 38 nitric acid 39 esr cup (tip top) 40 plastic droper big 41 micro cover glasses (cover slip) 22x22 mm 42 esbach albumeno meter 43 normal saline 44 urine analyzer strip with urine analyzer 16 pera meter 45 urino meter 46 reticulocte count stain 47 ehrlich reagant 48 liquid parafin 49 disposable esr tube with vial 50 leishman stain powder 51 wbc & rbc pipette 52 sodium citrate testtube 53 8 kev manual cell counters 54 leishman stain solution,liquid 55 micropipette 20,50,100 56 hemocytometer 57 suger strip 58 cbc vial purple cap k3 edtawith safety cap( label printed p.b.m. hospital, bikaner) ...

Sardar Patel Medical College - Rajasthan

37244157 supply of various type of test kits and consumables for pathology department syringe ( 5 mii 2. syringe ( i0 ml ) i synge ( 2 ml ) 4. glass slide 76mnx iidth 26mm+o / lmmin ricrips4anian _.. . cedar wood oil aancet i x 200 . methnol 9. deionised water ‘•. keaonebody strpurine n . i. urine stick for aib. sggar 12. tissue paper roil 5 mtr. u. sod. nitropurside 4% 14. eahach, s rrent oii immersion lens imp ( ) rtei ) can beti in existing i’ capiliary tube 17. tournmquet ‘a. xylene ‘. sulphar powder i. adhesive roll 21 disposable plain vial i2xi 10 mm yeliow colour ( iabel p!jtcd p.n.m. hospital. rikaner ) 21 disposable plain vial l2x1 i0mm biue colour ( iabel printed p.13.m. hospital, bikaner ) , 26. semen diluting fluid 27. [ hermnl paper 27x54 ( crc’ roll ) 28. lhermalpper_20x54 ( cic roli ) 29. field stain a & b .w linernoglovino_meter 31. antisera_forgroupingab.d 32. i ivdrochjoric atid . 33. disposable gloves 6.5 . pli ble gloves 7 . 35 disposable gloves 7.5 36. yellow tips 37. disinfection hand wash 3s. nitric acid 39. esr cup çrip top ) 4°. fiasticedro 41. micro cover glasses! ( cover slip ) 22x22mm 42. esbach albumeno meter 43. urine analyzer sirip wiih urine analyaer 16 pera meter 45 llrino!meter 46. reticulocte count stain 47. ehrlich reagant 48. liquid parafin 49. disposable esr tube.with vial, etc., ...

Medical And Health Services - Rajasthan

37192252 tender for mnjy lab x ray ecg test good purchase & bio medical items 1 2 preg card uristix four parameter 3 uristix albu@sugar 5 sample vial clot activator k3vial double cap edta vial 6 7 sugar kit erba2 / 200 urea kit5 / 20 8 9 sgotkit5 / 20 sgptkiterba5 / 20 10 serum aukuine phospate kit erba 5 / 20 11 12 13 14 15 bilirubin.kit 2 / 2 / 60 erba creatinine kit 2 / 2 / 60 erba 5 cholestrolkit 5 / 30 erba vdrl test kit sd hbsag testekit sd — 16 hdl chlestrol 2 / 50 erba 17 triglisride test kit 5 / 50 18 19 total protein kit 5, / so erba albumine kit 5 / 50 erba 20 21 22 gloco strip ijesman_solution 500 xylene 500 23 rbc diluting fluid 500, 24 wbc diluting fluid 500 25 sooium citrate 3.8 / so0 26 n / 10hcl500 27 tissue_paper roul 28 urine container 29 vidal test kit becon / span / arkray 3° glass slide 31 cover slip 32 lencet 33 test tube without cap rai vial 34 sugar vial disttle water 5 litter jsbn1 37|jsblii, 38 cappliary tube 39 heamocue strip 40 anlayzer printer roul 41 cell counter printer roll 42 filter paper 43 hiv kit esr tube 5 liquid parrafin oil 46 minidil2oltrhoriba .._ 47 abx_lyse blo 1 ltr horiba ‘ lyse cleanr 1 ltr horiba 49 monoclalr 500 ml horiba 50 minotrol s1 sulpher_power 52 blood group kit span / arkrey 53 blue.tips yellow tips 55 tunigate 56 esr disposable toptech 57 urine multisticks strips s8 micro piptte 10 100 59 micro piptte 100 1000, etc....

Medical Health And Family Welfare - Rajasthan

37117560 supply of lab regents / x ray / ecg under mnny ( investigation ) 1 antihuman globulin 2 anti sera abd 3 aso test 4 blood collection beg 5 blood collection beg pead 6 blue tips 7 yellow tips 8 capillary tubes 9 cover slip 10 crp test 11 distilled water 12 esr tube set disposable 13 glass marking pencil 14 glass slide 15 glycerine 16 hb estimation cardl / hemocue 17 hb pipette 20 micro 18 hepatitis b card 19 hepatitis c card 20 hiv tridot kit / triline 21 hytrogen proxjde 30% 22 jsb l stain 23 jsb 2 stain 24 k 3 edta blood collection via l 5 m ltube 25 labopol 26 lancet 27 lugols iodine 28 malaria card test ( jmitra ) 29 methanol 30 microprotein 31 multistix ( alb+sug+spgravity+ph+b.salt / pigment ) 32 n / 10 hcl 33 parafin oil 34 ra factor test 35 sodium hydrochloride 10% 36 strip for acetone detection in urine 37 sulphur powder 38 test tube glass 10x100 mm 39 test tube glass 12x100mm 40 sahils hb tube round 41 test tube glass 12x80 mm 42 tes ttube plastic 12x100 mm 43 tissue paper roll 44 typhydot test 45 urine pregnancy test card 46 uristix ( alb+sug ) strip ( siemens ) 47 vdrltest strip 48 widal test 49 xylene 50 hb meter ( squar bottom ) 51 hbtube ( squar bottom ) 52 filter paper 53 hiv kit for elisa 54 hbsag kit for elisa 55 vdrl kit for elisa 56 dengue kit for elisa lgm sd 57 micro pipette 0 100 micro. it. 58 micro pipette 100 100 micro. it. 59 micro pipette 5 micro. it. ( fix ) 60 micro pipette 10 micro. it. ( fix ) 61 micro pipette 500 micro. it. ( fix ) 62 staining jar 63 scrub typhus rapid test kit 64 scrub typhus elisa kit 65 chikunguniya rapid test kit 66 chikunguniya elisa kit 67 plastic container for urine sample collection 68 dengue ns 1 lgg & lgm detection rapid test ( jaimitra ) 69 slide dry rack 70 blood bag tripple 71 plastic test tube rack 72 timer 73 microscope blub 6v 20wgu ( low voltage halogen lamp ) 74 abx diluent mini ( horiba 3 part hematology analyzer ) 75 abx lyse bio ( horiba 3 part hematology analyzer ) 76 abx cleaner ( horiba 3 part hematology analyzer ) 77 abx minoclair ( horiba 3 part hematology analyzer ) 78 horiba 3 part hematology analyzer control regents 79 fluid pack 80 daily rinse kit 81 electrode 82 b.sugar ( erba machine ) 83 b.urea ( erba machine ) 84 s.albumin ( erba machine ) 85 s.alk.phosphatase ( erba machine ) 86 s.amylase ( erba machine ) 87 s.bilirubin ( erba machine ) 88 s.calcium ( erba machine ) 89 s.cholesterol, liquid form ( erba machine ) 90 s.creatinine ( erba machine ) 91 s.hdl cholesterol ( erba machine ) 92 s.hdl cholesterol, direct method, ( erba machine ) 93 s. ldh ( erba machine ) 94 s.triglyceride, liquid form ( erba machine ) 95 s.uric acid ( erba machine ) 96 sgot, liquid form ( erba machine ) 97 sgot, liquid form ( erba machine ) 98 total protein ( erba machine ) 99 ck nac 100 ck mb 101 sodium citrate collection vial ( 3.2% ) 102 uniplastin regent 103 sprit 104 diamond marker 105 carbol fuchsin 106 h2so4 25% 107 methylene blue 108 babmoo sticks 109 blood sugar strips 110 immersion oil 111 digital x ray film, fuji di hl ( blue base ) 8*10 112 digital x ray film fuji di hl ( blue base ) 10*12 113 digital x ray film carestream 8*10 114 digital x ray film carestream 10*12 115 dental x ray film 116 ecg roll ) , contec 117 ecg roll ( comen 1200a ) 12 channal 118 ecg roll bpl single channal 119 ecg gelly 120 bp instrument ( mercurial ) 121 bp monitor ( digital ) 122 developer 123 needle holder 124 edta vaccutainer vial 125 vaccutainer plain 126 vaccutainer needle 127 cbc roll ( for horiba 3 part machine 57x10 ) 128 semi auto analyzer printing roll for stat fax 300 a 129 fixer...

Ministry Of Defence - Rajasthan

36978500 bids are invited for methyl isobutyl ketone , acetyle acetone , xylene , ethyle acetate 25 liter plastic barrels , 25 litre isopropyl alcohol packed in hdpe drum...

University Of Agriculture - Rajasthan

36885038 tender for supply of laboratory chemicals and accessories 1 ethyl acetate pure, 99%ar 2 3 p anisaldehyde gallic acid monohydrate 4 acetic acid glacial ar s hydrochloric acid abt.35% pure 6 hydrogen peroxide 7 magnesium carbonate, light 8 nitric acid mi. 69% pure 9 orthophosphoric acid 10 petroleum ether 40 60rc ar 11 potassium dihydrogen phosphate anhydrous 12 saponin ( from plant ) 13 sodium carbonate anhydrous ar 14 5 sul phosal icylic acid dihydrate trichloroacetic acid folin ciocatteu reagent ( ml ) thioglycolic acid, 80% solution in water coomassie brilliant blue g 250 19 phytic acid sodium saft 1og acetic anhydride 2, 2 bipyridine , 22 citric acid anhydrous 23 perchloric acid _______. c 24 sodium hydrogen carbonate 25 tannic acid 26 sodium hydroxide powder 27 acetone 28 chloroform ar 29 bovine serum albumin 30 acrylamide:bisacrylamide ( 19:1 ) 31 32 ose special, low leo bind silane chloroform 33 34 diphenylamine_reagent 35 dithiothreitol ( dtt ) 36 fehling solution a 37 fehling solution b 38 glucose 39 glycerol 40 iodine solution 41 mg acetate 42 molisch reagent 43 n, n, n’, n’ tetramethylenediamine ( temed ) 44 ninhydrine 46 polyethylene glycol 47 potassium acetate 48 proteinasek 49 sodium acetate anhydrous 50 sodium bicarbonate solution 7.5% 51 trisodium citrate ( g ) 52 25mm mgci2 53 phenol crystal 54 6x gel loading dye 55 xylene cyanol 56 sodium phosphate dibasic anhydrous 57 sodium phosphate monobasic anhydrous 58 benedict reagent 59 picric acid 60 buffer capsules ph 40±0.05 61 buffer capsules ph 7.0±0.05 62 buffer capsules ph 9.2±0.05 63 triton x 100 64 tween 80 ( g ) . e 65 ethanol 66 micro tips ( 0.2 1o ul ) 67 micro tips ( 2 200 pl ) 68 micro tips ( 100 1oo0 u1 ) 69 micro tips ( 5000 pl ) , etc....

Medical Health And Family Welfare - Rajasthan

36750465 supply of chemical regents in xray sonography and blood bank in govt hospital chittorgarh , x ray, & sonography items , computerize digital x ray film 8 x 10 , computerize digital x ray film 11 x 14 , digital x ray cassets 14x17 , digital x ray cassets 14x14 , digital x ray cassets 10x12 , sonography paper roll , sonography jelly , e.c.g. jelly , e.c.g. paper roll bpl , biochemistery reagent , blood suger ( end point ) , blood urea ( fixed time ) , blood urea ( brith lot ) , s.creatanine ( fixed time ) , cholestrol ( end point ) , triglyceride ( end point ) , hdl reagent direct , bilirubin t&d ( end point ) , sgot ( kinetic ) , sgpt ( kinetic ) , alkaline phosphatase , s. a. phosphatas , amylase , uric acid , s. ldh , s.ck mb , s.ck nac , calcium , albumin , total protine , crpquantitative , crp qualitative , rf factor , raquantitative , bio chemistery reagents for fully autometic , wash 1 , wash 2 , blood sugar , blood urea , blood creatinine , blood cholesterol , blood triglycerides , hdl , blood bilirubin total , blood bilirubin direct , blood s.g.p.t. , blood s.g.o.t. , blood total protein , blood albumin , alk. phos. , uric acid , calcium , amylase , ck mb , ck nac , ldh , crp , auto wash , xl wash , erba norm , xl multical , albumin , alkaline phosphatase , bilirubin direct , bilirubin total , calcium , creatinine enzymatic , creatinine jaffe , cholestrole , glucose ( god pod ) , glucose hexokinase uv , total protein , triglyceride , crp , sgot el , sgpt , amylase , urea , uric acid , hdl cholesterol with calibrator , ldh p , phosphorus , rapid test , hbsag , hcv rapid , dengue combo ns1 antigen+lgg 1gm antibodytest , dengue antibody test , malariyaantigen test , pregnancy test , thaypi dot test , scrub thypus igm antibody test , chikungunya igm antibody test , vdrl test strip , urine albumin sugar test , urine analyser test strip 10 paramiter , leptospirosis rapid kit , hepatitis a , hepatitis e , typhoid iggigm , elisa test kit for lab , dengue ns1ag microlisa , scrub typhus igm elisa , chikungunya igmelisa , dengue 1gm microlisa , leptospirosis elisa kit , reagents for 5 part hematology analyser ( trans ) , h 560 diluent , h 560 lyse 1 , h 560 lyse 2 , h 560 elite h clean , h 560 controls ( h, n, l ) , h 560 calibrator , control h , control n , control l , calibrator , reagent for 5 part hematology analyser ( mindray ) , m 52 diluents , m 52 diff lyse , m 52 lh lyse , probe cleaner , calibrator , control low , control high , control nusmal , reagent for 3 part hematology analyser ( mindray ) , m 30 diluents , m 30 diff lyse , m 30 lh lyse , probe cleaner , reagents for ecl 105 , erba protime ls , erba actime , erba calcium chloride , erba ddimer , erba ddimer calibrator , erba ddimer control n+p , erba single reaction cuvettes src 10 , thermal printer paper rolls 3x57mmx15m , test kit forictc ( subject tonacoapproved ) , hiv tridot , hiv triline , hiv comb aids , rekteble neddle , vacuum 3.8 % sodium citrate esrblood collection. tube , floride blood collection vail , blood sample trensport vail ct gel , elisa kits for blood bank ( subject tonacoapproved ) , h.i.v.kit , h.c.v. kit , hbs ag. kit , reagents for blood bank , bovine albumin , anti a1b , anti “a1, ( lectin ) , anti “h” , anti “d”. igg+igm ( monoclonal ) , anti humen globuline ( ahg ) , blood grouping anti sera abd , r.p.r. test ( latex ) , cpda blood collection bag 350 ml , cpda blood collection bag 100 ml , cpda blood collection bag ( triple ) 350 ml , cpda blood collection bag ( triple ) 450 ml , cpda blood collection bag ( double ) 350 ml , cpda blood collection bag ( penta ) 450 ml , screw cap vial plain 5 ml , tourniquit belt ( standred quality ) , glass droper ( pauster pipet ) , hb haemocue 301 cuvet ( a meter and a lancet will be givenat free of cost on purchase of every 1500 microcuvettes ) , serology kits , r.a. factor , widal test , crp test qualitative , aso test , microbiology , mac conkey agar with 0.15% bile salts, cv and nacl 500 gm , nutrient agar , cled agar , sulfide indole motility agar , kovacs indole reagents , mannitol powder , glucose powder , lactose powder , sucrose powder , hydrogen peroxide 3 / 6% , oxidase reagent , mueller hinton agar , sda with chloramphenicol , crystal violet powder , agar powder bacteriological grade , thioglycollate powder , acetone , grams stain kit , hi chrome agar for candida 100 , potassium hydroxide , sda , lactophenol cotton blue , capsule stains , cary blair medium , safranin stain , lowenstein jensen powder , ferric chloride powder , bile esculine agar , peptone powder , selenite f broth powder , india ink or nigrosin , methylene blue stain , glutaraldehyde , ethylacohol , spirit , potassium tellurite agar , zn staining kit , tcbs agar , xylene , glucose phsphate broth , 0.5 mc farland standard , bromocersol purple indicator , andrades indicator , sodium hypochloride 10% , glassware and other plastic consumables etc. for microbiology ( all below glassware should be made of borosilicate glass preferably 3.3 glass & should meet standards of astm e, iso 9001, 7348, 3585 & din 12331 , glass petri dish culture 90 mm , glass slides size 75 mmx25mmx1.35mm , single cavity glass slide for motility , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml;100 / pk , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 30 ml:100 piece / pack , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 120 ml:40 piece / pack , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a, usp certicate , amber coloured wide mouth graduated glass bottle 500ml , glass funnel plain 60 degree angle long stem, size 75 mm , u shaped glass rod , glass beaker with spout ( discarding jar ) 1 ltr , test tube glass size 10mmx150mm , test tube glass size 20mmx150mm , measuring pipette with rubber bulb 10 ml ( mohr type ) glass b , measuring cylinder, with class a certificate capacity 1000ml with stopper , measuring cylinder, with class a certificate capacity 250 ml with stopper , durhams tube , cover slip 2*2 cm square , antibiotics discs for microbiology , amikacin 30 mg , amoxyclav 30 mcg , ampicillin 2mg , axithromycin 15 mcg , aztreonam 30 mcg , bacitracin 50 disc / vl , bile esculin discs , cefazolin ( cz ) 30 mcg , cefipime 30 mcg , cefixime 5mcg , cefoperazone sulbactum 75 mcg , cefoperazone sulbactum 30mcg , cefotaxime 30 mcg , cefoxitin 30 mcg , ceftazidime 30mg , ceftazidime / clavulamic acid 30 mg , ceftazidime / clavulamic acid10 mg , ceftriaxone 30 mcg , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mg , clindamycin 2 mcg , colistin 10 mcg , co trimoxazole 23 75 / 1.25 mg , erythromycin , gentamicin 10mcg , gentamicin 120mcg , imipenem 10mg , levofloxacin 5mcg , linezolid 30mg , meropenem 10 mcg , metronidazole5 mg , nitrofurantoin 300 mcg , novobiocin 30 mg , onpg disc , optochin disc ( for s.pnemonioe ) , oxidase discs. , penicillin g 10 units , piperacillin 100 mg , pipera tazobactum 100 / 10 mcg , polymyxin b 300 units , teicoplanin 30 mcg , tetracycline 30 mg , tobramycin 10 mcg , vancomycin 30 mcg , fosfomycin 200 mcg , tigecycline 15 mcg , cinoxacin 100 mcg , norfloxacin 100 mcg , oxacillin 10 mcg , other plastic consumables , slide boxes for students for 20 slides , heavy duty gloves heat resistand, category iii glove, preferably en 407 performance level , test tube stand polypropylene 3 tier for test tubes , paraffin film m rolls 2inch width 250 feet length , falcon tube ( conical ) polypropylenem usp class vi, max g force of 15, 000 xg:50 ml, 360 piece / pk , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each , test tube rack holder 40 50 holes vents plastic centrifugal deck , universal eto sterile plastic ( pp ) containers ( 30ml ) 100 piece in pack , coplin jars pp for keeping slides pack of 12 , sterile swab with collection vial ( hirmedia pref. ) 100 piece / pkt , spatula spoon shaped plastic for chemical dispense ( gradueated ) , filter paper size no.1 460x570: no of circles / sheets , autoclave bowie dick tape 1 pack of 30 test, complies to ansi / aami / iso 11140 5:2007 class 2 , ph paper strips 1 14 ph range himedia, fisher scientific , disposable 100 cm diameter petri dish , disposable test tubes 10 mm diameter 5 ml capacity , discarding tub 3 litre , sterile samole container , glass marking pencil , plastic basket for sample transportation 1feetx1.5feet , miscellaneous steel item , forcep stainless steel non corosive surgical grade ( 00 & higher ) , nichrome straight wire ( 2 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , nichrome loop wire ( 3mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , sterile stainless stell surgical blade of 11 nos. pack of 100 piece , forcep for cover glasses, kunhe type , steel rod for staining in practical lab , utility tray for slides , stainless steel forceps, pointed , autoclavable, size 8 inch, ss 410, 2 nos / pack , test tube washing brushes steel , scissors , spirit lamp , other kits and consumables for microbiology , anti hbsag elisa igm 4th generation, should include reactive and non reactive controls, sensitivity of more than or equal to 99%: specificity of more than or equal to 99%. analytical sensitivity: less than or equal to 0.50 ng / ml. no cross reactivity with hcv, tp, hiv or cmv: result time: preferable less than 90 min , anti hbeag elisa specimen: plasma or serum: sensitivity :97% or greater & specificity 99 100 % whichever is more shelf life greater than 12 months , anti hcv igm elisa 4th generation, microplate elisa coated with recombinant / synthetic peptide antigens for core, ns3, ns4 and ns5 and antibody to hcv core antigen: the assay should have relative sensitivity of 100% & specificity of more than or equal to 99% result time:90 min or less , anti hav elisa igm based on capture elisa, should detect igm anti hav in serum or plasma, should be evaluated in bbi hav serum conversion & hav mixed titre performance panel: sensitivity:3mlu / ml or 100% : specificity 99% or more incubation: time 3.5 hours or less: no cross reactivity with hbv, hiv, cmv , hav antigen elisa sample type:stool: specificity:91% of the elisa positive samples should also hav pcr positive.cross reacitivity should be not known , anti hev elisa igm indirect elisa: antibody capture based, 100% specific & 97% & above sensitive or sandwich elisa: double antifen based specificity & sensitivity greater than or equal to 99% , dengue igm elisa igm captureelisa; tested on serum or plasma , specificity :98% or more no9 cross reaction with chik, hcvm syphilis, hbsag, ana, hiv, rf, malaria: no interference with substances like edta3.5 ?mol / l & bilirubin 10 mg / dl ce marked preferably us fda cleared , dengure ns1 elisa ( based on sandwich elisa, test can be performed on serum, plasma , sensitivity= 99%: specificity = 98%: result time: preferably 100 mins or less: preferably us fda approved , ra latex agglutination polystyrene latex particles are used : diagnostidc sensitivity should be > 99%specificity >99% : iso, gmp certified , aso latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 99% specificity >98% iso, gmp certified , crp latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 96% specificity >97% iso, gmp certified , widal tube or slide agglutination iso certified widal antigens s, typhio & h antigens, s paratyphiah & bh antigen . positive & negative controls: sensitivity>89% & specificity > 88% time of result preferable less than 5 min. icmr approved ce / iso 13458 certified. ce rep registered . storage cond.: 2 8 degrees , rpr reagin antibodies based on flocculation principle using non treponemal antigen. tested on serum , plasma , sensitivity or 85% or more in primary syphilis and a specificity of 93% or more. the assay should be calibrated to who reference serum and the same should be supported by statement in kit insert and certifidate from manufacturer: result within 20 mins: should include positive and negative serum controls. , tpha kit or tp antibody kit cassette device with desicant, detect igg, m7 a antibodies: use serum , plasma or whole blood speciment. lateral flow doulbel sandiwich elisa technology, sensitiity 97% & more specificity 99% or more, external evaluation validates performance. , rota virus igm elisaenxyme immmunoaasays using polyclonal or monoclonal antibodies against the group a specific antigen ( vp 6 ) , lower detection limit of rotavirus antigen :< 10 ng / ml, specificity: 99% & above & sensitivity : 98% & above. , occult blood test performed in stool, reaction time 10min, guaiac or preferably anti haemoglobin antibodies based immunochromatographic assay based which is more sensitive than guaiac testing, no dietary restrictions, clia waived: storage 2 30 c, specificity>96% accuracy 97%, detection limit 50 ng / ml of heamologbin or 6?g hemoglobin / g feces. , others , vtm , parafilm tape roll ( 4inchx125 ft. ) , n / 10hcl , elisa reader paper roll , sample cup em 200 , 3.8% sodium citrate , field’s stain a , field’s stain b , 10% soduum hypo. , k3 vaccuim blood collection duble cape vail 3ml , k3 vaccuim blood collection duble cape vail 6ml , clot activator vail gel 5 ml , clot activator vail gel 10ml , citrate vial 2 ml , yellow tips , blue tips , micro slide , test tube 12*100mm , test tube 12*75mm , test tube plastic , lab use tissue paper roll ( 120 mtr ) , test tube stand ( 48 holes ) , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , methanol , urine dispo contaner plastic ( 50ml ) , bio waste bag ( red, yellow, black, blue ) capacity 60 90 litre ( large ) , cover slip , gimsa stain solution , leisman stain , glycerin , zedinol , glass beaker 500ml , glass beaker 250ml , glass beaker 100ml. , liquid parrafin , gluco strip with glucometer ( a meter of same brand will be given at free of cost on purchase ofevery 500 strips ) , auto pipete , auto pipete , auto pipete , auto pipete , auto pipete , multi channel auto pipete ( 8 channel ) , multi channel auto pipete ( 8 channel ) , e.c.g. roll ( 50 m.m.× 20 mtr ) , bandaid ( round ) , gel card for cross match , gel card for blood group , liqued hand wash , urine analyser printer pepar roll 50 / 52 mm , cbc printer paper roll , nitril gloves all size...

Medical Health And Family Welfare - Rajasthan

36710125 supply of chemical regents in x ray sonography laboratary and blood bank in govt hospital chittorgarh , x ray, & sonography items , computerize digital x ray film 8 x 10 , computerize digital x ray film 11 x 14 , digital x ray cassets 14x17 , digital x ray cassets 14x14 , digital x ray cassets 10x12 , sonography paper roll , sonography jelly , e.c.g. jelly , e.c.g. paper roll bpl , biochemistery reagent , blood suger ( end point ) , blood urea ( fixed time ) , blood urea ( brith lot ) , s.creatanine ( fixed time ) , cholestrol ( end point ) , triglyceride ( end point ) , hdl reagent direct , bilirubin t&d ( end point ) , sgot ( kinetic ) , sgpt ( kinetic ) , alkaline phosphatase , s. a. phosphatas , amylase , uric acid , s. ldh , s.ck mb , s.ck nac , calcium , albumin , total protine , crpquantitative , crp qualitative , rf factor , raquantitative , bio chemistery reagents for fully autometic , wash 1 , wash 2 , blood sugar , blood urea , blood creatinine , blood cholesterol , blood triglycerides , hdl , blood bilirubin total , blood bilirubin direct , blood s.g.p.t. , blood s.g.o.t. , blood total protein , blood albumin , alk. phos. , uric acid , calcium , amylase , ck mb , ck nac , ldh , crp , auto wash , xl wash , erba norm , xl multical , albumin , alkaline phosphatase , bilirubin direct , bilirubin total , calcium , creatinine enzymatic , creatinine jaffe , cholestrole , glucose ( god pod ) , glucose hexokinase uv , total protein , triglyceride , crp , sgot el , sgpt , amylase , urea , uric acid , hdl cholesterol with calibrator , ldh p , phosphorus , rapid test , hbsag , hcv rapid , dengue combo ns1 antigen+lgg 1gm antibodytest , dengue antibody test , malariyaantigen test , pregnancy test , thaypi dot test , scrub thypus igm antibody test , chikungunya igm antibody test , vdrl test strip , urine albumin sugar test , urine analyser test strip 10 paramiter , leptospirosis rapid kit , hepatitis a , hepatitis e , typhoid iggigm , elisa test kit for lab , dengue ns1ag microlisa , scrub typhus igm elisa , chikungunya igmelisa , dengue 1gm microlisa , leptospirosis elisa kit , reagents for 5 part hematology analyser ( trans ) , h 560 diluent , h 560 lyse 1 , h 560 lyse 2 , h 560 elite h clean , h 560 controls ( h, n, l ) , h 560 calibrator , control h , control n , control l , calibrator , reagent for 5 part hematology analyser ( mindray ) , m 52 diluents , m 52 diff lyse , m 52 lh lyse , probe cleaner , calibrator , control low , control high , control nusmal , reagent for 3 part hematology analyser ( mindray ) , m 30 diluents , m 30 diff lyse , m 30 lh lyse , probe cleaner , reagents for ecl 105 , erba protime ls , erba actime , erba calcium chloride , erba ddimer , erba ddimer calibrator , erba ddimer control n+p , erba single reaction cuvettes src 10 , thermal printer paper rolls 3x57mmx15m , test kit forictc ( subject tonacoapproved ) , hiv tridot , hiv triline , hiv comb aids , rekteble neddle , vacuum 3.8 % sodium citrate esrblood collection. tube , floride blood collection vail , blood sample trensport vail ct gel , elisa kits for blood bank ( subject tonacoapproved ) , h.i.v.kit , h.c.v. kit , hbs ag. kit , reagents for blood bank , bovine albumin , anti a1b , anti “a1, ( lectin ) , anti “h” , anti “d”. igg+igm ( monoclonal ) , anti humen globuline ( ahg ) , blood grouping anti sera abd , r.p.r. test ( latex ) , cpda blood collection bag 350 ml , cpda blood collection bag 100 ml , cpda blood collection bag ( triple ) 350 ml , cpda blood collection bag ( triple ) 450 ml , cpda blood collection bag ( double ) 350 ml , cpda blood collection bag ( penta ) 450 ml , screw cap vial plain 5 ml , tourniquit belt ( standred quality ) , glass droper ( pauster pipet ) , hb haemocue 301 cuvet ( a meter and a lancet will be givenat free of cost on purchase of every 1500 microcuvettes ) , serology kits , r.a. factor , widal test , crp test qualitative , aso test , microbiology , mac conkey agar with 0.15% bile salts, cv and nacl 500 gm , nutrient agar , cled agar , sulfide indole motility agar , kovacs indole reagents , mannitol powder , glucose powder , lactose powder , sucrose powder , hydrogen peroxide 3 / 6% , oxidase reagent , mueller hinton agar , sda with chloramphenicol , crystal violet powder , agar powder bacteriological grade , thioglycollate powder , acetone , grams stain kit , hi chrome agar for candida 100 , potassium hydroxide , sda , lactophenol cotton blue , capsule stains , cary blair medium , safranin stain , lowenstein jensen powder , ferric chloride powder , bile esculine agar , peptone powder , selenite f broth powder , india ink or nigrosin , methylene blue stain , glutaraldehyde , ethylacohol , spirit , potassium tellurite agar , zn staining kit , tcbs agar , xylene , glucose phsphate broth , 0.5 mc farland standard , bromocersol purple indicator , andrades indicator , sodium hypochloride 10% , glassware and other plastic consumables etc. for microbiology ( all below glassware should be made of borosilicate glass preferably 3.3 glass & should meet standards of astm e, iso 9001, 7348, 3585 & din 12331 , glass petri dish culture 90 mm , glass slides size 75 mmx25mmx1.35mm , single cavity glass slide for motility , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml;100 / pk , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 30 ml:100 piece / pack , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 120 ml:40 piece / pack , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a, usp certicate , amber coloured wide mouth graduated glass bottle 500ml , glass funnel plain 60 degree angle long stem, size 75 mm , u shaped glass rod , glass beaker with spout ( discarding jar ) 1 ltr , test tube glass size 10mmx150mm , test tube glass size 20mmx150mm , measuring pipette with rubber bulb 10 ml ( mohr type ) glass b , measuring cylinder, with class a certificate capacity 1000ml with stopper , measuring cylinder, with class a certificate capacity 250 ml with stopper , durhams tube , cover slip 2*2 cm square , antibiotics discs for microbiology , amikacin 30 mg , amoxyclav 30 mcg , ampicillin 2mg , axithromycin 15 mcg , aztreonam 30 mcg , bacitracin 50 disc / vl , bile esculin discs , cefazolin ( cz ) 30 mcg , cefipime 30 mcg , cefixime 5mcg , cefoperazone sulbactum 75 mcg , cefoperazone sulbactum 30mcg , cefotaxime 30 mcg , cefoxitin 30 mcg , ceftazidime 30mg , ceftazidime / clavulamic acid 30 mg , ceftazidime / clavulamic acid10 mg , ceftriaxone 30 mcg , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mg , clindamycin 2 mcg , colistin 10 mcg , co trimoxazole 23 75 / 1.25 mg , erythromycin , gentamicin 10mcg , gentamicin 120mcg , imipenem 10mg , levofloxacin 5mcg , linezolid 30mg , meropenem 10 mcg , metronidazole5 mg , nitrofurantoin 300 mcg , novobiocin 30 mg , onpg disc , optochin disc ( for s.pnemonioe ) , oxidase discs. , penicillin g 10 units , piperacillin 100 mg , pipera tazobactum 100 / 10 mcg , polymyxin b 300 units , teicoplanin 30 mcg , tetracycline 30 mg , tobramycin 10 mcg , vancomycin 30 mcg , fosfomycin 200 mcg , tigecycline 15 mcg , cinoxacin 100 mcg , norfloxacin 100 mcg , oxacillin 10 mcg , other plastic consumables , slide boxes for students for 20 slides , heavy duty gloves heat resistand, category iii glove, preferably en 407 performance level , test tube stand polypropylene 3 tier for test tubes , paraffin film m rolls 2inch width 250 feet length , falcon tube ( conical ) polypropylenem usp class vi, max g force of 15, 000 xg:50 ml, 360 piece / pk , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each , test tube rack holder 40 50 holes vents plastic centrifugal deck , universal eto sterile plastic ( pp ) containers ( 30ml ) 100 piece in pack , coplin jars pp for keeping slides pack of 12 , sterile swab with collection vial ( hirmedia pref. ) 100 piece / pkt , spatula spoon shaped plastic for chemical dispense ( gradueated ) , filter paper size no.1 460x570: no of circles / sheets , autoclave bowie dick tape 1 pack of 30 test, complies to ansi / aami / iso 11140 5:2007 class 2 , ph paper strips 1 14 ph range himedia, fisher scientific , disposable 100 cm diameter petri dish , disposable test tubes 10 mm diameter 5 ml capacity , discarding tub 3 litre , sterile samole container , glass marking pencil , plastic basket for sample transportation 1feetx1.5feet , miscellaneous steel item , forcep stainless steel non corosive surgical grade ( 00 & higher ) , nichrome straight wire ( 2 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , nichrome loop wire ( 3mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , sterile stainless stell surgical blade of 11 nos. pack of 100 piece , forcep for cover glasses, kunhe type , steel rod for staining in practical lab , utility tray for slides , stainless steel forceps, pointed , autoclavable, size 8 inch, ss 410, 2 nos / pack , test tube washing brushes steel , scissors , spirit lamp , other kits and consumables for microbiology , anti hbsag elisa igm 4th generation, should include reactive and non reactive controls, sensitivity of more than or equal to 99%: specificity of more than or equal to 99%. analytical sensitivity: less than or equal to 0.50 ng / ml. no cross reactivity with hcv, tp, hiv or cmv: result time: preferable less than 90 min , anti hbeag elisa specimen: plasma or serum: sensitivity :97% or greater & specificity 99 100 % whichever is more shelf life greater than 12 months , anti hcv igm elisa 4th generation, microplate elisa coated with recombinant / synthetic peptide antigens for core, ns3, ns4 and ns5 and antibody to hcv core antigen: the assay should have relative sensitivity of 100% & specificity of more than or equal to 99% result time:90 min or less , anti hav elisa igm based on capture elisa, should detect igm anti hav in serum or plasma, should be evaluated in bbi hav serum conversion & hav mixed titre performance panel: sensitivity:3mlu / ml or 100% : specificity 99% or more incubation: time 3.5 hours or less: no cross reactivity with hbv, hiv, cmv , hav antigen elisa sample type:stool: specificity:91% of the elisa positive samples should also hav pcr positive.cross reacitivity should be not known , anti hev elisa igm indirect elisa: antibody capture based, 100% specific & 97% & above sensitive or sandwich elisa: double antifen based specificity & sensitivity greater than or equal to 99% , dengue igm elisa igm captureelisa; tested on serum or plasma , specificity :98% or more no9 cross reaction with chik, hcvm syphilis, hbsag, ana, hiv, rf, malaria: no interference with substances like edta3.5 ?mol / l & bilirubin 10 mg / dl ce marked preferably us fda cleared , dengure ns1 elisa ( based on sandwich elisa, test can be performed on serum, plasma , sensitivity= 99%: specificity = 98%: result time: preferably 100 mins or less: preferably us fda approved , ra latex agglutination polystyrene latex particles are used : diagnostidc sensitivity should be > 99%specificity >99% : iso, gmp certified , aso latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 99% specificity >98% iso, gmp certified , crp latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 96% specificity >97% iso, gmp certified , widal tube or slide agglutination iso certified widal antigens s, typhio & h antigens, s paratyphiah & bh antigen . positive & negative controls: sensitivity>89% & specificity > 88% time of result preferable less than 5 min. icmr approved ce / iso 13458 certified. ce rep registered . storage cond.: 2 8 degrees , rpr reagin antibodies based on flocculation principle using non treponemal antigen. tested on serum , plasma , sensitivity or 85% or more in primary syphilis and a specificity of 93% or more. the assay should be calibrated to who reference serum and the same should be supported by statement in kit insert and certifidate from manufacturer: result within 20 mins: should include positive and negative serum controls. , tpha kit or tp antibody kit cassette device with desicant, detect igg, m7 a antibodies: use serum , plasma or whole blood speciment. lateral flow doulbel sandiwich elisa technology, sensitiity 97% & more specificity 99% or more, external evaluation validates performance. , rota virus igm elisaenxyme immmunoaasays using polyclonal or monoclonal antibodies against the group a specific antigen ( vp 6 ) , lower detection limit of rotavirus antigen :< 10 ng / ml, specificity: 99% & above & sensitivity : 98% & above. , occult blood test performed in stool, reaction time 10min, guaiac or preferably anti haemoglobin antibodies based immunochromatographic assay based which is more sensitive than guaiac testing, no dietary restrictions, clia waived: storage 2 30 c, specificity>96% accuracy 97%, detection limit 50 ng / ml of heamologbin or 6?g hemoglobin / g feces. , others , vtm , parafilm tape roll ( 4inchx125 ft. ) , n / 10hcl , elisa reader paper roll , sample cup em 200 , 3.8% sodium citrate , field’s stain a , field’s stain b , 10% soduum hypo. , k3 vaccuim blood collection duble cape vail 3ml , k3 vaccuim blood collection duble cape vail 6ml , clot activator vail gel 5 ml , clot activator vail gel 10ml , citrate vial 2 ml , yellow tips , blue tips , micro slide , test tube 12*100mm , test tube 12*75mm , test tube plastic , lab use tissue paper roll ( 120 mtr ) , test tube stand ( 48 holes ) , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , methanol , urine dispo contaner plastic ( 50ml ) , bio waste bag ( red, yellow, black, blue ) capacity 60 90 litre ( large ) , cover slip , gimsa stain solution , leisman stain , glycerin , zedinol , glass beaker 500ml , glass beaker 250ml , glass beaker 100ml. , liquid parrafin , gluco strip with glucometer ( a meter of same brand will be given at free of cost on purchase ofevery 500 strips ) , auto pipete , auto pipete , auto pipete , auto pipete , auto pipete , multi channel auto pipete ( 8 channel ) , multi channel auto pipete ( 8 channel ) , e.c.g. roll ( 50 m.m.× 20 mtr ) , bandaid ( round ) , gel card for cross match , gel card for blood group , liqued hand wash , urine analyser printer pepar roll 50 / 52 mm , cbc printer paper roll , nitril gloves all size...

Medical And Health Services - Rajasthan

36457627 tender for supply of laboratory equipment 1 a.s.l.o. kit ( rapid ) 2 acetic acid 3 alkine phosp. ( for semiautoanalizer ) 4 amylase test kit 5 auto analyzer paper role 6 auto pippetes tips ( 5ml. / micro lit. ) 7 blood sugger kit ( for semiautoanalizer ) 8 blood urea kit ( for semiautoanalizer ) 9 blue tipes 10 yellow tipes 11 c.r.p. kit ( quantative ) 12 c.r.p. kit ( qualittive ) 13 capilary tube ( isi marked ) 14 stop watch 15 abx cbc detergernt solution horiba co. 16 abx cbc diluent ( 20 ltr ) horiba co. 17 abx cbc lyse ( 1 ltr ) horiba co. 18 cbc printer paper 19 cbc probe cleaner ( 1 ltr ) 20 cbc mono clair ( 500 ml ) 21 cbc controll horiba co. 22 centirfuse tube ( isi marked ) 23 chamber cover slip 24 cholstol kit ( for semiautoanalizer ) 25 ck nac test kit 26 ckmb test kit 27 cl+ 28 coombes test ( direct ) 29 coombes test ( indirect ) 30 hiv rapid card 31 cubette calorimeter 32 chikengunia elisa test kit 33 chikengunia rapid test kit 34 dengue kit ( elisa method kit ) ns1, igg, igm ( other ) 35 dengue kit ( elisa method kit ) ns1, igg, igm ( j.mitra ) 36 dengue kit ( elisa method kit ) ns1, igg, igm ( s.d. ) 37 dengue rapid kit ns1 igm / igg ( other ) 38 dengue rapid kit ns1 igm / igg ( j.mitra ) 39 dengue rapid kit ns1 igm / igg ( s.d. ) 40 disttil water ( 5 ltr. tin ) 41 dlc counter 42 dropper 43 e.d.t.l. powder 44 plane vial ( double cap ) 45 e.s.r. pipetts ( use and throw ) 46 electolyte kit chlorine 47 erba cell wash for biochem. 48 esr stand 49 esr tube glass 50 tissue paper role 51 filter paper / blooting paper 52 fuchet regent for bile pigment 53 glass pfncil ( marking ) 54 gluco strips bg 02, 03 ( dr. morpfn ) 55 glucometer 56 glucometer strip ( other ) 57 jsb ist & iind 58 k+ 59 lactin a kit ( rapid ) 60 ldh test kit 61 lenset 62 lipidprofile 63 liqucilince ( e ) 64 lismans stain 250ml / 500ml 65 m.t. vail 10 tu 66 malaria fild stain a 67 malaria fild stain b 68 slide box ( 100 slide ) 69 slide staning stand 70 beakar 250 350ml ( slide staning ) 71 micro clear glass slide ( 76*26*0.95 ) with ground polish edge ( isi marked ) 72 micro pipette 0 50 other 73 micro pipette 0 50 erba 74 micro pipette 0 100 other 75 micro pipette 0 100 erba 76 micro pipette 0 500 other 77 micro scopice cober slip 78 eye piece 5x ( microscope ) 79 eye piece 10x ( microscope ) 80 microscope lense 10x 81 microscope lense 40x 82 microscope lense 100x 83 xylene ( for microscope lence cleaning ) 84 micro pipette 0 500 erba 85 multisticks ( for urine ) 86 n / 10 solution 87 na+ 88 neuber’s chamber 89 nitic acid 90 p.t. tube ( isi marked ) with cork & sticker 91 platelet counting fluid ( rees ecker ) 92 pregnancy kit card other 93 pregnancy kit card acon 94 pregnancy kit card s.d. 95 pregnancy kit card jmitra 96 promthrombin testkit 97 r.a. factor ( rapid ) 98 rbc pipette 99 rh view box 100 s. calcium 101 s.g.o.t. ( for semiautoanalizer ) other 102 s.g.o.t. ( for semiautoanalizer ) erba. co. 103 s.g.p.t. ( for semiautoanalizer ) other 104 s.g.p.t. ( for semiautoanalizer ) erba. co. 105 seman analysis sierm count 106 serum albumin test kit 105 serum bilirubin ( for semiautoanalizer ) 106 serum cretinine kit ( for semiautoanalizer ) 107 serum hdl 108 serum ldl 109 serum protin 110 serum protine ( for semiautoanalizer ) 111 serum trigly ceride 112 sodium citrate 113 sulfur powder 114 scrub typhous elise kit elise for igg / igm 115 scrub typhous elise test kit 116 scrub typhous rapid test kit 117 t.s.h. 118 t3 119 t4 120 tec fluid 121 test tube 10 ( isi marked ) 122 test tube 4 ( isi marked ) 123 test tube holder 124 test tube stand 125 test tube ( isi marked ) 126 tlc fluid 127 tlc pipetts ( isi marked ) 128 triglyceride 129 uric acid ( for semiautoanalizer ) 130 urine analizer ( strip ) 131 urine container 30ml with stikar 132 urinstrip ( aib & sugger ) 133 multistrip ( urin ) 134 v.d.r.l. 135 vdrl rapid card 136 yellow tipes 137 wbc fluid 138 widal test ( slide method ) 139 aslo 50 t 140 blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes 1 abx diluent 2 abx alphalyse 3 abx eosinofix 4 abx cleaner 141 abx minoclear 1 reagents for elisa reader 2 hiv elisa 1x100t 3 hbs ag elisa 1x100t 142 hcv alisa 1x100t 143 fully auto analyser model erbaxl 300 reageuts, chemicals & disposables 144 albumin system pack 145 amylase system pack 146 bilirubin t&d system pack 147 urea system pack 148 cholestrol system pack 149 alkaline phosphate system pack 150 glucose system pack 151 s. creatnin system pack 152 calcium system pack 153 total protein system pack 154 trigly ceride system pack 155 hdl colestrol direct system pack 156 sgot system pack 157 sgpt system pack 158 chloride system pack 159 uric acid system pack 160 ck system pack 161 ckmb system pack 162 sample cup system pack 163 ggt system pack 164 ldl cholestrol with calibrator system pack 165 ldhp system pack 166 microprotein system pack 167 phosporus system pack 168 x l multical system pack 169 x l wash system pack 170 regent for fully auto anlyzar ( randox ) s a human assayed multi sera level 2 b human assayed multi sera level 3 c calibration sera level 3 d wash solution no.1 e wash solution no. 2 f ast ( got ) liquid g alt ( gpt ) ( liquid ) h alk. phos. ( liquid ) i bilirubin direct liquid j bilirubin total liquid k calcium liquid l cholesterol liquid m glucose liquid n creatinine liquid o urea liquid p uric acid liquid q triglycerides liquid r c1 wash solution 171 regent 1 trop t test kit ( rodhe deiuh ) ( rodhe deiuh ) 2 trop i test kit ( rodhe deiuh ) ( rodhe deiuh ) 172 quantitative crp kit 173 edta tube double cap 174 heamoglobin meter ( squar shape ) ( isi mark ) 175 cloted vial with stikar 176 multi channel pippet ( 0μl 50μl ) ( 50μl 100μl ) ( 100μl 1000μl ) erba 177 ( cbc rotater ) 178 cross match card 179 blood group card 180 glass measuring cylinder 181 vdrl rotater 182 elisa machine / reader / washer one set 96 test ( rayto ) wave length range 400 750 nm 183 blood weight machine ( ) 184 blood donation donor coatch 185 binocular microscope 186 tissu paper role 187 cover slip size ( 18x18mm micro cover glass ) no.1....

Medical Health And Family Welfare - Rajasthan

36402103 supply of lab and blood bank regents in govt bdm district hospital kotputli , list for laboratry & blood bank regents , elisa test kit for hiv 96 test (4th generation) , elisa test kit for hiv 96 test (3rd generation) , elisa test kit for hcv 96 test , elisa test kit for hcv 96 test (4th generation) , elisa test kit for hbsag 96 test(4th generation) , elisa test kit for hbsag 96 test(3rd generation) , elisa test kit for dengue igm 96 test , elisa test kit for dengue igg 96 test , elisa test kit for dengue ns 1 96 test , elisa test kit for scrub typhus 96 test , elisa test kit for chickengunia96 test , rapid test card malaria pan ldh 1 piece , rapid test card malaria antigen 1 piece , rapid test card for dengue ns1 1 piece , rapid test card for dengue igm 1 piece , rapid test card for dengue ns1 + igm ( combo ) 1 piece , rapid test card for hiv(4th generation) 1 piece , rapid test card for hiv 1 piece , rapid test card for hcv 1 piece , rapid test card for hcv (3rd generation) 1 piece , rapid test card for hcv (4th generation) 1 piece , rapid test card for hbsag 1 piece , rapid test card for scrub typhus 1 piece , rapid test card for chickengunia 1 piece , rapid test card for typhoid igm + igg 1 piece , rapid test card for syphilis 1 piece , rapid test strip for syphilis 1 piece , rapid test card for hiv & syphilis 1 piece , pregnency test strip 1 piece , pregnency test card 1 piece , antisera anti. a monoclonal 10 ml , antisera anti b monoclonal 10 ml , antisera anti ab monoclonal 10 ml , antisera anti d igm monoclonal 10 ml , antisera anti d (igm + igg) monoclonal 10 ml , lectin a1 monoclonal 10 ml , ahg monoclonal 10 ml , antisera anti h monoclonal 10 ml , blood grouping test kit (abd kit) (monoclonal) 10 ml each , bovine alumine 22% 10 ml , gel card ahg (coomb gel card) for cross match 1 piece , gel card ahg (coomb gel card) for blood group 1 piece , liss solution 500 ml ( ready ) , blood sample collection edta vial single cap5 ml 100 piece , blood sample collectionplainvial single cap 5 ml 100 piece , blood sample collectionpt vial single cap 5 ml 100 piece , blood sample vial5ml (edta)double cap 100 piece , blood sample vial 5ml (plain) double cap 100 piece , blood sample collectionclot activater vial single cap 5 ml 100 piece , blood collecting bag cpda 1 paed 100ml 1 piece , blood collecting bag cpda 1 350ml single 1 piece , aslo test kit 4ml ( latex ) , aslo test kit 50ml ( quantitative ) , analyser paper roll for horiba 3 part cbc 1 piece , analyzer paper roll for semi biochemistry analyzer 1 piece , analyzer paper roll for lura urineanalyzer 1 piece , pasture pippett (plastic) volume 5 ml 1 piece , wash bottel 2 ltr , wash bottel 5 ltr , wash bottel 10 ltr , throat swab (cotton) 100 piece , throat swab (nylon) 100 piece , throat swab (dacron) 100 piece , plastic zip lock pocket 100 piece , blood sugar test strip with acquachek with glucometer (50 strip) , blood urea test kit , blood sugar accusure insci glucometer strip (50 strip) , crp test kit4ml ( latex ) , crp test kit50ml ( quantitative ) , crp titration test kit4ml , cover slip for neubar chamber 100 piece , cover slip for glass slide 100 piece , counting chamber (neubar) 1 piece , capilary tube 1.5 mm diameter x 10 15 cm length (50 piece) , cbc roll (pos 555 tl) (55mm×15 mtr) 1 roll , ckmb trop t test card(1 piece) , ckmb trop i card(1 piece) , cknac trop t test card (1 piece) , ck mb solution 1x25 ml , ck nac solution 1x25 ml , disposal droper(100 piece) , plastic test tube with screw cap 10ml(100 piece) , plastic test tube with screw cap 5ml(100 piece) , disposal plastic test tube 5ml(100 piece) , disposal plastic test tube 10ml(100 piece) , disposable face mask (100 piece) , disposal cap(100 piece) , edta solution 500ml bottel , drabkin solution 5 ltr. pack , dettol liquid (500ml) , esr standwestergen blood test pipet (5 test stand) 1 piece , esr tube glass for westergen mathod 1 piece , disposable plastic esr pippet 100 piece , esr pippet cuff 100 piece , elicote vial 100 piece , floride vacutainor vial 100 piece , glass slide 76mmx26mm 100 piece , haemoglobinometer (german made)top 1 piece , hb tube square haemometer mesauring tube (top) 10 piece , giemsa stain 500 ml , methylene blue stain500 ml , gention violet stain 500 ml , jsb i (solution ) 500ml , jsb ii (solution) 500 ml , leishman stain 500ml , lense cleaning paper packet (50 page) , lable chips (paper) 1000 piece , liquid parafin 500ml , micro tips 1000 micro ltr 1000 piece , micro tips 200 micro ltr 1000 piece , micro tips 50 micro ltr 1000 piece , micro tips 20 micro ltr 1000 piece , micro scope blub isi 1 piece , microscope lense (made in german, japan, poland) 1 piece , micro pippet10 to 100 micro 1 piece , micro pippet100 to1000 micro 1 piece , multichannel micropippet for elisa 1 piece , n/10 hcl 500ml , n95 mask with respirator 1 piece , n95 mask without respirator 1 piece , mask tripple layer 100 piece , pap stain 500 ml , hematoxylin and eosin stain 500 ml , p.p. e.kit for swine flue 1 piece , p.p. e.kit sitra approved, 90 gsmwith (n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit 100 gsm sitra approved, 90 gsmwith (n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit for corona with (triple layer mask, googles,face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit googles 1 piece , face shield 1 piece , surgical sterile gloves 6 no 1 pair , surgical sterile gloves 6.5 no 1 pair , surgical sterile gloves 7 no 1 pair , surgical sterile gloves 7.5 no 1 pair , disposal rubber gloves large size 1 piece , disposal rubber gloves medium size 1 piece , infrared thermometer 1 piece , multi surface disinfectant liquid 500 ml , foot press sanitizer stand 1 piece , uv disinfection sanitizres 1 piece , pulse oxymeter finger tip 1 piece , r.a. test kit 4ml ( latex ) , r.a. test kit 50ml ( quantitative ) , test tube stand 100 test tube (steel) 1 stand , sodium citrate solution 500ml , sterile water 5 l packing , semen dilutingfluid 100 ml , spinal niddle 26 g 1 piece , triplefilterd disttled water5 l packing , test tube stand steel 24 test tube , test tube stand steel 12 test tube , test tube stand plastic12 test tube , test tube stand plastic24 test tube , test tube stand plastic48 test tube , test tube stand plastic50 test tube , tissue paper roll 1 piece , arm tourniquites for blood sampling 1 piece , urine test strip for albumine, sugar & ketone body 100 piece , urine test strip (albumine sugar) 100 piece , urine container (disposable) 30ml , vtmvial forswine flu & corona 1 piece , vial 5 ml (open mouth) for cross match (plastic) 100 piece , vial 5 ml (open mouth) for cross match (glass) 100 piece , vacutainor plain vial 5 ml 100 piece , vacutainor edta k3 vial 5 ml 100 piece , vacutainor holder and niddlemulti sample 100 piece , vacume test tube edta (with niddle) 2ml 100 piece , vacume test tube edta (with niddle) 5ml 100 piece , vacume test tube plain (with niddle) 2ml 100 piece , vacume test tube plain (with niddle) 5ml 100 piece , widal test kit 4 x 5 (to, th, ah, bh) 1 kit rate , dettol hand wash 500ml , phenyle 5 ltr. , vacutainor sodium citrate test tube 100 piece , cuso4 solution for hemoglobine estimation 100 piece , wintrobs tube 100 piece , disposable esr test tube 100 piece , swine flu vaccine 0.5 ml , sodium hypochloride 6% 5 ltr. , sodium hypochloride 5% 5 ltr. , sodium hypochloride 4% 5 ltr. , xylene 100ml , coplin staining jar 100 ml , coplinstainingjar 200 ml , staining jar 250 ml , gram staning regent (readymade) 100 ml , sticker roll for computer (4 x 4 size) 1 roll , culture bottle 100 ml , culture bottle 200 ml , culture bottle 500 ml , gluteraldehyde 5 ltr. , vial for calcium test 100 piece , prolyle control (for electrolite machine) , multi control for semi auto biochemistry analyzer , bar code sticker l x w (2x1) 5000 piece , wax ribbon roll forbar code sticker l x w (2x1) 5000 piece , digital dlc counter machine 1 piece , regents forsemi auto analyser machine , serum calcium test kit liquid (2x100 ml) , serum creatinine test kit liquid (2x100 ml) , serum cholestrol test kit liquid (2x100 ml) , serum bilirubin test kit liquid (200 ml) , serum sgot test kit (2x50 ml) , spirit 5 ltr. (methylated) , serum sgpt test kit(2x50 ml) , s. alk. phosphate kit liquid (2x50 ml) , s. protein total liquid (2x50 ml) , s. albumin kit liquid (2x50 ml) , s. ldh liquid (2x50 ml) , s. amylase liquid (2x50 ml) , s. uric acid liquid (2x50 ml) , p.p.e kit for hiv 1 piece , serum ldh test kit liquid (2x50 ml) , blood sugar test kit (2x500 ml) , cpkmm trop ttest kit 1x25ml , cpkmb trop t test kit 1x25ml , hdl chloresterol test kit (erba, span) (2x50 ml) , triglyceride test kit (2x50 ml) , regents for culture media , nutrient agar plate 1 piece , sheep blood agar plate 1 piece , macconkey agar plate 1 piece , triple sugar iron agar 1 piece , urea agar base(christensen) (autoclavable) 1 piece , citrate agar , oxidase discs (50 discs/vl) , gram stains kit 50 ml , grams crystal violet , kovacs indole regent , whatman filter paper no 1 100 piece , gention violet staning 100 ml , crystal violet stain100 ml , grams iodine 100 ml , lugol iodine 100 ml , aluminium slide tray for 10 slide 1 piece , potassium iodide 200 gm , safranin counter stain 100 ml , acetone solution 100 ml , absolute ethyl alcohol 100 ml , 95 % ethyl alcohol100 ml , methyl alcohol 100 ml , phosphate buffer solutions (ph 7.2) 500 ml , vial 50 ml 1 piece , folken tube 1 piece , autoclave strip 1 piece , powder sucrose 75 gm , lancet with guard 100 piece , niddle 26 g 100 piece , niddle 23 g 100 piece , draining rack , measuring cylinder 100 ml , measuring cylinder 200 ml , slide staining rack 1 piece , nicrome loop 1 piece , pt vial for pt inr 100 piece , plastic gown (disposable) 1 piece , plastic gown (washable) 1 piece...

Medical Health And Family Welfare - Rajasthan

36167062 supply of various types of test kits, rejents and materials for laboratory and blood bank at mahatma gandhi hospital bhilwara , n/10 hcl (h b meter sahilis ) 1x500 ml , copper sulphate powder 1x500 gm , hb meter tube (square) (h b meter sahilis ) 1x1 tube , whatsmans filter paper (circular) (bt manual) 1x100 pcs , lancet(bt manual) 1x100 pcs , lancet(bt manual) 1x200 pcs , capillary tube fine (bt ct manual) 1x100 tube , neubar chamber (tlc manual) 1x1 unit , wbcpipette (tlc manual) 1x1 pcs , methanol (dlc & pbf manual) 1x2.5 ltr , methanol (dlc & pbf manual) 1x500 ml , field stain (dlc & pbf manual) 1x500 ml a+1x500 ml b (a+b) kit , glass slides (dlc & pbf manual) 1x50 slide pkt , cedar wood oil(dlc & pbf manual) 1x500 ml , reticulocytecount fliud (dlc & pbf manual) 1x100 ml , mgg stain(dlc & pbf manual) 1 kit , rapid papstain(dlc & pbf manual) 1 kit , leishmansstain(dlc & pbf manual) 1*500 ml cytochrome+1x500 ml stock buffer (2x) , leishmansstain(dlc & pbf manual) 1 kit , esr stand with marking(esrmanual) 1x1 pcs , esr test cup (plastic)(esrmanual) (1x500 cup pkt) , esr pipette (glass)(esrmanual) (1x5 pipette) , esr pipette with bulb (disposable autosuck) (esr manual) (1x100 pipette) , tri sodium citrate 3.8% (solution) (esr manual) (1x500 ml) , stop watch (esr manual) 1x1 pcs , k3 edta tube (double cap) cbc (1x100 tube pkt) , urine albumin/sugar strip (manual) (1x100 strip) , container 50 ml capacity disposable with screw cap plastic (urine albumin/sugar manual) (1x100container) , multi stix (urine complete manual) 16 parameter (1x100 stix) , multi stix (urine complete manual) 12 parameter (1x100 stix) , cover slip (urine complete manual) (1x50x20) , urine pregnancy test strip (manual) (1x100 strip) , urine pregnancy test strip (manual) (1x50 strip) , urine pregnancy test card (manual) (1x30 card) , urine pregnancy test card (manual) (1x50 card) , lugols iodine (stool test manual) (1x125 ml) , 33% acetic acid(common reagent for urine stool manual) (1x500 ml) , sulpher powder (common reagent for urine stool manual) (1x400 gm) , keto diastic (for urine manual) (1x50) , hemo spot test for occult blood (1x100) , hemo spot test for occult blood (1x200) , trop t rapid (cardic enzyme test) (1x1) , trop irapid (cardic enzyme test) (1x1) , sky blue cap tube (for pt inr) (1x100) , coombs reagent (abo rh agglutination,slide) (1x5 ml) , coombs reagent (abo rh agglutination,slide) (1x10 ml) , bovine albumin 22% (abo rh agglutination,slide) (1x5 ml) , bovine albumin 22% (abo rh agglutination,slide) (1x10 ml) , blood sugar reagent enzymatic (for semi auto god/pod) (2x200 ml) , urea berthlot (for semi auto urease end point (liquid)) (2x100 ml) , urea kinetic (for semi auto) 5x20 ml , creatinine (jaffes for semi auto,initial rate) r1 2x60 ml r2 2x60 ml , sgot for semi auto (without pridoxal phosphate ifcc method) 5x20 ml , sgpt for semi auto (without pridoxal phosphate ifcc method) 5x20 ml , alkaline phosphate kinetic (for semi auto, pnpp) (12x5 ml) , total protein (semi auto analyzwer) (2x50 ml) , albumin(semi auto analyzwer) (2x50 ml) , bilirubin total (for semi auto,jendrassik & grof (1x200 ml) , bilirubin direct (for semi auto,jendrassik & grof (1x200 ml) , uric acid (for semi auto,mono vial) (1x50) , calcium (for semi auto,mono vail) (1x50 ml) , ck mb kinetic (for semi auto) r1 2x8 mlr2 2x1 ml , ck nac kinetic (for semi auto) r1 2x8 mlr2 2x1 ml , amalyse kinetic (for semi auto) (2x20 ml) , cholesterol (for semi auto,enzymatic) (20x50 ml) , hdl cholesterol (for semi auto) (2x20 ml) , triglycerides enzymatic (for semi auto) (1x50 ml x4) , lipase (for semi auto) , ggt (for semi auto) , hba1c(for semi auto) , na+(for semi auto) , k+(for semi auto) , cl (for semi auto) , csf protein fluid (for csf protein manual) (1x100 ml) , code free (blood sugar strip rapid) (1x100) , sample cup plastic (for biochemistry) (1x500) , hepatitis b (hbsag) card (1x100) , hepatitis b (hbsag) card (1x50) , hepatitis b (hbsag) card (1x30 card) , hepatitis b (hbsag) strip (1x30) , hepatitis b (hbsag) strip (1x50) , hepatitis b (hbsag) strip (1x100) , hepatitis b (hbsag) elisa 3rd generation (1x96) , hepatitis b (hbsag) elisa 4th generation (1x96) , vdrl carbon reagent 1*10 ml , vdrl elisa anti body test1*96 , vdrl rapid strip (1x30) , vdrl rapid strip (1x50) , vdrl rapid strip (1x100) , vdrl rpr( rapid) kit (1x50tests) , vdrl rpr( rapid) kit (1x100 test) , hiv rapid card triline(1x30) , hiv rapid card triline(1x50) , hiv rapid tridot (1x50) , hiv rapid tridot (1x100) , hiv rapid combaids (1x48) , hiv elisa 3rd generation (1x96) , hiv elisa 4 thgeneration 1*96 , anti hcv anti bodyrapid card (1x30) , anti hcv anti bodyrapid card (1x50) , hcv elisa 3 rd generation (1x96) , hcv elisa 4thgeneration (1x96) , malaria rapid card antigen/ldh (1x30) , malaria rapid card antigen/ldh (1x50) , malaria rapid card antigen/ldh (1x100) , malariaelisa pan antigen1*96 , pan malaria (rapid pf/pv)(1x100) , pan malaria (rapid pf/pv)(1x50) , pan malaria (rapid pf/pv)(1x30) , widal test kit (vials) (to,th,ah,bh) agglutination rgf 1*4*5 ml , typhoid igm antibody card test(1x1) , aslo kit (agglutination) (1x50) , aslo kit (agglutination) (1x100) , r.a. factor kit (agglutination,qualitative) (1x50) , r.a. factor kit (agglutination,qualitative) (1x100) , jsb i (mp test slide method) (1x500 ml) , jsb ii(mp test slide method) (1x500 ml) , z.n. stain rapid kit (sputum for afb) (1x2x100 ml) , z.n. stain rapid kit (sputum for afb) 1 kit , sprit lamp (sputum for afb staining) (1x1) , geimsa stain , crp (latex agglutination) (1x100) , crp (latex agglutination) (1x50) , dengue rapid antibody (igg+igm)+antigen (ns1)combo card (1x1) , dengue antibody (igg+igm) rapid card (1x1) , dengue antigen (ns1) rapid card (1x1) , dengue elisa antibody (igm) (1x48) , dengue elisa antibody (igm) (1x96) , dengue elisa antigen (ns1) (1x48) , dengue elisa antigen (ns1) (1x96) , scrub tyhpus rapid card (antibody igm) (1x30) , scrub tyhpus elisa (antibody igm) (1x96) , scrub tyhpus elisa (antibody igm) (1x48) , chikungunya rapid card (antibody igm) (1x30) , chikungunya elisa (antibody igm) (1x48) , chikungunya elisa (antibody igm) (1x96) , vtm with swab (for swine fiu) (1x1) , ppe kit (for swine flu) (1x1) , transfer blood bag (without anti coagulant) 100 ml (1x10x10) , blood collection bag (cpda single bag )350 ml (1x10x10) , blood collection bag (cpda single bag )100 ml (1x10x10) , blood collection bag (cpda double bag )350 ml (1x6x10) , blood collection bag (cpda double bag )450 ml (1x6x10) , blood collection bag (cpda double bag with sagm )450 ml (1x6x11) , blood collection bag (cpda tripple bag withoutsagam ) 450 ml (1x5x10) , blood collection bag (cpda tripple bag withsagam ) 450 ml (1x5x10) , blood collection bag (cpda tripple bag with sagam ) 350 ml (1x5x10) , blood collection bag (cpda quadriplebag with sagam) 350 ml (1x4x10) , blood collection bag (cpda quadriplebag with sagam) 450 ml (1x4x10) , quantiple 450 ml (1x3x10) , bio medical waste white bucket with pedal top 25 lit. (1x1) , ns (0.9%) normal saline(1x500 ml) , test tube rack plastic 1x96 wells (1x1) , test tube rack plastic 1x48 wells (1x1) , soft ball (exercise ball)(1x8) , pipette stand plastic (1x1) , antisera stand plastic (1x1) , antisera anti a1 lactin (1x5 ml) , antisera anti h (1x5 ml) , antisera anti ab (1x5 ml) , anti human globulin (ahg) (1x5 ml) , anti a polycolonol (abo rh agglutination,slide) (1x10 ml) , anti b polycolonol (abo rh agglutination,slide) (1x10 ml) , anti d polycolonol (abo rh agglutination,slide) (1x10 ml) , a,b,d vial (abo rh agglutination,slide) (1x3x10 ml) , anti sera amonoclonal(abo rh agglutination,slide) (1x10 ml) , anti sera bmonoclonal(abo rh agglutination,slide) (1x10 ml) , anti sera dmonoclonal(abo rh agglutination,slide) (1x10 ml) , glass test tube 4 (1x100) , glass test tube 3 (1x100) , disposable mask(1x100) , disposable mask(1x50) , mask tripple layer (1x1) , mask n 95 (1x1) , dropper plastic 5 ml (1x100) , micropore transparent tape 1 (1x1) , micropore transparent tape 2 (1x1) , micropore transparent tape 3 (1x1) , band aid (1x100) , bandage 10 cm (1x12) , tongue dipresser wooden (1x100) , zipper polythen (for packing medium size) (1x100) , printer ribbon dot matrix (1x10) , vaccutainer (red top ) for biochemistry 5ml (1x100) , bio medical waste greenbucket with pedal top 25 lit. (1x1) , bio medical waste red bucket with pedal top 25 lit. (1x1) , bio medical waste blue bucket with pedal top 25 lit. (1x1) , bio medical waste yellow bucket with pedal top 25 lit. (1x1) , bio medical waste black bucket with pedal top 25 lit. (1x1) , gel+clot activatervial with cap (3ml) 1 *100 , clot activator vial 4ml 1 *100 , plain screw cap tube 5ml (1x100) , oil immersion lens (for microscope) (1x1) , liquid paraffin(for microscope) (1x500 ml) , tourniquet (buckle type) (1x1) , touniquiet (velcro) (1x1) , rectified spirit(1x500 ml) , phenyl (1x5 ltr) , lyzol (1x5 ltr) , toilet cleaner (1x500 ml) , acid for washing (1x500 ml) , mop (1x1) , dusting cloth (1x1) , doormat 4*6 (1x1) , glass cleaner(1x500 ml) , puncture proof box(1x1) , b.p. instrument (mercury) (1x1) , b.p. instrument dial (1x1) , b.p. instrument digital (1x1) , b.p. instrument cuff with cover (1x1) , b.p. instrument armlet rubber (1x1) , bulb rubber (1x1) , weight machine digital up to 150 kg (1x1) , weight machine arroe up to 150 kg (1x1) , postal scale 1kg (1x1) , tips stand (1x1) , beaker glass 500 ml (1x1) , measuring cylinder 500 ml (1x1) , slipeer rubber (1x1) , calcium sandoz 100 tablet chewable (1x100) , bucket blue with sieve (for bio medical waste) 25 ltr (1x1) , bucket red with sieve (for bio medical waste) 25 ltr (1x1) , micro pipette 10ul(fix volume) (1x1) , micro pipette 20ul(fix volume) (1x1) , micro pipette 50ul(fix volume) (1x1) , micro pipette 100ul(fix volume) (1x1) , micro pipette 500ul(fix volume) (1x1) , micro pipette 1000ul(fix volume) (1x1) , micro pipette 5 50ul(variable) (1x1) , micro pipette 20 200ul(variable) (1x1) , micro pipette 100 1000ul(variable) (1x1) , paper gloves (1x100) , surgical gloves latex disposable (large) (1x100) , surgical gloves latex disposable (medium) (1x100) , surgical gloves latex disposable (smsll) (1x100) , surgical gloves latex 6 (1x1 pair) , surgical gloves latex6.5 (1x1 pair) , surgical gloves latex7 (1x1 pair) , surgical gloves latex7.5 (1x1 pair) , surgical examinination gloves (free size) (1x100) , hand sanitizer (liquid) (1x500 ml) , sodium hypo chloride 5% (1x5 ltr) , test tube rack aluminium (1x72 wells) (1x1) , test tube rack aluminium (1x96wells) (1x1) , test tube rack plastic (1x48 wells) (1x1) , test tube rack plastic (1x96 wells) (1x1) , test tube rack plastic (1x24 wells) (1x1) , slide tray aluminium for 20 slides (1x1) , slide tray aluminium for 24 slides (1x1) , disposable needle 20 nos (1x100) , disposable needle 22 nos (1x100) , disposable needle 24 nos (1x100) , disposable needle 26 nos (1x100) , disposable needle 23 nos (1x100) , disposable syringe 2cc with needle (1x100) , disposable syringe 5cc with needle (1x100) , disposable syringe 10cc with needle (1x50) , blue tips(1x500) , yellow tips (micro) (1x1000) , tissue paper (1x1 roll) , d.i. water (1x5 ltr) , glass marking pencil (1x10) , permanent marker pen (1x1) , marker pen fine tip(1x1) , cotton (1x500 gm) , cpda penta bag 450 ml (1x1x1) , cpda penta bag 450 ml (1x10x6) , cpda penta bag 450 ml (1x10x10) , d.w.(0tds)(1x5ltr) , digital tharmameter 1 pcs , glucometer (code free) (1x1) , blood sugar strip code free (1x100) , accucheck active (blood sugar strip )(1x50) , glucometer cell (1x1) , carbon bush for centrifuge machine (1x2) , grams stain (1x500 ml) , liquid soap for hand wash (1x500 ml) , scalpal blade 11 to 23no (1x100 pcs ) , syringe 20 cc with needle (1x25 pcs) , syringe 50 cc with needle (1x25 pcs) , torch igm elisa (1x96) , torch igm elisa (1x48) , torch igg elisa (1x96) , torch igg elisa (1x48) , hepttitis a elisa (1x96) , hepttitis a elisa (1x48) , thermal printer paper roll (size 57x25mm) (1x12) , anti hav rapid card (1x50) , anti hev rapid card (1x50) , hiv elisa (igg+igm+antibody combo) (1x96) , hiv elisa (igg+igm+antibody combo) (1x48) , surgical knife blade 23 no. (1x100) , aluminium screw for 30 ml glass bottle (30 ml) , bath soap , gdw 5% (glass bottle) (500 ml) , ns (glass bottle) (500 ml) , bio medical waste bag black 50ltr (1x100) , digital weighing machine cell (1x1) , pencil cell (small/medium) (1x1) , liss/coombs (24x12) , diluent (1x500 ml) , abo/rh (4x12) , abo/d+ reverse (24x12) , binocular microscope eye piece 10 x (1x1) , binocular microscope eye piece 5 x (1x1) , binocular microscope objective lens 10 x (1x1) , binocular microscope objective lens 40 x (1x1) , binocular microscope bulb (1x1) , glass slide size 75mmx25mmx1.35mm(1x50) , anti hav elisa igm (1x96) , hbsag elisa (1x96) , hcv tridot pack 4th genration (1x100) , tpha rapid kit (1x1) , brucella igm elisa (1x96) , micropore tap 4 (1x1) , biological indicator of autoclabe machine1 roll , anti hbs ag (hepa card) pack size(1x100test) , ana (16 strips) , japanese encephalitis igm (1x96 tests) , rota virus igm elisa(1x96) , rotavirus/adenovirus latex agglutination(1x100 test) , salmonella o ag group c for salmonella 5 ml x 1 (1 vial) , brucella igm elisa96 test/kit , measles igm (mu capture) (1x96 tests) , hsv 2 card test pack size(100 test) , rubber chestbulb for ecg lead 1 pcs , bio medical waste greenbucket with pedal top 50 lit. (1x1) , bio medical waste red bucket with pedal top 50 lit. (1x1) , bio medical waste blue bucket with pedal top 50 lit. (1x1) , bio medical waste yellow bucket with pedal top 50 lit. (1x1) , bio medical waste black bucket with pedal top 50 lit. (1x1) , plastic bag for biomedical waste 25 ltr red (1x100) , plastic bag for biomedical waste 25 ltr green (1x100) , plastic bag for biomedical waste 25 ltr yellow (1x100) , plastic bag for biomedical waste 25 ltr black (1x100) , plastic bag for biomedical waste 25 ltr blue (1x100) , plastic bag for biomedical waste 50 ltr red (1x100) , plastic bag for biomedical waste 50 ltr green (1x100) , plastic bag for biomedical waste 50 ltr yellow (1x100) , plastic bag for biomedical waste 50 ltr black (1x100) , plastic bag for biomedical waste 50 ltr blue (1x100) , formaldehyde solution (1x5 ltr) , cotton mop (1x1) , dry mop (1x2) , d dimer qualitative (1x60) , d dimer quantitative (1x100) , il 6 (1x100) , pro calcitranin (1x100) , ferritin (1x100) , hba1c kit (1x100) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x500 ml) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x1 ltr) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x5 ltr) , deoxycholate citrate agar(500 gm) , mac conkey agar (500 gm) , nutrient agar (500 gm) , cled agar (500 gm) , mycological peptone (500 gm) , mannitol motility agar (500 gm) , christian urea agar (500 gm) , triple sugar iron media(500 gm) , simmons citrate agar (500 gm) , kovacs indole reagent (500 gm) , mannitol powder (500 gm) , glucose powder(500 gm) , lactose powder (500 gm) , sucrose powder (500 gm) , hydrogen peroxide 3/6% (500 ml) , oxidase reagent 100 gm , mueller hinton agar(500 gm) , potassium di hydrogen phosphate powder 500gm (500 gm) , robertson’s cooked meat broth medium 500 gm (500 gm) , bile salt powder with cholic acid content >= 45.0%, certified, 250 gm (250 gm) , sda with chloramphenicol500 gm (500 gm) , xylose lysine deoxycholate agar (xld agar ) (500 gm) , crystal violet powder 100 gm/pack (500 gm) , thioglycollate powder 500 gm (500 gm) , iodine crystals 100/500 gm(500 gm) , sodiumbicarbonate 500 gm (500 gm) , ammonium oxalate powder 500 gm (500 gm) , potassium permanganate powder 500gm (500 gm) , calcium chloride 100 gm (500 gm) , zeihl neelsen stain kit500 ml with proper cas number, certified (2000 ml) , brain heart infusion broth 500 gm (500 gm) , acetone 500 ml (500 gm) , leishman stainpractical grade for microsopy twin pack 500 ml(500 gm) , leishman stainpractical grade for microsopy 100 gm powder(500 gm) , bile esculin agar 500 gm (500 gm) , selenite f brothpowder( 100gm) , grams stain kit(2 ltr) , dermatophyte test agar & supplement(500 gm) , hi chrome agar for candida 100gm (500 gm) , potassium hydroxide 500 gm (500 gm) , sda with chloramphenicol500 gm (500 gm) , sodium chloride (anhydrous) 500 gm (500 gm) , india ink or nigrosin 100 gm , lactophenol cotton blue(500 gm) , albert stain 100 ml each a& b 100 ml , lowenstein jensen powder 500gm(500 gm) , phenol crystals 500 mg (500 mg) , mannitol motility agar 100 gm , of basal medium 500 gm (500 gm) , ferric chloride powder 500 gm (500 gm) , amikacin (30mg) (2000 discs) , amoxyclav (30 mcg) (2000 discs) , ampicillin(2mg) (2000 discs) , azithromycin(15mcg) (2000 discs) , aztreonam(30mcg) (2000 discs) , bacitracin (50 discs/vl)(1000 discs) , bile esculin discs (500 discs) , cefazolin (cz) (30 mcg) (2000 discs) , cefipime(30mcg) (2000 discs) , cefixime (5mcg) (2000 discs) , cefoperazone sulbactum(75mcg/30mcg) (2000 discs) , cefotaxime (30 mcg) (2000 discs) , cefoxitin (30 mcg) (2000 discs) , ceftazidime (30mg) (2000 discs) , ceftazidime /clavulamic acid (30/10mg) (2000 discs) , ceftriaxone (30mcg) (2000 discs) , cefuroxime(30 mcg) (2000 discs) , chloramphenicol(30mcg) (2000 discs) , ciprofloxacin (5mg) (2000 discs) , clindamycin 2 mcg (2000 discs) , colistin (10mcg) (2000 discs) , co trimoxazole (23 75/1.25mg)(2000 discs) , erythromycin(2000 discs) , gentamicin(10mcg) (2000 discs) , gentamicin(120mcg) (2000 discs) , imipenem (10mg) (1000 discs) , levofloxacin (5mcg) (2000 discs) , linezolid(30mg) (2000 discs) , meropenem(10mcg) (1000 discs) , metronidazole(5mg)(2000 discs) , nalidixic acid (30mg) (1000 discs) , nitrofurantoin(300mcg) (2000 discs) , novobiocin (30 mg) (2000 discs) , onpg discs(1000 discs) , optochin disc (for s.pnemonioe ,,) (1000 discs) , oxidasediscs. (1000 discs) , ofloxacin (5mcg) (1000 discs) , penicillin g(10units) (1000 discs) , piperacillin (100mg) (2000 discs) , pipera tazobactum(100/10 mcg)(2000 discs) , polymyxin b(300units) (1000 discs) , teicoplanin(30mcg) (1000 discs) , tetracycline (30mg) (1000 discs) , ticarcillin clavulanic acid (75/10 mcg) (2000 discs) , tobramycin(10mcg) (2000 discs) , vancomycin(30mcg) (2000 discs) , fosfomycin 200 mcg (1000 discs) , cefoxitin + cloxacillin (2000 discs) , tigecycline 15 mcg (2000 discs) , cephazolin(30mcg) (2000 discs) , cinoxacin(100mcg) (1000 discs) , norfloxacin(100mcg) (2000 discs) , ertapenem(10mcg) (1000 discs) , oxacillin(10mcg) (1000 discs) , cefoxitin(30mcg) (2000 discs) , glass petri dish culture,90mm (50 pcs) , glass slides size 75mm x 25mm x 1.35 mm, 50/pk (500 pcs) , single cavity glass slide for motility 1 pcs , mccartney bottle w/ aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml ; 100/pk (100 pcs) , mccartney flat bottle :aluminium cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 30 ml; 100 piece /pack (100 pcs) , volumetric conical erlenmeyer flask (glass) 50 ml graduated w/ stopper, class a, usp certificate, (5 pcs) , volumetric conical flasks, erlenmeyer, narrow mouth, 100 ml (5 pcs) , volumetric conical erlenmeyer flask (glass) 500 ml graduated class a , usp certificate (5 pcs) , graduated laboratory dropping bottle with rubber dispenser fitted250 ml capacity of borosilicate glass(5 pcs) , amber coloured wide mouth graduated glass bottle 500 ml (5 pcs) , glass funnel plain 60 degree angle long stem, size 75mm (2 pcs) , glass beaker borosil 100 ml with spout (10 pcs) , u shaped glass rod(2 pcs) , glass beaker of 2 lt , heavy duty , double graduation metric scale (5 pcs) , glass beaker with spout (discarding jar) 1lt(5 pcs) , test tube glass size 12cm x 150 mm (50 tubes per pack) (1x50) , measuringpipette with rubber bulb 10 ml (mohr type) class b(5 pcs) , measuring cylinder, with class a certificate capacity 1000ml with stopper 1 pcs , measuring cylinder, with class a certificate ;capacity 250ml with stopper (2 pcs) , slide boxes for students for 100 slides 600 slide , heavy duty gloves heat resistant , category iii glove, preferably en 407 performance levels (4 pairs) , test tube stand polypropylene 3 tier fortest tubes(20 piece) , paraffin films m rolls 2 inch width 250 feet length(5 pack) , falcon tube (conical) polypropylene ,usp class vi, max g force of 15,000xg ;50 ml ,360 piece/pk (500 pcs) , falcon tube (conical) polypropylene 15 ml 1 pack of 300 each (300 pcs) , test tube rack holder 40 50 holes vents plastic centrifugal deck(10 pcs) , universal eto sterile plastic(pp) containers(30ml) 100 piece in pack (1000 pcs) , coplin jars pp for keeping slides pack of 12 (12 pcs) , sterile swab with collection vial ( himedia pref.) 100 piece/pkt (500 pcs) , screw cappedvial 3 ml polypropylene for serum storage(2 pcs) , spatula spoon shaped plastic for chemical dispense (graduated) 10 piece , autoclave bowie dick tape 1 pack of 30 tests, complies to ansi/aami/iso 11140 5:2007 class 2. (100 test) , ph paper strips 1 14 ph range himedia , fisher scientific(200 strips) , forcep stainless steel non corosive surgical grade (00 & higher) (3 pcs) , nichrome straight wire (2 mm) embedded in brass rod with heat resistant handle (preferably himedia) (5 pcs) , nichrome straight wire (3 mm) embedded in brass rod with heat resistant handle (preferably himedia) (5 pcs) , sterile stainless steel surgical blade of 15 nos. (500 pcs) , sterile stainless steel surgical blade of 23 nos.skin friendly cost effective(400 pcs) , steel surgical scalpel blade chisel/ handle (2 pcs) , forceps for cover glasses, kuhne type (4 pcs) , glass or diamond marker(5 pcs) , stainless steel tub 25 ltfor glass wash (2 pcs) , utility tray320x260x70mm for transport of samples(2 pcs) , forcep autoclavable, size 12 inch,blunt tip, ss 410 2 nos/pack (2 pcs) , forcep autoclavable, size 8 inch, blunt tip, ss 410 2 nos/pack (2 pcs) , stainless steel forceps, pointed, autoclavable, size 8 inch, ss 410 2 nos/pack 1 pcs , tongs stainless steel 12 inch for beaker (borosil)1 pcs , stainless steel forceps, pointed tips and handles 8 inch, 2 no/pack(100 pcs) , test tube washing brushes steel(pack of 10) (10 pcs) , zinc sulphate 100gm , cover slip 22 mm (1x50) , surgical gloves free size (not powderd) (nitrile hand gloves) (1x100) , xylene (1x500 ml) , slide drying tray aluminium (1x1) , sliper plastic (1x1) , sodium polyanethol sulphonate powder 5 gmsigma1 bottle...

Medical College - Rajasthan

36093405 supply of chemicals histology & pt inr machine reagents supply work i histology reagentcost paraffin wax with ceresin.6o.62c3o kg alochol(99.9%)20 ltr acetone 2o ltr xylene (sulpher free)20 ltr formaline 2o ltr heamatoxylene powders nos sodium iodides nos cytrike acid nos chloral hydrates nos aluminium ammoonium sulphate5 nos eiosine yellows nos l set for block preparationio set prothrombin time reagents kit(200 test ) etc ...

Shree Karan Narendra Agriculture University - Rajasthan

36053823 rate contract for chemicals for 2022 23 and 2023 24 1 1, 2 dichloroethane 2 1 naphthol ar 3 2 3 5 tri phenyl tetrazolium chloride ( ttc ) 4 2, 4 d 5 2, 4 dinitro phenyl hydrazine ( dnph ) 6 2, 6, dicholorophenol indophenol ( dcip ) 7 30% hydrogen peroxide ar grade 8 5 sulphosalicylic acid dihydrate ar 9 absolute alcohol 10 absorbant cotton 11 acetic acid glacial ar 12 acetocarmine solutions 13 acetone 14 acetone ( hplc grade ) 15 acetone ar ( special grade ) 16 acid fuchsine 17 acrylamide 18 activated charcoal ar grade 19 agar powder ( bacteriological grade ) 20 almunium chloride 21 aluminium chloride hexahydrate extrapure ar, 99% 22 aluminium foil 23 ammonia solution sp. gr 0.91 24 ammonium acetate ar grade 25 ammonium chloride 26 ammonium dihydrogen ortho phosphate 27 ammonium ferrous sulphate hexahydrates 28 ammonium molybdate ar grade 29 ammonium molybdate tetrahydrate extrapure 30 ammonium oxalate monohydrate 31 ammonium persulphate ( aps ) 32 ammonium sulphate 33 anhydrous sodium carbonate 34 anthorne reagent ( 2 n ) 35 anthrone ar 36 apron coat 37 ascorbate 38 ascorbic acid 39 azoxystrobin 40 azoxystrobin + hexaconazole 41 azoxystrobin +tebuconazole 42 bacillus subtilis 43 bap 44 bap solution 45 banzyl adenine 46 barium chloride dihydrate 47 barium sulphate 48 beef extractar grade 49 benomyle 50 bis acrylamide 51 blitox 50% wp ( coc ) 52 borex 53 boric acid ( powder ) 54 bovine serum albumin ( bsa ) 55 brassinolids 56 bromocresol blue indicator 57 bromocresol green 58 bromocresol purple sodium salt 59 bromophenol blue ( bpb ) 60 bromothymol blue indicator powder 61 buffer ampule ( setof 6 ) 62 buffer tablet of ph ( 4.0 ) 63 buffer tablet of ph ( 7.0 ) 64 cadmium chloride monohydrate 65 calciumnitrate tetrahydrate 66 calcium carbonate ar grade 67 calcium chloride 99% extra pure 68 calcium sulphate anhydrous 69 calcium sulphate dihydrate 70 captan 71 carbandzim+ mancozeb 72 carboxin 37.5% + thiram 37.5% ( vitavax power ) 73 carmine powder 74 castor oil 75 catechol extrapure 99% 76 cedar wood oil medium 77 chloroform ( ethanol stabilized ) 78 chloroform ( hplc grade ) 79 chlorothalonil 80 chlortetracycline hydrochloride 81 citric acid 82 clove oil 83 cobalt chloride hexahydrate ( cocl2.6h2o ) 84 cobaltus chloride 85 cobaltus nitrate hexahydrate 86 sulphuric acid ( h2so4 ) 87 coomassie brilient blue r250 88 copper sulfate pentahydrate ( cuso4.5h20 ) 89 copper sulphate 90 corn meal media 91 cotton blue 92 crystal violet ar grade 93 ctab ( cetyl trimethylammonium bromide ) 94 czapek”s dox agar 95 d ( + ) ribose 96 darco g 60 ( activated charcoal ) 97 liquid detergent ( lab garade ) 98 dextrose 99 d fructose a / r 100 di sodium hydrogen arsenate 101 dibasic sodium phosphate 102 diehylene tri amine penta acetic acid ( dtpa ) ar grade 103 diethyl ether ar ( stabilised ) 104 diethyline tri amine penta actic acid ( dtpa ) 105 difenconazole 106 dimethyl sulfoxide ( dmso ) 107 diphenylamine indicator 108 di sodium hydrogen arsenate 109 disodium tetrachloropalladate ( na2pdcl4 ) 110 dntps mix 111 edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 112 ethanol hplc grade 113 ethidium bromide 114 ethyl alcohol 115 ethyl methanesulfonate ( ems ) 116 ethylene alcohol 117 ethylenediaminetetraacetic acid ( na2edta ) 118 eucalyptus oil 119 ferric chloride 120 ferrion indicator 121 ferrous ammonium sulphate ar grade 122 ferrous sulphate ( feso4.7h2o ) ar 123 ferrous sulphate hypt 124 filter paper sheet 125 folin & ciocalteu’s phenol ( fcp ) reagent ar 126 folins uric acid 127 formaldehyde 128 fosetyl al 129 gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 130 glacial acetic acid 131 glucose ar grade 132 glutamic acid 133 glycerene 134 glycerol 135 glycine 136 gum acacia 137 n haxen 138 hexaconazole 139 hexaconazole 4% + zineb 68% 140 hoagland’s no. 2 basal salt mixture 141 huwasam spray ( nanosilver & peroxide ) 142 hydrochloric acid 143 hydrochloric acid 0.5n aq. solution 144 hydrochloric acid lr 145 hydrogen dichloroethan 146 hydrogen peroxide 30% 147 hydrogen peroxide 6% 148 hydroquinone 149 hydroxyl amines ( ha ) 150 hydroxylamine hydrochloride 151 iaa 152 iaa solution 153 iba 154 iba solution 155 iodide crystals 156 iodine ar grade 157 iron sulphate 158 iron tartrate 159 isoamyl alcohol 160 isopropanol alcohol 161 jasmonic acid 162 kavach ( syngenta ) 163 kh2po4 164 labolene 165 lactic acid ar 166 l ascorbic acid extrapure 167 l glycine ( triglycine ) extrapure, 99% 168 linseed oil 169 linseed oil cake 170 l phenylalanine extrapure chr, 99% 171 l tyrosine for biochemistry 172 magnesium chloride 173 magnesium sulfate heptahydrate ( mgso4.7h20 ) 174 malt agar 175 malts media 176 mancozeb 177 manganese sulfate monohydrate ( mnso4.h20 ) 178 manganese sulphate 179 manitol ar grade 180 martin’s media 181 mercaptoethanol 182 mercuric chloride ar 183 metalaxyl m ( ridomil gold ) 184 metaphosphoric acid 185 methanol 186 methanol ( ar grade ) 187 methanol hplc grade 188 methionine 189 methyl blue indicator ar grade 190 methyl methanesulfonate ( mms ) 191 methyl orange indicator 192 methyl red indicator 193 mgcl2 194 molyclean ma 03 phosphate free 195 molysol ‘e’ ar 196 monobasic sodium phosphate 197 myclobutanil 198 n ( 1 naphthyl ) ethylene diamine hcl ( n ned ) 199 n n methylenebisacrylamide 200 n orthophosphoric acid 201 n propanol 202 naa 203 naa solution 204 neemoil 205 nesseller reagent 206 nessler reagent ar grade 207 n hexane 99% ar 208 nicotinic acid 209 ninhydrin ar ( 99% assay ) 210 nitric acid 211 nitro blue tetrazolium ( nbt ) 212 nutrient agar 213 nutrient agar readymade 214 oat meal media 215 o dianisidine 216 orcinol 217 oxalic acid 218 oxaloacetic acid 219 p nitrophenyl sulphate 220 pacelio uslilacinus 221 paraffin wax 222 pcnb ( pentachloronitrobenzene ) 223 pda readymade 224 peg 6000 225 peptonear grade 226 petroleum ether ( 60 1000c ) 227 petroleum ether 60 80c 228 phenophthalin indicator 229 phenol ( 2n ) 230 phenol crystalline extrapure ar 231 phenol disalfonic acid 232 phenolphthalein indicator powder 233 phosphoric acid 234 p nitrophenol phosphate ar grade 235 polyvinylpyrolidone ( pvp ) 236 potasium meta bi sulphite 237 potassiumdicromate 238 potassiumhydroxide pellets 239 potassiumiodide 240 potassium acetate 241 potassium chloride 242 potassium chromate ar 243 potassium dichromate 244 potassium dichromate 245 potassium dihydrogen phosphate 246 potassium ferricyanide 247 potassium hydrogen sulphate 248 potassium iodide ( ki ) 249 potassium metabisulphite 250 potassium oxalate 251 potassium permanganate ar grade 252 potassium permangnate 253 potassium sulphate 254 potassium tartrate 255 potato dextrose broth 256 pottassium hydroxide 85% ar 257 pottassium nitrate 99% ar 258 propiconazole ( tilt ) 259 propineb ( antracol ) 70 w% 260 protein ladder marker ( mid range ) 261 pyridoxine hcl 262 pyrogallol extrapure 263 rapd marker ( molecular markers different series ) . 264 raxil ( bayer ) 265 resorcinol ar 266 rutin trihydrate pure 99% 267 saffranin 268 salicyclic acid 269 sesame oil 270 silver nitrate 271 sodiumchloride 272 sodium acetate anhydrous 273 sodium acetate trihydrate 274 sodium arsanate 275 sodium azide 276 sodium benzoate 277 sodium bicarbonate 278 sodium chloride 279 sodium chloride ar grade 280 sodium citrate 281 sodium cobalt nitrite 282 sodium dihydrogen phosphate 283 sodium dodicyl sulfate 284 sodium hydrogen carbonate ar grade 285 sodium hydroxide ar grade 286 sodium hydroxide extrapure ar 287 sodium hypochloride 288 sodium molybdate dihydrate ( na2moo42h20 ) 289 sodium nitrite 290 sodium phosphate 291 sodium potassium tartarate tetrahydrate 292 sodium silicate 293 sodium thiosulphate 294 sodium tungstate dihydrate extrapure ar, 99% 295 stannous chloride dihydrate 296 streptocycline 297 streptomycin sulfate 298 sucrose 299 sulfex 300 sulphailamide 301 sulphosalicylic acid 302 sulphuric acid 303 sulphuric acid 98% ar 304 taq buffer 305 taq polymerase ( su / pl ) 306 tebuconazole 307 temed 308 tergitol np 10 309 thiamine hcl 310 thiobarbituric acid 311 thiophanate methyl 70% wp 312 toluene 313 total hardness indicator tablets 314 tri chloroacetic acid 315 trichoderma harzianum 316 tricyclozol 8% + mancozeb 62% 317 triethylamine ( tea ) 318 triphenyl formazan ( tpf ) ar grade 319 tris hcl 320 triton x 100 321 universal indicator solution 322 v8 agar medium ( vinegar ) 323 vitavax power 324 wettable sulfur 325 xylene 326 yeast extract ar grade 327 zinc chloride 328 zinc oxide 329 zinc sulfate tetrahydrate ( znso4.4h20 ) 330 zinc sulphate heptahydrate...

Medical College - Rajasthan

35894046 rate contract for chemicals for pathology department , a.chemical & reagent and consumables , acid nitric lr , acid periodic ar , acid oxalic lr , acid hydrochloric lr , acid n/10 hcl ar , acid fuchsin lr , acid glacial acetic ar , acid phosphomolybdic lr , acid phosphotungstic lr , acid sulphuric lr , acide picric lr , acide formic lr , acid ascorbic lr , acid trichrocetic lr , acid cromic/chromictrioride lr , acid n/1 hcl ar , ammonium solution (liquid ammonia) lr , acetone ar , aluminium pot. sulphate ar (pot. alum) , aluminium ferric sulphate (iron alum) , albumin egg (flakes ) ar (himedia) , aniline blue lr , basic fuchsin lr , biebrich scarlet lr , crystal violet lr , congo red lr , dpx mount lr , eosin yellowar , formaldehyde 37 40% lr (formaline) , gold chloride lr , haemotoxylin lr , hexamine ar , isopropyl alcohol ar , light green s/f ar , methyl blue ar , paraffin wax 60 620c with cercine , paraffin wax in pelletes 58 60 c with cercine , potassium iodate lr , potassium hydroxidelr , potassium metabisulphate lr , phenol crystal (melted) lr , silver nitrate ar , sodium thiosulphate lr , sodium metabisulphate lr , dionised water , glycerin ar , sodium iodate lr , methanol ar , ether solvent lr , hydrogen peroxide (h2o2) , toluidine blue , xylene s/f ar , iodine , ferric chloride , alcian blue , activated charcoal powder , ethanol absulate , methyl voilet , giemsa stain powder a , oil immersion ar (1x30) , oil immersion ar (1x125) , neutral red , sodium hydrogen orthophosphate , may greenwald solution , leishman stain powder (rankem) , sodium citrate , potassium ferocynide , briliant crystal blue , sodium hydroxide (naoh) , sodium chloride (nacl) ar , disodium hydrophosphate , dextrose (glucose) , sodium nitrate , sodium acetate , liquid paraffin , potassium acetate , tlc fluid (trunks solution) , trbc fluid (hymes solution) , ammonium sulphate , trisodium citrate , benedicts reagents , sodium nitropruside , sodium toroculate , sulphur powder , lishman stain solution , spirit r/f , urine multisticker , blood group antisera abd , aluminium potassium , sulphate decarbohydrate ar , citric acid , hydroqunon , gelatin , fast green , normal saline 0.9% , lab detergent neutril , ammonium acetate , auromine , aluminium potassium ar , ammonium hydroxide (pure) ar , fast blue bb salt , fast gormet gbc salt ar , naphlyl acetate , parasanidine , hand wash gel , ammonium molibdate ar , aluminium ammonium sulphate , cytromatrix embedding medium , clestain blue , cobaltuse chloride , dettol , ferric ammonium citrate , gyecophosphate disodium salt hydrate , gentim violet , methyl green , new fushion , ossium tetraoxide , potassium carbonate , sodium bisulphate , tolidin blue , yellow ammonium sulphate , ammonium chloride , ab cotton , sodium hydrogen phosphate...

Sms Medical College - Rajasthan

35876352 rate contract for chemicals for pathology department (nit 224) 1. acidnitriclr 2. acid periodic ar 3. acidoxaliclr 4. acid hydrochloric lr 5. acid n/10 hclar 6. acid fuchsin lr 7. acid glacial acetic ar 8. acid phosphomolybdic lr 9, acid phosphotungstic lr 10. acid sulphuric lr 11. acid picric lr 12. acid formic lr . 13. acid ascorbic lr 14. acid trichloracetic lr 15. acid cromic/ chromictrioride lr 16. acid nil hcl ar 17. ammonium solution (liquid ammonia) lr 18. acetone ar 19. alumninium pot. sulphate ar (pot. alum) 20. aluminium ferric sulphate (iron alum) 21. albumin egg (flakes) ar (himedia) 22. aniline blue lr 23. basic fudhsin lr 24. l3iebrich scarlet lr 25. crystal violet lr 26. congo red lr 27. dpx mount lr 28. eosin yellow ar 29. formaldehyde 37 40% lr (formaline) 30. gold chloride lr 31. haemotoxylin lr 32. ilexamine ar 33. isopropyl alcohol ar 34. light green s/f ar 35. methyl blue ar 36. paraffin wax 60 62°c with cercine 37. parainn wax in pellets 5 8 60°c with cercine 38. potassium lodate lr 39. potassium hydroxide lr. 40. potassium metabisulphate lr 41. phenol crystal (melted) lr 42. silver nitrate ar 43. sodium thiosuiphate lr 44. sodium metabisulphate lr 45. dionised water 46. glycerin ar 47. sodium lodate lr — 48. methanol ar 49. ether solvent lr 50. hydrogen peroxide (h202) 51. toluidine blue 52. — xylene s/f ar 53. iodine 54. ferric chloride 55. alcian blue 56. activated charcoal powder ethanol absulate 57. 58. methyl voilet 59. giemsa stain powder a 60. oil immersion ar (1x30) 61. oil immersion ar (1x125) 62. 63. neutral red sodium hydrogen orthrophosphate 64. may greenwald solution . 65. leishman stain powder (rankem) 66. sodium citrate 67. potassium ferocynide — 68. briliant crystal blue 69. sodium hydroxide (naoh) 70. sodium chloride (nac1) ar — 71. disodium hydrophosphate 72. dextrose (glucose) 73. sodium nitrate 74. sodium acetate 75. liquid paraffin 76. potassium acetate ____ 77. tlc fluid (trunks solution) 78. trbc fluid (hymes solution) 79. ammonium sulphate 80. trisodium citrate 81. benedicts reagents — 82. sodium nitropruside .____r 83. sodium toroculate __________ 84. sulphur powder 85. lishman stain solution _____ 86. spirit r/f 87. urine multisticker blood group antisera abd 89. aluminium potassium 90. sulphate decarbohydrate ar 91. citric acid 92. hydroqunon 93. gelatin 94. fast green 95. normal saline 0.9% 96. lab detergent neutril 97. ammonium acetate 98. auromine 99. aluminium potassium ar 100. ammonium hydroxide (pure) ar 101. fastbluebb salt 102. fast gormet gbc salt ar 103. naphlyl acetate 104. parasanidine 105. hand wash gel 106. ammonium molibdate ar 107. aluminium ammonium sulphate 108. — cytromatrix embedding medium 109. clestain blue 110. cobaltuse chloride ill. dettol 112. ferric ammonium citrate 112. ferric ammonium citrate 113. gyecophosphate disodium salt hydrate 114. gentim violet 115. methyl green 116. new fushion 117. ossium tctraoxide 118. potassium carbonate 119. sodium bisulphate 120. tolidin blue 121. yellow ammonium sulphate 122. ammonium chloride 123. ab cotton 124. sodium hydrogen phosphate etc ...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

35370427 tender for reagents supply hametroxyline delafield, eosin, formaldehyde, cassette plastic, dpx mount, microscopic slide, cover slip, diamond pencil, nitric acid, xylene, acetone, filter paper, egg albumin, distill water, pap stain kit, microtome blade, tissue paper, field stain kit, cotton, rapid afb kit, pas staining kit, leishman stain kit, etc....

National Institute Of Ayurveda - Rajasthan

35315066 rate contract for supply of chemicals and glassware , chemicals : , zinc sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , sulphuric acid ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 ml , barium chloride ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , barium sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , copper sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , sodium hydroxide ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , folin & ciocalteus phenol reagent ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 100 ml , sodium potassium titrate ar cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , sodium carbonate ar cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , bsa standard cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10ml , ammonium molybdedate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , diehthyl amine ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100ml , cresolphthalein ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10g , hydroxy quinoline ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , formaldehyde ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5l , carboxy methyl cellulose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , hydrochloric acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , picric acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 g , leishman’s stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 250 ml , phosphate buffer solution ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , ammonium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , goldner’s strichome ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , gooding & steward’s fluid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sheep blood agar ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , acetone ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , xylene ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , benzene ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , ethanol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 200 ltr , harris haematoxyline ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , eosine yellow ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , iso propyl alcohol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , n butane for hplcar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , acetonitrile for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , water for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , methanol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 l , ethanol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , sodium carbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , phenol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , gallic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 gm , aluminium chloride hexa hydrate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , quercetin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25 g , gum acacia ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , acetic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , pepsin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , sodium citrate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , urathane ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , formic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , glycerin cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 l , streptozotocin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , phenolphathaline indicator ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125ml , paraformaldehyde ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , sucrose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , citrate buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , tris buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100ml , nicotinamide ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , nitro blue tetrazolium ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 3g , phosphate buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5l , ascorbic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , phosphate buffer solution ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 ltr , bovine serum albumin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , fetal bovine serum ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , penicillin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25g , streptomycin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 gm , dulbecco modified eagles medium (dmem) ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , cadmium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , distilled water ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 litre , sudan black dye ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100gm , von kosa stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , trichome masson stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , periodic acid shiff ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , dpx mount ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 250 ml , cedar wood oil ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125ml , ova albumin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , aluminum chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , nonxynol 9 ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25gm , hydrogen peroxide 30% ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 litre , dtnb ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10g , edta (sodium salt) ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , sodium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , potassium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , magnesium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , sodium biocarbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , monosodium phosphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , glucose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , calcium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , sodium hydrogen phosphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , polyvinyl pyrrolidone ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , trichloro acetic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , tertiary butyl alcohol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25g , l. methionine ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , sodium potassium tartarate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium hydroxide ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , triton x 100 ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 ml , riboflavin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10 gm , sodium carbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , copper sulphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , ez cleaner for hemotology analyzer cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , acetylcholine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , seratonine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 gm , 2 diphenyl 1 picrylhydrazyl cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , hypoxanthin cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25 gm , xanthin oxidase cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 unit , diethylenetri amine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 ml , penteacetic acid cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , nitro blue tetrazolium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 mg , phosphate buffer cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , folin ciocalteau regent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sodium bicarbote cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 ltr , aluminium chloride cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 gm , sodium nitrate cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , dimethyl sulfoxide cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , edta disodium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , disstilled water cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards5 ltr , cortisole cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 ml , carboxymethyl cellulose sodium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , triethanolamine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sodium biocarbonate cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium hydroxide cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , 0.2n sulphuric acid cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , recombinant human il 01 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , interlukin 6 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , recombinant human il 01 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , tnf alpha cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , kt03 lyse solution cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , probe cleanser cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50ml , kt03 diluent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 20 ltr , glasswares : , beakers 5 ml , beakers 10 ml , beakers 25 ml , beakers 50 ml , beakers 100 ml , beakers 250 ml , beakers 500 ml , beakers 1000 ml , beakers 2000 ml , beakers 5000 ml , bottle 25 ml , bottle 50 ml , bottle 100 ml , bottle 250 ml , bottle 500 ml , burettes 25 ml , burettes 50 ml , cylinders 5 ml , cylinders 10 ml , cylinders 25 ml , cylinders 50 ml , cylinders 100 ml , conical flask 10 ml , conical flask 25 ml , conical flask 50 ml , conical flask 100 ml , conical flask 250 ml , conical flask 500 ml , funnel 50 mm , funnel 75 mm , test tube mm 25x200 , watch glass 120 mm , crucible 30 ml , ml6 contractor 230v ac (2no+2nc) or equilant...

Indian Army - Rajasthan

35302383 supply of consumables and expendable medical stores supply of consumables and expendable medical stores , abdominal drain size22 fr , abdominal drain size26 fr , abdominal drain size30 fr , absolute alchohol bott of (500ml) , adhesive plaster micro porous tape 1 inches box of 12 , adhesive plaster microporous tape 3 inches box of 4 , adhesive plaster zinc oxide 7.5 cm x 5 mtr , aed pacing pads , afb kit (ready to use) (2x100 ml) , amylase test kit (4x20 ml) , arm sling (large) , arm sling pouch , arm sling( medium) , aso titre estimation kit (1.4 ml) , baby mucous sucker , bandage dvt stocking large , bandage dvt stocking medium , bandage dvt stocking small , bandage triangular , bilirubin total and direct estimationtest kit (6x44ml)(3x22 ml) , bone marrow aspiration and biopsy needle (disposable) 8 x 4 cm needle , bougie , bovine albumin (10 ml) , catheter suction endobronchial with terminaltransparentnon toxic pvc tubing sizefg 10, length 45 cm , catheter suction endobronchial with terminal transparent non toxic pvctubing sizefg 12 length 50 cm , catheter suction endobronchial with terminal transparent non toxic pvc tubing size fg 14 length 50 cm , ceasarean drapes , central venous catheter(3 lumen) 7fr18g (bbraun/ vygon ) , chest drainage size26 fr , chest drainage size30 fr , chloroform ar (analytical grade) (500ml) , cholesterol estimation test kit(5x20 ml) , ck mb kit (2x44) (2x11) , ck nac (2x44) (2x11) , clavicle bracel , clavicle bracem , clavicle braces , clavicle bracexl , cord clamp , cot finger splint , cover slips (22x50mm)(20 pkt of 10gm each) , crape bandage 15cm , crutches elbow adjustable , dark glass , disposable blade for microtom ( (high profile) (50 blade) , disposable embedding plastic ring(pack of 100) small size , disposable embedding plastic ring (pack of 100) large size , disposable embedding plastic ring (pack of 100) medium size , disposable gown , disposable lscs drape , disposable otpack , disposable ot drape , disposable petridish 90mm eto sterile (pack of 50) , disposable port 10mm , disposable port 5mm , disposable port 7mm , draw sheets disposable , dressing medicated gauze parafin, 10 cm x 10 cm square, tin of 24 , dressing, first aid, unmedicated sterile pack , ear buds bott of 100 , endoloop , erba actime (6x5 ml) , erba calcium chloride (10x10) , erba control ddimer n+p 5x1 ml ,5x1ml , erba d dimer r,1x7 ml , erba ddimer calibrator 1x1 ml , erba protime ls 50 (2x5 ml) , erba reaction cuvettes (1000 nos) , ether solvent 500 ml , fallopian ring , fibrin glue , formaldehyde solution (10 ltr) , functional knee support , g6pd test kit (pack of 50 test) , gauze surgical, open wove, unmedicated : 60 cm x 3 metres packet , gauze surgical, open wove, unmedicated: 60 cm wide , glass cuvette for pt (micro lab) (pack of 100 tube) , glucon d (500gm) , gomoris stain(500 ml) , heel cup (silicon or carbon copolymer) , hme filter , i gel size 1.0 , i gel size 1.5 , i gel size 2.0 , i gel size 2.5 , i gel size 4.0 , i gel size 5.0 , isetrol level 1,2,3(3x10x1.0 ml) , johnson baby buds , kit estimation of triglyceride test kit(5 x 20ml) , kit for estimation of ldh (2x10ml) , kit for estimation of sgot (4 x 24ml) (liquixx) , kit for estimation of sgpt ( 4 x 24ml) (liquixx) , kit for estimation of uric acid (5x 10ml liquixx) , kit lipase (1x20 ml) (1x5ml) , knee cap xl , knife bard packer, blade size 2 fitting (commercial no. 20) packet of 6 , knife bard packer, blade size 2 fitting (commercial no.22) packet of 6 , knife bard packer,. blade size 2 fitting (commercial no. 23) poacket of 6 , laryngeal mask airway size 2.0 , laryngeal mask airway size 3.0 , lectin for sub groups sera a1 (05 ml) , leishmans stain ready to use (500ml) , lignocaine 10% spray , lignocaine hydrochloride gel 0.2% 30gm , loop pds no 1 round body heavy , lot basilocid 500ml , lot cutacept 500ml , lotion betadin 10% bott of 100 ml , lumber puncture needle blue , lumber puncture needle yellow , may grunwald giemsa stain (mgg stain) ready to use(3x250) , mersilk 3/0, 3/8 cutting needle size 26mm with suture length 76mm , mersilk non absorbable braided suture blackno 2.0round bodied 76 cm , mersilk non absorbable braided suture black no 1 round bodied 76 cm , mersilk non absorbable braided suture black no 1.0cutting bodied 76 cm , mersilk non absorbable braided suture black no 3.0cutting bodied 76 cm , micro pipettes size 100 ul , micro pipettes size 10ul , micro pipettes size 200 ul , micro pipettes size 25ul , micro pipettes size 50 ul , micro pipettes size 500 ul , microlyte cal a (280 ml) , microlyte cal b (280 ml) , microlyte deproteinizer (100 ml) , micropore size 10cm , micropore size 6.0cm , mini spike , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 2.0cutting bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 3.0cutting bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 3.0round bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 4.0round bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglycaprone 25, undyed) no 4.0cutting bodied 70 cm , mpo stain (500 ml) , normal saline pouch 500 ml self collapsible , nylon non absorbable suture monofilament no 2.0 cutting 70 cm , nylon non absorbable suture monofilament no 3.0 cutting 70 cm , nylon non absorbable suture monofilament no 4.0 cutting 70 cm , pas stain (reddy to use) (3x500ml) , pds no 1 round body heavy , pencil cautry lead disposable , perritonial dialysis catheter (adult) , pigtail catheter drainage system with dialater set , pointed needle , pop slab 10 cm , pop slab 15 cm , port site dressing 2.5 cm x 2.5 cm , primapore size20cmx10cm , primapore size25cmx10cm , primapore size 15cmx8cm , primapore size 8.3cmx6cm , prolene non absorbable suture (monofilament polypropylene blue) no 1 cutting70 cm , prolene non absorbable suture (monofilament polypropylene blue) no 1 round bodied 70 cm , prothrombin test kit (1x5 ml)(isi value 1.0) , rams cannula size 0 , reticulocyte stain(ready to use) , reusableembedding plastic ring (pack of 100) medium size , reusable embedding plastic ring(pack of 100) small size , ribbon gauze , roller bandage 6cm , roller bandage10cm , serum (ahg) anti human globuline (05 ml) , sevoflurane , silk non absorbable braided suture 06 reelx 25mtr size no 1 , soda lime 05 kg jar , soft swab 10cmx10cm , specimen retrieval pouch endobag , spinal needle 27g , stain haemotoxilline(500 ml) ready to use , steam autoclave tape roll , sterile specimen bottle , sterile urine container (pack of 100) , strips `albumin` and glucose bottle of 100 strips(uristix) , strips `kitone` and glucose bottle of 100 strips(uristix) , surgical blade size 10 (packet of 6) , surgical blade size 11 (packet of 6) , surgical blade size 12 (packet of 6) , surgical blade size 15 (packet of 6) , swab stick disposable (pkt of 500 swab) , sysmex xp cell clean (50 ml) , sysmex xp 100eightcheck trilevel 3 wp (lxnxh) 3x1.5ml , sysmex xp 100 dil 20ltr , sysmex xp 100 stromatolyser wh (3x500ml) , t shapedbandage , tennis elbow support , thermograph for blood storage cabinet , tissue paper roll , tube test, 12 x 75 mm rimless , typhi igg & igm card(40 test kit) , under water seal drainage , urine bag , urine catheter size08fr , urine catheter size12fr , urine catheter size14fr , urine catheter size16fr , vicrylabsorbable suture no 1 round bodied 90 cm , vicrylrapid absorbable suture no 1/0 round bodied heavy needle , vicrylrapid absorbable suture no 2/0 round bodied heavy needle , vicryl rapid double needle 2 0, 150 cm with round body and reverse cutting double armed , walking aid monopod assist , walking stick tetra pod , widal test kit (4x5ml) 45 test , xylene (xyol pure) bott of 500 ml , yankur suction tube disposable...

Department of Agricultural Research and Education - Rajasthan

35135160 bids are invited for srl brand only supply aceton gc hs , hydrochloric acid , isopropanol gc , methanol extrapur ar acs exiplus , chloroform isoml alcohol for colecular biology , phenol chlororom isomyl alcohol , trichoroacetic acid extrapure , tis buffer for hplc , agar powder for microbiology , luria bertani agar , potato dextrose agar , sodium bicarbonate extrapure , n hexane pure , xylene cyanol ff extrapure , ar exiplus mutli compendial , bromophenol blue acs exiplus multi compendial , ethidium bromide for molecular biology , thoglycolic acid exiplus multi compendial , petroleum ether hplc uv spectoscopy , n butyy alcohol extrapure ar acx exiplus multi compendial , toluene extrapure ar acs exiplus multi compendial total quantity : 65...

Department Of Education - Rajasthan

34898280 bids are invited for verniar caliper , screw gauge 25mm , sphe ro meter , dcc wire , resistance wire ureka , resistance wire contan , resistance wire manghine , copper caprimeter pot , drowing bord woden , simple pendulam dob sel , stop clock , stop watch , thermameter 110c , therma meter , therma meter room temp , minimum maximum therma meter , drowing bord pin , sonometer , meter sccle wooden 1 mtr , meter bridge , potentiometer , resohance app , tunning fork set , rubber pad , stand. with claimp iron , plug kcc one way , plug kcc two way , resistance box 100000 , resistance box 100 , resistance box , rhehosted , zinc rod heavy , lacklanchi cell , denial cell , poras pot field , poras pot empty , cell box 2 cell plastic , ameter , volt meter dc 12 holt , galvenometer , induction cail , barmagnet , miliameter 500 ma , optical bench. 1 mtr. ss p , pn juction diode add p , pnp transistor , zener diode ap p , lens holder plastic , transistor loose , compass both side glass , solated weight , inclain plan p , hooks law app p , digital multimeter , parrol gram app p , battery eliminitor , reagent batlle nm 250 ml , reagent batlle nm 500 ml , reagent batlle wm 250 ml , reagent batlle wm 500 ml , dropping bottle 125 ml dolyks , glass tube , igawion tube , certifuge machire hand drive , certifuge machire remi electric , filter paper rim 500 nos , filter paper 125 , water bath copper , corck borar sel , pestal motor , weight machine , china disc , bunsen burner , pippel vlumatric 25ml , burrel 50 ml borocil a , test tube 25x150 borocil a , test tube 15x125 borocil a , test tube 12x100 borocil a , funnel 2 pvc. , funnel 100mm pvc. , test tube holder brass , test tube stand pvc. , spettula , sprit lamp ss , wash bottle 500 ml pvc. , reogent. bottle nm125ml borocil , beoker 100 ml borocil , beaker 250ml borocil , beaker 500ml borocil , conical. flask 250ml borocil , conical. flask 500ml borocil , flate. bottle flask. , conical. flask 500ml borocil , flate. bottle flask. 500ml borocil , dropper g , glass rod. , plaitinum wire , wire gauge. with fram , tonas , univer scal. ckeimp. , boss head , try pot stand , junior medical compound microscope , disseting microscope , forcep. big. , forcep. small , scisser small , scisser big , test. tube holder , test. tube stand , test. tube brush , stop. watch , niddle with plastic handal , dissecting brush , auxano meter , staing rock wooden , try. pot. stand , wire gauge , water bath electric rectangale , s phygnometer , stethoscope , dissecting tray. , electronic balance 300gm cap , test tube 15x125 borocilcole , watch glass , petric disc , plain slide , cavity slide , cover. slipe. , becker , becker 250ml borocilicete , measuring cylender 500ml pvc. , measuring cylender 100ml pvc , conicel flask. 250ml borocilicate , funnel 75mm pvc , gangoes potometer borociliate , gangoes respairometer borociliate , bell jar. soda glass , specimen jar. empty plastic , dropping bottle 60ml sodaglass , wash bottle 500ml pvc , dropper plastic , dessicator polykab. 300ml , thermameter clinic , funnel pvc , sprit. lamp aluminium , all permanan slide at the list , meosis. slide , mitosis slide , model amba , model frog , model eye , model ear , model brain , human skelition without box , all raxine charts at the list , all specimen at the list , specimen , material cutting dicot rot, stem leaf , material cutting monoct rot, stem leaf , filter paper 100 nos. , p.h. paper glaxo , saffarawine glaxo , eiosine glaxo , glycerol glaxo , methylene blue glaxo , fast green lanco , xylene rankem , formeldenyde glaxo , chloroform glaxo , acetocarmine lancer , bendicy solu. glaxo , steel almihra , teacher chair...

Medical Health And Family Welfare - Rajasthan

34846615 supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit ( 4th gen. ) , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit ( 4th gen. ) , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clotaing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , hb.tube , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 ?l ) , blue tips for micro pipette ( 1000 ?l ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 ?l , aerosol barrier tips 20 ?l , aerosol barrier tips 100 ?l , aerosol barrier tips 200 ?l , aerosol barrier tips 1000 ?l , water molecular grade 500 ml , self locking cable tie for bmw bags , micro pipette stand , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , cryo gloves all size , falcon tube 50 ml , falcon tube 15 ml , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) . , autoclave single channel micropipettes 100 1000ul , autoclave single channelmicropipettes 0 100ul , autoclave single channelmicropipettes 0 50ul , autoclave single channelmicropipettes 0 10ul , autoclave single channelmicropipettes 0 200ul...

Medical And Health Services - Rajasthan

34806181 supply of lab reagents i hcv test tri dot rapid card ) 2 hbsag test ( rapid card ) 3 lll3sag eisa test kit ( 4th gen ) 4 iiiv test ( tr dot rapid card ) 5 hiv ehsa test kit ( 4th gen. ) 6 hcv eisa test kit 4th gen ) 7 vdrl test kit ( strip ) 8 urine pregn—cy test kit ( card ) 9 dengue tut kit ( rapid card ) 10 dengue 1gm ehsa test kit i i denue ns i elisa test kit 12 ii ) card for gel card cross matching ( for biorad machine ) 13 pt i’est reagent kit ( 4x2 ml ) 14 widal test kit 15 malaria card ( rapid test for malaria antigen ) 16 crptes 17 aslo test kit 18 r.a. factor kit ( slide method ) 19 anti a, anti b & anti d ( monoclonal tg ( &, 20 21 amid ( monoclonal igg & im ) anti d monoclonal 1gm 22 anti h lcctin 23 anti al lectine 24 bovine albumin 25 anti human globulin rcoombs sera ) 26 multistix urine test strips ( for 10 parameter ) 27 urine sthp for ketones & glucose 28 leishnan stain liguid çready to use ) 29 giemsa stain solution ( ready to use ) 30 field stain reagent ( a+b ) 31 whatmans filter paper 32 p1 i paper ( litmus paper ) 33 cover slip for slide 34 capillary tube ror clotaing time 35 esr stand 36 methanol 37 dionised water 38 sample cup for biochemistry 39 ecoshield 40 absolute isopropenol ( molecular grade ) 41 reservior trough 42 plain glass test lube, 43 96 well vtm ( for 15 ml vth4 ) 44 blood sugar test kit ( manual ) 45 s. urea ( manual ) 46 s. creatinine ( manual ) 47 s. bilirubin ( manual ) 48 s. sgot ( manual ) 49 s. sgpt ( manual ) 50 w.13.c diluting fluid 51 r.b.c diluting fluid 52 semen i ) iluting fluid 53 losinophil diluting fluid 54 platelet diluting fluid 55 sahlis ilaemoglobinomcter 56 iibtube 57 iib. pipette 58 w.b.c pipette 59 r.b.c pipette 60 improved neubauer counting chanber 61 clean sole solution ( glass ware ) 62 levermed lab airticals disinfectant 63 combystyne labairticle disinfectant 64 tourniquet, 3.2% sodium citrate coated disposabie esr tube / pipette 71 pricker disposablclancct ) 72 sulphur powder 73 glacial acetic acid 74 liquid paraffin ( heavy ) 75 iodine solution 76 xylene 77 microscope glass slide 78 k3 edta disposable vaccuta ner vial 79 plain disposable vaccuta net vial 80 sodium floride ( naf ) disposable vaccutaner vial 81 clot activator disposable vaccutaner vial 82 3.2% sodium citrate disposable vaccuta net vial 83 chikengunya 1gm elisa test kit 84 scrub typus elisa test kit 85 ethanol molecular grade ( 500 ml ) 86 aerosol barner tips 10 pl 87 aerosol barrier tips 20 pi 88 aerosol bather tips 100 lul 89 aerosol bather tips 200 ul 90 aerosol barrier tips 1000, etc....

Department of Agricultural Research and Education - Rajasthan

34435952 bids are invited for srl brand only supply acetic acid glacial extrapure ar acs exiplus code 93602 , aceton gc hs 99.9 for ovi residual analysis code 89140 , acrylamide 3x cryst extrapure ar, 99.9 for electrophoresis code 15657 , n n methyl bisacrylamide 3x cryst for molecular biology 99.5 code 67320 , edta disodium salt dihydrate for molecular biology 99.5 code 43272 , glycerol glycerin for molecular biology 99.5 code 43272 , glycine for molecular biology, 99.5 code 64072 , hydrochloric acid 5n aq solution code 34472 , indicator papers ph 2.0 10.5 wide range code 27671 , indicator papers ph 6.5 9.0 narrow range code 61169 , isopropanol gc hs, 99.9 code 10140 , brilliant blue r code 93473 , methanol extrapur ar acs exiplus 99.8 code 37152 , chloroform isoamyl alcohol 24 1 for molecular biology code 85563 , phenol chloroform isoamyl alcohol 25 24 1 ph 8.0 for molecular biology code 69031 , polyvinylpyrrolidone pure pvp k 30 exiplus code 65155 , sodium carbonate anhydrous extrapure ar acs exiplus 99.9 code 93857 , sodium lauryl sulphate extrapure ar acs 99 code 54468 , n n n n tetramethyl ethylenediamine teme for molecular biology 99.5 code 52145 , trichloroacetic acid extrapure 99 code 90544 , tris buffer for hplc 99.9 code 56995 , ethylmethanesulphonate ems extrapure 99 code 85108 , agar powder for microbiology code 77981 , luria bertani broth code 22006 , luria bertani agar code 46502 , potato dextrose agar code 71788 , silica gel blue self indicating coarse 5 8 mesh code 85148 , citric acid anhydrous extrapure ar acs exiplus multi compendial, 99.5 code 16842 , sodium bicarbonate extrapure 99 code 56398 , n hexane pure 99 code 77045 , xylene cyanol ff extrapure ar exiplus multi compendial code 75122 , bromophenol blue acs exiplus multi compendial code 93676 , ethidium bromide for molecular biology 95 code 93079 , thioglycolic acid exiplus multi compendial 80 code 74118 , petroleum ether 60 80 for hplc uv spectroscopy code 15340 , n butyl alcohol extrapure ar acs exiplus multi compendial 99.5 code 15612 , toluene extrapure ar, acs exiplus multi compendial 99.5 code 95227...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

Jawaharlal Nehru Medical College - Rajasthan

34135658 pathology lab items pathology lab items , list of pathology lab items reagents / kits / chemical / glassware / polyware etc year 2022 24 , acetic acid glacial sq 99 100% 2.5 ltr. , acetone ar 2.5 ltr. , acid fuschin 25gm , aluminium chloride sq anhydrous 500gm , aluminium potassium sulphate ( postassium alum ) ar 500gm , albuno meter , alcian blue 8 gs , ammonia solution lr 500ml , ammonium bromide 100gm , ammonium oxalate 500gm , aniline blue ( water soluble ) 25gm , anti sera a , anti sera b , anti sera d , azure ii 100 gm , atrx antibody , basic fuschin 25gm , biebrick scarlet 25 gm , blood / serum sample tube , borex ar 500gm , boric acid 500gm , brilliant cresyl blue 25gm , chromogranin antibody , calcium chloride lr 500gm , carbol fuchsin conc. stain solution 200ml , carbol fuchsin ( zn strong ) 500ml , carmine ar 25gm , cd 3 antibody , cd 5 antibody , cd 10 antibody , cd 20 antibody , cd 23 antibody , cd 30 antibody , cd 45 antibody , charcoal ar 200gm , chlorauric acid ( gold chloride ) , chromium trioxide ( chromic acid, ) , chromotrope ar 25 gm , citric acid ar 500gm , sta c.k. prest , ck 7 antibody , ck 20 antibody , ck 5 / 6 antibody , calretinin antibody , coag control , congo red ar 100gm , coombs serum ( ahg ) polyclonal 5ml , cover glass , crystal violet 25gm , crystal violet 100gm , d.m. water 5ltr , dab background sniper mach 2 hrp polymer combo , deionised water ( triple deionised ) , deka phan ( 100 strips ) , urine control urinorm , desmin antibody , diluent for dna extraction , diva decloakerm 20x , dpx mountant 250ml , disposable esr pipette , ema antibody , er antibodies , esr pipette ( glass ) ( marrienfield made in germany ) , esr pipette glass , ethanol , eosin yellow ( water soluble ) , erba h3 contri level , ferric ammonium sulphate , filter paper sheet , filter card for cytospin , formaldehyde solution 37 41% w / v ar 5 ltr. , funnel filtering for glass , gentian violet ar 25gm , giemsa.s staining powder 25 gm , glass beaker various sizes , glass slide 1.35 mm , glass slides , glass test tube 100 x 12 mm , glass test tube 75 x 12 mm , glycerol ( glycerine ) ar 500ml , gfap antibody , haemeto critcapillary , haemotoxylin crystal 25gm , hand sanitizer , hmb 45 antibody , hep par 1 antibody , her 2 antibodies ( creb 2 ) , hplc variants ii test kit ar 500 test , hplc lyphocheck a2 control 0.5 ml x 4 , hydrochloric acid ( conc ) 2.5ltr. , hydrogen peroxide ( 3% ) 500ml , hydrogen peroxide solution 30% w / v ( 100 volumes ) lr 500ml , hydroquinone ar 5 gm , hypochlorite solution , idh1 antibody , iodine crystal ar 100gm , isopropyl alcohol 2.5 ltr. , jet cassettes with lid disposable , k3 edta tube vacutainer , 3.2% sodium ctrate vacutainer , ki67 antibody , lancet , leishman stain liquid , light green, sf yellowish , liquid parafin , lithium carbonate , lysercell wnr ( 5 ltr. ) , flourocell wnr , sulfolyser 5l , xn control l1 , xn control l2 , xn control l3 , xn cal , measuring cylinder 1000 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , mercuric chloride 100gm , mercuric oxide ( yellow ) , methanol ar 2.5 ltr. , methyl blue 10 gm. , methyl orange 5 gm. , methyl violet 20 gm. , micro pipette 100?l , micro pipette 200?l , micro pipette 50?l , micropipette variable volume upto 1 ml , micropipette variable volume upto 200 micro ltr. , microscope bulb ( philips ) ( .6v / 20w ) , microscopic cover glass 22x 50 mm , mpo ( myeloperoxidease ) stain kit , museum mounting jar ( glass ) ( varioussize ) , multistix ( urine ) , nuclear fast red stain 5 gm , nuclear fast red ( kernechtrot ) , neubaur counting chamber ( marrien field made in germany ) , nitric acid ( 69 72% ) , napsin a antibody , oil red o ar 100gm , orcein synthetic 5gm , orinasys gk , orinasys gp , orange g6 , oxalic acid 500gm , pan ck antibody , periodic acid phenol ( carbolic acid ) , phosphotungstic acid ar 100gm , p63 antibody , phosphomolybdic acid , picric acid ar 500 gm , pipette tips blue vol . 1000 ?l , pipette tips yellow vol . 200 ?l , ph strips , polylysine coated slides , ponceau 2r 25 gm , potassium acetate , potassium bromide 100gm , potassium carbonate 10 gm , potassium carbonate 25 gm , potassium chloride 500 gm , potassium dichromate 500gm , potassium dihydrogen phosphate 500gm , potassium ferocyanide ar 500 gm , potassium hydroxide ( koh ) , potassium iodide ar 100 gm , potassium nitrate , potassium permanganate lr 100gm , procold coolent , propylene glycol , pr antibodies , pt kit , qualitative filter paper diameter mm size 460x570 sheets grade 1 , quinoline yellow 25gm , rapid pap stain , resorcinol , reticulocyte count stain 25 ml , reti culocyte counting reagent , sodium acetate , sodium bicarbonate , sodium nitrate lr 25 gm , sodium bisulfite 500gm , sma antibody , sodium barbiturate 500gm , sodium chloride lr 500gm , sodium citrate 500gm , sodium hydroxide pellets , sodium hypochlorite 4% 2.5 ltr. , sodium hypochlorite solution ( 4% naclo 74.4 ) , sodium metabisulfite ar 500 gm , sodium phosphate monobasic 500gm , sodium black b 100gm , sodium thiosulphate 500gm , sta balls , sta cacl 2 , sta c.k prest , sta neoplastin cl+10 , sta cuvette , stago coagulation control. ( n+p ) , sta neophnal , sta cleaner solution , sta cuvettes 1000 , sta coag control n+p vial , stago coagulation control , sulfolyser 5 ltr. , sulphuric acid , sysmex cell pack dcl , sysmex sulfolyser , sysmex stromatolyser 4dl , sysmex stromatolyser 4ds 42 ml x 3 , s100 antibody , synaptophysin antibody , tartazine 5 gm , tbs 40x buffer , test tube l x b=12x100 mm , thermal paper roll 47 x55mm x 30 mts. , tissue paper roll , thionine , toluidine blue o , torniquete , transponder ( esr ) , trichloroacetic acid 100gm , 500ml ready made , tri sodium citrate dihydrate 500gm , ttf1antibody , tdt antibody , universal card alifex , latex control , urine container , urine control urinorm , vimentine antibody , writing pen for thermograph temperature recording , xylene , xylene ( sulphur ) free ar , xn check l1 , xn check l2 , xn check l3 , xn cal , zinc sulphate , tbs auto wash buffer 40 x 250 ml , mach 2 univ hrp polymer with dab & background sniper , diva decloakerm 20x 250 ml , er monoclonal ( clonal sp1 ) , pr monoclonal ( clonal sp2 ) , creb b 2 , hydrophobic pap pen , orinasys gp , micro pipette 1000 ?l , sta neoplastin 12x10x5 ml , phloxine b 25 gm , sulphuric acid 500 ml , tbs solution 40x biocare 250 ml , transponder , paraffin wax with ceresin 2 kg , periodic acid 100 gm , phenol 500gm , sta cephascreen , sta cacl 2 , sta liquid fib , sta dwren koller , sta liatest fdp , sta fdp control , sta fdp calibrator , sta desorb u , 3.2 % sodium citrate vial ( vacutainer ) , field stain i 500 ml , field stain ii 500 ml , glass marking pen...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33896694 supply of various laboratory items of m.m.n.n.j.y it paraffin wax 60 62% with ceresin absolute akohol ( ethanol 3 distilled water 4 xylene 5 sidit 6 cotton roll ( item related to schedule 1 as per rtpp rules 2013. priority will be given to msme sector hence enclose msme certificate i 7 micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass } b chloral hydrate 9 among solution 10 formaldehyde solution 40% 11 white adhesive tape u mfaotorne disposable blade high profile. 13 filter pape round 100x1 pkt 14 cassettes 3 crn.x1.5cm. ( plastic ) —yellow 15 cassettes 3 cm.3c2.5cnt. ( plastic ) —white 16 lain gloves sterilized 6.5p.0 / 75 no. 17 latex gloves unsterilized 6.5 / 7.0 / 7.5 no. i 18 dextrose 19 albumin powder 20 leishman stain 21 sulphur powder 22 sodium acetate 23 potassium ) acetate 24 potassium nitrate 25 benedlcts solution 26 acetone 27 dpx solution 28 cover slip libc18 0.1 man english glass 29 cover slip 22x22 0.1 mm english glass 30 cover slip 22360 0.1 mm english glass 31 glycerine 32 di— ionized water 33 schlffs reagent 34 bees wax 35 cea ( primary antibodies ) 36 gfap ( primary antibodies ) 37 hmb 4s ( primary antibodies ) 38 death ( primary antibodies ) 39 ema ( primary antibodies ) 40 bc12 temary setitakein4 41 hmwck ( primary antibodies ) 42 ck7 ( primary antibodies ) 43 er ( pnrnary antibodies ) 44 cd30 ( primary antibodies ) 45 cds ( primary antibodies ) 46 co23 ( primary antibodies ) 47 ck20 ( pdmary antibodies ) 48 1367 ( primary antibodies ) 49 cd10 ( primary antibodies ) 50 synaptoplvysin ( primary antibodies ) si pr ( primary antibodies ) 52 mpo ( primary antibodies ) 53 pax•5 ( primary antibodies ) 54 cd3 ( primary antibodies ) 55 vit1 ( primary antibodies ) 56 swo ( primary antibodies ) 57 aeuae3 ( muld ck ) ( primary antibodies ) 58 sma ( primary antibodies ) s9 inhibit ( primary antibodies ) 60 hpv ( primary antibodies ) 61 pi4 peran rams* 62 eber ( primary antbodes ) 63 oript avvin rebtedhes ) 64 cod ( primary antibodies ) 65 arnyioid ( primary antibodies ) 66 her 2— neu ( primary antibodies ) 67 vimentin ( primary antibodies ) 68 chromcieamin ( primary antibodies ) 60 antigens retrial buffer diva deciosket mr ( for manual ihc staining ) 70 background snapper ( for manual inc staining ) 71 wash buffer tbs autowash buffer 40x ( for manual ihc staining ) 72 imp polymer detection kit ( for manual ihc staining ) 73 pohtlysine coated slides ( for manual inc staining ) 74 peroxidaxed block 1 ( for manual ihc stain:mg ) 75 beuzold dab chtornogen ( for manual ihc staining ) 76 betazold dab substrate buffer ( for manual ihc staining ) 77 cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) sway! disinfectandfor cryostate ) i churls for cryostat microtome by thermofisher ( for cryostate ) microtorne blades ( high definition ) l cell pack dcl rd / sulfolyser 1....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33775824 lab equipment and material in labs supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp. 28 wash bottles 50o ml. 29 reagent bottle 12s ml. 30 reagent bottle 2so ml. 31 reagent bottle 500 ml. 32 ! reagent bottle 2so ml. 33 reagent bottle 5o0 ml. 3.4 dropping bottles 125 ml. 35 glass tube 6x10 mm. 36 fusion tube 6x10 mm. 37 centrifuge machine ( fourt.t. ) 3s centruge machine ( fourt.t. ) 39 filter paper ( sheet ) , i 4o filter paper ( v ) 41 , water bath 41 water bath 42 cork borer 43 pastel and mostars 15 cm. 44 pastel and mostars 20 cm. 4s weighing machine 1kg 1 c1nder 500 ml 47 cylinder 100o ml. i 48 condenser 500 ml. 49• separating funnel 10o0 ml. 50 ‘ gas genrator 1 bter 51 thermometer 30 cm._long 52 thermometer 3o cm. long 53 thermometer 30cm. long ! 54 thermometer indus. max mi 55_pipette stand pvc etc...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33757904 supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp....