Department of Agricultural Research and Education - Rajasthan

35135160 bids are invited for srl brand only supply aceton gc hs , hydrochloric acid , isopropanol gc , methanol extrapur ar acs exiplus , chloroform isoml alcohol for colecular biology , phenol chlororom isomyl alcohol , trichoroacetic acid extrapure , tis buffer for hplc , agar powder for microbiology , luria bertani agar , potato dextrose agar , sodium bicarbonate extrapure , n hexane pure , xylene cyanol ff extrapure , ar exiplus mutli compendial , bromophenol blue acs exiplus multi compendial , ethidium bromide for molecular biology , thoglycolic acid exiplus multi compendial , petroleum ether hplc uv spectoscopy , n butyy alcohol extrapure ar acx exiplus multi compendial , toluene extrapure ar acs exiplus multi compendial total quantity : 65...

Department Of Education - Rajasthan

34898280 bids are invited for verniar caliper , screw gauge 25mm , sphe ro meter , dcc wire , resistance wire ureka , resistance wire contan , resistance wire manghine , copper caprimeter pot , drowing bord woden , simple pendulam dob sel , stop clock , stop watch , thermameter 110c , therma meter , therma meter room temp , minimum maximum therma meter , drowing bord pin , sonometer , meter sccle wooden 1 mtr , meter bridge , potentiometer , resohance app , tunning fork set , rubber pad , stand. with claimp iron , plug kcc one way , plug kcc two way , resistance box 100000 , resistance box 100 , resistance box , rhehosted , zinc rod heavy , lacklanchi cell , denial cell , poras pot field , poras pot empty , cell box 2 cell plastic , ameter , volt meter dc 12 holt , galvenometer , induction cail , barmagnet , miliameter 500 ma , optical bench. 1 mtr. ss p , pn juction diode add p , pnp transistor , zener diode ap p , lens holder plastic , transistor loose , compass both side glass , solated weight , inclain plan p , hooks law app p , digital multimeter , parrol gram app p , battery eliminitor , reagent batlle nm 250 ml , reagent batlle nm 500 ml , reagent batlle wm 250 ml , reagent batlle wm 500 ml , dropping bottle 125 ml dolyks , glass tube , igawion tube , certifuge machire hand drive , certifuge machire remi electric , filter paper rim 500 nos , filter paper 125 , water bath copper , corck borar sel , pestal motor , weight machine , china disc , bunsen burner , pippel vlumatric 25ml , burrel 50 ml borocil a , test tube 25x150 borocil a , test tube 15x125 borocil a , test tube 12x100 borocil a , funnel 2 pvc. , funnel 100mm pvc. , test tube holder brass , test tube stand pvc. , spettula , sprit lamp ss , wash bottle 500 ml pvc. , reogent. bottle nm125ml borocil , beoker 100 ml borocil , beaker 250ml borocil , beaker 500ml borocil , conical. flask 250ml borocil , conical. flask 500ml borocil , flate. bottle flask. , conical. flask 500ml borocil , flate. bottle flask. 500ml borocil , dropper g , glass rod. , plaitinum wire , wire gauge. with fram , tonas , univer scal. ckeimp. , boss head , try pot stand , junior medical compound microscope , disseting microscope , forcep. big. , forcep. small , scisser small , scisser big , test. tube holder , test. tube stand , test. tube brush , stop. watch , niddle with plastic handal , dissecting brush , auxano meter , staing rock wooden , try. pot. stand , wire gauge , water bath electric rectangale , s phygnometer , stethoscope , dissecting tray. , electronic balance 300gm cap , test tube 15x125 borocilcole , watch glass , petric disc , plain slide , cavity slide , cover. slipe. , becker , becker 250ml borocilicete , measuring cylender 500ml pvc. , measuring cylender 100ml pvc , conicel flask. 250ml borocilicate , funnel 75mm pvc , gangoes potometer borociliate , gangoes respairometer borociliate , bell jar. soda glass , specimen jar. empty plastic , dropping bottle 60ml sodaglass , wash bottle 500ml pvc , dropper plastic , dessicator polykab. 300ml , thermameter clinic , funnel pvc , sprit. lamp aluminium , all permanan slide at the list , meosis. slide , mitosis slide , model amba , model frog , model eye , model ear , model brain , human skelition without box , all raxine charts at the list , all specimen at the list , specimen , material cutting dicot rot, stem leaf , material cutting monoct rot, stem leaf , filter paper 100 nos. , p.h. paper glaxo , saffarawine glaxo , eiosine glaxo , glycerol glaxo , methylene blue glaxo , fast green lanco , xylene rankem , formeldenyde glaxo , chloroform glaxo , acetocarmine lancer , bendicy solu. glaxo , steel almihra , teacher chair...

Medical Health And Family Welfare - Rajasthan

34846615 supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit ( 4th gen. ) , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit ( 4th gen. ) , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clotaing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , hb.tube , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 ?l ) , blue tips for micro pipette ( 1000 ?l ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 ?l , aerosol barrier tips 20 ?l , aerosol barrier tips 100 ?l , aerosol barrier tips 200 ?l , aerosol barrier tips 1000 ?l , water molecular grade 500 ml , self locking cable tie for bmw bags , micro pipette stand , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , cryo gloves all size , falcon tube 50 ml , falcon tube 15 ml , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) . , autoclave single channel micropipettes 100 1000ul , autoclave single channelmicropipettes 0 100ul , autoclave single channelmicropipettes 0 50ul , autoclave single channelmicropipettes 0 10ul , autoclave single channelmicropipettes 0 200ul...

Medical And Health Services - Rajasthan

34806181 supply of lab reagents i hcv test tri dot rapid card ) 2 hbsag test ( rapid card ) 3 lll3sag eisa test kit ( 4th gen ) 4 iiiv test ( tr dot rapid card ) 5 hiv ehsa test kit ( 4th gen. ) 6 hcv eisa test kit 4th gen ) 7 vdrl test kit ( strip ) 8 urine pregn—cy test kit ( card ) 9 dengue tut kit ( rapid card ) 10 dengue 1gm ehsa test kit i i denue ns i elisa test kit 12 ii ) card for gel card cross matching ( for biorad machine ) 13 pt i’est reagent kit ( 4x2 ml ) 14 widal test kit 15 malaria card ( rapid test for malaria antigen ) 16 crptes 17 aslo test kit 18 r.a. factor kit ( slide method ) 19 anti a, anti b & anti d ( monoclonal tg ( &, 20 21 amid ( monoclonal igg & im ) anti d monoclonal 1gm 22 anti h lcctin 23 anti al lectine 24 bovine albumin 25 anti human globulin rcoombs sera ) 26 multistix urine test strips ( for 10 parameter ) 27 urine sthp for ketones & glucose 28 leishnan stain liguid çready to use ) 29 giemsa stain solution ( ready to use ) 30 field stain reagent ( a+b ) 31 whatmans filter paper 32 p1 i paper ( litmus paper ) 33 cover slip for slide 34 capillary tube ror clotaing time 35 esr stand 36 methanol 37 dionised water 38 sample cup for biochemistry 39 ecoshield 40 absolute isopropenol ( molecular grade ) 41 reservior trough 42 plain glass test lube, 43 96 well vtm ( for 15 ml vth4 ) 44 blood sugar test kit ( manual ) 45 s. urea ( manual ) 46 s. creatinine ( manual ) 47 s. bilirubin ( manual ) 48 s. sgot ( manual ) 49 s. sgpt ( manual ) 50 w.13.c diluting fluid 51 r.b.c diluting fluid 52 semen i ) iluting fluid 53 losinophil diluting fluid 54 platelet diluting fluid 55 sahlis ilaemoglobinomcter 56 iibtube 57 iib. pipette 58 w.b.c pipette 59 r.b.c pipette 60 improved neubauer counting chanber 61 clean sole solution ( glass ware ) 62 levermed lab airticals disinfectant 63 combystyne labairticle disinfectant 64 tourniquet, 3.2% sodium citrate coated disposabie esr tube / pipette 71 pricker disposablclancct ) 72 sulphur powder 73 glacial acetic acid 74 liquid paraffin ( heavy ) 75 iodine solution 76 xylene 77 microscope glass slide 78 k3 edta disposable vaccuta ner vial 79 plain disposable vaccuta net vial 80 sodium floride ( naf ) disposable vaccutaner vial 81 clot activator disposable vaccutaner vial 82 3.2% sodium citrate disposable vaccuta net vial 83 chikengunya 1gm elisa test kit 84 scrub typus elisa test kit 85 ethanol molecular grade ( 500 ml ) 86 aerosol barner tips 10 pl 87 aerosol barrier tips 20 pi 88 aerosol bather tips 100 lul 89 aerosol bather tips 200 ul 90 aerosol barrier tips 1000, etc....

Department of Agricultural Research and Education - Rajasthan

34435952 bids are invited for srl brand only supply acetic acid glacial extrapure ar acs exiplus code 93602 , aceton gc hs 99.9 for ovi residual analysis code 89140 , acrylamide 3x cryst extrapure ar, 99.9 for electrophoresis code 15657 , n n methyl bisacrylamide 3x cryst for molecular biology 99.5 code 67320 , edta disodium salt dihydrate for molecular biology 99.5 code 43272 , glycerol glycerin for molecular biology 99.5 code 43272 , glycine for molecular biology, 99.5 code 64072 , hydrochloric acid 5n aq solution code 34472 , indicator papers ph 2.0 10.5 wide range code 27671 , indicator papers ph 6.5 9.0 narrow range code 61169 , isopropanol gc hs, 99.9 code 10140 , brilliant blue r code 93473 , methanol extrapur ar acs exiplus 99.8 code 37152 , chloroform isoamyl alcohol 24 1 for molecular biology code 85563 , phenol chloroform isoamyl alcohol 25 24 1 ph 8.0 for molecular biology code 69031 , polyvinylpyrrolidone pure pvp k 30 exiplus code 65155 , sodium carbonate anhydrous extrapure ar acs exiplus 99.9 code 93857 , sodium lauryl sulphate extrapure ar acs 99 code 54468 , n n n n tetramethyl ethylenediamine teme for molecular biology 99.5 code 52145 , trichloroacetic acid extrapure 99 code 90544 , tris buffer for hplc 99.9 code 56995 , ethylmethanesulphonate ems extrapure 99 code 85108 , agar powder for microbiology code 77981 , luria bertani broth code 22006 , luria bertani agar code 46502 , potato dextrose agar code 71788 , silica gel blue self indicating coarse 5 8 mesh code 85148 , citric acid anhydrous extrapure ar acs exiplus multi compendial, 99.5 code 16842 , sodium bicarbonate extrapure 99 code 56398 , n hexane pure 99 code 77045 , xylene cyanol ff extrapure ar exiplus multi compendial code 75122 , bromophenol blue acs exiplus multi compendial code 93676 , ethidium bromide for molecular biology 95 code 93079 , thioglycolic acid exiplus multi compendial 80 code 74118 , petroleum ether 60 80 for hplc uv spectroscopy code 15340 , n butyl alcohol extrapure ar acs exiplus multi compendial 99.5 code 15612 , toluene extrapure ar, acs exiplus multi compendial 99.5 code 95227...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

Jawaharlal Nehru Medical College - Rajasthan

34135658 pathology lab items pathology lab items , list of pathology lab items reagents / kits / chemical / glassware / polyware etc year 2022 24 , acetic acid glacial sq 99 100% 2.5 ltr. , acetone ar 2.5 ltr. , acid fuschin 25gm , aluminium chloride sq anhydrous 500gm , aluminium potassium sulphate ( postassium alum ) ar 500gm , albuno meter , alcian blue 8 gs , ammonia solution lr 500ml , ammonium bromide 100gm , ammonium oxalate 500gm , aniline blue ( water soluble ) 25gm , anti sera a , anti sera b , anti sera d , azure ii 100 gm , atrx antibody , basic fuschin 25gm , biebrick scarlet 25 gm , blood / serum sample tube , borex ar 500gm , boric acid 500gm , brilliant cresyl blue 25gm , chromogranin antibody , calcium chloride lr 500gm , carbol fuchsin conc. stain solution 200ml , carbol fuchsin ( zn strong ) 500ml , carmine ar 25gm , cd 3 antibody , cd 5 antibody , cd 10 antibody , cd 20 antibody , cd 23 antibody , cd 30 antibody , cd 45 antibody , charcoal ar 200gm , chlorauric acid ( gold chloride ) , chromium trioxide ( chromic acid, ) , chromotrope ar 25 gm , citric acid ar 500gm , sta c.k. prest , ck 7 antibody , ck 20 antibody , ck 5 / 6 antibody , calretinin antibody , coag control , congo red ar 100gm , coombs serum ( ahg ) polyclonal 5ml , cover glass , crystal violet 25gm , crystal violet 100gm , d.m. water 5ltr , dab background sniper mach 2 hrp polymer combo , deionised water ( triple deionised ) , deka phan ( 100 strips ) , urine control urinorm , desmin antibody , diluent for dna extraction , diva decloakerm 20x , dpx mountant 250ml , disposable esr pipette , ema antibody , er antibodies , esr pipette ( glass ) ( marrienfield made in germany ) , esr pipette glass , ethanol , eosin yellow ( water soluble ) , erba h3 contri level , ferric ammonium sulphate , filter paper sheet , filter card for cytospin , formaldehyde solution 37 41% w / v ar 5 ltr. , funnel filtering for glass , gentian violet ar 25gm , giemsa.s staining powder 25 gm , glass beaker various sizes , glass slide 1.35 mm , glass slides , glass test tube 100 x 12 mm , glass test tube 75 x 12 mm , glycerol ( glycerine ) ar 500ml , gfap antibody , haemeto critcapillary , haemotoxylin crystal 25gm , hand sanitizer , hmb 45 antibody , hep par 1 antibody , her 2 antibodies ( creb 2 ) , hplc variants ii test kit ar 500 test , hplc lyphocheck a2 control 0.5 ml x 4 , hydrochloric acid ( conc ) 2.5ltr. , hydrogen peroxide ( 3% ) 500ml , hydrogen peroxide solution 30% w / v ( 100 volumes ) lr 500ml , hydroquinone ar 5 gm , hypochlorite solution , idh1 antibody , iodine crystal ar 100gm , isopropyl alcohol 2.5 ltr. , jet cassettes with lid disposable , k3 edta tube vacutainer , 3.2% sodium ctrate vacutainer , ki67 antibody , lancet , leishman stain liquid , light green, sf yellowish , liquid parafin , lithium carbonate , lysercell wnr ( 5 ltr. ) , flourocell wnr , sulfolyser 5l , xn control l1 , xn control l2 , xn control l3 , xn cal , measuring cylinder 1000 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , mercuric chloride 100gm , mercuric oxide ( yellow ) , methanol ar 2.5 ltr. , methyl blue 10 gm. , methyl orange 5 gm. , methyl violet 20 gm. , micro pipette 100?l , micro pipette 200?l , micro pipette 50?l , micropipette variable volume upto 1 ml , micropipette variable volume upto 200 micro ltr. , microscope bulb ( philips ) ( .6v / 20w ) , microscopic cover glass 22x 50 mm , mpo ( myeloperoxidease ) stain kit , museum mounting jar ( glass ) ( varioussize ) , multistix ( urine ) , nuclear fast red stain 5 gm , nuclear fast red ( kernechtrot ) , neubaur counting chamber ( marrien field made in germany ) , nitric acid ( 69 72% ) , napsin a antibody , oil red o ar 100gm , orcein synthetic 5gm , orinasys gk , orinasys gp , orange g6 , oxalic acid 500gm , pan ck antibody , periodic acid phenol ( carbolic acid ) , phosphotungstic acid ar 100gm , p63 antibody , phosphomolybdic acid , picric acid ar 500 gm , pipette tips blue vol . 1000 ?l , pipette tips yellow vol . 200 ?l , ph strips , polylysine coated slides , ponceau 2r 25 gm , potassium acetate , potassium bromide 100gm , potassium carbonate 10 gm , potassium carbonate 25 gm , potassium chloride 500 gm , potassium dichromate 500gm , potassium dihydrogen phosphate 500gm , potassium ferocyanide ar 500 gm , potassium hydroxide ( koh ) , potassium iodide ar 100 gm , potassium nitrate , potassium permanganate lr 100gm , procold coolent , propylene glycol , pr antibodies , pt kit , qualitative filter paper diameter mm size 460x570 sheets grade 1 , quinoline yellow 25gm , rapid pap stain , resorcinol , reticulocyte count stain 25 ml , reti culocyte counting reagent , sodium acetate , sodium bicarbonate , sodium nitrate lr 25 gm , sodium bisulfite 500gm , sma antibody , sodium barbiturate 500gm , sodium chloride lr 500gm , sodium citrate 500gm , sodium hydroxide pellets , sodium hypochlorite 4% 2.5 ltr. , sodium hypochlorite solution ( 4% naclo 74.4 ) , sodium metabisulfite ar 500 gm , sodium phosphate monobasic 500gm , sodium black b 100gm , sodium thiosulphate 500gm , sta balls , sta cacl 2 , sta c.k prest , sta neoplastin cl+10 , sta cuvette , stago coagulation control. ( n+p ) , sta neophnal , sta cleaner solution , sta cuvettes 1000 , sta coag control n+p vial , stago coagulation control , sulfolyser 5 ltr. , sulphuric acid , sysmex cell pack dcl , sysmex sulfolyser , sysmex stromatolyser 4dl , sysmex stromatolyser 4ds 42 ml x 3 , s100 antibody , synaptophysin antibody , tartazine 5 gm , tbs 40x buffer , test tube l x b=12x100 mm , thermal paper roll 47 x55mm x 30 mts. , tissue paper roll , thionine , toluidine blue o , torniquete , transponder ( esr ) , trichloroacetic acid 100gm , 500ml ready made , tri sodium citrate dihydrate 500gm , ttf1antibody , tdt antibody , universal card alifex , latex control , urine container , urine control urinorm , vimentine antibody , writing pen for thermograph temperature recording , xylene , xylene ( sulphur ) free ar , xn check l1 , xn check l2 , xn check l3 , xn cal , zinc sulphate , tbs auto wash buffer 40 x 250 ml , mach 2 univ hrp polymer with dab & background sniper , diva decloakerm 20x 250 ml , er monoclonal ( clonal sp1 ) , pr monoclonal ( clonal sp2 ) , creb b 2 , hydrophobic pap pen , orinasys gp , micro pipette 1000 ?l , sta neoplastin 12x10x5 ml , phloxine b 25 gm , sulphuric acid 500 ml , tbs solution 40x biocare 250 ml , transponder , paraffin wax with ceresin 2 kg , periodic acid 100 gm , phenol 500gm , sta cephascreen , sta cacl 2 , sta liquid fib , sta dwren koller , sta liatest fdp , sta fdp control , sta fdp calibrator , sta desorb u , 3.2 % sodium citrate vial ( vacutainer ) , field stain i 500 ml , field stain ii 500 ml , glass marking pen...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33896694 supply of various laboratory items of m.m.n.n.j.y it paraffin wax 60 62% with ceresin absolute akohol ( ethanol 3 distilled water 4 xylene 5 sidit 6 cotton roll ( item related to schedule 1 as per rtpp rules 2013. priority will be given to msme sector hence enclose msme certificate i 7 micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass } b chloral hydrate 9 among solution 10 formaldehyde solution 40% 11 white adhesive tape u mfaotorne disposable blade high profile. 13 filter pape round 100x1 pkt 14 cassettes 3 crn.x1.5cm. ( plastic ) —yellow 15 cassettes 3 cm.3c2.5cnt. ( plastic ) —white 16 lain gloves sterilized 6.5p.0 / 75 no. 17 latex gloves unsterilized 6.5 / 7.0 / 7.5 no. i 18 dextrose 19 albumin powder 20 leishman stain 21 sulphur powder 22 sodium acetate 23 potassium ) acetate 24 potassium nitrate 25 benedlcts solution 26 acetone 27 dpx solution 28 cover slip libc18 0.1 man english glass 29 cover slip 22x22 0.1 mm english glass 30 cover slip 22360 0.1 mm english glass 31 glycerine 32 di— ionized water 33 schlffs reagent 34 bees wax 35 cea ( primary antibodies ) 36 gfap ( primary antibodies ) 37 hmb 4s ( primary antibodies ) 38 death ( primary antibodies ) 39 ema ( primary antibodies ) 40 bc12 temary setitakein4 41 hmwck ( primary antibodies ) 42 ck7 ( primary antibodies ) 43 er ( pnrnary antibodies ) 44 cd30 ( primary antibodies ) 45 cds ( primary antibodies ) 46 co23 ( primary antibodies ) 47 ck20 ( pdmary antibodies ) 48 1367 ( primary antibodies ) 49 cd10 ( primary antibodies ) 50 synaptoplvysin ( primary antibodies ) si pr ( primary antibodies ) 52 mpo ( primary antibodies ) 53 pax•5 ( primary antibodies ) 54 cd3 ( primary antibodies ) 55 vit1 ( primary antibodies ) 56 swo ( primary antibodies ) 57 aeuae3 ( muld ck ) ( primary antibodies ) 58 sma ( primary antibodies ) s9 inhibit ( primary antibodies ) 60 hpv ( primary antibodies ) 61 pi4 peran rams* 62 eber ( primary antbodes ) 63 oript avvin rebtedhes ) 64 cod ( primary antibodies ) 65 arnyioid ( primary antibodies ) 66 her 2— neu ( primary antibodies ) 67 vimentin ( primary antibodies ) 68 chromcieamin ( primary antibodies ) 60 antigens retrial buffer diva deciosket mr ( for manual ihc staining ) 70 background snapper ( for manual inc staining ) 71 wash buffer tbs autowash buffer 40x ( for manual ihc staining ) 72 imp polymer detection kit ( for manual ihc staining ) 73 pohtlysine coated slides ( for manual inc staining ) 74 peroxidaxed block 1 ( for manual ihc stain:mg ) 75 beuzold dab chtornogen ( for manual ihc staining ) 76 betazold dab substrate buffer ( for manual ihc staining ) 77 cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) sway! disinfectandfor cryostate ) i churls for cryostat microtome by thermofisher ( for cryostate ) microtorne blades ( high definition ) l cell pack dcl rd / sulfolyser 1....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33775824 lab equipment and material in labs supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp. 28 wash bottles 50o ml. 29 reagent bottle 12s ml. 30 reagent bottle 2so ml. 31 reagent bottle 500 ml. 32 ! reagent bottle 2so ml. 33 reagent bottle 5o0 ml. 3.4 dropping bottles 125 ml. 35 glass tube 6x10 mm. 36 fusion tube 6x10 mm. 37 centrifuge machine ( fourt.t. ) 3s centruge machine ( fourt.t. ) 39 filter paper ( sheet ) , i 4o filter paper ( v ) 41 , water bath 41 water bath 42 cork borer 43 pastel and mostars 15 cm. 44 pastel and mostars 20 cm. 4s weighing machine 1kg 1 c1nder 500 ml 47 cylinder 100o ml. i 48 condenser 500 ml. 49• separating funnel 10o0 ml. 50 ‘ gas genrator 1 bter 51 thermometer 30 cm._long 52 thermometer 3o cm. long 53 thermometer 30cm. long ! 54 thermometer indus. max mi 55_pipette stand pvc etc...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33757904 supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Sms Medical College - Rajasthan

33636877 rate contract for chemicals and media items for microbiology department ( nit 45 ) t , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Medical College - Rajasthan

33634315 rate contract for chemical and media items for microbiology department rate contract for chemical and media items for microbiology department , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

Rajasthan University Of Health Science - Rajasthan

33465082 regents and consumables items for microbiology lab regents and consumables items for department microbiology lab , electrical items : , alberts stain , alkaline peptone water , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbeab elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , antiinuelear antibody ( ani ) elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , corn meal agar , cover slips 22 x 22 mm , crp test kit , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable polythene gloves , dubos medium , ecoshield , edta powder , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , mr vp medium ( glucose phosphate broth ) , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile transport medium ( stuart medium ) with test tube and swab individually packed , sulphanilamide , tcbs , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , hcv igmrapid card , occult blood stool , rpr test kit...

Department Of Medical Education - Rajasthan

33432025 supply of general items for tb / vrdl / rt pcr lab 1 absorbent paper roll 2 absorbent paper sheet 3 aluminum foil 4 autoclavable pp plastic racks for 96 places 5 bags, biohazard, ( transparent autoclavable ) 6 cetylpyridinium chloride ( cpc ) for biochemistry mw 358.0 1>98% 7 cold chain box ( 12 lit. ) , 8 cotton roll 9 diamond pencil 1o di sodium hydrogen phosphate 11 disposable head caps disposable lab gownspp ( large and 12 medium ) 13 disposable shoe cover disposable syringes 5 ml ( 22 & 24 14 gauge ) 15 dnase / rnase surface decontaminant 16 dropper bottle droppers, sterile, plastic 1 .5 ml, 17 graduated droppers, sterile, plastic 3.0 ml, 18 graduated, disposable 19 edta 20 ethunol 95% 21 filter paper 22 fluorescent staining kit for afb 23 formaldehyde 24 glass funnel 25 gloves nitrile, size s m l 2s gloves. latex size s m’ l 27 glycerol, 28 hydrochloric acid, fuming ( 37% ) 29 hydrogenperoxyde 30% 30 immersion oil laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for 31 pcr lab 32 laboratory thermometer 33 l asparagine 34 lint free soft tissue liquid dispensing wash bottle 35 plastic ( 500ml ) 36 u medium base powder ready mix 37 loop, disposable 10 i1 38 loopholder 39 loopholder rack 4o magnesium sulphate 41 malachite green 42 mask ( disposable surgical ) 43 mccartney bottle 15 ml 44 mccartney bottle 7 ml 45 mc farland standard set micro pipette stand pipette stands 46 for5pipettes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20iil ) maximum recovery / minimum retention 47 filtered, racked, sterile micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimum retention filtered, raqked, sterile 48 ( i00 l000jil ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / minimum retention filtered, racked, sterle ( 49 2 200 ji l ) molecular grade ethanol 50 molecular grade isopropanol 51 52 n95 respirators ( niosh approved ) 53 na acetate n acetyl l cysteine ( nalc ) 54 powder 55 naphthyl ethylendiamine 56 needle destroyer 57 niacin strips 58 nichrome wire 59 nicotinamide 60 paraflim 61 pcr tubes flat snap cap 0.2 ml 62 pcr tubes strip wiih flat cap optical for rt pcr 0.2 ml 63 phenol, 64 plastic racks ( 15 ml tubes ) plastic racks for 15 ml conical 65 falcon tubes plastic racks for 2 ml mct, 66 autoclavable. plastic racks for 50 ml conical 67 falcon tubes plastic storage box for 0.2 ml pcr 68 tubes with lid plastic storage box with lid for 2 ml 69 cryovials i ox 10 7o potassium dihydrogen phosphate 71 potussium permanganate 72 sample collection container sterile 73 cryovials screw cap ( hinged ) mct tapered 74 ( 1.5ml ) 75 slide drying racks snap cap ( hinged ) mct tapered 76 ( 1.5 ml ) snap cap ( hinged ) mct round 77 bottom ( 2 ml ) 78 sodium chloride, naci 79 sodium hydroxide, naoh, 80 sodium hypochlorite solution 81 sodium nitrate 82 spnay botties spnaylde 500 ml 83 spray bottles plastic pp 250 ml 84 sputum container 85 staining bottle 86 staining rack 87 sterile blue tips bulk ( l000iil ) 88 sterile tips bulk ( l0ll ) , 89 sterile yellow tips bulk ( 10011l ) 90 sulfuric acid, concentrated 91 sulphanilamide 92 test tube rack pp for vtm tubes 93 tissue roll 94 torn iguet 95 tr maynesium di eitrgteu 96 tube, centrifuge, 15 ml with screw cap 97 tube, centrifuge, 50 ml with screw cap 98 tubes cryovial, sterile with screwcap. 2 ml 99 tubes reaction. 2 ml 100 universal bottle for cultures. 28 ml 101 water molecular biology grade 102 xylene 103 zinc powder 104 zn acid fast staining kit 105 autoclavable pp cryoboxes suitable for storage at 80 c 10 xi0 samples for2rnlcryovials, autoclavablepp racks for 1.5 ml 106 mct 48 samples ( 24 pieces ) ....

Jhalawar Medical College and SRG Hospital - Rajasthan

33421913 rate contract supply of general items for tb / vrdl / rt pcr labs at medical college and hospital jhalawar , microbiology dept. , absorbent paper roll , absorbent paper sheet , aluminum foil , autoclavable pp plastic racks for 96 places , bags, biohazard, ( transparent autoclavable ) , cetylpyridinium chloride ( cpc ) for biochemis mw 358.01>987% , cold chain box ( 12 lir ) , cofton roll , diamond pencil , di sodium hydrogen phosphate , disposable head caps , disposable iab gownspp ( large and medium ) , disposable shoe cover , disposable syringes 5 ml ( 22 & 24 gauge , dnase / rnase surface decontaminant , dropper bottle , droppers, sterile, plastic 1.5 ml, graduated , droppers, sterile, plastic 3.0 ml, graduated, disposable , edta , ethanol 95% , filter paper , fluorescent staining kit for afb , formaldehyde , glass funnel , gloves nitrile, size s m l , gloves, iatex size s m l , glycerol , hydrochloric acid, fuming ( 37% ) , hydrogenperoxyde 30% , immersion oil , laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab , laboratory thermometer , l asparagine , lint free soft tissue , liquid dispensing wash bottle plastic ( 500m1 ) , lj medium base powder ready mix , loop, disposabte 10 pl , loopholder , loopholder rack , magnesium sulphate , malachite green , mask ( disposable surgical ) , mccartney bottle 15 mt , mccartney bottle 7 ml , mc farland standard set , micro pipette stand pipette stands for 5 pipttes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20p1 ) maximum recovery / lvlinim u m retention filtered racked, sterile , micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimurt retention filtered, racked sterile ( 100 100ul ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / ivlinimum retention filtered, racked sterile ( 2 200ul ) , molecular grade ethanol , molecular grade isopropanol , n95 respirators ( niosh approved ) , na acetate , n acetyl l cysteine ( nalc ) powder , naphthyl ethylendiimine , needle destroyer , niacin strips , nichrome wire , nicotinamide , parafilm , pcr tubes flat snap cap 0.2 ml , pcr tubes strip with flat cap optical for rt pcr0.2 ml , phenol i , plastic racks ( 15 ml tubes ) , plastic racks for 15 ml conical falcon tubes , plastic racks for 2 ml mct, autoclavab le, , plastic racks for 50 ml conical falcon tubes , plastic storage box for 0.2 ml pcr tubes with lid , plastic storage box with lid for 2 ml cryovials 10x10 , potassium dihydrogen phosphate , potassium permanganate , sample collection container sterile , cryovials , screw cap ( hinged ) mct tapered ( 1.5ml ) , slide drying racks , snap cap ( hinged ) mct tapered ( 1.5 ml ) , cap ( hinged ) mct tapered ( 2 ml ) , sodium chloride, nacl , sodium hydroxide, naoh , sodium hypochlorite solution , sodium nitrate , spray bottles sprayldpe 500 ml , spray bottles plastic pp 250 ml , sputum container , staining bottle , staining rack , sterile biue tips butk ( 1000u1 ) , sterile tips butk ( 10ul ) , sterile yellow tips bulk ( l00ul ) , sulfuric acid, concentrated , sulphanilamide , test tube rack pp for vtm tubes , tissue roll , torniquet , tri magnesium di citrate , tube, centrifuge, 13 ml with screw cap , tube, centrifuge, 50 ml with screw cap , tubes cryovial, sterile with screwcap, 2 ml , tubes reaction, 2 ml , universal bottle for culturcs, 28 ml , water molecular biology grade , xylene , zinc powder , zn acid fast stainidg kit , autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 mlcryovials , autoclavable pp racks for 1.5 ml mct 48 samples ( 24 pieces ) ...

Medical Health And Family Welfare - Rajasthan

33349004 rate contract tender for supply of consumables item , acetic acid , calcium chloride fused , boric acid , hydrogen per oxide , hydrochloric acid , phospho molybdic acid , sudan ii , nitric acid , sulphuric acid , acetone , ammonium molybdate , di ammonium hydrogen phosphate , iso amyl alcohol , ammonium hydroxide solution , antimony ( iii ) chloride , ammonium ferric sulphate , acetonitrile , bismuth subnitrate , bromocresol green indicator ar , chloroform , carbon tetra chloride , petroleum ether 60 80 , phloroglucinol , phenol , paraffin liquid , resorcinol , sodium hydroxide pelletes , diethyl ether , fehling solution a , furfural , glycerol , xylene , methyleneblue solution indicator , methylorange indicator , fehling solution b , silver nitrate , di phenyl carbazide , petroleum ether 40 60 , phenopthaline indicator , cobalt sulphate , fast red ( allura red ) colour , alkali blue 6 b indicator , rosaniline acetate , zinc acetate , potassiumhydroxide , benzene , hexane , n heptane , potassium iodide , sudan i , sudan iii , sudan iv , sodium hydoxide solution , silica gel , toluene , furfuraldehyde , aluminum oxide ( al2o3 ) , tartrazine color , sunset yellow color fcf , carmosine color , ponceau 4rcolor , brilliant blue color , fast green fcf color , metanil yellow color , iodine monochloride ampules , ninhydrine , potassium chromate , potassium dichromate , starch soluble , sulphur powder , tri sodium citrate , ampules 0.1n sodium hydroxide of 6 , ampules 0.1n sodium thiosulphate of 6 , ampules 0.1n hydrochloric acid of 6 , ampules 0.1n silver nitrate of 6 , iodine crystal , sodium potassium tartrate , di methyle amino banzaldehyde , copper sulphate , potassium sulphate , edta powder , sodium carbonate , copper acetate , bromine ampule , carbon di sulphide , phenol , methyl red indicator , phenol red indicator , phenolphthalien indicator , eriochrome black t indicator , di mehtyel yellow , bromothymol blue indicator , bromophenol indicator , di mehtyel yellow colour , caramel colour , rhodamin b , amaranth colour , erythrosine colour , acid yellow colour , sucrose pure , acid orange ( orange grade ) color , butter yellow color , methanol ms optima grade , acetonitrilms optima grade , ethyl acetate ms optima grade , acetic acid ms optima grade , aluminum ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , antimony ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , arsenic ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , barium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , bismuth ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , cadmium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , calcium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , chromium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , copper ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , germanium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , gold ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , iron ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , lead ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , magnesium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , manganese ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , mercury ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , nickel ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , potassium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , rhodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , scandium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , selenium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , silver ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , sodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tellurium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tin ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , vanadium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , zinc ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , customized gc pesticide mix nist certified crm ( compound list enclosed ) , customizedlc pesticide mix nist certified crm ( compound list enclosed ) , curcumin nist certified crm ( 1000 mg / l ) , 37 component fame mixcrmfor fatty acid , vitamin a ( 1000 mg / l ) , vitamin d ( 1000 mg / l ) , vitamin b12 ( 1000 mg / l ) , vitamin b3 ( 1000 mg / l ) , vitamin c ( 1000 mg / l ) , potassium hydrogen phthalate , sodium carbonate , mustard oil , ground nut oil , potassium di chromate , sodium chloride , sucrose , oryzonol , argemone oil reference standard , castor oil reference standard , mineral oilreference standard , cotton seed oilreference standard , turmeric with lead chrome reference standard , potassium di chromate reference standard , potassium hydrogen phtallatereference standard , sodium carbonatereference standard , sodium chloridereference standard , sand particle size pass through 500 micron is seive size and retained on 180 micron is seive , standard is seive set ofaperture size size 4 mm, 3.35 mm, 1.70 mm, 1.0 mm with solid bottom pan each , vitamin a reference standard , nutrient brothw / 1%peptone , nutrient agar , mac conkey broth w / nurtral red , mac conkeys agar , plate count agar ( pca ) , bairedparkes agar medium , yeast extract dextrose chloramphenicol agar medium , potato dextrose agar , m r vp medium , bismuth sulphide agar medium , thermometer 0 to 1000c , cedar wood oil / immersion , forcepsss , tray plastic , kovacsindole reagent , grams stain kit , steam indicator tape , dry heat chemical process strips , stereothermophilus ampoule , disposable shoe cover , ph paper strips , autoclavable disposable bags , brown paper , uv lamp for sterilization , autoclavable micropipette ( 1000 fixed volume, 500 5000 variable volume, 50 200 microlitre , micropipette tip box , scissors small , labels and taps , aluminum foil , butter paper , hand gloves ( small and large ) , slippers , liquid soup solution for glassware washing 5 ltr pack , lens paper , beaker , beaker , beaker , beaker , beaker , burret , burret , butyrometer tube for milk testing , dropping bottle plastic , dropping bottle plastic , dropping bottle plastic , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , cover slip , condenser for rmset , crusible quartz without lid , diamond pencil , flask conical , flask conical , flask conical , flask conical , flask iodine stopper , funnel glass , funnel plastic , separating funnel , glass rod all type , rubber bulb medium size , rubber bulb size big , pipettes graduated , pipettes graduated , pipettes graduated , pipettes volumetric , pipettes volumetric , pipettes volumetric , pipettes volumetric , test tube with stopper , petri dish pair ( glass ) , volumetric pipette , caplliry tube , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , density bottle , soxhlet flask , glass beads , glass slide for microscopy , heating mantal net for 250ml , heating mantal net for 500ml , automatic tilt with 250ml bottle , automatic tilt with 250ml bottle , soxhletcondensor medium , aluminium dishes , reagent bottle , reagent bottle , reagent bottle amber coloured , reagent bottle amber coloured , mojonnier fat extraction tube , pipette stand plastic verticle , air condenser with joint 100cm , dean & stark apparatus 10.0ml , auto pippete sucker , suction flask , colum chomrplaingl, stpk for colour estimation , thermometer zeel , lactometerzeel , centrifuge tube glass with stopper , butyrometer tube aluminium stand , volatile oil clanveger type , lighter thanwater , desicator with cap , toungue ss , soxhlet clamps , with boss head , asbestosed wire gauge , mortar & pestal , volumetric flask ( rm reciever ) , membrane filtration assemboly with pump & filters , beaker , beaker , iodine flask , butyrometer key , butyrometer tube cork , filter paper sheet 1 ( 46*57cm ) , filter paper no. 1 diameter 125mm , filter paper no. 2 diameter 125mm , filter paper no. 4 diameter 125mm , filter paper no. 42 dimeter 125mm , centrifuge tubes ( pp tubes ) 50mlpkt , centrifuge tubes ( pp tubes ) 15mlpkt , nylon syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , ptfe syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , nitril gloves ( medium size ) , nitril gloves ( small size ) , brush for butyrometr test tube brush , tong 12 ss , spatulla 8 ss , auto sampler vials with cap and septa 1x100 , 100 1000 micro litre tips universal graduated ( 1x1000 ) , 10 100 micro litre tips , 1 5 ml tips ( 1x100 ) , tissue rolls , lens paper , disposable lab coat , non absorbant cotton roll500gm , nitrogen gas cylinder 47 litre ( 99.999% purity ) , argon gas cylinder47 litre ( 99.999% purity ) , helium gas cylinder47 litre ( 99.999% purity ) , hydrogen gas cylinder47 litre ( 99.999% purity ) , zero air gas cylinder47 litre ( 99.999% purity ) , membrane filter ( 0.45 ) um ( millipore ) , aluminum foil food grade ( extra hygiene ) rolls , tlc plate aluminium ( 20x20 cm ) , coloumn for vitamin analysis c 18 1.8?m, 2.1x100mm , coloumn for vitamin analysis c 18 2.6?m, 2.1x100mm , gc coloum 105 mtr. capillary tg 5ms, 105mtr. lenth x0.25 pore size for fatty acid profile , alpha. amylase 100 gm , sodium acetate500 gm , ammonium formate 100 gm , di potassium hydrogen phosphate 500 gm...

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

National Institute Of Ayurveda - Rajasthan

33123875 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux / bd ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux / bd ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500gm , amikacin ( himedia / sigma / biomerieux / bd ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux / bd ) 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux / bd ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux / bd ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux / bd ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux / bd ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux / bd ) 50 ml , cefipime ( himedia / sigma / biomerieux / bd ) 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) 1 vial , cefoxiti ( himedia / sigma / biomerieux / bd ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux / bd ) 1 vial , citrate agar ( himedia / sigma / biomerieux / bd ) 500gm , cled agar ( himedia / sigma / biomerieux / bd ) 500gm , clindamycin ( himedia / sigma / biomerieux / bd ) 1 vial , colistin ( himedia / sigma / biomerieux / bd ) 1 vial , coplin jar ( himedia / sigma / biomerieux / bd ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux / bd ) 1 vial , cotton roll ( himedia / sigma / biomerieux / bd ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux / bd ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux / bd ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux / bd ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux / bd ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux / bd ) 5 litr , doxycline ( himedia / sigma / biomerieux / bd ) 1 vial , dpx mount ( himedia / sigma / biomerieux / bd ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux / bd ) 125 ml , erythromycin ( himedia / sigma / biomerieux / bd ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux / bd ) 500 gm , forceps ( himedia / sigma / biomerieux / bd ) 1 pc , fosfomycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) 1 strip , giemsa stain ( himedia / sigma / biomerieux / bd ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux / bd ) 5 litr , glass slides ( himedia / sigma / biomerieux / bd ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux / bd ) 500 ml , grams iodine ( himedia / sigma / biomerieux / bd ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux / bd ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux / bd ) 500 ml , imipenem ( himedia / sigma / biomerieux / bd ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux / bd ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux / bd ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux / bd ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux / bd ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux / bd ) 500 ml , levofloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , linezolid ( himedia / sigma / biomerieux / bd ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux / bd ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) 1 holder , methanol ( himedia / sigma / biomerieux / bd ) 500 ml , methylene blue ( himedia / sigma / biomerieux / bd ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux / bd ) 125 ml , mrvp media ( himedia / sigma / biomerieux / bd ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux / bd ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux / bd ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux / bd ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux / bd ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux / bd ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux / bd ) 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , novabiocin ( himedia / sigma / biomerieux / bd ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux / bd ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux / bd ) 500gm , optochin ( himedia / sigma / biomerieux / bd ) 1 vial , oxidase discs ( himedia / sigma / biomerieux / bd ) 1 vial , penicillin g ( himedia / sigma / biomerieux / bd ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux / bd ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux / bd ) 1 vial , piperacillin ( himedia / sigma / biomerieux / bd ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux / bd ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux / bd ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux / bd ) 100ml , ria vials ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux / bd ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux / bd ) 125 ml , sim media ( himedia / sigma / biomerieux / bd ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux / bd ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux / bd ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux / bd ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux / bd ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux / bd ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux / bd ) 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) 1 vial , tobramycin ( himedia / sigma / biomerieux / bd ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) 500gm , urea agar base ( himedia / sigma / biomerieux / bd ) 500gm , urea solution 40% ( himedia / sigma / biomerieux / bd ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux / bd ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux / bd ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux / bd ) 500 ml , xylene ( himedia / sigma / biomerieux / bd ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Medical Health And Family Welfare - Rajasthan

33105744 supply of lab and blood bank regents in govt bdm district hospital kotputli supply of lab and blood bank regents in govt bdm district hospital kotputli , list for laboratry & blood bank regents , elisa test kit for hiv 96 test ( 4th generation ) , elisa test kit for hiv 96 test ( 3rd generation ) , elisa test kit for hcv 96 test , elisa test kit for hbsag 96 test ( 4th generation ) , elisa test kit for hbsag 96 test ( 3rd generation ) , elisa test kit for dengue igm 96 test , elisa test kit for dengue igg 96 test , elisa test kit for scrub typhus 96 test , elisa test kit for chickengunia96 test , elisa test kit for hcv 96 test , rapid test card malaria pan ldh 1 piece , rapid test card malaria antigen 1 piece , rapid test card for dengue ns1 1 piece , rapid test card for dengue igm 1 piece , rapid test card for dengue ns1 + igm ( combo ) 1 piece , rapid test card for hiv ( 4th generation ) 1 piece , rapid test card for hiv 1 piece , rapid test card for hcv 1 piece , rapid test card for hcv ( 3rd generation ) 1 piece , rapid test card for hcv ( 4th generation ) 1 piece , rapid test card for hbsag 1 piece , rapid test card for scrub typhus 1 piece , rapid test card for chickengunia 1 piece , rapid test card for typhoid igm + igg 1 piece , rapid test card for syphilis ( rpr ) 1 piece , rapid test strip for syphilis ( rpr ) 1 piece , rapid test card for hiv & syphilis 1 piece , pregnency test strip 1 piece , pregnency test card 1 piece , antisera anti. a monoclonal 10 ml , antisera anti b monoclonal 10 ml , antisera anti ab monoclonal 10 ml , antisera anti d igm monoclonal 10 ml , antisera anti d ( igm + igg ) monoclonal 10 ml , lectin a1 monoclonal 10 ml , ahg monoclonal 10 ml , antisera anti h monoclonal 10 ml , blood grouping test kit ( abd kit ) ( monoclonal ) 10 ml each , bovine alumine 22% 10 ml , gel card ahg ( coomb gel card ) for cross match 1 piece , liss solution 500 ml ( ready ) , blood sample collection edta vial single cap5 ml 100 piece , blood sample collectionplainvial single cap 5 ml 100 piece , blood sample collectionpt vial single cap 5 ml 100 piece , blood sample vial5ml ( edta ) double cap 100 piece , blood sample vial 5ml ( plain ) double cap 100 piece , blood sample collectionclot activater vial single cap 5 ml 100 piece , blood collecting bag cpda 1 paed 100ml 1 piece , blood collecting bag cpda 1 350ml single 1 piece , aslo test kit 5ml ( latex ) , aslo test kit 50ml ( quantitative ) , analyser paper roll for horiba 3 part cbc 1 piece , analyzer paper roll for semi biochemistry analyzer 1 piece , analyzer paper roll for lura urineanalyzer 1 piece , pasture pippett ( plastic ) volume 5 ml 1 piece , wash bottel 2 ltr , wash bottel 5 ltr , wash bottel 10 ltr , throat swab ( cotton ) 100 piece , throat swab ( nylon ) 100 piece , throat swab ( dacron ) 100 piece , plastic zip lock pocket 100 piece , blood sugar test strip with acquachek with glucometer ( 50 strip ) , blood urea test kit , blood sugar accusure insci glucometer strip ( 50 strip ) , crp test kit5ml ( latex ) , crp test kit50ml ( quantitative ) , crp titration test kit5ml , cover slip for neubar chamber 100 piece , cover slip for glass slide 100 piece , counting chamber ( neubar ) 1 piece , capilary tube 1.5 mm diameter x 10 15 cm length ( 50 piece ) , cbc roll ( pos 555 tl ) ( 55mm×15 mtr ) 1 roll , ckmb trop t test card ( 1 piece ) , ckmb trop i card ( 1 piece ) , cknac trop t test card ( 1 piece ) , ck mb solution 1x25 ml , ck nac solution 1x25 ml , disposal droper ( 100 piece ) , plastic test tube with screw cap 10ml ( 100 piece ) , plastic test tube with screw cap 5ml ( 100 piece ) , disposal plastic test tube 5ml ( 100 piece ) , disposal plastic test tube 10ml ( 100 piece ) , disposable face mask ( 100 piece ) , disposal cap ( 100 piece ) , edta solution 500ml bottel , drabkin solution 5 ltr. pack , dettol liquid ( 500ml ) , esr standwestergen blood test pipet ( 5 test stand ) 1 piece , esr tube glass for westergen mathod 1 piece , disposable plastic esr pippet 100 piece , esr pippet cuff 100 piece , elicote vial 100 piece , floride vacutainor vial 100 piece , glass slide 76mmx26mm 100 piece , haemoglobinometer ( german made ) top 1 piece , hb tube square haemometer mesauring tube ( top ) 10 piece , giemsa stain 500 ml , methylene blue stain500 ml , gention violet stain 500 ml , jsb i ( solution ) 500ml , jsb ii ( solution ) 500 ml , leishman stain 500ml , lense cleaning paper packet ( 50 page ) , lable chips ( paper ) 1000 piece , liquid parafin 500ml , micro tips 1000 micro ltr 1000 piece , micro tips 200 micro ltr 1000 piece , micro tips 50 micro ltr 1000 piece , micro tips 20 micro ltr 1000 piece , micro scope blub isi 1 piece , microscope lense ( made in german, japan, poland ) 1 piece , micro pippet10 to 100 micro 1 piece , micro pippet100 to1000 micro 1 piece , multichannel micropippet for elisa 1 piece , n / 10 hcl 500ml , n95 mask with respirator 1 piece , n95 mask without respirator 1 piece , mask tripple layer 100 piece , p.p. e.kit for swine flue 1 piece , p.p. e.kit sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit 100 gsm sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit for corona with ( triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit googles 1 piece , face shield 1 piece , surgical sterile gloves 6 no 1 pair , surgical sterile gloves 6.5 no 1 pair , surgical sterile gloves 7 no 1 pair , surgical sterile gloves 7.5 no 1 pair , disposal rubber gloves large size 1 piece , disposal rubber gloves medium size 1 piece , infrared thermometer 1 piece , multi surface disinfectant liquid 500 ml , foot press sanitizer stand 1 piece , uv disinfection sanitizres 1 piece , pulse oxymeter finger tip 1 piece , r.a. test kit 5ml ( latex ) , r.a. test kit 50ml ( quantitative ) , test tube stand 100 test tube ( steel ) 1 stand , sodium citrate solution 500ml , sterile water 5 l packing , semen dilutingfluid 100 ml , spinal niddle 26 g 1 piece , triplefilterd disttled water5 l packing , test tube stand steel 24 test tube , test tube stand steel 12 test tube , test tube stand plastic12 test tube , test tube stand plastic24 test tube , test tube stand plastic48 test tube , test tube stand plastic50 test tube , tissue paper roll 1 piece , arm tourniquites for blood sampling 1 piece , urine test strip for albumine, sugar & ketone body 100 piece , urine test strip ( albumine sugar ) 100 piece , urine container ( disposable ) 30ml , vtmvial forswine flu & corona 1 piece , vial 5 ml ( open mouth ) for cross match ( plastic ) 100 piece , vial 5 ml ( open mouth ) for cross match ( glass ) 100 piece , vacutainor plain vial 5 ml 100 piece , vacutainor edta k3 vial 5 ml 100 piece , vacutainor holder and niddlemulti sample 100 piece , vacume test tube edta ( with niddle ) 2ml 100 piece , vacume test tube edta ( with niddle ) 5ml 100 piece , vacume test tube plain ( with niddle ) 2ml 100 piece , vacume test tube plain ( with niddle ) 5ml 100 piece , widal test kit 4 x 5 ( to, th, ah, bh ) 1 kit rate , dettol hand wash 500ml , phenyle 5 ltr. , vacutainor sodium citrate test tube 100 piece , cuso4 solution for hemoglobine estimation 100 piece , wintrobs tube 100 piece , disposable esr test tube 100 piece , swine flu vaccine 0.5 ml , sodium hypochloride 6% 5 ltr. , sodium hypochloride 5% 5 ltr. , sodium hypochloride 4% 5 ltr. , xylene 100ml , coplin staining jar 100 ml , coplinstainingjar 200 ml , staining jar 250 ml , gram staning regent ( readymade ) 100 ml , sticker roll for computer ( 4 x 4 size ) 1 roll , culture bottle 100 ml , culture bottle 200 ml , culture bottle 500 ml , gluteraldehyde 5 ltr. , vial for calcium test 100 piece , prolyle control ( for electrolite machine ) , multi control for semi auto biochemistry analyzer , bar code sticker l x w ( 2x1 ) 5000 piece , wax ribbon roll forbar code sticker l x w ( 2x1 ) 5000 piece , digital dlc counter machine 1 piece , regents forsemi auto analyser machine , serum calcium test kit liquid , serum creatinine test kit liquid , serum cholestrol test kit liquid , serum bilirubin test kit liquid , serum sgot test kit , spirit 5 ltr. ( methylated ) , serum sgpt test kit , s. alk. phosphate kit liquid 30 x 10ml , s. protein total liquid , s. albumin kit liquid , s. ldh liquid , s. amylase liquid , s. uric acid liquid , p.p.e kit for hiv 1 piece , serum ldh test kit liquid , blood sugar test kit , cpkmm trop ttest kit 1x25ml , cpkmb trop t test kit 1x25ml , hdl chloresterol test kit ( erba, span ) , triglyceride test kit , regents for culture media , nutrient agar plate 1 piece , sheep blood agar plate 1 piece , macconkey agar plate 1 piece , triple sugar iron agar 1 piece , urea agar base ( christensen ) ( autoclavable ) 1 piece , citrate agar , oxidase discs ( 50 discs / vl ) , gram stains kit 50 ml , grams crystal violet , kovacs indole regent , whatman filter paper no 1 100 piece , gention violet staning 100 ml , crystal violet stain100 ml , grams iodine 100 ml , lugol iodine 100 ml , aluminium slide tray for 10 slide 1 piece , potassium iodide 200 gm , safranin counter stain 100 ml , acetone solution 100 ml , absolute ethyl alcohol 100 ml , 95 % ethyl alcohol100 ml , methyl alcohol 100 ml , phosphate buffer solutions ( ph 7.2 ) 500 ml , vial 50 ml 1 piece , folken tube 1 piece , autoclave strip 1 piece , powder sucrose 75 gm , lancet with guard 100 piece , niddle 26 g 100 piece , niddle 23 g 100 piece , draining rack , measuring cylinder 100 ml , measuring cylinder 200 ml , slide staining rack 1 piece , nicrome loop 1 piece , pt vial for pt inr 100 piece , plastic gown ( disposable ) 1 piece , plastic gown ( washable ) 1 piece...

National Institute Of Ayurveda - Rajasthan

33078537 tender for supply of laboratory chemicals for rrdr project tender for supply of laboratory chemicals for rrdr project , 1 naphthol ( gr ) ( merck ) 100 gm , acetic acid glacil ( gr ) ( merck ) 500 ml , acetone ( ar ) ( merck ) 2.5 ltr , ammonia solution 25% ( gr ) ( merck ) 2.5 ltr , benedicts reagent ( qc ) ( merck ) 500 ml , buffer capsules ph 4.00±0.05 10 ( std. ) ( merck ) 10 tb , buffer capsules ph 7.00±0.05 10 ( std. ) ( merck ) 10 tb , chloroform ( gr ) ( merck ) 2.5 ltr , copper sulfate ( gr ) ( merck ) 500 gm , cyclohexane ( gr ) ( merck ) 2.5 ltr , dextrose ( gr ) ( merck ) 500 gm , diethyl ether ( gr ) ( merck ) 500 ml , ethyl acetate ( gr ) ( merck ) 2.5 ltr , fast green ( merck ) 5 gm , fehlings solution a ( merck ) 500 ml , fehlings solution b ( merck ) 500 ml , ferric chlorideanhydrous emplura ( merck ) 500 gm , formic acid 100% ( gr ) ( merck ) 500 ml , hydrochloric acid ( 37% ) ( gr ) ( merck ) 2.5 ltr , hydrogen peroxide 30% ( gr ) ( merck ) 500 ml , iodine resublimed ( gr ) ( merck ) 100 gm , lead acetate trihydrate ( gr ) ( merck ) 500 gm , mercuric chloride ( gr ) ( merck ) 100 gm , methanol ( gr ) ( merck ) 2.5 ltr , methyl red ( merck ) 25 gm , methylene blue alk. lofflers ( merck ) 125 ml , ninhydrin ( gr ) ( merck ) 25 gm , nitric acid ( 69% ) ( gr ) ( merck ) 500 ml , perchloric acid ( 60% ) ( gr ) ( merck ) 500 ml , phenol ( gr ) ( merck ) 500 gm , phenolphthalein ( merck ) 50 gm , phloroglucinol ( gr ) ( merck ) 25 gm , polyethylene glycol ( merck ) 500 ml , potassium chlorate ( merck ) 500 gm , potassium dichromate ( acs ) ( merck ) 500 gm , potassium iodide ( ar ) ( merck ) 500 gm , potassium permanganate ( gr ) ( merck ) 500 gm , pyridine solution ( gr ) ( merck ) 500 ml , rochelle salt ( gr ) ( merck ) 500 gm , ruthenium red 99% ( merck ) 250 mg , sodium bic ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium c ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium chloride ( gr ) ( merck ) 500 gm , sodium diethyldithioc ( ar ) bamate ( gr ) ( merck ) 100 gm , sodium hydroxide ( gr ) ( merck ) 500 gm , sodium phospate monobasic ( merck ) 500 gm , sodium phosphate dibasic ( merck ) 500 gm , sodium sulfate ( gr ) ( merck ) 500 gm , sodium thiosulfate ( gr ) ( merck ) 500 gm , st ( ar ) ch ( gr ) ( merck ) 500 gm , sudan red 3 ( 85% ) ( merck ) 25 gm , sulfuric acid ( gr ) ( merck ) 500 ml , terti ( ar ) y butyl alcohol ( ar ) ( merck ) 500 ml , tetramethylammonium hydroxide ( merck ) 250 ml , thioglycollic acid ( 80% ) ( merck ) 500 ml , toluene ( gr ) ( merck ) 2.5 ltr , trichloroacetic acid ( merck ) 500 gm , zinc acetate ( ar ) ( merck ) 500 gm , aluminium chloride ( ar ) ( cdh ) 250 gm , amberlite ira 400 exchange resin ( cdh ) 500 gm , ammonium oxalate ( ar ) ( cdh ) 500 gm , ammonium sulphate ( ar ) ( cdh ) 500 ml , ( ar ) senic solution std. ( cdh ) 100 ml , benzene ( ar ) ( cdh ) 2.5 ltr , blue tetrazolium ( ar ) ( cdh ) 1 gm , bromine water ( ar ) ( cdh ) 100 ml , camphor 95% std. ( cdh ) 100 gm , canada balsam ( synthetic ) ( cdh ) 500 ml , c ( ar ) bon tetrachloride 99.5% ( ar ) ( cdh ) 500 ml , citric acid ( ar ) ( cdh ) 500 gm , diphenylthioc ( ar ) bazone ( ar ) ( cdh ) 25 gm , dpx ( cdh ) 250 ml , eosin ( cdh ) 125 ml , ethanol 99% ( cdh ) 5 ltr , folin ciocalteus phenol reagent ( cdh ) 100 ml , formaldehyde ( ar ) ( cdh ) 2.5 ltr , gelatin ( cdh ) 500 gm , glycerin ( ar ) ( cdh ) 2.5ltr , glucose ( cdh ) 500 gm , hydroxylamine hydrochloride ( ar ) ( cdh ) 100 gm , indigo c ( ar ) mine ( ar ) ( cdh ) 25 gm , lead solution stand ( ar ) d ( cdh ) 100 ml , magnesium metal ( cdh ) 500 gm , mercuric nitrate ( ar ) ( cdh ) 100 gm , millons’ reagent ( cdh ) 500 ml , n hexane ( er ) ( cdh ) 2.5 ltr , p anisaldehyde ( cdh ) 250 ml , p ( ar ) affin wax ( cdh ) 2 kg , petroleum ether ( ar ) ( cdh ) 2.5 ltr , phenol red ( ar ) ( cdh ) 5 gm , phosphomolybdic acid ( cdh ) 25 gm , picric acid ( ar ) ( cdh ) 500 gm , potassium hydroxide ( ar ) ( cdh ) 500 gm , potassium mercuri iodide ( ar ) ( cdh ) 100 gm , safranine 90% ( cdh ) 25 gm , sodium ( ar ) senate ( ar ) ( cdh ) 250 gm , sucrose ( ar ) ( cdh ) 500 gm , thymol blue ( cdh ) 125 ml , vanillin ( ar ) ( cdh ) 100 gm , xylene ( ar ) ( cdh ) 500 ml , zinc metal ( ar ) ( cdh ) 500 gm , chloral hydrate ( ar / lr ) ( reidel ) 500 gm...

Indian Army - Rajasthan

33027012 supply of consumables and expendable medical stores supply of consumables and expendable medical stores , 1.6 dihydroxy, 2 5 dioxahexane 11.2 g, glutaradahyde 5.0 g, benzaconium chloride 5.0 gm ( bott of 500 ml ) , ab gel ( gelatin sponge ) , abdominal binder large , abdominal binder medium , abdominal drain size22 fr , abdominal drain size26 fr , abdominal drain size30 fr , abg calibration gas bottle , abg cassette ( pkt of 25 ) , absolute alchohol bott of 500ml ) , acarbose 25 mg tab , accucheck active glucostrips bott of 50 , acetazolamide 250 mg tab , acetone ( 500 ml ) , actime ( 6x5 ml ) , acyclovir skin5% oint , adhesive tape 10 cm , adrenaline tartrate ( 1:1000 ) , 1 ml inj , afb kit ( ready to use ) , alendronate sodium70 mg tab , alkaline phospate test kit ( 5 x 20ml ) , allopurinol 100 mg tab , amisulpride 200 mg tab , amlodipine5 mg + losartan 50 mg tab , amlodipine besylate 10 mg tab , amlodipine besylate 2.5 mg tab , ammonium alum , amytriptilline 10 mg tab , analgesic spray , antacid gel each 5ml containing dried aluminium hyroxide gel ip 250mg, magn esium hydroxide nf 250mg and methyl polysiloxane 50mg bott of 200 ml syp , anti phlebitis cream tube of 15g / 20g oint , anti d ( rho ) immunoglobulin ( monoclonal ) 300 mcg inj , antispasmodic cap containing dicyclomine hcl 10mg, dextroprop oxyphen hcl 65mg acetaminophen ip 400mg , antispasmodic drop bott of 15ml , apixaban 2.5 mg tab , aso titre estimation kit ( kit of 50 test ) , atenolol 50mg + amlodipine 5 mg tab , atropine0.6 mg / ml, 1 ml amp inj , azithromycin syp bott of 15 ml , b 12, 500 mcg / ml inj , bacillus ciausli 2 billion spores / 5ml , baclofen 10 mg tab , bandage `t` shaped , bandage triangular , beclomethasone + phenylpherine + lignocaine tube of 20 gm ( no pile ) oint , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcgper m , beclomethasonedipropionate nasal apray50 mcgperdose metereddose150 units , benzocaine 20%, pecatin based , oral ointment tube of 5 gm , benzoyl peroxide 2.5% tube of 20 gm , betahistine sustained release 24 mg tab , betamethasone 4mg 1ml inj , bilirubin total and direct estimation test kit ( 4x60 ) ml , biphasic isophane insulin 30 / 70 vial of 10 ml inj , bisacodyl tab 5 mg ( perpn:tab ) , bisoprolol 2.5 mg tab , blood glucose test kit ( 2 x 200ml ) , bone wax , bromocriptine 2.5 mg tab , budesonide 200 mcg + formetrol 6mcg autohaler inhelar , bupivacaine 0.5% 20ml vial inj , bupivacaine heavy 0.5% 4 ml amp inj , buspirone hcl 10 mg tab , c reactive protein , caffeine 20 mg / 1ml1ml inj , calcium chloride ( 10x10 ) , calcium gluconate 10% in 10 ml amp inj , carbidopa 25mg+levodopa 100mg tab , carbolic acid 400 gm bott ( phenol ) , carboxy methyl cellulose 1% eye drop bott of 5 ml eye drop , carvedilol 6.25 mg tab , chest drainage size26 fr , chest drainage size30 fr , chloramphenicol5% w / vclotrimazole 1% w / vbetamethasone 0.25 % w / vlignocaine hcl 2%w / vin bott of 5 ml ear drop , chlordiaxapoxide 10 mg tab , chloroform ar ( analytical grade ) 500ml bottle , chloroquine phosphate ( containing 50 gm base per 5 ml ) bottle syrup , chloroquine phosphate 250 mg tab , chloroxylenol, terpineol & absolute alcohol liquid jar of 5 ltr , chlorzoxazone 500mg+ diclofen sodium 50 mg+ paracetamol 325 mg tab , cholesterol estimation test kit ( 5x20 ml ) , cilnidipine 5 mg tab , ciprofloxacin +dexamethasone eye / ear drop , ciprofloxacin 200 mg / 100 ml inj , ciprofloxacin ear drop , ck ( 2x80ml ) ( 2x2ml ) , ck mb kit , clarithromycin 500 mg inj , clindamycin 100mg+clotrimazole 100mg vaginal pessary , clobetasol propionate cream + gentaycin +miconazole tube of 20 gm oint , clomipramine hcl 25 mg tab , clonazepam 0.5 mg tab , clonazepam 2 mg tab , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , condom catheter , conjugated estrogen 0.625 mg ( premarin ) tab , control ddimer n+p 5x1 ml , 5x1ml , corn cap pkt of 4 , cover slips ( 22x40mm ) ( 20 pkt of 10gm each ) , cover slips ( 22x50mm ) ( 20 pkt of 10gm each ) , covid 19 rapid antigen point of care test with sample collection swab individually packed ( kit of 25 tests ) , cream luliconazole, tube of 15gm , creem silver sulphadiazine 1% ( sterilic ) tube of 25 g , cremaffin white each 15 ml containing milk of magnesia 11.25 ml, liq paraffin 3.75ml bottle of 170 ml , csf protein , cyclopentolate hcl 1% opth soln bottle of 5 ml , cyclophosphamide 50 mg tab , cyproheptadine 4 mg tab , d dimer r, 1x7 ml , daflon 500 mg tab , dapagliflozin 10 mg , ddimer calibrator 1x1 ml , deflazacort 6mg, tab , dengue ( ns1, igg & igm ) , dental needle 25 , dental needle 26 , dental syringe , desonide lotion0.05% bott of 30 ml , desvenalafaxine 50 mg tab , dexamethasone 0.5 mg tab , dexmedetomidine 100 mcg / ml, 1 ml amp inj , diclofenac patch , diclofenac sodium suppository 100 mg , digoxin 0.25 mg tab , digoxin 0.5 mg, 2 ml inj , dilator trachea with spring 12.5 cm long ss , diltiazem 5mg / ml inj , dinoprostone gel 0.5 mg ( in 3 gm / 2.5 ml ) , dinoprostone vaginal insert , disodium citrate syp ( bott of 100ml ) , disposable blade for microtom ( ( high profile ) , disposable drapes sheet , disposable embedding plastic ring ( pack of 100 ) large size , disposable embedding plastic ring ( pack of 100 ) medium size , disposable embedding plastic ring ( pack of 100 ) small size , disposable port 10mm , disposable port 5mm , disposable port 7mm for laparoscopic surgery , disposable sterile ot pack , disposal esr westerngreen tube , divalproate sodium 500mg tab , dopamine hcl40 mg / ml, 5ml inj , doxepin 25 mg cap , doxepin hcl 75 mg cap , doxycyclline 100 mg tab , drotaverine hcl 1%, 20 mg / ml, 2 ml inj , drotaverine hcl 80 mg tab , duloxetine 20 mg tab , duolin 2.5 ml respule , dura protector , ear bud bott of 100 , ear wick , ecosprin 150 mg tab , entecavir 0.5 mg tab , ergotamine 1 m+caffine 100 mg +paracetamol 250 mg and prochlorpramazine 25 mg tab , erythropoitein 2000 iu epo inj , estrogen cream , ethamsylate 250 mg, tab , ether solvent 500 ml , ethinyal estradiol+drosperinone tab , ethinyl estradiol 0.035 mg, cyproterone acetate 2 mg ( pack of 21 or 28 t , etoricoxib 120 mg tab , etrocoxib 60 mg tab , ett flexometallic size 4.0 , ett flexometallic size 4.5 , ett flexometallic size 5.0 , ett flexometallic size 5.5 , ett flexometallic size 6.0 , ett flexometallic size 6.5 , ett flexometallic size 7.5 , ett flexometallic size 8.0 , ett flexometallic size 8.5 , ett flexometallic size7.0 , eye drop moxifloxacin 0.5% , eye drop moxifloxacin 0.5% +prednisolone acetate 1% , eye drop nepafenac suspension 0.1% , eye drop olopatadine 0.1% bott of 5ml , eye drop tobramycin 0.3% + flouromethalone acetate 1% bak 0.01% 5ml , eye drops dorzolamide 2% , eye ointment moxifloxacian 0.5% , fallopian rings ( pkt of 200 ) , febuxostat 40 mg tab , fexofenadine hydrochloride tab 120 mg , fluconazole 150 mg + azithromycin 1 gm + secnidazole 1 gm tab , fluconazole infusion inj 2 mg / ml 100 ml bottle , fluoromethalone 0.1% eye drop bott of 5 ml , fluoxetine hcl 20 mg cap , flurbiprofen sodiumophthalmic solution0.03%vial of 5 ml , fluvoxamine 50 mg cap , foleys balloon catherer, silicon, size fr 8 , framycetin sulphate 1% cream, tube of 100 gms , fsh 75 iu inj , g6pd test kit ( pack of 10 test ) , gauze surgical, open wove, unmedicated: 60 cm wide , glass cuvette for pt , glossy paper for colposcopy machine , glucosamine 250mg+ chondroitin sulphate 200 mg cap , glucose powder ( dextrose monohydrate for oral use in pack of 100 gm ) , glucose strip one touch strips ( suger check advance ) , gluteraldehyde ( 2% ) 5 ltr bott , glycerin bott of 200 ml , grommet , haematinic tab / cap containing ferrous fumarate, vit b 12 , folic acidan ( autrin ) , haemorrhoidal rings ( pkt of 25 ) , haloperidol 5 mg inj , haloperidol 5 mg tab , haloperidol dispersible 10 mg tab , hbs ag elisa kit of 96 test , hbsag rapid kit of 50 test , hcv elisa kit of 96 test , hcv rapid kit of 50 test , hepattitis b vaccine ( adult dose 10 ml ) , hiv elisa kit of 96 test ( 4 th generation ) , hiv rapid kit of 50 test , homatropine hydrochloride, sol 2% , hpv 9 vaccine inj , human chorionic gonadotrophin 2000 iu inj , human chorionic gonadotrophin 5000 iu inj , human rabies immunoglobulin 2 ml ( 300 iu ) , hydrochlorothiazide 25 mg , hydroxyprogestrone caporate 500 mg / 2 ml inj , hydroxyprophyl methylcellulose usp 2% w / v ( max visc ) for intra ocular use , hydroxyprophyl methylcellulose ( hypermellous ) solution uspeye drop , i gel size 1.0 , i gel size 1.5 , i gel size 2.0 , i gel size 2.5 , i gel size 4.0 , i gel size 5.0 , ibuprofen + paracetamol bott of 60 ml syp , imipramine 25 mg tab , indicator soda lime , indomethacin 75 mg sr tab , inj isoxsuprine hydrochloride 10mg amp of 2ml , inj ketamine hcl 50 mg / ml vial of 2 ml , inj metoclopramide hcl ( 5mg / ml ) inj amp of 2 ml. , inj morphine 15 mgin 1 ml amp , inj pheniramine maleate 22.75 mg per ml amp of 2ml ( avil ) , inj phenobarbitone sodium 200 mg in ampoule of 1ml , inj propofol 1% n or 10mg / ml, 20 ml vial / amp , inj succinylcholine cholride 50mg / ml vial of 2 ml , inj thiopentone ampoule of 0.5g without water for injection , inj vasopressin 20 units / ml ( perpn: inj ) , inj verapamil 5mg, 2ml inj , inj.glycopyrrolate 0.2 mg / ml ampl of 1 ml , inj.metoprolol1mg / ml amp of 5 ml. , inj.multi vitamin iv infusion amp of 10ml , inj.vecuronium bromide 4mg / ml amp of 1 ml. , insulin lispro 100 iu / ml 3 ml inj , introducer for gigle wire , iohexol 50 ml inj , ipratropium bromide respiratory solution 250 mcg / ml vial of 15 ml , iron drops paediatric containing ferrous fumerate 25mg / ml. vit b 12 12. , iron sucrose 20 mg / 5 ml inj , isetrol level 1, 2, 3 ( 3x10x1.0 ml ) , isonized300 mg tab , isotretinion 20 mg tab , ketoconazole shampoo bott of 75 ml , kit estimation ofproteinkit ( 8x50 ml ) , kit estimation of micro protein , kit estimation of triglyceride test kit ( 5 x 20ml ) , kit for estimation of albumin ( 5x 10ml liquixx ) , kit for estimation of amylase ( 12x5 ml ) , kit for estimation of creatinine ( 4x50 ml ) , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12x5 ml ) , kit for estimation of ldh ( 12x5 ml ) , kit for estimation of sgot ( 4 x 24ml ) ( liquixx ) , kit for estimation of sgpt ( 4 x 24ml ) ( liquixx ) , kit for estimation of urea ( kinetic method ) , kit for estimation of uric acid ( 5x 10ml liquixx ) , kit lipase , kit occult blood , kits for estimation of albumin , labetalol hcl 100mg tab , labetalol hcl 4 ml amp inj , lactocalamine lotion bott of 120 ml , lamotrigine 25 mg tab , lamotrigine 50 mg tab , lancet sterile size 10 , laproscopic fallope ring applicator , laryngeal mask airway size 1.0 , laryngeal mask airway size 1.5 , laryngeal mask airway size 2.0 , laryngeal mask airway size 2.5 , laryngeal mask airway size 3.0 , laryngeal mask airway size 4.0 , laryngeal mask airway size 5.0 , lectin for sub groups sera a1 , leflunomide 10 mg tab , leflunomide 20mg tab , leishmans stain ready to use ( 500ml ) , letrazole 2.5 mg tab , leveteracetam 500 mg tab , levetiraceram ext release 500 mg tab , levo salbutamol 50 mcg + ipratropium 20 mcg metered dose inhaler, 200 dose units , levonorgestrel iu system , levosalbutamol aerosol inhalation pack of100 200 doses ( each metere , levosulpride 50 mg tab , lignocainehcl 2% with adrenaline ( 1:80000 ) inj vial of 30 ml , lignocaine 10% spray , lignocaine hci 2% ( without adrenaline ) 30ml inj ( suitable for ophthalmic use also ) , lignocaine hcl solution 2% for iv use, vial of 50 ml , lignocaine hydrochloride4% topical solution bottle of 30ml , lignocaine hydrochloride gel 0.2% 30gm , lignocaine with adrenaline dental catridge 1:80000 iu , lina retractor , linezolid infusion 200 mg to 300mg / 100 ml , lint absorbent, cotton , liquor formaldehyde 40% w / v , lopinavir 200mg + ritonavir 50mg tab , lorazepam 1 mg tab , lorazepam 2 mg / ml amp of 2 ml inj ( prepn:inj ) , magnesium sulphate 50% inj , may grunwald giemsa stain ( mgg stain ) ready to use , meclizine 25 mg tab , mefemenic acid 250 mg + dicyclomine 10 mg tab , mefenemic acid 500mg cap , memantine 10mg tab , mephentermine 30 mg / ml, 10 ml vial inj , merocel nasal pack with string 10 cm , merocel nasal pack with string 8 cm , mersilk non absorbable braided suture black no 1 cutting bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 1 round bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 1.0cutting bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 2.0cutting bodied 76 cm ( pkt of 12 nos , mersilk non absorbable braided suture black no 2.0round bodied 76 cm ( pkt of 12 foils ) , mesalamine suppository 500 mg , mesalmine 1.2 gm tab , metformin 1000 mg + glimipride 1 mg tab , metformin 500mg+ vildagliptin 50mg , methyl alcohol bott of 500 ml , methylergometrine maleate 0.2mg, 1 ml inj , methylprednisolone 16mg, tab , metoprolol tartarate 25mg xl tab. , metronidazole inj for iv usel containning 500mg per bott of 100mll , miconazole nitrate 2% creamskin tube of 15 gm , micro tips 1000 ul , micro tips 10 200 ul , microlyte cal a ( 280 ml ) , microlyte cal b ( 280 ml ) , microlyte deproteinizer , micropore size 10cm , micropore size 6.0cm , microscope focus lens 300 mm ( labomed ) , microscope focus lens 400 mm ( labomed ) , midazolam 1 mg / ml 10 ml vial inj , mifepristone 200 mcg+ misoprostal 200 mcg ( combikit ) tab , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0cutting bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 3.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 4.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglycaprone 25, undyed ) no 4.0cutting bodied 70 cm ( pkt of 12 foils ) , mouth ulcer gel tube of 10 gm , moxifloxacin 0.5 % w / v ear drop , multistix of 10 parameters ( dekhaphan laura ) 100 strips , multivitamin bott of 200 ml syp , n acetylcystene 200 mg / ml amp of 2 ml inj , n acetylcystine 600 mg tab , nasal spray buffered hypertonic saline spray 100ml , nasal spray buffered isotonic solution 135ml , nasal spray mometasonefuroate 0.05%benzalkonium chloride 100 metered dose nasal spray , nasal spray oxymetazoline hydrochloride 0.05%, benzalkonium chloride 0.01% 10 ml , nasal spray oxymetazoline hydrochloride 0.1%, benzalkonium chloride 0.01% 10 ml , nasal spray solspry saline 100 ml / 100gm per 100 metered dose , nasal spray xylometazoline 0.14 mg / 0.14 ml preservative free , natamycin 5% eye drop , nitrocontine 2.6 mg tab , nitrofurantion 100 mg tab , nitroglycerine 2.6mg tab , nitroglycerine 5 mg / ml, 5 ml inj , nor ethisterone 5 mg tab , normal saline nasal drops 20ml, sodium chloride 0.65% , oral solution sodium valporoate 200 mg / 5ml bottle of 100 ml. , oxcarbazepine 150 mg tab , oxytocin 5 units per 1.0ml amp inj , pantoprazole 40mg+ domeperidone 20mg tab , paracetamol 10 mg / ml infusion in 100 ml bottle , paracetamol 150 mg / ml amp of 2 ml iv inj , paracetamol 650 mg tab , paradichlorobenzene, benzocaine, chlorbutol&terpentine oil ear drops 10ml , paraffin wax ( 56 degree c ) , paraformaldehyde tab , pds no 1 round body heavy , pentoxyphyllin400 mg tab , petri disk disposable ( pack of 100 dick ) , pheniramine maleate of 25 mg tab , phenobarbitone 20 mg / 5ml bott of 60 ml syp , phenobarbitone 30 mgtab , phenytoin sodium vial of 100 mg ( sodium dilentin ) inj , piroxicam tab 20mg , pointed needle , poly ethelyne glycol 400 nf 0.4% propyline glycol 0.3%, sorbitol, hp guar, borate, polyquqad 0.001% 10 ml eye drop , potassium chloride 15% inj ( intravenous ) ampoule of 10ml ( 1.5g ) , povidone iodine 2% gargles bottle 100ml , pregabalin 75mg cap , pregablin 75 mg+ methylcobalamine 1500 mcg tab , primapore size20cmx10cm , primapore size25cmx10cm , primapore size 15cmx8cm , primapore size 8.3cmx6cm , printer roll ( sysmex ) 57mm x 20mtr , prochlorperazine maleate 5 mg tab , prolene non absorbable suture ( monofilament polypropylene blue ) no 1 cutting bodied 70 cm ( pkt of 12 foils ) , prolene non absorbable suture ( monofilament polypropylene blue ) no 1 round bodied 70 cm , promethazine syp 5mg / 5ml bott of 6 ml , promethazine+pholcodine bott of 60 ml , proparcaiane 0.5% eye drop , prothrombin test kit ( 1x5 ml ) ( isi value 1.0 ) , protime ls 50 ( 10x5 ml ) , pttk test kit , pyrazinamide 1500 mg tab ( perpn:tab ) , quinine dihydrochloride 300mg / ml, 2 ml inj , ra factor test , rabies immunoglobulin 300 iuinj , rabies vaccine rabipur 1 ml inj , rabiprazole +levosulpridetab , raney clip applicator with clips , rapid test for malaria pan / pf antigen ( 50test kit ) , rasagaline 0.5 mg , redivac suction drain size 12 fr , ribbon gauze , rifampicin 150 mg cap , rifampicin 600 mg + inh 300 mg tab , rifaximin 550 mg tab , roller bandage 6cm , roller bandage10cm , rosuvastatin 20 mg tab , rotacaps formetrol6 mcg+budesonide 200 mcg bott of 30 , salbutamol sulphate respirator solution 5 mg / ml, vial 0f 10 ml , salmetrol + fluticasone 250 mdi inhaler , saw gigle wire for bur hole , serratiopeptidase 5mg tab , serum anti d igg , serum anti d igm , serum anti h , serum anti haemoglobuline , serum anti haemoglobuline gp a , serum anti haemoglobuline gp ab , serum anti haemoglobuline gp b , silk non absorbable braided suture 06 reelx 25mtr size no 1 , silodosin 8 mg tab , sinus pack 3.5mm with string , sodium bicarbonate 7.5% solution ampoule of 10ml inj , sodium chloride eye drops 5% 5ml bottle , sodium cromoglycate eye drops 2% bottle of 5 ml. , spironolactone 25 mg tab , strips `albumin` and glucose bottle of 100 strips , sulphamethoxazole 200mg and trimethoprim 40 mg per 5ml bott. of 50m , sumatriptan 50 mg tab , suspension pyrantel pamoate 250 mg / 5 ml. , syp oesteocalcium , syp zinc 20 mg / 5ml, bottle of 100 ml , syrup terbutaline sulphate 1.25 mg + bromhexine hcll 4 mg + guaiphh , sysmex xp cell clean , sysmex xp 100eightcheck trilevel3 wp ( lxnxh ) 3x1.5ml , sysmex xp 100 dil 20ltr , sysmex xp 100 stromatolyser wh 3x500ml , tab colchicine 0.5 mg , tab dehydrogestron 10 mg , tab methimazole 10 mg , tab methotrexate 5mg , tab methyldopa tab 250 mg , tab primaquine ( 7.5 mg base ) , tab promethazinehcl 25 mg , tab septran ds , tab sertraline 50mg , tab sodium valporoate 200 mg , tab thyroxin sodium 75 mcg , tab triamterene ip 50 mg and benzthiazide nfc ( us ) 25 mg , tab venlafaxine 37.5 mg , tab.propranolol hcl 40 mg , tab.pyrazinamide 0.5 gm , tab.trihexyphenidyl hcl 2 mg , tacrolimus 0.03% to 0.1% ( w / w cream 10g ) , cream , tamoxifen citrate 20 mg tab , telmesartan 20mg tab , telmisartan 40 mg + hydrochlorthiazide 6.25 mg tab , tennis elbow support , terbinafine 1% cream tube of 10 gm , terbinafine hcl tab of 250gm , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses , ticagrelor 90 mg tab , tissue paper roll , trache dresssing , trache hold , tracheostomy tube double lumen size 8.5 id , tracheostomy tube double lumen size 9.0 id , tracheostomy tube single lumen size 2.5 id , tracheostomy tube single lumen size 3.0 id , tracheostomy tube single lumen size 3.5 id , tracheostomy tube single lumen size 4.0 id , tracheostomy tube single lumen size 4.5 id , tracheostomy tube single lumen size 5.0 id , tracheostomy tube single lumen size 5.5 id , tracheostomy tube single lumen size 6.0 id , tracheostomy tube single lumen size 6.5 id , tracheostomy tube single lumen size 7.0 id , tracheostomy tube single lumen size 7.5 id , tracheostomy tube single lumen size 8.0 id , tracheostomy tube single lumen size 8.5 id , tracheostomy tube single lumen size 9.0 id , tramadol hcl 50 mg cap / tab ( prepn:cap ) , tropicamide 1% with 5% phenylephrine eye drop bott of 5 ml , trypsin chymotrypsin tab , tube test, 12 x 75 mm rimless , tube, test, 100 mm x 12 mm, rimless , typhi igg & igm card , typhoid vaccine injectable , urine collecting bag with volume meter , urine strips glucose+ketone bodies bott of 100 strips , ursodexycholic acid udca tab 150 mg , vdrl syphill’s rapid kit of 50 , vildagliptin 50 mg tab , vitamin d3 oral drops 800 iu bott of 30 ml , vitamin e 400mg cap , walking aid monopod assist , whatmen filter paper ( round ) , widal test kit ( 4x5ml ) , woundclot surgical ( wc s 44 c ) 10x10 cm / 4*4 inch , woundclot trauma ( wc jsr 820 ) 8x20 cm / 3.2*8 inch , xylene ( xyol pure ) bott of 500 ml , xylometazoline hcl 0.05% w / v nosal solution for paed use bottle of 10 , zidovudine 300mg+ lamivudine 150mg tab , zidovudine tab 300 mg...

Department of School Education - Rajasthan

32996706 bids are invited for acetone , biurate reagent , ammonia solution , n butanol , di ethyl ether , glycerol , molish reagent , methylene blue , xylene , lens cleaning , formaldehyde , hydrogen per oxide , slide , cover slip , cover slips , dropper , beaker , specimen bottle , lancet , lancet pen , aluminum foil roll , capillary tubes , pricking needle , surgical cotton , rubbergloves , surgical mask , surgical gloves , polythene cover , neubaur chamber , sphygmomanometer , white tiles , brush , frog model , element , sponge , hydra , obelia , euglena , paramecium , virtual interactive dissectionsoftware , chart , chart , model total quantity : 677...

Government Medical College - Rajasthan

32938160 supply of lab reagents in bangur hospital pali for the year 2022 23 1 a.p.t.t 3ml j.mitra / arkery / transasia 2 a.s.o. latex with control 100 test aspen / arkery / tulip / expedia 3 absolute alcohol 500 ml ankem / biolab / b.d.h / c.d.h 4 acetotone test powder 100 gr. rankem / biolab / b.d.h / c.d.h 5 acid phosphate kit 8 ml accurex / erba / semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem / biolab / b.d.h / c.d.h 8 albert stain b 500 ml rankem / biolab / b.d.h / c.d.h 9 albumin kit 5x50 ml accurex / erba / semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex / erba / semens 12 amylase liquid stable 6x6 ml accurex / erba / semens 13 anti a monoclonal 10 ml tulip / arkery / ortho / j.mitra 14 anti a1 5 ml tulip / arkery / ortho / j.mitra 15 anti ab 10 ml tulip / arkery / ortho / j.mitra 16 anti b monoclonal 10 ml tulip / arkery / ortho / j.mitra 17 anti d igm monoclonal 10 ml tulip / arkery / ortho / j.mitra 18 anti d rhod igg igm polyclonal 10 ml tulip / arkery / ortho / j.mitra 19 anti h 5 ml tulip / arkery / ortho / j.mitra 20 anti human globin 10 ml tulip / arkery / ortho / j.mitra 21 aptt 3 ml j.mitra / arkery / transasia 22 aqua 4 water 1 ltr accurex / erba / semens 23 barium cloride 10 % 500 ml rankem / biolab / b.d.h / c.d.h 24 beaker glass 100 ml per pcs borosil 25 beaker glass 200 ml per pcs borosil 26 beaker glass 500 ml per pcs borosil 27 bile pigment rapid biolab / microexpree / titan 28 billrubin t&d 4x60 ml accurex / erba / semens / randox 29 bleaching powder 1 kg isi 30 blood bag quardipal sagam per pcs mitra / hll / panpol 31 blood bags 100 ml per pcs mitra / hll / panpol 32 blood bags 350 ml per pcs mitra / hll / panpol 33 blood bags triple sagam per pcs mitra / hll / panpol 34 blood bags weighing machine per pcsisi 35 blood lancet 100 pcs isi 36 bovin albumin 10% 10 ml tulip / arkery / ortho / j.mitra 37 c.k. mb kit 2x8 / 2x2 ml accurex / erba / semens / randox 38 c.k. nac kit 2x8 / 2x2 ml accurex / erba / semens / randox 39 c.r.p. latex with control 100 test arkery / aspen / accurex / expedia / tulip 40 c.r.p. turbilatex 50 ml accurex / erba / horiba 41 c.s.f. chloride 2x50 ml accurex / erba / semens 42 c.s.f. protin 2x50 ml accurex / erba / semens 43 calcium kit 2x50 ml accurex / erba / semens / randox 44 capilary tube 1x100 pcs top tech / merinfield / labtech 45 centifuse machine 16 tube ce certified per pcs remi / appendrop / isi 46 centifuse machine 32 tubece certified per pcs remi / eppendrof / isi 47 centifuse machine 8 tube cecertified per pcsremi / eppendorf / isi 48 chikanguniya elisa kit 96 test j.mitra / s.d. biosensor / novatech 49 chikguniya card igg / igm per card j.mitra / s.d. / meril 50 cholestrol kit 5x20 ml accurex / erba / semens / randox 51 combistix 100 st semens / erba / accurex 52 counting chamber per pcs top tech / merinfield / labtech 53 cover slip english glass 18 mm 200 gr bluestar / borosil / merinfield 54 cover slip english glass 22 mm 200 gr bluestar / borosil / merinfield 55 creatitine kit 4x60 ml accurex / erba / semens 56 cuppling jar per pcs polylab / abdos / labtech 57 deionized water 5 ltr ases / jupiter / vardhmaan 58 dengue duo ns1, igg, igm per card j.mitra / s.d. biosensor / meril 59 dengue elisa igg 96 test j.mitra / s.d. biosensor / meril 60 dengue elisa igm 96 test j.mitra / s.d. biosensor / meril 61 dengue elisa ns1 96 test j.mitra / s.d. biosensor / meril 62 dengue igg / igm rapid card per card j.mitra / s.d. biosensor / meril 63 dengue ns1 rapid card per card j.mitra / s.d. biosensor / meril 64 disposable e.s.r. pippeteper pcs lab tech / top tech / premier plus 65 disposable needle noa. 22 per pcs b.d. / dispovan / nipro 66 disposable syringe 2 cc per pcs b.d. / dispovan / nipro 67 disposable syringe 5 cc per pcs b.d. / dispovan / nipro 68 disposable syringe 10 cc per pcs b.d. / dispovan / nipro 69 distil water 5 ltr ases / jupiter / vardhmaan 70 drabkin solution 1 ltr ases / jupiter / vardhmaan 71 dry bath incubater per pcs isi 72 e.d.t.a. solution 500 ml rankem / biolab / b.d.h / c 73 e.s.r. felling vial per pcs rankem / biolab / b.d.h / c.d.h 74 e 10 stand per kit top tech / lab tech / premier plus 75 eosnophil counting fluid 100 ml rankem / biolab / b.d.h / c.d.h 76 ethnol 95%absolute 500 ml rankem / biolab / b.d.h / c.d.h 77 examination gloves 100 pcs hll / ttk / nulife 78 face mask 3 ply ( sigle pack ) per pcs nulife / mcare / romson 79 field stain a500 ml rankem / biolab / b.d.h / c.d.h 80 field stain b 500 ml rankem / biolab / b.d.h / c.d.h 81 filter paper 13.5 cm 100 leavs whatman / axiva / no1 82 formalline5 ltr rankem / biolab / b.d.h / c.d.h 83 fouchest reagents 125 ml rankem / biolab / b.d.h / c.d.h 84 giemsa stain 500 ml rankem / biolab / b.d.h / c.d.h 85 glucose kit 2x200 ml accurex / erba / semens 86 glass marking pencil ( 1 pcs. ) 87 grams stain kit 500 ml rankem / biolab / b.d.h / c.d.h 88 gulcosign strips per strips gulcosign 89 h.a.v. elisa igg 96 test c.t.k / meril / j.mitra / s.d. 90 h.a.v. igg card 96 test c.t.k / meril / j.mitra / s.d. 91 h.b. meter squre per pcs toptech / premierplus / merinfield 92 h.b. meter round per pcs 93 h.b. pipeete per pcs toptech / premierplus / merinfield 94 h.b. tube squre per pcs toptech / premierplus / merinfield 95 hb 301 micro cuvette per pcs. toptech / premierplus / merinfield 96 h.c.l. n / 10 solution 500 ml rankem / biolab / b.d.h / c.d.h 97 h.c.v. tri dot cardper cardit shouldbe 4th generation. it shouldbe based on flow through technolog it should must have a long shelf life & only in the form of card not in theform of strips.it shouldbe approved and evaluaed by nib .it shouldbe short interpretation time not more than 3 5 minutes.it should have specificity and sensitivity of 100%j.mitra 98 h.c.v.elisa 4 th gen96 test wells coated with synthetic peptide including ns3, ns4, ns5 and core sensitivity should be over 99.8% of whoand nib panels.specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity.should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. j.mitra / meril / g.b.c / erba / 99 h.e.v. elisa igm 96 test meril / j.mitra / s.d. 100 h.e.v. igm card per card meril / j.mitra / s.d. 101 h.i.v. tri dot + ag ( 4th generation ) per cardit should be 4th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / meril / s.d. biosensor 102 h.i.v. tri dot cardper cardit should be 3th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / s.d.biosensor / meril 103 h.i.v. rapid test per card it should be direct sandwitch assay 3rd gen & detection of igm, igg & iga antibodies it should have serum, plasma, whole blood it should be sensitivity >99.50% and specificity 99.00%.it should have sample volume 10ul serum / plasma or 20ul whole blood it should be long shelf life it should be who, nari, nib approved.s.d. biosensor / erba / meril / j.mitra / qualpro / 104 h.i.v.elisa 4th gen it should detect hiv 1, hiv 2, hiv o and antigen p24 simultaneously ( 4th gen ) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. should be compatible with automated as wellas manual elisa.one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel.tmb substrate should be stable ready.j.mitra / meril / erba / s.d. biosensor / g.b.c. tiwan 105 hbsag elisa kit 96 testwells coated with two or more monoclonal anti hbs ( murine and human origin ) .should detect all subtypes e.g. ad, ay, etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. 106 should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels.specificity should be over 99.8%.tmb substrate should be ready to use.must be evaluated and approved by nib.96 test j.mitra / meril / erba / s.d. biosensor / novatech 107 incubator 18x18x18 s.s. per pcs isi 108 j.s.b. 1st stain 500 ml rankem / biolab / b.d.h / c.d.h 109 j.s.b. iindstain 500 mlrankem / biolab / b.d.h / c.d.h 110 ketodiastix50 strips semens / erba / accurex 111 l.d.h. kit accurex / erba / semens / randox 112 lancets per pcs plaza / top tech / s.d. 113 leishmaan stain liqued 500 ml rankem / biolab / b.d.h / c.d.h 114 leishmaan stain powder 500 grrankem / biolab / b.d.h / c.d.h 115 lipase kitaccurex / erba / semens / randox 116 malaria pf / pv ag test per test it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) . infection / cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. j.mitra / s.d. bio sensor / meril / erba / 117 measuring cylinder 50 ml ( glass ) per pcs. 118 measuring cylinder 100 ml ( glass ) per pcs. 119 measuring cylinder 250 ml ( glass ) per pcs. 120 measuring cylinder 500 ml ( glass ) per pcs. 121 measuring cylinder 50 ml ( plastic ) per pcs. 122 measuring cylinder 100 ml ( plastic ) per pcs. 123 measuring cylinder 250 ml ( plastic ) per pcs. 124 methnol5 ltr rankem / biolab / b.d.h / c.d.h 125 methylene blue liquid 500 ml rankem / biolab / b.d.h / c.d.h 126 micro pipeete fix fully autoclavable with 3 years warrenty per pcs tranasia / finepipeete / thermo / durapet 127 micro pipeete variable fully autoclavable with 3 year warranty per pcs tranasia / finepipeete / thermo / durapet 128 micro protin kit accurex / erba / semens 129 micro tips up to 1000 ul 500 pcs gilson / labtech / a.v.dis 130 micro tips up to 200 ul 1000 pcs gilson / labtech / a.v.dis 131 microglass slide isi 50 slide bluestar / borosil / alphachem 132 microscope blub per pcs phillps / osram / bajaj / 133 multi chanal pipeete with 3 years warranty per pcs tranasia / finepipeete / tjermo / durapet 134 multi stix 14 parameter ( dekhaphen ) 100 st semens / transasia / accurex / durai / 135 n 95 mask per pcs romson / 3m / polymed / mrk / 136 nitral gloves 100 pcs romsom / m care / mrk / polymed 137 nitric adid 500 gr rankem / biolab / b.d.h / c.d.h 138 normal sline 500 ml rankem / biolab / b.d.h / c.d.h 139 o2 valve with humidifier per pcs isi 140 occult blood in stool 200 test tulip / accurex / biolab 141 oil immersion 100 ml rankem / biolab / b.d.h / c.d.h 142 ovan 18x18x18 s.s. per pcs isi / remi / 143 p.p.e kit per pcs drdo approved 144 pep stain per kit 145 paper roll 50x20 mtrper roll erba 146 paper roll 57x10 mtr per roll horiba 147 paper roll 57x20 mtr per roll erba 148 pasture pipeete per pcs lab tech / top tech / a.v. consumable 149 phosphrous kit accurex / erba / semens 150 pipeete stand per pcs plaza / top tech / expedia / labsystem 151 platlet diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 152 pregnancy card / hcg device per card acon / aspen / erba / diagnocure 153 r.a. test kit with control 100 test acurex / erba / spinreact / arkrey / biolab 154 r.b.c. diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 155 r.f. turbilatex 50 ml accurex / erba / human / arkrey / biolal 156 r.h. view box per pcs remi / plus / top tech / alpha 157 r.p.r. test 100 test tulip / erba / acurex / human / arkrey 158 rapid pap stain 250 simmer tulip / biolab / himedia 159 recticlusytes count fluid 100 ml rankem / biolab / b.d.h / c.d.h 160 ria tube 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 161 ria vial 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 162 room thermometer per pcs labtech / toptech / a.v. consumable / isi 163 s.g.o.t. kit 5x20 ml accurex / erba / semens / randox 164 s.g.p.t. kit 5x20 ml accurex / erba / semens / randox 165 sample cups from xl300 500 pcs erba / hitachi / top tech 166 screw cap tube 13x100 100 tube labtech / polylab / a.v. cons 167 scrub typhus elisa 96 test novatech / j.mitra / s.d.biosensor / g.b.c 168 seman diluting fluid 100 ml rankem / biolab / b.d.h / c.d.h 169 slide cage per pcs labtech / toptech / a.v.co / k.d 170 slide rack per pcs labtech / toptech / a.vcon / k.d 171 slide stand per pcs labtech / toptech / a.v.co / k.d 172 slide staning rack per pcs labtech / toptech / a.v. / k.d 173 sodium citrate 3.8% 500 ml rankem / biolab / b.d.h / c.d.h 174 sodium hypochloride 8 10 % 5 ltr rankem / biolab / b.d.h / c.d.h 175 stain rack per pcs labtech / toptech / a.v. / k.d 176 stethoscope per pcs litman / isi / 177 sulpher powder 500 gr rankem / biolab / b.d.h / c.d.h 178 surgical gloves 6, 7.5.7 pair m.r.k. / caltex / hll / 179 t.s.h. elisa 96 test j.mitra / erba / suyog / s.d. bio 180 t3 elisa96 test j.mitra / erba / suyog / 181 t4 elisa 96 test j.mitra / erba / suyog / 182 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 183 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 184 test tube brush per pcs labtech / toptech / a.v. / k.d 185 test tube stand 48 hole per pcs 186 test tube stand 96 hole per pcs 187 thermoplastin5 ml j.mitra / erba / arkery 188 timmer watch digital per pcs k.d. / top tech / amron / isi 189 tincher iodine 400 ml 190 tissue paper roll per roll 191 total protin kit 5x50 ml accurex / erba / semens / randox 192 triglycerdies kit 5x20 ml accurex / erba / semens / randox 193 tronicate rubber per pcs 194 troponine i per card alfa / j.mitra / accurex / diagnocure 195 troponine t per card roche 196 tsutsugamuchi card per card j.mitra / s.d. biosensor / athenesedx / 197 tray for slide ( aluminium ) per pcs. 198 typhoid card igg / igm per card j.mitra / diagnocure / s.d. biosensor / 199 urea bertlot kit 2x100 det accurex / erba / semens / randox 200 urea bun5x20 ml accurex / erba / semens 201 uric acid kit 5x20 ml accurex / erba / semens 202 urine continer 50 ml with sticker individually packed per pcs labtech / a.v / top tech 203 uristix glu / ketone / pro 100 st semens / accurex / erba / transasia 204 v.d.r.l. cardper card assay for qualitative detection of all isotype of antibodies ( igm, igg & iga ) against treponema pallidium.it should must have a long shelf life & only in the form of card not in the form of strips.rapid card test in individual pack.it should be nib, naco, nari approvedmeril / s.d. biosensor / accurex / diagnocure 205 v.d.r.l. shaker per pcs remi / penpol / oxford / top tech 206 vacutanier clot, gel activete 13x75 mm 3 to 5ml ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate 207 batch wise sterility , pyrogenicity and toxicity certificate should be givenit should be usfda / europen ce certified. b.d. / 208 vacutanier k2 edta 13x75 mm ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.b.d 209 vacutanier sodium citrate 13x75 mm ( 100 pcs ) for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalatebatch wise sterility , pyrogenicity and toxicity certificate should be givenit should be sfda / europen ce certified. b.d 210 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.per pcs b.d 211 viral transport media 50 vial icmr approved 212 w.b.c. fluid500 ml rankem / biolab / b.d.h / c.d.h 213 water bath per pcs remi / top tech / premier plus 214 widal kit 4x5 ml per kit arkery / becon / tulip 215 xylene 500 ml rankem / biolab / b.d.h / c.d.h 216 z.n. stain 4x50 ml rankem / biolab / b.d.h / c.d.h 217 covid ag card icmr approved test icmr approved 218 covid ab card icmr approved test icmr approved 219 covid elis igg icmr approved 96 test icmr approved 220 hand santizer500 ml icmr approved 221 hand santizer 5ltr icmr approved 222 automatic hand santizer machine pcs icmr approved 223 bandaid round pcs j&j / labtech / hll / mrk 224 cryocentrifuge machine ( 5500i ) blood bag bucket ( green colour ) per pc. 225 disposable needle noa. 26 & 24 per pcs b.d. / dispovan / nipro 226 micro tips stand ( small ) per pcs. 227 micro tips stand ( big ) per pcs. 228 micropopette 10 ul to 100 ulper pcs. tranasia / finepipeete / thermo / durapet 229 micropopette 100 ul to 1000 ulper pcs. tranasia / finepipeete / thermo / durapet 230 isopropyl alcohol solution 70% ( 500 ml ) per pcs. 231 gel card grouping per pcs.j. mitra / sd / bio / biorad 232 gel card cross matchper pcs.j. mitra / sd / bio / biorad 233 chest stand wall modelper pcs. 234 dental hangerper pcs. 235 x ray developer 13.5 ltrper pkt. 236 x ray fixer 13.5 ltr per pkt. 237 u.s.g. jelly 250 grper pcs. 238 e.c.g jelly 250 gr.per pcs. 239 e.c.g roll 8310m 210x20 ml per pcs. 240 eeg electrodeper pcs. 241 eeg pasteper pcs. 242 ecg battery digitalper pcs. 243 ecr battery for 108 tper pcs. 244 ecg beltper pcs. 245 ecg cable for digital per pcs. 246 ecg chest electrode per pcs. 247 ecg clip per pcs. 248 ecg roll for 108 tper pcs. 249 ecg roll for 6108 per pcs. 250 ecg rubber bulb per pcs. 251 ecg trolly per pcs. 252 glysrine 100 mlper bottle 253 lead aprinper pcs. 254 lead divider 7x17 per pcs. 255 tmt jelly 250 ml per pcs. 256 usg jelly 250 gr. per pcs. 257 usg printer roll per pcs. 258 usg tissue paper roll per pcs. 259 x ray cassetts 10x12per pcs. fuji / kodak / jindal 260 x ray cassetts 12x15per pcs. fuji / kodak / jindal 261 x ray cassetts 14x17per pcs. fuji / kodak / jindal 262 x ray cassetts 6.5x8.5 per pcs. fuji / kodak / jindal 263 x ray cassetts 8x10per pcs. fuji / kodak / jindal 264 x ray film 10x12 ( 150 films ) per pkt.fuji / kodak / jindal 265 x ray film 12x15 ( 150 films ) per pkt.fuji / kodak / jindal 266 x ray film 6.5x8.5 ( 150 films ) per pkt. fuji / kodak / jindal 267 x ray film 8x10 ( 150 films ) per pkt. fuji / kodak / jindal 268 x ray hanger 10x12 269 x ray hanger12x15 270 x ray hanger 14x17 271 x ray hanger 6.5x8.5 272 x ray hanger 8x10 273 x ray screen 10x12 fuji / kodak / jindal 274 x ray screen 12x15 fuji / kodak / jindal 275 x ray screen 14x17 fuji / kodak / jindal 276 x ray screen 6.5x8.5 fuji / kodak / jindal 277 x ray screen 8x10 fuji / kodak / jindal 278 ecg machine battery charger 279 x ray fixer 13.5 ltr. 280 tmt electrode 281 tmt report chart 282 x ray film dental 283 x ray film 14x17 284 8 x 10digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 285 10 x 12 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 286 11 x 14 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 287 14 x 17digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 288 dental & occlusal x ray films 57x76 mm fuji / kodak / jindal 289 imaging plate and cassettes ( c.r.system ) 08”x10” fuji / kodak / jindal 290 imaging plate and cassettes ( c.r.system ) 10”x12” fuji / kodak / jindal 291 imaging plate and cassettes ( c.r.system ) 14”x17” fuji / kodak / jindal 292 protactive screen ( mobile ) lead barriar with lead glass window...

Medical And Health Services - Rajasthan

32936627 supply of lab reagents in bangur hospital pali for the year 2022 23 1 a.p.t.t 3ml j.mitra / arkery / transasia 2 a.s.o. latex with control 100 test aspen / arkery / tulip / expedia 3 absolute alcohol 500 ml ankem / biolab / b.d.h / c.d.h 4 acetotone test powder 100 gr. rankem / biolab / b.d.h / c.d.h 5 acid phosphate kit 8 ml accurex / erba / semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem / biolab / b.d.h / c.d.h 8 albert stain b 500 ml rankem / biolab / b.d.h / c.d.h 9 albumin kit 5x50 ml accurex / erba / semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex / erba / semens 12 amylase liquid stable 6x6 ml accurex / erba / semens 13 anti a monoclonal 10 ml tulip / arkery / ortho / j.mitra 14 anti a1 5 ml tulip / arkery / ortho / j.mitra 15 anti ab 10 ml tulip / arkery / ortho / j.mitra 16 anti b monoclonal 10 ml tulip / arkery / ortho / j.mitra 17 anti d igm monoclonal 10 ml tulip / arkery / ortho / j.mitra 18 anti d rhod igg igm polyclonal 10 ml tulip / arkery / ortho / j.mitra 19 anti h 5 ml tulip / arkery / ortho / j.mitra 20 anti human globin 10 ml tulip / arkery / ortho / j.mitra 21 aptt 3 ml j.mitra / arkery / transasia 22 aqua 4 water 1 ltr accurex / erba / semens 23 barium cloride 10 % 500 ml rankem / biolab / b.d.h / c.d.h 24 beaker glass 100 ml per pcs borosil 25 beaker glass 200 ml per pcs borosil 26 beaker glass 500 ml per pcs borosil 27 bile pigment rapid biolab / microexpree / titan 28 billrubin t&d 4x60 ml accurex / erba / semens / randox 29 bleaching powder 1 kg isi 30 blood bag quardipal sagam per pcs mitra / hll / panpol 31 blood bags 100 ml per pcs mitra / hll / panpol 32 blood bags 350 ml per pcs mitra / hll / panpol 33 blood bags triple sagam per pcs mitra / hll / panpol 34 blood bags weighing machine per pcsisi 35 blood lancet 100 pcs isi 36 bovin albumin 10% 10 ml tulip / arkery / ortho / j.mitra 37 c.k. mb kit 2x8 / 2x2 ml accurex / erba / semens / randox 38 c.k. nac kit 2x8 / 2x2 ml accurex / erba / semens / randox 39 c.r.p. latex with control 100 test arkery / aspen / accurex / expedia / tulip 40 c.r.p. turbilatex 50 ml accurex / erba / horiba 41 c.s.f. chloride 2x50 ml accurex / erba / semens 42 c.s.f. protin 2x50 ml accurex / erba / semens 43 calcium kit 2x50 ml accurex / erba / semens / randox 44 capilary tube 1x100 pcs top tech / merinfield / labtech 45 centifuse machine 16 tube ce certified per pcs remi / appendrop / isi 46 centifuse machine 32 tubece certified per pcs remi / eppendrof / isi 47 centifuse machine 8 tube cecertified per pcsremi / eppendorf / isi 48 chikanguniya elisa kit 96 test j.mitra / s.d. biosensor / novatech 49 chikguniya card igg / igm per card j.mitra / s.d. / meril 50 cholestrol kit 5x20 ml accurex / erba / semens / randox 51 combistix 100 st semens / erba / accurex 52 counting chamber per pcs top tech / merinfield / labtech 53 cover slip english glass 18 mm 200 gr bluestar / borosil / merinfield 54 cover slip english glass 22 mm 200 gr bluestar / borosil / merinfield 55 creatitine kit 4x60 ml accurex / erba / semens 56 cuppling jar per pcs polylab / abdos / labtech 57 deionized water 5 ltr ases / jupiter / vardhmaan 58 dengue duo ns1, igg, igm per card j.mitra / s.d. biosensor / meril 59 dengue elisa igg 96 test j.mitra / s.d. biosensor / meril 60 dengue elisa igm 96 test j.mitra / s.d. biosensor / meril 61 dengue elisa ns1 96 test j.mitra / s.d. biosensor / meril 62 dengue igg / igm rapid card per card j.mitra / s.d. biosensor / meril 63 dengue ns1 rapid card per card j.mitra / s.d. biosensor / meril 64 disposable e.s.r. pippeteper pcs lab tech / top tech / premier plus 65 disposable needle noa. 22 per pcs b.d. / dispovan / nipro 66 disposable syringe 2 cc per pcs b.d. / dispovan / nipro 67 disposable syringe 5 cc per pcs b.d. / dispovan / nipro 68 disposable syringe 10 cc per pcs b.d. / dispovan / nipro 69 distil water 5 ltr ases / jupiter / vardhmaan 70 drabkin solution 1 ltr ases / jupiter / vardhmaan 71 dry bath incubater per pcs isi 72 e.d.t.a. solution 500 ml rankem / biolab / b.d.h / c 73 e.s.r. felling vial per pcs rankem / biolab / b.d.h / c.d.h 74 e 10 stand per kit top tech / lab tech / premier plus 75 eosnophil counting fluid 100 ml rankem / biolab / b.d.h / c.d.h 76 ethnol 95%absolute 500 ml rankem / biolab / b.d.h / c.d.h 77 examination gloves 100 pcs hll / ttk / nulife 78 face mask 3 ply ( sigle pack ) per pcs nulife / mcare / romson 79 field stain a500 ml rankem / biolab / b.d.h / c.d.h 80 field stain b 500 ml rankem / biolab / b.d.h / c.d.h 81 filter paper 13.5 cm 100 leavs whatman / axiva / no1 82 formalline5 ltr rankem / biolab / b.d.h / c.d.h 83 fouchest reagents 125 ml rankem / biolab / b.d.h / c.d.h 84 giemsa stain 500 ml rankem / biolab / b.d.h / c.d.h 85 glucose kit 2x200 ml accurex / erba / semens 86 glass marking pencil ( 1 pcs. ) 87 grams stain kit 500 ml rankem / biolab / b.d.h / c.d.h 88 gulcosign strips per strips gulcosign 89 h.a.v. elisa igg 96 test c.t.k / meril / j.mitra / s.d. 90 h.a.v. igg card 96 test c.t.k / meril / j.mitra / s.d. 91 h.b. meter squre per pcs toptech / premierplus / merinfield 92 h.b. meter round per pcs 93 h.b. pipeete per pcs toptech / premierplus / merinfield 94 h.b. tube squre per pcs toptech / premierplus / merinfield 95 hb 301 micro cuvette per pcs. toptech / premierplus / merinfield 96 h.c.l. n / 10 solution 500 ml rankem / biolab / b.d.h / c.d.h 97 h.c.v. tri dot cardper cardit shouldbe 4th generation. it shouldbe based on flow through technolog it should must have a long shelf life & only in the form of card not in theform of strips.it shouldbe approved and evaluaed by nib .it shouldbe short interpretation time not more than 3 5 minutes.it should have specificity and sensitivity of 100%j.mitra 98 h.c.v.elisa 4 th gen96 test wells coated with synthetic peptide including ns3, ns4, ns5 and core sensitivity should be over 99.8% of whoand nib panels.specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity.should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. j.mitra / meril / g.b.c / erba / 99 h.e.v. elisa igm 96 test meril / j.mitra / s.d. 100 h.e.v. igm card per card meril / j.mitra / s.d. 101 h.i.v. tri dot + ag ( 4th generation ) per cardit should be 4th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / meril / s.d. biosensor 102 h.i.v. tri dot cardper cardit should be 3th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / s.d.biosensor / meril 103 h.i.v. rapid test per card it should be direct sandwitch assay 3rd gen & detection of igm, igg & iga antibodies it should have serum, plasma, whole blood it should be sensitivity >99.50% and specificity 99.00%.it should have sample volume 10ul serum / plasma or 20ul whole blood it should be long shelf life it should be who, nari, nib approved.s.d. biosensor / erba / meril / j.mitra / qualpro / 104 h.i.v.elisa 4th gen it should detect hiv 1, hiv 2, hiv o and antigen p24 simultaneously ( 4th gen ) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. should be compatible with automated as wellas manual elisa.one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel.tmb substrate should be stable ready.j.mitra / meril / erba / s.d. biosensor / g.b.c. tiwan 105 hbsag elisa kit 96 testwells coated with two or more monoclonal anti hbs ( murine and human origin ) .should detect all subtypes e.g. ad, ay, etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. 106 should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels.specificity should be over 99.8%.tmb substrate should be ready to use.must be evaluated and approved by nib.96 test j.mitra / meril / erba / s.d. biosensor / novatech 107 incubator 18x18x18 s.s. per pcs isi 108 j.s.b. 1st stain 500 ml rankem / biolab / b.d.h / c.d.h 109 j.s.b. iindstain 500 mlrankem / biolab / b.d.h / c.d.h 110 ketodiastix50 strips semens / erba / accurex 111 l.d.h. kit accurex / erba / semens / randox 112 lancets per pcs plaza / top tech / s.d. 113 leishmaan stain liqued 500 ml rankem / biolab / b.d.h / c.d.h 114 leishmaan stain powder 500 grrankem / biolab / b.d.h / c.d.h 115 lipase kitaccurex / erba / semens / randox 116 malaria pf / pv ag test per test it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) . infection / cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. j.mitra / s.d. bio sensor / meril / erba / 117 measuring cylinder 50 ml ( glass ) per pcs. 118 measuring cylinder 100 ml ( glass ) per pcs. 119 measuring cylinder 250 ml ( glass ) per pcs. 120 measuring cylinder 500 ml ( glass ) per pcs. 121 measuring cylinder 50 ml ( plastic ) per pcs. 122 measuring cylinder 100 ml ( plastic ) per pcs. 123 measuring cylinder 250 ml ( plastic ) per pcs. 124 methnol5 ltr rankem / biolab / b.d.h / c.d.h 125 methylene blue liquid 500 ml rankem / biolab / b.d.h / c.d.h 126 micro pipeete fix fully autoclavable with 3 years warrenty per pcs tranasia / finepipeete / thermo / durapet 127 micro pipeete variable fully autoclavable with 3 year warranty per pcs tranasia / finepipeete / thermo / durapet 128 micro protin kit accurex / erba / semens 129 micro tips up to 1000 ul 500 pcs gilson / labtech / a.v.dis 130 micro tips up to 200 ul 1000 pcs gilson / labtech / a.v.dis 131 microglass slide isi 50 slide bluestar / borosil / alphachem 132 microscope blub per pcs phillps / osram / bajaj / 133 multi chanal pipeete with 3 years warranty per pcs tranasia / finepipeete / tjermo / durapet 134 multi stix 14 parameter ( dekhaphen ) 100 st semens / transasia / accurex / durai / 135 n 95 mask per pcs romson / 3m / polymed / mrk / 136 nitral gloves 100 pcs romsom / m care / mrk / polymed 137 nitric adid 500 gr rankem / biolab / b.d.h / c.d.h 138 normal sline 500 ml rankem / biolab / b.d.h / c.d.h 139 o2 valve with humidifier per pcs isi 140 occult blood in stool 200 test tulip / accurex / biolab 141 oil immersion 100 ml rankem / biolab / b.d.h / c.d.h 142 ovan 18x18x18 s.s. per pcs isi / remi / 143 p.p.e kit per pcs drdo approved 144 pep stain per kit 145 paper roll 50x20 mtrper roll erba 146 paper roll 57x10 mtr per roll horiba 147 paper roll 57x20 mtr per roll erba 148 pasture pipeete per pcs lab tech / top tech / a.v. consumable 149 phosphrous kit accurex / erba / semens 150 pipeete stand per pcs plaza / top tech / expedia / labsystem 151 platlet diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 152 pregnancy card / hcg device per card acon / aspen / erba / diagnocure 153 r.a. test kit with control 100 test acurex / erba / spinreact / arkrey / biolab 154 r.b.c. diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 155 r.f. turbilatex 50 ml accurex / erba / human / arkrey / biolal 156 r.h. view box per pcs remi / plus / top tech / alpha 157 r.p.r. test 100 test tulip / erba / acurex / human / arkrey 158 rapid pap stain 250 simmer tulip / biolab / himedia 159 recticlusytes count fluid 100 ml rankem / biolab / b.d.h / c.d.h 160 ria tube 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 161 ria vial 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 162 room thermometer per pcs labtech / toptech / a.v. consumable / isi 163 s.g.o.t. kit 5x20 ml accurex / erba / semens / randox 164 s.g.p.t. kit 5x20 ml accurex / erba / semens / randox 165 sample cups from xl300 500 pcs erba / hitachi / top tech 166 screw cap tube 13x100 100 tube labtech / polylab / a.v. cons 167 scrub typhus elisa 96 test novatech / j.mitra / s.d.biosensor / g.b.c 168 seman diluting fluid 100 ml rankem / biolab / b.d.h / c.d.h 169 slide cage per pcs labtech / toptech / a.v.co / k.d 170 slide rack per pcs labtech / toptech / a.vcon / k.d 171 slide stand per pcs labtech / toptech / a.v.co / k.d 172 slide staning rack per pcs labtech / toptech / a.v. / k.d 173 sodium citrate 3.8% 500 ml rankem / biolab / b.d.h / c.d.h 174 sodium hypochloride 8 10 % 5 ltr rankem / biolab / b.d.h / c.d.h 175 stain rack per pcs labtech / toptech / a.v. / k.d 176 stethoscope per pcs litman / isi / 177 sulpher powder 500 gr rankem / biolab / b.d.h / c.d.h 178 surgical gloves 6, 7.5.7 pair m.r.k. / caltex / hll / 179 t.s.h. elisa 96 test j.mitra / erba / suyog / s.d. bio 180 t3 elisa96 test j.mitra / erba / suyog / 181 t4 elisa 96 test j.mitra / erba / suyog / 182 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 183 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 184 test tube brush per pcs labtech / toptech / a.v. / k.d 185 test tube stand 48 hole per pcs 186 test tube stand 96 hole per pcs 187 thermoplastin5 ml j.mitra / erba / arkery 188 timmer watch digital per pcs k.d. / top tech / amron / isi 189 tincher iodine 400 ml 190 tissue paper roll per roll 191 total protin kit 5x50 ml accurex / erba / semens / randox 192 triglycerdies kit 5x20 ml accurex / erba / semens / randox 193 tronicate rubber per pcs 194 troponine i per card alfa / j.mitra / accurex / diagnocure 195 troponine t per card roche 196 tsutsugamuchi card per card j.mitra / s.d. biosensor / athenesedx / 197 tray for slide ( aluminium ) per pcs. 198 typhoid card igg / igm per card j.mitra / diagnocure / s.d. biosensor / 199 urea bertlot kit 2x100 det accurex / erba / semens / randox 200 urea bun5x20 ml accurex / erba / semens 201 uric acid kit 5x20 ml accurex / erba / semens 202 urine continer 50 ml with sticker individually packed per pcs labtech / a.v / top tech 203 uristix glu / ketone / pro 100 st semens / accurex / erba / transasia 204 v.d.r.l. cardper card assay for qualitative detection of all isotype of antibodies ( igm, igg & iga ) against treponema pallidium.it should must have a long shelf life & only in the form of card not in the form of strips.rapid card test in individual pack.it should be nib, naco, nari approvedmeril / s.d. biosensor / accurex / diagnocure 205 v.d.r.l. shaker per pcs remi / penpol / oxford / top tech 206 vacutanier clot, gel activete 13x75 mm 3 to 5ml ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate 207 batch wise sterility , pyrogenicity and toxicity certificate should be givenit should be usfda / europen ce certified. b.d. / 208 vacutanier k2 edta 13x75 mm ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.b.d 209 vacutanier sodium citrate 13x75 mm ( 100 pcs ) for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalatebatch wise sterility , pyrogenicity and toxicity certificate should be givenit should be sfda / europen ce certified. b.d 210 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.per pcs b.d 211 viral transport media 50 vial icmr approved 212 w.b.c. fluid500 ml rankem / biolab / b.d.h / c.d.h 213 water bath per pcs remi / top tech / premier plus 214 widal kit 4x5 ml per kit arkery / becon / tulip 215 xylene 500 ml rankem / biolab / b.d.h / c.d.h 216 z.n. stain 4x50 ml rankem / biolab / b.d.h / c.d.h 217 covid ag card icmr approved test icmr approved 218 covid ab card icmr approved test icmr approved 219 covid elis igg icmr approved 96 test icmr approved 220 hand santizer500 ml icmr approved 221 hand santizer 5ltr icmr approved 222 automatic hand santizer machine pcs icmr approved 223 bandaid round pcs j&j / labtech / hll / mrk 224 cryocentrifuge machine ( 5500i ) blood bag bucket ( green colour ) per pc. 225 disposable needle noa. 26 & 24 per pcs b.d. / dispovan / nipro 226 micro tips stand ( small ) per pcs. 227 micro tips stand ( big ) per pcs. 228 micropopette 10 ul to 100 ulper pcs. tranasia / finepipeete / thermo / durapet 229 micropopette 100 ul to 1000 ulper pcs. tranasia / finepipeete / thermo / durapet 230 isopropyl alcohol solution 70% ( 500 ml ) per pcs. 231 gel card grouping per pcs.j. mitra / sd / bio / biorad 232 gel card cross matchper pcs.j. mitra / sd / bio / biorad 233 chest stand wall modelper pcs. 234 dental hangerper pcs. 235 x ray developer 13.5 ltrper pkt. 236 x ray fixer 13.5 ltr per pkt. 237 u.s.g. jelly 250 grper pcs. 238 e.c.g jelly 250 gr.per pcs. 239 e.c.g roll 8310m 210x20 ml per pcs. 240 eeg electrodeper pcs. 241 eeg pasteper pcs. 242 ecg battery digitalper pcs. 243 ecr battery for 108 tper pcs. 244 ecg beltper pcs. 245 ecg cable for digital per pcs. 246 ecg chest electrode per pcs. 247 ecg clip per pcs. 248 ecg roll for 108 tper pcs. 249 ecg roll for 6108 per pcs. 250 ecg rubber bulb per pcs. 251 ecg trolly per pcs. 252 glysrine 100 mlper bottle 253 lead aprinper pcs. 254 lead divider 7x17 per pcs. 255 tmt jelly 250 ml per pcs. 256 usg jelly 250 gr. per pcs. 257 usg printer roll per pcs. 258 usg tissue paper roll per pcs. 259 x ray cassetts 10x12per pcs. fuji / kodak / jindal 260 x ray cassetts 12x15per pcs. fuji / kodak / jindal 261 x ray cassetts 14x17per pcs. fuji / kodak / jindal 262 x ray cassetts 6.5x8.5 per pcs. fuji / kodak / jindal 263 x ray cassetts 8x10per pcs. fuji / kodak / jindal 264 x ray film 10x12 ( 150 films ) per pkt.fuji / kodak / jindal 265 x ray film 12x15 ( 150 films ) per pkt.fuji / kodak / jindal 266 x ray film 6.5x8.5 ( 150 films ) per pkt. fuji / kodak / jindal 267 x ray film 8x10 ( 150 films ) per pkt. fuji / kodak / jindal 268 x ray hanger 10x12 269 x ray hanger12x15 270 x ray hanger 14x17 271 x ray hanger 6.5x8.5 272 x ray hanger 8x10 273 x ray screen 10x12 fuji / kodak / jindal 274 x ray screen 12x15 fuji / kodak / jindal 275 x ray screen 14x17 fuji / kodak / jindal 276 x ray screen 6.5x8.5 fuji / kodak / jindal 277 x ray screen 8x10 fuji / kodak / jindal 278 ecg machine battery charger 279 x ray fixer 13.5 ltr. 280 tmt electrode 281 tmt report chart 282 x ray film dental 283 x ray film 14x17 284 8 x 10digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 285 10 x 12 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 286 11 x 14 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 287 14 x 17digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 288 dental & occlusal x ray films 57x76 mm fuji / kodak / jindal 289 imaging plate and cassettes ( c.r.system ) 08”x10” fuji / kodak / jindal 290 imaging plate and cassettes ( c.r.system ) 10”x12” fuji / kodak / jindal 291 imaging plate and cassettes ( c.r.system ) 14”x17” fuji / kodak / jindal 292 protactive screen ( mobile ) lead barrier with lead glass window etc...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32786325 science lab tools, equipemnt & reagent vernior calipers, screw guage, spherometer, dcc wire, resistance wire, copper calorimeter, drawing boards, drawing pin, pendulum bob, stop clock, thermometer, sonometer, meter scale, meter bridge, potentometer, set of tunning fork, rubber pad, stand with clamp, plug key, resistance box, rheostat, zinc rod, laclance cell, deniel cell, prous pot lens holder, beaker, flask conical, flask flat, bottom, dropper, glass rod, platinum wire, crusible tong, unviersal clamp, tripod stand, burner, pipetters, test tube, test tube, reagent bottle, reagent bottle, glass tube, centrifuge machine, filter paper, filter paper kit, cork borer, cylinder, gas generator, thermometer, pipette stand, junior medical compound microscope, forcep, scissor, test tube brush, needle with plastic handle, dissecting brush, wire mess, water bath rectangular, funnel, measuring cylinder, amoeba, eye, dissected forg anatomy, ear, rana tigrina, hyla, draco, bat, hydrila, fern 1 beeker 250 ml 2 wacth glass rectangular glass 3 plate 4 lens convex assorted 5 lens convex assorted 6 prism slab 7 glass slab mirror convex 8 assorted mirror convex 9 assorted 10 allpin beaker flask conical flask flat dropper glass rod , platnum wire wire guage , crucibl e tong universal clamp , boss heads , tripod stand , chine dish burner pippettes burette , test tubes , 22 funnel 23 funnel 24 test tube holder 25 lest tube stand 26 spatula 27 sprint lamp 28 wash bottles 29 reagent bottle 30 reagent bottle 31 i reagent bottle 32 reagent bottle 33 reagent bottle 34 l ) roping bottles 35 glass tube 36 fusion tube 37 gentriuge machine — 45 vciehingmaci? _4 cyirider 47 clinder — 48 condenser 49 sçprating funnel 50 gas ( ienrator 51 thermometer _ __ the rmometerr 53 thermometer 54 i’hermnometcr indus. c5 pipette sand weighing machine _ j rnonoco leaf 2 dicot leaf monoco leaf 4 dicot leaf s monocot leaf 6 dicot leaf 7 fitter paper 8phpaper saifranine 2 eosin 3 glycerine 4 methyl blue 5 fast green 6 xylene 7 formaline 8 ch’oroform 9 acetocormine 10 bandict solution feeling solution 12 felling solution b 13 potasium hydroxide 14 sodium hydroxide 15 sudan iv 16 picric acid 17 ethyl alcohol 18 canada balssom 19 starch powder 20 sucrose 21 cobalt chloride 22 iodine solution 23 borric acid 24 potasium chloride 25 blood testing kit 26 spirit etc...

Medical College - Rajasthan

32468477 chemicals and glass item on rate contract for one year phenyl hydrogine hydrochloride trichloro acetic acid (tca) nin hydrin thiosemi carbozide sulphuric acid 6 hydrochloric acid 5 50 lit. 7 nitric acid 5 50 lit. 8 glacial acetic acid 5 50 lit. 9 banedicts reagent 5 50 lit. 10 bar ford reg 5 50 lit. 11 sodium hydroxide 500 gm 5 kg 12 ammonia(liq) 500 gm 5 kg 500 ml 5 lit. 13 hydrogen peroxide 14 mercuric sulphate 500 gm 5 kg 15 ammonium sulphate 500 gm 5 kg 16 sodium carbonate(na2co3) 500 gm 5 kg 500 ml 50 lit. 17 formalin 18 19 sulphosalicylic acid 500 gm 5 kg maltose 500 gm 5 kg 20 sodium tungstate 500 gm 5 kg 21 copper sulphate 500 gm 5 kg 22 23 24 glycerine 5 50 lit. a (alpha) naphthol (molischs reagent 100 gm 1 kg. peptone (bdh) 500 gm 5 kg 25 egg albumin powder powder(bdh) 500 gm 5 kg 26 ethanol 500 m1 5 lit. 27 dextose 500 gm 5 kg 28 lactose 500 gm 5 kg 29 fructose 500 gm 5 kg 500 gm 5 kg 30 sucrose 31 carbolic acid 500 gm 5 kg 32 hydrogen peroxide 500 ml 5 lit. 33 ammonia solution 10 50 lit 34 concentrated sulphuric acid 10 50 lit 35 mercuric sulphate 10 5014 36 glacial acetic acid 10 50 lit 37 tipole (for washing slides) 10 50 lit 38 methanol 10 50 lit 39 xylene 10 50 lit dettol liquid paraffin (heavy) 500 gm 2 kg 20 50 lit 500 mg 5 k 500 m 5 lc_ methylene blue pholoxin b propylene glycol lr potasium chloride lr calcium chloride fused lr sodium bi carbonate anhydrous sodium bi hydrogen phosphate 1 500 gm glycose anhydrous 500 gm z:2u22 23limited tender limitedl_chemicals limited tender docx 74 formalin (forivialdihyde 37%) ia 500 ml 75 gention voilet solution lr 500 ml 76 77 leishman stain solution caderwood oil 1000 ml 100 ml 78 clove oil 100 ml 79 cinnamon oil 100 ml glass item . 3t 4 dit wr6d) mnd 44) 31t 4 (err cr) 1 amber dark bottle(125 ml) each ni co marker pen(blue/black) each conical flask (2.5 liter) each 4 beaker (1 liter) each test tube 18x150 . 100 nos f .c, edta vial 100 500 nos 7 slide packets big size 100 500 packets 8 capillary tuve (glass) 10 cm long 100 500 packets 9 hemoglobin stirrer (glass rod 2 mm diameter) 100 200 nos 10 petridishe glass 4 diameter 100 200 nos etc ...

Medical Health And Family Welfare - Rajasthan

32464925 supply of chemicals and consumables for blood bank and lab at govt hospital jalore supply of chemicals and consumables for blood bank and lab at govt hospital jalore , anti human globulin , anti sera a , anti sera a1 , anti sera ab , anti sera b , anti sera d , anti sera d other make , aso test , blood collection beg , blood collection beg pead , blue tips , capillary tubes , cover slip , crp test , distilled water , esr tube set disposable , glass marking pencil , glass slide , glycerine , hb estimation card / hemocue , hb pipette 20 micro , hepatitis b card , hepatitis c card , hiv tridot kit / tri line , hytrogen proxide 30% , jsb 1 stain , jsb 2 stain , k 3 edta blood collection vial 5 ml tube , labopol , lancet , lugols iodine , malaria card test , methanol , microprotein , multistix ( alb + sug + spgravity + ph + b.salt / pigment ) , n / 10 hcl , parafin oil , ra test , sodium hydrochloride 10% , strip for aceton detection in urine , sulpher powder , test tube glass 10x100 mm , test tube glass 12x100mm , sahils hb tube round , test tube glass 12x80 mm , test tube plastic 12x100 mm screw capped , tissue paper roll , typhydot test , urine pregnancy test card , uristix ( alb+sug ) strip , vdrl test strip , widal test , xylene , yellow tips , hb meter ( squar bottom ) , hb tube ( squar bottom ) , filter paper , hiv kit for elisa , hbsag kit for elisa , vdrl kit for elisa , dengue kit for elisa igm sd , dengue kit for elisa ns1 , micro pipette 0&100 micro. lt. , micro pipette 100&1000 micro. lt. , micro pipette5 micro. lt. ( fix ) , micro pipette10 micro. lt. ( fix ) , micro pipette500micro. lt. ( fix ) , staining jar , scrub typhus rapid test kit , scrub typhus elisa kit , chikunguniya rapid test kit , chikunguniya elisa kit , plastic container for urine sample collection , dengue ns 1 igg & igm detection rapid test kit , slide dry rack , blood bag tripple , plastic test tube rack , timer , microscope blub 6 v 20wgu ( low voltage halogen lamp ) , reagents for sfri 5 part hematology analyzer , diluent , lyse , quench , clair 5.1 , blood troll high control22 , blood troll low control 22 , reagents for horiba 3 part hematology analyzer , diluent mini , lyse , cleaner , reagents for electrolyteprolyte , fluid pack , daily rinse kit , electrode , reagents for biosystems a 15 fully automated biochemistry analyser , a amylase – direct 11583 , sgpt m11533 , albumin m11573 , alkaline phosphotase ( amp ) m11593 , sgot m11531 , bilurubin ( total &direct ) m11515 , calcium arsenazo m91570 , cholesterol m11505 , cholesterol hdl direct 11557 , cholesterol ldl direct 11585 , creatinine m11502 , glucosem11538 , lipase 11793 , uric acid m11521 , cholesterol hdl 11523 , trigycerides m11529 , protein ( total ) m11500 , urea ( bun_uv ) m11517 , ha hypo clean mac90417 , reaction rotor for a 15 , system liquid for a 15 , washing for a 15 , reagents for erba machine , b. sugar , b. urea , creatinine kinase mb , s creatinine kinase ( ck nac ) , s.albumin , s.alk.phosphatase , s.amylase , s.bilirubin , s.calcium , s.cholesterol , s.creatinine , s.hdl cholesterol , s.hdl cholesterol ( direct ethod ) , s.ldh , s.triglyceride , s.uric acid , sgot , sgpt , total protein...

Medical And Health Services - Rajasthan

32436045 blood bank and laboratory regents supply 1 anti human globulin 10ml 2 anti sera a 10ml 3 anti sera al 5ml 4 anti sera ab 10ml 5 anti sera b 10ml 6 anti sera 0 10ml 7 anti sera 0 other make 10ml 8 aso test 20 test 9 blood collection beg 350 ml 10 blood collection beg pead 100 ml 11 blue tips 500 nos 12 capillary tubes 100 tube 13 cover slip 1x20 14 crp test 20 test 15 distilled water 5 ltr 16 [ sr tube set disposable 100 tube one pkt 17 glass marking pencil each 18 glass slide 50 slide par pkt 19 glycerine 500 ml 20 hb estimation card / hemocue each 21 hb pipette 2d micro each 22 hepatitis b card 50 test 23 hepatitis c card 100 test tridot 24 hiv tridot kit / tri line 100 test tridot 25 hytrogen proxide 30% 100 ml 26 jsb i stain 500 ml 27 bb 2 stain 500 ml 28 k 3 edta blood collection vial 5 ml tube 5000 tube 29 labopol 5 ltr cane 30 lancet 4000 31 lugols iodine 100 ml 32 malaria card test each test 33 methanol 5 ltr 34 microprotein 1x50 ml 35 multistix ( alb + sug + spgravity + ph + b.salt / pigment ) 100 strips s.ditecho 36 n / 10 hcl 500 ml 37 parafin oil 500 ml 38 ra test 25 test 39 sodium hydrochloride 10% 5 ltr 40 strip for aceton detection in urine one kit 41 sulpher powder 100gm 42 test tube glass 10x100 mm 100 tube 43 test tube glass 12x100mm 100 tube i 44 sahils hb tube round eash _ 45 test tube glass 12x80 mm 100 tube 46 test tube plastic 12x100 mm screw capped 400 47 tissue paper roll each 48 typhydot test 25 test 49 urine pregnancy test card 100 test 50 uristix ( alb+sug ) strip 100 strips 51 vdrl test strip 50 test 52 widal test 4x5 ml 53 xylene 500 ml 54 yellow tips sod no. 55 hb meter ( squar bottom ) each 56 hb tube ( squar bottom ) each 57 filter paper 150 mm dia 58 hiv kit for elisa 96 test kit 59 hbsag kit for elisa 96 test kit 60 vdrl kit for elisa 96 test kit 61 dengue kit for elisa igm sd 96 test kit 62 dengue kit for elisa ns1 96 test kit 63 micro pipette 0 100 micro. it. each 64 micro pipette 100 1000 micro. it. each 65 micro pipette 5 micro. it. ( fix ) each 66 micro pipette 10 micro. it. ( fix ) each 67 micro pipette 500 micro. it. ( fix ) each 68 staining jar each 69 scrub typhus rapid test kit each 70 scrub typhus elisa kit each 71 chikunguniya rapid test kit each 72 chikunguniya elisa kit each 73 plastic container for urine sample collection each 74 dengue ns 1 igg & igm detection rapid test kit each 75 slide dry rack each 76 blood bag trippte 450 ml 77 plastic test tube rack each 78 timer each 79 microscope blub 6 v 20wgu ( low voltage halogen lamp ) each reagents for sfri 5 part hematology analyzer 80 diluent 20 ltr 81 lyse 5 ltr 82 quench 1 ltr 83 clair 5.1 60m1 84 blood troll high control 22 5 ml 85 blood troll low control 22 5 ml reagents for horiba 3 part hematology analyzer 86 diluent mini 20 ltr 87 lyse 400m1 88 cleaner 1 ltr reagents for electrolyte prolyte 89 fluid pack 1 90 daily rinse kit 1 91 electrode 1 reagents for biosystems a 15 fully automated biochemistry analyser 92 a amylase — direct 11583 5x5 m 93 sgpt m11533 lx200 ml 94 albumin m11573 1x250m1 95 alkaline phosphotase ( amp ) m11593 lx200 ml 96 sgot m11531 lx200 ml 97 bilurubin ( total &direct ) m11515 2+2x50 ml 98 calcium arsenazo m91570 4x50 ml 99 cholesterol m11505 1x200 ml 100 cholesterol hdl direct 11557 1x80 ml 101 cholesterol ldl direct 11585 1x80 ml 102 creatinine m11502 4x50 ml 103 glucose m11538 5x200 ml 104 lipase 11793 1x60 ml 105 uric acid m11521 lx200 ml 106 cholesterol hdl 11523 2x50 + 2x50 ml 107 trigycerides m11529 2x250 ml 108 protein ( total ) m11500 2x250 ml 109 urea ( bun_uv ) m11517 2x250 m1 110 ha hypo clean mac90417 4x100 ml 111 reaction rotor for a 15 lx10 nos 112 system liquid for a 15 lx1000 ml 113 washing for a 15 1x100 ml reagents for erba machine 114 b. sugar 2x200ml 115 b. urea 5x2om l 116 creatinine kinase mb 2x8 / 2x2 ml 117 5 creatinine kinase ( ck nac ) 5x2.2 ml 118 s.albumin 5x50 ml 119 s.alk.phosphatase 10x2.2 ml 120 5.amylase 6x6 ml 121 s.bilirubin 4x60 ml 12 2 s calcium 123 s.cholesterol 124 s.creatinine 125 s.hdl cholesterol 126 s.hdl cholesterol ( direct ethod ) 127 s.ldh 128 s.triglyceride 129 sairic acid 130 sgot 131 sgpt 132 total protein etc...

Medical And Health Services - Rajasthan

32202322 regents for pathology lab 1 aceton 2 propanol 3 xylene 4 wa 5 microtome blade 6 plastic ring 7 eosin yellow 8 hemotoxiline crystal 9 sodium iodate 10 dpx ...

Indian Army - Rajasthan

32105238 local purchase of medicine for mh jodhpur , medicines : , alkaline phosphatase ( 2x44 / 2x11 ml ) , lipase ( 1x44 / 1x11 ml ) , albumin ( 10x44 ml ) , amylase ( 5x22 ml ) , bilirubin direct ( 6x44 / 3x22 ml ) , total bilirubin ( 6x44 / 3x22 ml ) , calcium ( 10x12 ml ) , cholesterol ( 10x44 ml ) , creatinine ( 5x44 / 5x11 ml ) , glucose ( 10x44 ml ) , hdl cholesterol ( 4x30 / 4x10 ml ) , ldl cholesterol ( 2x30 / 2x10 ml ) , total protein ( 10x44 ml ) , triglycerides ( 5x44 / 5x11 ml ) , urea ( 5x44 / 5x11 ml ) , uric acid ( 5x44 / 5x11 ml ) , ggt ( 2x44 / 2x11 ml ) , erba norm ( 1x5 ml ) , erba path ( 1x5 ml ) , erba xl multical ( 4x3 ml ) , cuvette for em 360 , ck mb ( 2x44 / 2x11 ml ) , ck nac ( 2x44 / 2x11 ml ) , ldh ( 2x44 / 2x11 ml ) , phosphorous ( 10x12 ml ) , micro protein ( 10x12 ml ) , sgpt ( 6x44 / 3x22 ml ) , sgot ( 6x44 / 3x22 ml ) , crp quantitative test ( 2x22 / 1x11 ml ) , ra factor quantitative test ( 1x22 / 1x5.5 ml ) , sample cups , pm kit ( em 360 ) , completetubing set ( em 360 ) , erba auto wash ( 10x100 ml ) , appen droff tube , biored biochemistry control ( level 1 ) , biored biochemistry control ( level 2 ) , cell pack solution ( 20 ltr ) , cell cleaner solution ( 50 ml ) , wbc / hgblysed reagent ( sromatolyser ) 500 ml , control ( 1x3 ) for sysmax kx 21 , printing paper 110 mm , calibrator for sysmax kx 21 , bact / alert blood culture infants , bact / alert blood culture adults ( aerobic ) , bact / alert blood culture adults ( an aerobic ) , crp ( 100 test / kit ) , ra factor ( 100 test / kit ) , aso ( 100 test / kit ) , widal ( 4x5 ml ) , dengue ( ns1, igg / igm ) rapid test , malaria parachek card ( 50 test ) , occultblood ( 50 test ) kit , pregnancy test card , h1n1 rapid test kit , viral transport media ( 50 test ) , esr tube , typhi dot igm ( 50 test ) , ketosticks ( 100 strips ) , uristickes ( 100 stripes ) , urine container ( 50 ml ) , sterile urine container ( 50 ml ) single packed , chloroform , microscopic cover glass ( 22x50mm ) , auto pipette multi channel , auto pipette ( 5 50 ul ) , auto pipette ( 50 200 ul ) , tissue paper roll , whatman filter paper no 1 , whatman filter paper no 4 , harris haematoxylin ( readymade stain ) , parafin wax with ceresin , perl stain , grocott stain , pas stain , reticulin stain , casette for tissue hilding , l mould , liquor ammonia , rapid pap stain , disposable blade ( art no 2840700 ) for microtome ( compatable with slee ) , durham tube ( 50 test ) , petridishes , sugar set for microbiological test lactose , sugar set for microbiological test maltose , sugar set for microbiological test glucose , sugar set for microbiological test urease , sugar set for microbiological test citrate , gram stain kit , zn stain kit , kovac reagent strip ( 25 strip / vial ) , lead acetate strip ( 25 strip / vial ) , oxidase disc ( 50 disc / vail ) , l j media ( readymade ) , mpo stain , spirit , band aid , litmus paper , procalcitonin rapid , gloves ( ancelle ) non latex , surgical blade 20’ , rna extraction kit ( containing:5x50 spins, carrier rna 1550 ?g, avl buffer 155ml, aw1 wash buffer 98 ml, aw2 wash buffer 66ml ) ( 250 tests in each kit ) , covid 19 one step rt pcr kit ( for orf1ab & n gene ) ( 50 test in each kit ) , strip indicators for sterilisation control ( for testing sterility of drums ) , vacutainer: edta 3ml , vacutainer sodium fluoride / sodium fluoride+k3edta , vacutainer sterile tube with gel 5ml , vacutainer sterile tube with out gel – 5ml , vacutainer sodium citrate – 3ml , agglutination tube ( felix ) 50 mmx12 mm , elisa reader thermal paper 110mm , glass cover microscopic , 22 x 30mm , glass cover 22x50 mm , paper filter round pkt of 100 , paper filter square ( 51cm x 51cm ) pkt of 100 , printing paper roll 55 mm for semiautoanalyser , acetone commercial , glacial acetic acid , hydrochloric acid. , alcohol dehydrated , alcohol methyl , d p x mounting med , prothrombin time , pttk reagent , xylene ( xylol pure ) , rapid coliform kit / water culture kit , meropenem 10ug ( pack of five vial ) , oxacillin 1 ug ( pack of five vial ) , ampicillin10ug ( pack of five vial ) , amoxyclav ( pack of five vial ) , imipenem ( pack of five vial ) , penicillin 10ug ( pack of five vial ) , tetracyclin 30ug ( pack of five vial ) , clindamycin ( pack of five vial ) , bacitracin 0.04ug ( pack of five vial ) , cefotaxim ( pack of five vial ) , ceftriaxone ( pack of five vial ) , ceftazidim / clavulanic acid ( pack of five vial ) , optochin ( pack of five vial ) , novobicin ( pack of five vial ) , ampi sulbactum ( pack of five vial ) , cefoxitin30ug ( pack of five vial ) , ceftazidim ( pack of five vial ) , chloramphenicol ( pack of five vial ) , colistin ( pack of five vial ) , streptomycin 300ug hls ( pack of five vial ) , linezolide ( pack of five vial ) , ticoplanin30ug ( pack of five vial ) , netilmycin ( pack of five vial ) , norfloxacin ( pack of five vial ) , nitrofurantoin ( pack of five vial ) , cefepime ( pack of five vial ) , amikacin ( pack of five vial ) , azythromycin ( pack of five vial ) , co trimoxazole ( pack of five vial ) , cefoperazone ( pack of five vial ) , ciprofloxacin ( pack of five vial ) , erythromycin ( pack of five vial ) , gentamicin ( pack of five vial ) , gentamicin 120ug hsg ( pack of five vial ) , levofloxacin ( pack of five vial ) , nalidixic acid 30ug ( pack of five vial ) , piperacillin 100ug ( pack of five vial ) , vancomycin 30ug ( pack of five vial ) , polymixin b ( pack of five vial ) , piperacillin / tazobactam ( pack of five vial ) , ofloxacin 5ug ( pack of five vial ) , cifran ( pack of five vial ) , ceftriaxone / sulbacta ( pack of five vial ) , augmentin ( pack of five vial ) , cefoparazone / sulbactum ( pack of five vial ) , tigicyclin ( pack of five vial ) , fluconazole ( pack of five vial ) , minocycline 30ug ( pack of five vial ) , ceftazidime avibactam ( pack of five vial ) , aztreonam 30ug ( pack of five vial ) , ertapenem 10ug ( pack of five vial ) , rifampicin ( pack of five vial ) , doxycycline 30ug ( pack of five vial ) , fosfomycin 200ug ( pack of five vial ) , pefloxacin ( pack of five vial ) , quinapristin dalfopristin ( pack of five vial ) , gatiflox 5ug ( pack of five vial ) , peflox 5ug ( pack of five vial ) , fostomycin 200ug ( pack of five vial ) , doripenem 10ug ( pack of five vial ) , ritampin 5ug ( pack of five vial ) , oinupeistin dalopristin 15ug ( pack of five vial ) , filter barrier tips ( 10?l ) pack of 960 , filter barrier tips ( 20?l ) pack of 960 , filter barrier tips ( 50?l ) pack of 960 , filter barrier tips ( 100?l ) pack of 960 , filter barrier tips ( 200?l ) pack of 960 , filter barrier tips ( 1000?l ) pack of 960 , 8 strip 0.1 ml tubes and flat optical strip caps ( each pkt contain 125 strip tubes +caps ) , kimtec wipes , molecular grade ethanol / bott of 500ml , absolute alcohol , falcon tube ( 50ml ) , micro centrifuge tube ( 2.0 ml ) pkt of 500 tube , eppendorf tube ( 1.5 ml ) pkt of 500 tube , rnase kil , covid 19 rapid ag test ( kit of 25 test ) , vtm kit ( kit of 50 test ) , d dimer fia ( porteblein sd biosensopr ) , pct fia ( porteblein sd biosensopr ) , drabkins sol for hb estimation , kit dengue serology ( ns1, igm / igg ) rapid test ( 10 test / kit ) , kit glucose 10x50 ml for semi auto analyzer , kit hdl 2x50 ml for semi auto analyzer , kit sgot for semi auto analyzer , kit sgpt for semi auto analyzer , kit t3 elisa , kit triglyceride 10x50 ml for semi auto analyzer , kit tsh elisa , kit urea 10x50 ml for semi auto analyzer , kit uric acid 10x50 ml for semi auto analyzer , kit cholestrol 2x50 ml for semi auto analyzer , microscope slide 75mm x 25 mm ( pkt of 50 ) , kit t4 elisa , vaccum blood collection tubes with needles : edta 3ml , vaccum blood collection tubes with needles : heparin 3ml , vaccum blood collection tubes with needles : sterile tube with gel 5ml ( material plastic / glass ) , vaccum blood collection tubes with needles and additives sodium fluoride / sodium fluoride+k3edta in tubes of vol 02 ml , solution erba wash 50 ( ml ) , pregnancy stip , kit paracheck sd ( green colourlebel ) no of 100 strip , mico tips ( 5 200ul ) , mico trips ( 500 1000ul ) , spirit , urostix ( 100 test per kits ) , urine dipstick 10 parameter ( sp gravity urobilinogen, nitrates, protine / albumine, glucose, kitones, ph, bilirubin, heme / rbc , vaccutainer plain , microscope cover slip 22 x 70mm , urine container disposable , lancet disposable ( pack of 100 ) , urine analysis strips ( bott of 50 strips ) , kit malaria paracheck ( antigen ) pack of 40 test , kit creatinine 10x50 ml for semi auto analyzer...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040958 supply of equipments, articles and reagents for dept. of physiology and biochemistry 1. medical microscope (binocular) zoom stereo binocular microscope frame all aluminum pressure diecasted body paint p.u. coating in light cream shade observation 45 degrees inclined binocular head can be routed through 360° magnification standard magnification from 7x to 45x (zooming ration 1:6:4) focusing rack and pinion focusing system, single stroke up to 50mm. eye pieces incident and transmitted illumination 2000, halogen lamp. (optional ring illuminator) 15 2. westergren’s pipette for esr good quality glass made 25 3. haematocrit tubes materialglass outer diameter 1.5 1.6 mm, inner diameter 1.1 1.2 mm 25 4. semi auto analyzer low level photometer provides basic solution wavelengths: 340, 405, 500, 546, 620nm, 3 more filters optional wavelengths range is 330 800nm. absorbance range: 0.500 ~ 3.500abs resolution 0.001 abs (displayed), 0.0001abs (calculated) temperature control 25°c,30°c,37°c,±0.1°c and ambient temperature 01 5. haemoglobinometer (sahil) shalishb meter good quality chamber having better graduated square tube & properly visible comparator (standard) tube. 5 6. haemocytometer good quality of improved neubauer chamber, wbc,rbc pipette, cover slip and having wooden box improved neubauer chamber improved bc& wbc chamber, having better quality of cover slip. 5 7. sphygmomanometer b. p. apparatus manual and mercury based, better quality of rubber tubes and arm cuff. 5 8. stethoscope singal rubber tube better quality of diaphragm and ear piece. 5 9. clinical thermometer (digital) upto 60*c glass made 5 10. knee hammer neurological hammer better handling, s.s. body 2 11. esr pump made of good quality plastic with capacity to hold pipette and suck the blood 2 12. cd(blank) 10 13. dvd(blank) 10 14. slides glass ( for making pbf) 100 15. models( respiratory, reproductive(male & female), 03 16. audio visual aids( computer led monitor, cpu, speaker, ups) 01set 17. refrigerator 190ltr. 01 pc 18. acetic acid – glacial 500 ml 19. acetone 500 ml 6 25 sign & seal of firms 20. ammonia solution 100 ml 21. ammonium crystals 100 gm 22 ammonium oxalates 100 gm 23 ammonium sulphatases powder 100gm. 24 anti a, anti b, anti – d 1 ml (each) 25 barfoed’s reagents 1 x 30 ml 26 barium chloride 100 ml 27 benedict reagent 500 ml 28 benzedrine powder 100 gm 29 dextrose 100 gm 30 ehrlich’s aldehyde reagent 100 ml 31 fehling solution – a 500 ml 32 fehling solution b 500 ml 33 foucher’s reagent 100 ml 34 fructose 100 gm 35 hydrochloric acid n/10 500 ml 36 hydrogen peroxide 500 ml 37 immersion oil cedar wood 30 ml 38 iodine solution 100 ml 39 leishman’s stain 500 ml 40 methanol ( ordinary ) 100 ml 41 molisch’s reagent 100 ml 42 ninhydrine solution 100 ml 43 nitric acid 500 ml 44 normal saline 500 ml 45 phenylhydrazine 100 ml 46 phyloxin – b solution ( tec) 125 ml 47 pieric acid 100 ml 48 pilot’s fluid ( platelets ) 100 ml 49 platelets diluting fluid – 100 ml 50 r b c diluting fluid 500 ml 51 sodium acetate trihydrate crystal 200 ml 52 sodium hydroxide solution 200 ml 53 sodium nitroprusside dehydrate purified 100 gm 54 sodium nitroprusside crystals 100 gm 55 spirit surgical 500 ml 56 sucrose 100 gm 57 sulphosaliyic acid 100 ml 58 sulphuric acid 500 ml 59 t e c diluting fluid 500 ml 60 tollen’s reagent 100 ml 61 w b c diluting fluid – 500 ml 62 xylene 500 ml 63 centrifuging conical tubes 15 ml 15 64 pipits 10ml 10 65 pipits 15ml 10 66 test tubes (15ml) 100 67 test tubes stands 10 68 test tubes holders 20 69 staining tray (for pbf) 10 70 watch glass 10 71 reagents bottles 125gm wide mouth 20 72 glass slide pkt. 10 73 cover slip pkt. 02 74 hand gloves(free size) 100 75 dropping bottles plastic 120ml 20 7 25 sign & seal of firms 76 becker 25ml 10 77 becker 50ml 10 78 lancets 100 79 capillary tubes for blood clotting 100 80 filter paper 100 81 distilled water ...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Rajasthan University Of Health Science - Rajasthan

31927326 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , sodium metabisulfite , capillary tubes , sprit , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n / 10 hcl , cedar wood oil , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50 ) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution ( liquid ammonia ) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate ( ammonium iron sulphate ) , ferric chloride , formalin ( formaldehyde 37 40 % ) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with ( ceresin 60 62 c ) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block ( white ) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye ( for shiff reagent ) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

31913247 supply of chemicals reagents consumable items for department of pathology anti b ( sera ) anti d ( sera ) sodium metabisulfite capillary tubes _ g6pd kit ( 12 tests ) ocutt blood kit coombs anti sera cover slip ( 18x18mm ) .__ dxposible nediles ( 24cuage ) disposible neoiues ( 22guage ) disposibue sterile urine comawer_ esr_oispoxable pipette glass marker pencil jsb stain i jsb stain ii ketone strips — — 1.ancets leishman’s stain micro glass slides microscope bulb cedar wood oil anti a ( sera ) ie thmnea? 26 ridh&e 27 reticulocyte stain semen diluting rluid 29 sodium citrate 3.2% 30 sodium citrate 3.8x 31 thermnlparllomm? 32 thermal paper 8o mm 33 thermalpaper57mm — 34 small test tube plastic small test tube glass 36. tips ( 1o04o0o11l ) 37 tips ( 10 2ooi.l ) 38 tissue paper roll — 39 torniguate ( cloth ) 4o urine multi sttips 41 urine strips for alt 42 vacutainer edta vial _ 43 vacutainer sodium citrate 3.2 % vial 44 wbc diluting fluid 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area giemsa stain liquid carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid !carbol fucihsin cover slip ( 22xso ) diamond pencil distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid _!carbol fucihsin _ cover slip ( 22xso ) diamond pencil . ? distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lo e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid hand sanitizer i ., 7o dic counter ( 8ditfrential miii ) fl acetk acid 72 acetone 73 acid fuschifl 74 acid periodic 75 activated charcoal 76 alicine blue 77 akjminftumchlo 78 mumoumhydx!h 7 ammoniun solution tliouid ammonlia 80 aniline blue 81 basic fuchsinl 82 benzidinle powder 83 biebrich scarlet — 84 brilliant cresyl blue 85 carmine power 86 celestine blue 87 chloral hvdrate 88 citric acid concentrated hcl 91 egg albumin flake 92 eosin yellow stain powder ferric ammonium sulphate ( ammonium 93 iron sulphate ) 94 ferric chloride gold chloride haematoxyline crystal hydrochloric acid ar hydrogen peroxide light green malt diastase mercuric oxide metanil yellow murcuri chloride 109 neutral red 110 nitric acid 111 nuclear fast red 112 numbering paper . 113 oxalic acid ______ _ 114 paraffin wax with ( ceresin 60 62 c ) ______ 115 peanut oil i 103 104 105 106 107 methylene blue _______ microtome blade ( low profile ) 108 9s rorman ( forrnaidehyde3 , _. _ congo red 89 90 fl6 e ? 117 phosphomolybuc acid 118 phosphotuflgstic acid .._________ i19. picric acid 120 plastic ring for block (white) 121 potassium oichromte 122 potassium hydroxi — 123 potassium metabisulphit 124 potassium permagnate 12s propaflolol — 126 readymade giemsanstanf 127 rosanilinle dye (for shiff reagent) 128 silver nitrate 135 tetrazollum chlorlde 136 toludine blue 137 xylene — 138 139 rapid pap stain kit disposable gloves sterile 140 disposable gloves unsteriliged 141 non speciheesterase kit 142 bovine albumin_22% 129 sodium nitropruside 13o sodium hydroxide 131 sodium sulphate — 132. sodium thiosuiphate 133 sudan black b 134 sulfurous acid_ ...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31861994 supply of laboratory and blood bank chemicals, regents equipment at jln govt. hospital nagaur supply of laboratory and blood bank chemicals, regents equipment at jln govt. hospital nagaur , name of test reagents & chemicals and cards , a.s.o. 100 test sd / j. mitra / tulip , acetic acid bdh 500 ml , acetone 5 ltr. , albumin klt 5*50 ml erba , alkaline phasp ( auto span ) 20 ml / erba , alkaline phasp ( erba ) , amylase kit 6*6 ml erba / j.mitra / tulip , anti sera group a, b, d kits ml j.mitra / tulip 10 ml , australia antigen per kit rapid , auto pipette 100 1000 ul , auto pipette 10 ul , auto pipette 500 ul , auto pipette 50 ul , auto pipette 50 ul , band aid per piece , benedicts qualitative reagent 5 ltr , bilirubin 4*60 ml. erba , bovine albumin sera 5 ml. jmitra / tulip etc , brillint cresyl bule 100 ml , brush for claning test tube per piece , c.r.p. 100 test sd / j. mitra / tulip etc , calcium kit 2*50 ml erba , capillary tube per tube , chikangunia rapid test sd / i. mitra / tulip etc per test , cholestol kit 5*20 ml. erba etc , ck nac kit 2*10 ml. erba / j.mitra / tulip etc , ck mb kit 2*8 ml 2*2 nil erba / j. mitra / tulip etc , combs sera 5 ml. j.mitra / tulip etc , cotton tape &3 4 per piece , cover slip glss 18 mm , cover slip glass chember , creatinine kit 4*60 ml. erba , dengue card igg / igm / ns 1 sd / j. mitra / tulip etc , dengue elisa kit sd / j. mitra / tulip per kit , diastix bayer 100 strips , disposable esr pipette with tube per tube , distil water 5 lit gallan h2so4 reg , dropper big size 9 per piece , earba wash kit cat no. 1921 4*50 ml , edta vials ( k3 ) 13*75 mm double cape per piece , edta vials ( k3 ) 13*75 mm single cape per piece , ehrlichs reagent 500 ml , eosinophil solution 500 ml , eosinophil counting fluid 500 ml , erba cim 5 semi auto analiser pm kit , erba roll paper 2.5 p th. paper per roll , erba roll paper 3 plan tharmal paper per roll , erba roll paper 4 per roll , esr pipette gdr each , ethyl alcohol 500 ml , auto pipette 100ul , filter paper pe piece , gention fluid 500 ml , giemsa stain 500 ml , glass slide 50 pcs. , glucose kit 2*200 ml erba , grams crytal violet per piece , grams iodine 500 ml , grams ( stain ) 500 ml , hb 301 hemocue microcuvets per tube , hb pipetle top per piece , hb tube top per piece , hbs ag kit rapid sd / j. mitra / tulip etc , hbs ag kit elisa 96 test sd / j. mitra / tulip etc , hcv elisa 96 test sd / j. mitra / tulip etc , hcv kit rapid sd / j. mitra / tulip etc , hdl cholesterol 2*50 ml. erba , hiv kit ( elisa ) 96 test sd / j. mitra / tulip etc , hiv kit ( rapid ) sd / j. mitra / tulip etc , hiv tridot sd / tulip / j. mitra etc , hiv elisa 4th gen. , hydrochloric acid bdh 500 ml , jsb stain i malaria , jsb stain ii malaria , ldh ( p l ) kit 25 ml 4*8 / 1*8 ml erba / j.mitra / tulip etc , leishman stain 500 ml , methyl alcohol 500 ml , methyleneblue 500 ml , micro protein 1*50 liqued , multistix bayer 100 strip , neuber counting chamber rohan india brigh line , nitric acid bdh 500 ml , occult blood test kit , pasture pipette glass , pipette glass 10 ml , pipette glass 1 ml , pipette glass 20 ml , plastic urine containers per piece , potassium hydroxide 500 ml , pregnancy colour card acon / hicks / mainkind etc , pt kit ( agappe ) ivd , pt kit ( uniplastin ) , ra kit 100 test , rmt antigen set sd / j. mitra / tulip etc , scrub tiphus rapid test sd / j. mitra / tulip etc , seminal fluid 500 ml , serum cap test tube 4 screq cap , serum sample cup , sgot kit 5*20 ml. erba etc , sgpt kit 5*20 ml erba etc , sulfuric acid 500 ml , sulphuric acid bdh 500 ml , sulpur flower ( powder ) 500 gm , test tube 3 glass , test tube 3 plastic , test tube 4 glass , test tube 4 plastic , test tube stand 48 , test tube stand 96 , test tube with screw cap 3 , test tube with screw cap 4 , tips blue 1x500 pack , tips yellow 1x1000 pack , total protein test kit 5*50 ml erba , triglyceride 5*50 ml erba , unnas polychrone methyne blue , urea kit 5*20 ml erba , uric acid test kit 5*20 ml. erba , uric acid test kit 5*50 ml. erba , uristix bayer 100 strips / seimens / bayer etc , vdrl card sd / acon / tulip , wbc pipette gdr , widal test kit 100 test sd / j. mitra / tulip etc , xylene 500 ml , blood suger erba kit , anti ab ( group ) j. mitra / tulip etc , sodium hypocloride 5 ltr. , blood bag 350 ml , blood beg ( pedia ) , needle 22 / 23 no. 1x100 pack , chikangunia elisa test kit , keto distix , test tube jelly 4 , anti d polyclonal igg+igm , anti h polyclonal igg+igm , anti a polyclonal igg+igm , sensitized o cells , chikungunyaelisatestkit , scrubtyphuselisatestkit , havigmelisatestkit , hevigmelisatestkit , typhidotelisatestkitfortyphoid , typhidotrapidtestfortyphoid , tube agglutination test kit fortyphoid , modifiedcarryblairmedium , brainheartinfusionmedium ( bhi ) , deoxycholatecitrateagar ( dca ) , phenolphthaleinphosphateagar ( ppa ) , bloodculturebottleswithbrainheartinfusionbroth ( 20ml ) , bloodculturebottleswithbrainheartinfusionbroth ( 70ml ) , simagar , ssagar , bloodagarbase , cledmedia , nutrientagar , macconkeyagar , mullerhintonagar , thiosulphatecitratebilesaltagar ( tcbsagar ) , mannitolagar , salanitebroth , sorbitolmacconkeyagar , chromeagar ( hicromeutiagar ) , xldagar , sabourauddextroseagar ( sda ) , alkalinepeptonewater , amies / stuart media for sample , carryblairmediaforstooltransport , triplesugarironagar , peptonewater , simmoncitrateagar , ureaagarbaseforureasetest , ureasolutionforureasetest , kovac’sreagent ( indolereagent ) , glucosephosphatebroth , methylredindicatorsolution , alphanaptholforvptest ( barrita ) , 40%koh ( barritb ) , 30%hydrogenperoxide ( h2o2 ) , oxidasereagent , optochin , bacitracin , novobiocin , sodiumdeoxycholate , phpaper1to14 , phpaper2to10.5 , ferricchloride , tryptonebrothforindoletest , glassmarkingpencil , ofmedia ( glucose ) , vials for storage ( cryo, eppendores ) b , bileesculinagar , tsb [ tryptonesoyabroth ] , glycerol , gram’sstainkit , afb ( zn ) stainkit , albertstainkit , lugol’siodine , indianink , glasspetriplates ( 100mm ) , disposablepetriplates ( 100mm ) , measuringcylinder50ml , measuringcylinder100ml , measuringcylinder250ml , conicalflasks100ml , conicalflasks250ml , conicalflasks500ml , testtube10ml , maccartneybottle ( 100ml ) , coverslips ( 18*18mm ) , glassrod , glassslides ( 76*26*0.95mm ) , slidetrays , multichannelmicropipette ( 30?l– , micropipette ( 10 100microlitre ) , micropipette ( 100 1000microlitre ) , acetone , 70%ethanol , 70%ethlyalcohol , 10%koh , urinecontainer ( 50ml ) , sterilestoolcontainerwithspoon , pre sterilecottonswabs , swabsticks ( withtube ) , bloodculturebottlewithoutmedia ( forbhimedia ) 30ml , blottingpapersheet , ceedarwoodoil , testtubestand18*150 [ 20x20mm ] , stainingrack ( rodwithstand ) , reagentbottle ( narrow mouth ) 125ml , plasticinforhangingdroppreparation , plasticdroper1*100 , discardingjar , inoculationloop ( 10microlitre ) , inoculationloop ( standardforurineculture0.001ml ) , inoculationloopholder , spatula6 , scissors6 , forceps6 , stopwatch , diamondmarkerpencil , tonguedepressor , tissuepaperroll , aluminumfoil , filterpapersheet , bunsenburnerwithsmallgascylinder , spiritlamp , normalsaline , glovesnitrile , paraffintape2x250 , analyticalweighing balances ( cap.0.01gm 220gm ) , electric heater for water boiling [ waterbath ] , thermometer110c, mercuryfilled , autoclave thermophilus strip forinternalqualitycheck , incubator thermophilus strip forinternalqualitycheck , 0.5macfarlandsolution , 0.5macfarlandunitpaper , vibriocholeraeantisera, polyo1 , vibriocholeraeantisera, o139bengal , fecaloccultbloodtestkit , amikacin ( 30mcg ) , augmentin ( 20 / 10mcg ) , ampicillin ( 10mcg ) , cefepime ( 30mcg ) , cefoxitin ( 30mcg ) , ceftazidime ( 30mcg ) , ceftriaxone ( 10mcg ) , cefuroxime ( 30mcg ) , chloramphenicol ( 30mcg ) , ciprofloxacin ( 10mcg ) , clindamycin ( 2mcg ) , cotrimoxazole ( 25mcg ) , doxycycline ( 10mcg ) , erythromycin ( 10mcg ) , gentamycin ( 10mcg ) , imipenem ( 10mcg ) , levofloxacin ( 5mcg ) , linezolid ( 30mcg ) , meropenem ( 10mcg ) , nalidixicacid ( 30mcg ) , netilmicin ( 10mcg ) , nitrofurantoin ( 300mcg ) , norfloxacin ( 10mcg ) , ofloxacin ( 5mcg ) , oxacillin ( 1mcg ) , penicillin ( 10mcg ) , peperacillin / tazobactam ( 100 / 10mcg ) , teicoplanin ( 30mcg ) , tetracycline ( 30mcg ) , vancomycin ( 30mcg ) ...

Medical And Health Services - Rajasthan

31845083 mnjy lab and blood bank regents 1 a.s.o. 100 test sd/j. mitra/tulip pack rate tax 2 acetic acid bdh 500 ml 3 acetone 5 ltr. 4 albumin klt 5*50 ml erba 5 alkaline phasp (auto span) 20 ml/erba 6 alkaline phasp (erba) 7 amylase kit 6*6 ml erba/j.mitra/tulip 8anti sera group a,b,d kits ml j.mitra/tulip 10 ml| 9 australia antigen per kit rapid 10 auto pipette 100 1000 ul 11 auto pipette 10 ul 12auto pipette 500 ul 13 auto pipette 50 ul 14 auto pipette 50 ul 15 band aid per piece 16 benedicts qualitative reagent 5 ltr 17 bilirubin 4*60 ml. erba 18 bovine albumin sera 5 ml. jmitra/tulip etc 19 brillint cresyl bule 100 ml 20 brush for claning test tube per piece 21 c.r.p. 100 test sd/j. mitra/tulip etc 22 calcium kit 2*50 ml erba 23 capillary tube per tube 24 chikangunia rapid test sd/l. mitra/ tulip etc per test 25 cholestol kit 5*20 ml. erba etc 26 ck nac kit 2*10 ml. erba/j.mitra/tulip ete 27 ck mb kit 2*8 ml 2*2 nil erbal j, mitra/tulip etc 28 combs sera 5 ml. j.mitra/tulip etc 29 cotton tape &3 4 per piece 30 cover slip glss 18 mm 31|cover slip glass chember | 32|creatinine kit 4*60 ml. erba 33 dengue card igg/lgm/ns 1 sd/j. mitra/ tulip etc 34 dengue elisa kit sd/ j. mitra/ tulip per kit 35 diastix bayer 100 strips 36 disposable esr pipette with tube per tube 37 distil water 5 lit gallan h2so4 reg 38 dropper big size 9 per piece 39 earba wash kit cat no. 1921 4*50 ml 40 edta vials (k3) 13*75 mm double cape per piece 41 edta vials (k3) 13*75 mm single cape per piece 42 ehrlichs reagent 500 ml 43 eosinophil solution 500 ml 44 eosinophil counting fluid 500 ml 45 erba cim 5 senmi auto analiser pm kit 46 erba roll paper 2.5 p th. paper per roll 47 erba roll paper 3 plan tharmal paper per roll 48 erba roll paper 4 per roll 49 esr pipette gdr each 50 ethyl alcohol 500 ml 51 auto pipette 100ul 2 filter paper pe piece 3 gention fluid 500 ml 54 giemsa stain 500 ml 55 glass slide 50 pcs. 56 glucose kit 2*200 ml erba 57 grams crytal violet per piec 58 grams lodine 500 ml 59 grams (stain) 500 ml 60 hb 301 hemocue microcuvets per tube 61 hb pipetle top per piece 62 hb tube top per piece 63 hbs ag kit rapid sd/j. mitra/ tulip etc 64 hbs ag kit elisa 96 test sd/j. mitra/tulip etc 65 hcv elisa 96 test sd/j. mitra/ltulip ete 66 hcv kit rapid sd/ j. mitra/tulip ete 67|hdi cholesterol 2*50 ml. erba 68 hiv kit (elisa) 96 test sd/j. mitra/tulip etc 69|hiv kit (rapid) sd/j. mitra/tulip etc 70|hiv tridot sid/tulip/ j. mitra ete 71 hiv elisa 4h gen. 72|hydrochloric acid bdi1 500 ml 73|jsb stain i malaria 74 jsb stain ii malaria 75 ldh (p l) kit 25 ml 4*8/1*8 ml erba/j.mitra/tulip etc 76|leishman stain 500 ml 77|methyl alcohol 500 ml 78 methyleneblue 500 ml 79 micro protein 1*50 liqued 80 multistix bayer 100 strip 81 neuber counting chamber rohan india brigh line 82 nitric acid bdh 500 ml 83 occult blood test kit 84 pasture pipette glass 85 pipette glass 10m 86 pipette glass 1 ml 87 pipette glass 20 ml 88 plastic urine containers per piece_ 89|potassium hydroxide 500 ml 90 pregnancy colour card acon/hicks/mainkind etc 91 ptkit (agappe) ivd 92 pt kit (uniplastin) 93 ra kit 100 test 94 rmt antigen set sd/ j. mitra/tulip etc 95 scrub tiphus rapid test sd/ j. mitra/ tulip etc 96 seminal fluid 500 ml 97|serum cap test tube 4 screq cap 98 serum sample cup 99 sgot kit 5*20 ml. erba etc 100 sgpt kit 5*20 ml erba etc 101 sulfuric acid 500 ml 102 sulphuric acid bdh 500 ml 103 sulpur flower (powder) 500 gm 104 test tube 3 glass 105 test tube 3 plastic 106 test tube 4 glass 107 test tube 4 plastic 108 test tube stand 48 | 109|test tube stand 96 | 110/ test tube with screw cap 3 | 111 test tube with screw cap 4 |112|tips blue 1x500 pack 113 tips yellow 1x1000 pack iorvivit tkiti4tlr ri14 total protein test kit 5*50 ml erba 115 triglyceride 5*50 ml erba 116|unnas polychrone methyne blue 117|urea kit 5*20 ml erba 118 uric acid test kit 5*20 ml. erba 119|uric acid test kit 5*50 ml. erba 120 uristix bayer 100 strips/seimens/bayer etc 121 vdrl card sd/acon/tulip 122 wbc pipette gdr | 123 widal test kit 100 test sd/j. mitra/tulip etc | 124|xylene 500 ml 125 blood suger erba kit 126 anti ab (group) j. mitra/tulip etc 127 sodium hypocloride 5 itr, 128 blood bag 350 ml 129 blood beg (pedia) 130|needle 22/23 no. 1x100 pack 131 chikangunia elisa test kit 132 keto distix 133 test tube jelly 4 134 anti d polyclonal igg+igm 135 anti h polyclonal lgg+lgm 136 anti a polyclonal igg+lgm 137 sensitized o cells 96test 138 chikungunyaelisatestkit 139 scrubtyphuselisatestkit 140 ha vigmelisatestkit 141 hevlgmelisatestkit 142 typhidotelisatestkitfortyphoid 143 typhidotrapidtestfortyphoid 144 tube agglutination test kit for typhoid 96test 96test |96test n.q. n.q. n.q. 145 modifiedcarryblairmedium 500gm 146 brainheartinfusionmedium |500gm (bhi) 147 deoxycholatecitrateagar(dca) 148 phenolphthaleinphosphateagar(ppa) |149 bloodculturebottleswithbrainheartinfusionbroth(20ml) 100gm 100gm |1ox20ml 150 bloodculturebottleswithbrainheartinfusionbroth(70ml) 1ox70ml 500gm 151 simagr |152 ssagar |153|bloodagarbase 500gm 500gm t154|cledmedia 500gm 155|nutrienta gar | 156 macconkey agar 157| mullerhintonagar 158 thiosulphatecitratebilesaltagar(tcbsagar) 500gm |500gm 500gm 500gm 159 mannitolagar 100gm 160 salanitebroth 500gm 161|sorbitolmacconkeyagar 500gm 162 chromeagar(hicromeutlagar) |500gm | 163|xldagar |164 sabourauddextroseagar(sda) | 165 alkalinepeptonewater 500gm 500gm |500gm 166 amies/stuart media for sample 50nos. 167carryblairmediaforstooltransport 100gm 168|triplesugarlronagar 500gm 500gm | 169|peptonewater |100gm 170 simmoncitrateagar 171 ureaagarbaseforureasetest 100gm 5vl 172 ureasolutionforureasetest 100ml 173|kovacsreagent(lndolereagent) 174 glucosephosphatebroth 175 methylredindicatorsolution 500gm 125ml 100ml 176 alphanaptholfor vptest(barrita) |100ml 177 40%koh(barritb) 178 30%hydrogenperoxide(h202) 500ml 100ml 179|oxidasereagent 50disc 180|optochin 181 bacitracin |50disc 100disc 182 novobiocin 100gm pack 183 sodiumdeoxycholate |184 phpaper l to 14 185 phpaper2to10.5 186 ferricchloride pack 500gm 100gm 187 tryptonebrothforlndoletest each 188 glassmarkingpencil 189 ofmedia(glucose) s00gm 1000 nos 190 vials for storage(cryo,eppendores)b | 100gm 191 bileesculinagar |192 tsb[tryptonesoyabroth] 193 glycerol 5x200ml . t194 gramsstainkit 195 afb(zn)stainkit kit kit 196|albertstainkit kit |197|lugolslodine 198 ndianlnk 199 glasspetriplates (100mm) 200 disposablepetriplates(100mm) 201 measuringcylinder5oml |125ml 23ml each 600nos each 202 measuringcylinder 1 00ml each 203 measuringcylinder250ml each 204 conicalflasks100ml 205 conicalflasks250ml each each 206|conicalflasks500ml each 207 testtube1oml 208 maccartneybottle(100ml) each each pktofl0gm coverslips(18*18mm) 209 each 210 glassrod glassslides(76*26*0.95mm) 211 pktof5oslid| es each 212 slidetrays 213 multichannelmicropipette (30ul each 214 micropipette(10 100microlitre) 215 micropipette(100 1000microlitre) each each 500ml 216 acetone 500ml 217 70%ethanol 218 70%%ethlyalcohol 219|10%koh 220 urinecontainer0m 221 sterilestoolcontainerwithspoon 500m each 1x500 nos s0onos 222 pre sterilecottonswabs 10onos 100nos. 223 swabsticks(withtube) 224 bloodculturebottlewithoutmedia(forbhimedia)30ml each each 225 blottingpapersheet 226 ceedarwoodoil 227 testtubestand18*150[20x20mm] 100ml 4nos 228 stainingrack(rodwithstand) 229 reagentbottle (narrow mouth)125m |each each 230 plasticinforhangingdroppreparation ipkt 231 plasticdroper1 *100 |100nos 232 discardingjar 233 inoculationloop(10microlitre) | ix8nos. 234 |inoculationloop(standardforurineculture0.00 i ml) ix8nos. 235 inoculationloopholder |ix8nos. 236 spatula6 237 scissors6 each each 238|forceps6 each 239 stopwatch each 240diamondmarkerpencil each | 241 tonguedepressor 242 tissuepaperroll 243 aluminumfoil 244 filterpapersheet |each |iroll iroll each 245 bunsenburnerwithsmallgascylinder |1set 246 spiritlamp each each 100nos 247 normalsaline 248 glovesnitrile 249 paraffintape2x250 1roll 250 analytical weighing balances (cap.0.01gm 220gm) each 251 electric heater for water boiling[waterbath] each 252 thermometer1 10c,mercuryfilled each 253 autoclave thermophilus strip forinternalqualitycheck ix250 nos ix1000 nos 254 incubator thermophilus strip forinternalqualitycheck 255 0.5macfarlandsolution inos 256 0.5macfarlandunitpaper n.q. 257 vibriocholeraeantisera, polyo1 iml 258 vibriocholeraeantisera,o 139bengal 259 fecaloccultbloodtestkit 260 amikacin(30mcg) iml |ikit |5x50 261 augmentin(20/10mcg) 5x50 262 ampicillin(1 omcg) 5x50 263 cefepime(30meg) 264 cefoxitin(30meg) 5x50 5x50 265 ceftazidime(30mcg) 5x50 266 ceftriaxone(1 omcg) 5x50 267 cefuroxime(30mcg) 5x50 268 chloramphenicol(30mcg) 269 ciprofloxacin(1 omcg) 270 clindamycin(2mcg) 271 cotrimoxazole(25meg) 272 doxycycline(1 omcg 5x50 |sx50 |sx50 5x50 x 273 erythromycin(1 0meg) 5x50 274 gentamycin(1 0mcg) 5x50 275 imipenem(10mcg) 276 levofloxacin(5mcg) 5x50 5x50 277 linezolid(30mcg) 5x50 278|meropenem(1 omcg) 5x50 279 nalidixicacid(30mcg) 5x50 280 netilmicin(1omcg) 5x50 281 nitrofurantoin(300mcg) 5x50 282 norfloxacin(1 omeg) 5x50 283 ofloxacin(smog) sx50 284 oxacillin( imeg) 5x50 285|penicillin(10mcg) 5x50 286 peperacillin/tazobactam(100/10mcg) 5x50 287 teicoplanin(30mcg) |sx50 288 tetracycline(3omcg) 5x50 289 vancomycin(30mcg) ...

Rajasthan Rajya Vidhyut Utpadan Nigam Limited - Rajasthan

31837375 procurement of lab chemicals, glass wares and polythene wares for ssctpp suratgarh i hydrochloric acid ar / gr / sq / excelr / er / purifiw 2 ammonium molybdate nr / gr / sq / exce1r / er / punredw 3 sodium suiphite ar / gr ar / gr / sqiexcelr / er / punified 4 oxalic acid aw / gr / sojexce1r / er / puriendd s xylenol orange indicator ar / gr 6 nessler reagent ar / gr / sq / excelr / er / pu 7 potassium hydroride ( kok ) aw / gr / sq / excelr / er / 8 edta ( disodium salt ) ar / gr / saexcelr / er / wdu 9 potassium chromate ( k2cro4 ) aw / gr / sq / excelr / er / nr 10 phenolphthalein ar / gr / sq / exce1r / a / nw 11 methyl orange powder ar / gr / sq / excelr / er / pumrd. 12 mercuric thiocya nate ar / g r / sq / exce lr / er / piu ni fled 13 eriochrome biack t aw / gr / sq / excelr / a1w1u — luquid ammonia / ammnflium hydroxide, 25% ( gravity+o9 ) ar / gr / swexcelr / w / 1 16 isopropyl alcohol arigriso.jexce lr/e r/puri fled [17 acetic acid glacial ar/gr/sq/exce1r/m/irilfw? e g 18 hydroxyl ammifle hydrochloride ( hydroxylammoflium chloride) ar/gr/sq/excelb/u/n 19 1, 10 ihenanthrolefle (0 pienantiralifle) ar/gr/soj(xceir/e fl/punified 20 disodium hydnogen phoshpate ar/gr/sq/excelr/[f/ulff 21 potassium iodide ar/gr/sqiexc[ l r/er/purified ph lndic.ator paper (ph 1.014.0) with colour scale 22 aw/gr/sqj(xcelr/(r/puniri[d potassium chloride ar/gr/5q/excelr/er/purif led £ potassiurn permacnate (kmno4) aw/gr/sqjexair/er/purified 25 ethyl alcohol (ethanol) ar/gr/sqiexcelr/er/puriried 26 methyl alcohol ar/gr/sqjexcelr/er/purified 27 standerd iodine n/10 ar/gr/sq/excelr/er/purified 28 potassium déhydrogen phosphate ar/gr/sqjexcelr/er/purified 29 sodium hydroxide (pallet) ar/gr/sq/excelr/er/purified 30 31 hydrazlne sulphate arigr/sqjexce tr/er/purified methyl red powder ar/gr/so/exceir/er/pu rifled 32 ammonium per sulphate crystalline ar/gr/sq/excetr/er/purified 33 sodium dihydrogen phosphate ar/gr/sq/exce ir/er/purif ied/acs 34 potassium dichromate ar/gr/sq/excelr/er/purified (k2cr2o7) 35 chlorotex ir aw/gr/sqjexcelr/er/purifi(d —. 37 ph buffer capsule (ph =7.0 3 pkt) one pack of 10 tablets 38 39 ph buffer capsule (ph=9.2 3 pkt) one pack of 1o tablets karl fischer reagent ar/gr/sqjexcelr/er/ purified 40 stannous chloride arjgr/sqjexcelr/er/purified/lr 41 whatman paper 42 ar/gr/sqjexcelr/er/pu rirled 42 universal indicator ph 4 11 ar/gr/sqjexcelr/er/puri fied/lr/ep 43 hexamethylene tetramine ar/gr/sq/exceir/er/purified 44 ammonia buffer solution ar/gr/sqjexcelr/er/purified 45 lead nitrate ar/gr/sqjexcei.r/er/ purified 46 1 n hydrochloric acid ampule (cvs) ar/gr/sgjexcelr/er/puniri[o 47 1n naoh ampule (cvs) ar/gr/sq/excelr/er/puririeo 4s nflo sulphuric acid ampule (cvs) ar/gr/sqj[xcelrier/purified | n/ 10 sodium tnio sulphate ampule aw/gr/sqjexcelr/rw/purlf1ed s0 1 lexaminc powder ar/gr/sq/excelr/er/pun1fied s1 sodiun ncetate ar/gr/sqiexcelr/er/purifieo/1r/sq s2 1 amino 2 napthol 4 sulphonic acid aw/gr/sqjexcelr/er/purifie d 53 ammonium chloride ar/gr/sqiexcelr/er/punif 54 ammoniun acetate ar/gr/sqjexcelr/er/pualf s5 ammonium oxalate ar/gr/sojexcelr/er/purif led 56 ncetone ar/gr/sq/exceur/er/purificd s7 ammonlum buffer ar/gr/sq/exceur/er/purlfi s8 rerrous ammonium sulphate ar/gr/sqiexcelr/er/punified 59 nitric acid ar/gr/sq/excelr/erinunified 60 silver nitrate aw/gr/sq/excelr/er/puafrd? 61 sodium meta bisuiphite ar/gr/swexcelr/ew/purdf 62 xylene ar/grisq/excelrieripunified 63 ferric nitrate aw/gr/sqjexchrieripunified 64 sodium potassium ta rtarate ar/gr/sqjexcelrier/pu rifled b glass wares ____e 65 sariorius filter paper cellulose iitraie i7mm dia pore iize 0.45 inn,cataloguenoll3c6 — 66 specific gravity glass hydrometer range 50o 100o 67 specific gravity glass hydrometer range 10o0 200o 68 specific gravity glass hydrometpr range 1000 120o 69 specific grawity glass hydrometer range 1.4 1.6 70 graduated cyiriders single meiric scale 1000 ml wiii rour out with _______ certictate graduated cyinders single metric scale 500 ml with pour out with certlcfate — graduated cyinders single metric scale 250m1 with pour out with __________________ . certicfate graduated cyinders single metric scale 100 ml with pour out with certicf ate 6raduated cyinders single metric scale 50 ml with pour out with . certiclate 72 73 74 graduated cyinders single metric scale 25 ml wnth pour out with certicfate 76 c — graduated cyinders single metric scale 10 ml with pour out with certiclate polythene wares 77 78 chloroform bledder pipette bulb 79 bottle polythene with screw cap inner lid 500 ml 80 bottle polythene with screw cap inner lid 1000 ml 81 beakers griffin low form with spout 1oomi 82 beakers griffin low form with spout 2s0 ml 83 beakers griffin low form with spout 5oo ml ...

National Institute Of Ayurveda - Rajasthan

31740943 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

National Institute Of Ayurveda - Rajasthan

31672736 tender for supply of laboratory chemicals for rrdr project tender for supply of laboratory chemicals for rrdr project , 1 naphthol ( gr ) ( merck ) 100 gm , acetic acid glacil ( gr ) ( merck ) 500 ml , acetone ( ar ) ( merck ) 2.5 ltr , ammonia solution 25% ( gr ) ( merck ) 2.5 ltr , benedicts reagent ( qc ) ( merck ) 500 ml , buffer capsules ph 4.00±0.05 10 ( std. ) ( merck ) 10 tb , buffer capsules ph 7.00±0.05 10 ( std. ) ( merck ) 10 tb , chloroform ( gr ) ( merck ) 2.5 ltr , copper sulfate ( gr ) ( merck ) 500 gm , cyclohexane ( gr ) ( merck ) 2.5 ltr , dextrose ( gr ) ( merck ) 500 gm , diethyl ether ( gr ) ( merck ) 500 ml , ethyl acetate ( gr ) ( merck ) 2.5 ltr , fast green ( merck ) 5 gm , fehlings solution a ( merck ) 500 ml , fehlings solution b ( merck ) 500 ml , ferric chlorideanhydrous emplura ( merck ) 500 gm , formic acid 100% ( gr ) ( merck ) 500 ml , hydrochloric acid ( 37% ) ( gr ) ( merck ) 2.5 ltr , hydrogen peroxide 30% ( gr ) ( merck ) 500 ml , iodine resublimed ( gr ) ( merck ) 100 gm , lead acetate trihydrate ( gr ) ( merck ) 500 gm , mercuric chloride ( gr ) ( merck ) 100 gm , methanol ( gr ) ( merck ) 2.5 ltr , methyl red ( merck ) 25 gm , methylene blue alk. lofflers ( merck ) 125 ml , ninhydrin ( gr ) ( merck ) 25 gm , nitric acid ( 69% ) ( gr ) ( merck ) 500 ml , perchloric acid ( 60% ) ( gr ) ( merck ) 500 ml , phenol ( gr ) ( merck ) 500 gm , phenolphthalein ( merck ) 50 gm , phloroglucinol ( gr ) ( merck ) 25 gm , polyethylene glycol ( merck ) 500 ml , potassium chlorate ( merck ) 500 gm , potassium dichromate ( acs ) ( merck ) 500 gm , potassium iodide ( ar ) ( merck ) 500 gm , potassium permanganate ( gr ) ( merck ) 500 gm , pyridine solution ( gr ) ( merck ) 500 ml , rochelle salt ( gr ) ( merck ) 500 gm , ruthenium red 99% ( merck ) 250 mg , sodium bic ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium c ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium chloride ( gr ) ( merck ) 500 gm , sodium diethyldithioc ( ar ) bamate ( gr ) ( merck ) 100 gm , sodium hydroxide ( gr ) ( merck ) 500 gm , sodium phospate monobasic ( merck ) 500 gm , sodium phosphate dibasic ( merck ) 500 gm , sodium sulfate ( gr ) ( merck ) 500 gm , sodium thiosulfate ( gr ) ( merck ) 500 gm , st ( ar ) ch ( gr ) ( merck ) 500 gm , sudan red 3 ( 85% ) ( merck ) 25 gm , sulfuric acid ( gr ) ( merck ) 500 ml , terti ( ar ) y butyl alcohol ( ar ) ( merck ) 500 ml , tetramethylammonium hydroxide ( merck ) 250 ml , thioglycollic acid ( 80% ) ( merck ) 500 ml , toluene ( gr ) ( merck ) 2.5 ltr , trichloroacetic acid ( merck ) 500 gm , zinc acetate ( ar ) ( merck ) 500 gm , aluminium chloride ( ar ) ( cdh ) 250 gm , amberlite ira 400 exchange resin ( cdh ) 500 gm , ammonium oxalate ( ar ) ( cdh ) 500 gm , ammonium sulphate ( ar ) ( cdh ) 500 ml , ( ar ) senic solution std. ( cdh ) 100 ml , benzene ( ar ) ( cdh ) 2.5 ltr , blue tetrazolium ( ar ) ( cdh ) 1 gm , bromine water ( ar ) ( cdh ) 100 ml , camphor 95% std. ( cdh ) 100 gm , canada balsam ( synthetic ) ( cdh ) 500 ml , c ( ar ) bon tetrachloride 99.5% ( ar ) ( cdh ) 500 ml , citric acid ( ar ) ( cdh ) 500 gm , diphenylthioc ( ar ) bazone ( ar ) ( cdh ) 25 gm , dpx ( cdh ) 250 ml , eosin ( cdh ) 125 ml , ethanol 99% ( cdh ) 5 ltr , folin ciocalteus phenol reagent ( cdh ) 100 ml , formaldehyde ( ar ) ( cdh ) 2.5 ltr , gelatin ( cdh ) 500 gm , glycerin ( ar ) ( cdh ) 2.5ltr , glucose ( cdh ) 500 gm , hydroxylamine hydrochloride ( ar ) ( cdh ) 100 gm , indigo c ( ar ) mine ( ar ) ( cdh ) 25 gm , lead solution stand ( ar ) d ( cdh ) 100 ml , magnesium metal ( cdh ) 500 gm , mercuric nitrate ( ar ) ( cdh ) 100 gm , millons’ reagent ( cdh ) 500 ml , n hexane ( er ) ( cdh ) 2.5 ltr , p anisaldehyde ( cdh ) 250 ml , p ( ar ) affin wax ( cdh ) 2 kg , petroleum ether ( ar ) ( cdh ) 2.5 ltr , phenol red ( ar ) ( cdh ) 5 gm , phosphomolybdic acid ( cdh ) 25 gm , picric acid ( ar ) ( cdh ) 500 gm , potassium hydroxide ( ar ) ( cdh ) 500 gm , potassium mercuri iodide ( ar ) ( cdh ) 100 gm , safranine 90% ( cdh ) 25 gm , sodium ( ar ) senate ( ar ) ( cdh ) 250 gm , sucrose ( ar ) ( cdh ) 500 gm , thymol blue ( cdh ) 125 ml , vanillin ( ar ) ( cdh ) 100 gm , xylene ( ar ) ( cdh ) 500 ml , zinc metal ( ar ) ( cdh ) 500 gm , chloral hydrate ( ar / lr ) ( reidel ) 500 gm...

Medical Health And Family Welfare - Rajasthan

31636681 supply of lab reagents in bangur hospital pali for the year 2022 23 supply of lab 1 a.p.t.t 3ml j.mitra/arkery/transasia 2 a.s.o. latex with control 100 test aspen/arkery/tulip/expedia 3 absolute alcohol 500 ml ankem/biolab/b.d.h/c.d.h 4 acetotone test powder 100 gr. rankem/biolab/b.d.h/c.d.h 5 acid phosphate kit 8 ml accurex/erba/semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem/biolab/b.d.h/c.d.h 8 albert stain b 500 ml rankem/biolab/b.d.h/c.d.h 9 albumin kit 5x50 ml accurex/erba/ semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex/erba/semens 12 amylase liquid stable 6x6 ml accurex/erba/semens 13 anti a monoclonal 10 ml tulip/arkery/ortho/j.mitra 14 anti a1 5 ml tulip/arkery/ortho/j.mitra 15 anti ab 10 ml tulip/arkery/ortho/j.mitra 16 anti b monoclonal 10 ml tulip/arkery/ortho/j.mitra 17 anti d igm monoclonal 10 ml tulip/arkery/ortho/j.mitra 18 anti d rhod igg igm polyclonal 10 ml tulip/arkery/ortho/j.mitra 19 anti h 5 ml tulip/arkery/ortho/j.mitra 20 anti human globin 10 ml tulip/arkery/ortho/j.mitra 21 aptt 3 ml j.mitra/arkery/transasia 22 aqua 4 water 1 ltr accurex/erba/semens 23 barium cloride 10 % 500 ml rankem/biolab/b.d.h/c.d.h 24 beaker glass 100 ml per pcs borosil 25 beaker glass 200 ml per pcs borosil 26 beaker glass 500 ml per pcs borosil 27 bile pigment rapid biolab/microexpree/titan 28 billrubin t&d 4x60 ml accurex/erba/ semens/randox 29 bleaching powder 1 kg isi 30 blood bag quardipal sagam per pcs mitra/hll/panpol 31 blood bags 100 ml per pcs mitra/hll/panpol 32 blood bags 350 ml per pcs mitra/hll/panpol 33 blood bags triple sagam per pcs mitra/hll/panpol 34 blood bags weighing machine per pcsisi 35 blood lancet 100 pcs isi 36 bovin albumin 10% 10 ml tulip/arkery/ortho/j.mitra 37 c.k. mb kit 2x8/2x2 ml accurex/erba/ semens/randox 38 c.k. nac kit 2x8/2x2 ml accurex/erba/ semens/randox 39 c.r.p. latex with control 100 test arkery/aspen/accurex/expedia/tulip 40 c.r.p. turbilatex 50 ml accurex/erba/horiba 41 c.s.f. chloride 2x50 ml accurex/erba/ semens 42 c.s.f. protin 2x50 ml accurex/erba/ semens 43 calcium kit 2x50 ml accurex/erba/ semens/randox 44 capilary tube 1x100 pcs top tech/merinfield/labtech 45 centifuse machine 16 tube ce certified per pcs remi/ appendrop/ isi 46 centifuse machine 32 tubece certified per pcs remi/ eppendrof/ isi 47 centifuse machine 8 tube cecertified per pcsremi/ eppendorf/ isi 48 chikanguniya elisa kit 96 test j.mitra/s.d. biosensor/novatech 49 chikguniya card igg/igm per card j.mitra/s.d./meril 50 cholestrol kit 5x20 ml accurex/erba/ semens/randox 51 combistix 100 st semens/erba/accurex 52 counting chamber per pcs top tech/merinfield/labtech 53 cover slip english glass 18 mm 200 gr bluestar/borosil/merinfield 54 cover slip english glass 22 mm 200 gr bluestar/borosil/merinfield 55 creatitine kit 4x60 ml accurex/erba/ semens 56 cuppling jar per pcs polylab/abdos/labtech 57 deionized water 5 ltr ases/jupiter/vardhmaan 58 dengue duo ns1,igg,igm per card j.mitra/s.d. biosensor/meril 59 dengue elisa igg 96 test j.mitra/s.d. biosensor/meril 60 dengue elisa igm 96 test j.mitra/s.d. biosensor/meril 61 dengue elisa ns1 96 test j.mitra/s.d. biosensor/meril 62 dengue igg/igm rapid card per card j.mitra/s.d. biosensor/meril 63 dengue ns1 rapid card per card j.mitra/s.d. biosensor/meril 64 disposable e.s.r. pippeteper pcs lab tech/top tech/premier plus 65 disposable needle noa. 22 per pcs b.d./dispovan/nipro 66 disposable syringe 2 cc per pcs b.d./dispovan/nipro 67 disposable syringe 5 cc per pcs b.d./dispovan/nipro 68 disposable syringe 10 cc per pcs b.d./dispovan/nipro 69 distil water 5 ltr ases/jupiter/vardhmaan 70 drabkin solution 1 ltr ases/jupiter/vardhmaan 71 dry bath incubater per pcs isi 72 e.d.t.a. solution 500 ml rankem/biolab/b.d.h/c 73 e.s.r. felling vial per pcs rankem/biolab/b.d.h/c.d.h 74 e 10 stand per kit top tech/lab tech/premier plus 75 eosnophil counting fluid 100 ml rankem/biolab/b.d.h/c.d.h 76 ethnol 95%absolute 500 ml rankem/biolab/b.d.h/c.d.h 77 examination gloves 100 pcs hll/ttk/nulife 78 face mask 3 ply(sigle pack) per pcs nulife/mcare/romson 79 field stain a500 ml rankem/biolab/b.d.h/c.d.h 80 field stain b 500 ml rankem/biolab/b.d.h/c.d.h 81 filter paper 13.5 cm 100 leavs whatman/axiva/ no1 82 formalline5 ltr rankem/biolab/b.d.h/c.d.h 83 fouchest reagents 125 ml rankem/biolab/b.d.h/c.d.h 84 giemsa stain 500 ml rankem/biolab/b.d.h/c.d.h 85 glucose kit 2x200 ml accurex/erba/ semens 86 glass marking pencil (1 pcs.) 87 grams stain kit 500 ml rankem/biolab/b.d.h/c.d.h 88 gulcosign strips per strips gulcosign 89 h.a.v. elisa igg 96 test c.t.k/meril/j.mitra/s.d. 90 h.a.v. igg card 96 test c.t.k/meril/j.mitra/s.d. 91 h.b. meter squre per pcs toptech/premierplus/merinfield 92 h.b. meter round per pcs 93 h.b. pipeete per pcs toptech/premierplus/merinfield 94 h.b. tube squre per pcs toptech/premierplus/merinfield 95 hb 301 micro cuvette per pcs. toptech/premierplus/merinfield 96 h.c.l. n/10 solution 500 ml rankem/biolab/b.d.h/c.d.h 97 h.c.v. tri dot cardper cardit shouldbe 4th generation. it shouldbe based on flow through technolog it should must have a long shelf life & only in the form of card not in theform of strips.it shouldbe approved and evaluaed by nib .it shouldbe short interpretation time not more than 3 5 minutes.it should have specificity and sensitivity of 100%j.mitra 98 h.c.v.elisa 4 th gen96 test wells coated with synthetic peptide including ns3,ns4,ns5 and core sensitivity should be over 99.8% of whoand nib panels.specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity.should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. j.mitra/meril/g.b.c/erba/ 99 h.e.v. elisa igm 96 test meril/j.mitra/s.d. 100 h.e.v. igm card per card meril/j.mitra/s.d. 101 h.i.v. tri dot + ag (4th generation)per cardit should be 4th generation.it should be based on flow through technolog with dual detectionssystem.(synthetic peptide & recombinent).it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who (naco). j.mitra/meril/s.d. biosensor 102 h.i.v. tri dot cardper cardit should be 3th generation.it should be based on flow through technolog with dual detectionssystem.(synthetic peptide & recombinent).it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who (naco). j.mitra/s.d.biosensor/meril 103 h.i.v. rapid test per card it should be direct sandwitch assay 3rd gen & detection of igm,igg & iga antibodies it should have serum,plasma,whole blood it should be sensitivity >99.50% and specificity 99.00%.it should have sample volume 10ul serum/plasma or 20ul whole blood it should be long shelf life it should be who,nari,nib approved.s.d. biosensor/erba/meril/j.mitra/ qualpro/ 104 h.i.v.elisa 4th gen it should detect hiv 1,hiv 2,hiv o and antigen p24 simultaneously (4th gen) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. should be compatible with automated as wellas manual elisa.one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel.tmb substrate should be stable ready.j.mitra/meril/erba/s.d. biosensor/g.b.c. tiwan 105 hbsag elisa kit 96 testwells coated with two or more monoclonal anti hbs (murine and human origin).should detect all subtypes e.g. ad,ay,etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. 106 should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels.specificity should be over 99.8%.tmb substrate should be ready to use.must be evaluated and approved by nib.96 test j.mitra/meril/erba/s.d. biosensor/novatech 107 incubator 18x18x18 s.s. per pcs isi 108 j.s.b. 1st stain 500 ml rankem/biolab/b.d.h/c.d.h 109 j.s.b. iindstain 500 mlrankem/biolab/b.d.h/c.d.h 110 ketodiastix50 strips semens/erba/accurex 111 l.d.h. kit accurex/erba/ semens/randox 112 lancets per pcs plaza/top tech/s.d. 113 leishmaan stain liqued 500 ml rankem/biolab/b.d.h/c.d.h 114 leishmaan stain powder 500 grrankem/biolab/b.d.h/c.d.h 115 lipase kitaccurex/erba/ semens/randox 116 malaria pf/pv ag test per test it should be based on pldh & hrp antigen detection on plastic cassette(not dipstick). infection/cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. j.mitra/s.d. bio sensor/meril/erba/ 117 measuring cylinder 50 ml (glass)per pcs. 118 measuring cylinder 100 ml (glass)per pcs. 119 measuring cylinder 250 ml (glass)per pcs. 120 measuring cylinder 500 ml (glass)per pcs. 121 measuring cylinder 50 ml (plastic)per pcs. 122 measuring cylinder 100 ml (plastic)per pcs. 123 measuring cylinder 250 ml (plastic)per pcs. 124 methnol5 ltr rankem/biolab/b.d.h/c.d.h 125 methylene blue liquid 500 ml rankem/biolab/b.d.h/c.d.h 126 micro pipeete fix fully autoclavable with 3 years warrenty per pcs tranasia/ finepipeete/thermo/durapet 127 micro pipeete variable fully autoclavable with 3 year warranty per pcs tranasia/ finepipeete/thermo/durapet 128 micro protin kit accurex/erba/ semens 129 micro tips up to 1000 ul 500 pcs gilson/ labtech/a.v.dis 130 micro tips up to 200 ul 1000 pcs gilson/ labtech/a.v.dis 131 microglass slide isi 50 slide bluestar/borosil/alphachem 132 microscope blub per pcs phillps/osram/bajaj/ 133 multi chanal pipeete with 3 years warranty per pcs tranasia /finepipeete/tjermo/durapet 134 multi stix 14 parameter (dekhaphen) 100 st semens/transasia/accurex/durai/ 135 n 95 mask per pcs romson/3m/polymed/mrk/ 136 nitral gloves 100 pcs romsom/m care/mrk/polymed 137 nitric adid 500 gr rankem/biolab/b.d.h/c.d.h 138 normal sline 500 ml rankem/biolab/b.d.h/c.d.h 139 o2 valve with humidifier per pcs isi 140 occult blood in stool 200 test tulip/accurex/biolab 141 oil immersion 100 ml rankem/biolab/b.d.h/c.d.h 142 ovan 18x18x18 s.s. per pcs isi/remi/ 143 p.p.e kit per pcs drdo approved 144 pep stain per kit 145 paper roll 50x20 mtrper roll erba 146 paper roll 57x10 mtr per roll horiba 147 paper roll 57x20 mtr per roll erba 148 pasture pipeete per pcs lab tech/top tech/a.v. consumable 149 phosphrous kit accurex/erba/ semens 150 pipeete stand per pcs plaza/top tech/expedia/labsystem 151 platlet diluting fluid 500 ml rankem/biolab/b.d.h/c.d.h 152 pregnancy card / hcg device per card acon/aspen/erba/diagnocure 153 r.a. test kit with control 100 test acurex/erba/spinreact/arkrey/biolab 154 r.b.c. diluting fluid 500 ml rankem/biolab/b.d.h/c.d.h 155 r.f. turbilatex 50 ml accurex/erba/human/arkrey/biolal 156 r.h. view box per pcs remi/ plus/top tech/alpha 157 r.p.r. test 100 test tulip/erba/acurex/human/arkrey 158 rapid pap stain 250 simmer tulip/biolab/ himedia 159 recticlusytes count fluid 100 ml rankem/biolab/b.d.h/c.d.h 160 ria tube 12x100 mm 100 pcs labtech/toptech/a.v. consumable/polylab 161 ria vial 12x100 mm 100 pcs labtech/toptech/a.v. consumable/polylab 162 room thermometer per pcs labtech/toptech/a.v. consumable/isi 163 s.g.o.t. kit 5x20 ml accurex/erba/ semens/randox 164 s.g.p.t. kit 5x20 ml accurex/erba/ semens/randox 165 sample cups from xl300 500 pcs erba/ hitachi/top tech 166 screw cap tube 13x100 100 tube labtech/polylab/a.v. cons 167 scrub typhus elisa 96 test novatech/j.mitra/s.d.biosensor/g.b.c 168 seman diluting fluid 100 ml rankem/biolab/b.d.h/c.d.h 169 slide cage per pcs labtech/toptech/a.v.co/k.d 170 slide rack per pcs labtech/toptech/a.vcon/k.d 171 slide stand per pcs labtech/toptech/a.v.co/k.d 172 slide staning rack per pcs labtech/toptech/a.v. /k.d 173 sodium citrate 3.8% 500 ml rankem/biolab/b.d.h/c.d.h 174 sodium hypochloride 8 10 % 5 ltr rankem/biolab/b.d.h/c.d.h 175 stain rack per pcs labtech/toptech/a.v./k.d 176 stethoscope per pcs litman/isi/ 177 sulpher powder 500 gr rankem/biolab/b.d.h/c.d.h 178 surgical gloves 6,7.5.7 pair m.r.k./caltex/hll/ 179 t.s.h. elisa 96 test j.mitra/erba/suyog/s.d. bio 180 t3 elisa96 test j.mitra/erba/suyog/ 181 t4 elisa 96 test j.mitra/erba/suyog/ 182 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 183 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 184 test tube brush per pcs labtech/toptech/a.v. /k.d 185 test tube stand 48 hole per pcs 186 test tube stand 96 hole per pcs 187 thermoplastin5 ml j.mitra/erba/arkery 188 timmer watch digital per pcs k.d./top tech/amron/isi 189 tincher iodine 400 ml 190 tissue paper roll per roll 191 total protin kit 5x50 ml accurex/erba/ semens/randox 192 triglycerdies kit 5x20 ml accurex/erba/ semens/randox 193 tronicate rubber per pcs 194 troponine i per card alfa/j.mitra/ accurex/diagnocure 195 troponine t per card roche 196 tsutsugamuchi card per card j.mitra/s.d. biosensor/athenesedx/ 197 tray for slide (aluminium) per pcs. 198 typhoid card igg/igm per card j.mitra/diagnocure/s.d. biosensor/ 199 urea bertlot kit 2x100 det accurex/erba/semens/randox 200 urea bun5x20 ml accurex/erba/ semens 201 uric acid kit 5x20 ml accurex/erba/ semens 202 urine continer 50 ml with sticker individually packed per pcs labtech/a.v/ top tech 203 uristix glu/ketone/pro 100 st semens/accurex/erba/transasia 204 v.d.r.l. cardper card assay for qualitative detection of all isotype of antibodies(igm,igg & iga) against treponema pallidium.it should must have a long shelf life & only in the form of card not in the form of strips.rapid card test in individual pack.it should be nib,naco,nari approvedmeril/s.d. biosensor/accurex/diagnocure 205 v.d.r.l. shaker per pcs remi/penpol/oxford/top tech 206 vacutanier clot,gel activete 13x75 mm 3 to 5ml (100 pcs) it should be made of clear latex free polyethylene terephthalate 207 batch wise sterility ,pyrogenicity and toxicity certificate should be givenit should be usfda/europen ce certified. b.d./ 208 vacutanier k2 edta 13x75 mm(100 pcs) it should be made of clear latex free polyethylene terephthalate batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified.b.d 209 vacutanier sodium citrate 13x75 mm(100 pcs)for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalatebatch wise sterility ,pyrogenicity and toxicity certificate should be givenit should be sfda/europen ce certified. b.d 210 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified.per pcs b.d 211 viral transport media 50 vial icmr approved 212 w.b.c. fluid500 ml rankem/biolab/b.d.h/c.d.h 213 water bath per pcs remi/top tech/premier plus 214 widal kit 4x5 ml per kit arkery/becon/tulip 215 xylene 500 ml rankem/biolab/b.d.h/c.d.h 216 z.n. stain 4x50 ml rankem/biolab/b.d.h/c.d.h 217 covid ag card icmr approved test icmr approved 218 covid ab card icmr approved test icmr approved 219 covid elis igg icmr approved 96 test icmr approved 220 hand santizer500 ml icmr approved 221 hand santizer 5ltr icmr approved 222 automatic hand santizer machine pcs icmr approved 223 bandaid round pcs j&j/labtech/hll/mrk 224 cryocentrifuge machine (5500i) blood bag bucket (green colour) per pc. 225 disposable needle noa. 26 & 24 per pcs b.d./dispovan/nipro 226 micro tips stand (small) per pcs. 227 micro tips stand (big) per pcs. 228 micropopette 10 ul to 100 ulper pcs. tranasia/ finepipeete/thermo/durapet 229 micropopette 100 ul to 1000 ulper pcs. tranasia/ finepipeete/thermo/durapet 230 isopropyl alcohol solution 70% (500 ml) per pcs. 231 gel card grouping per pcs.j. mitra/sd/bio/biorad 232 gel card cross matchper pcs.j. mitra/sd/bio/biorad 233 chest stand wall modelper pcs. 234 dental hangerper pcs. 235 x ray developer 13.5 ltrper pkt. 236 x ray fixer 13.5 ltr per pkt. 237 u.s.g. jelly 250 grper pcs. 238 e.c.g jelly 250 gr.per pcs. 239 e.c.g roll 8310m 210x20 ml per pcs. 240 eeg electrodeper pcs. 241 eeg pasteper pcs. 242 ecg battery digitalper pcs. 243 ecr battery for 108 tper pcs. 244 ecg beltper pcs. 245 ecg cable for digital per pcs. 246 ecg chest electrode per pcs. 247 ecg clip per pcs. 248 ecg roll for 108 tper pcs. 249 ecg roll for 6108 per pcs. 250 ecg rubber bulb per pcs. 251 ecg trolly per pcs. 252 glysrine 100 mlper bottle 253 lead aprinper pcs. 254 lead divider 7x17 per pcs. 255 tmt jelly 250 ml per pcs. 256 usg jelly 250 gr. per pcs. 257 usg printer roll per pcs. 258 usg tissue paper roll per pcs. 259 x ray cassetts 10x12per pcs. fuji/ kodak/jindal 260 x ray cassetts 12x15per pcs. fuji/ kodak/jindal 261 x ray cassetts 14x17per pcs. fuji/ kodak/jindal 262 x ray cassetts 6.5x8.5 per pcs. fuji/ kodak/jindal 263 x ray cassetts 8x10per pcs. fuji/ kodak/jindal 264 x ray film 10x12 (150 films)per pkt.fuji/ kodak/jindal 265 x ray film 12x15 (150 films)per pkt.fuji/ kodak/jindal 266 x ray film 6.5x8.5 (150 films)per pkt. fuji/ kodak/jindal 267 x ray film 8x10 (150 films)per pkt. fuji/ kodak/jindal 268 x ray hanger 10x12 269 x ray hanger12x15 270 x ray hanger 14x17 271 x ray hanger 6.5x8.5 272 x ray hanger 8x10 273 x ray screen 10x12 fuji/ kodak/jindal 274 x ray screen 12x15 fuji/ kodak/jindal 275 x ray screen 14x17 fuji/ kodak/jindal 276 x ray screen 6.5x8.5 fuji/ kodak/jindal 277 x ray screen 8x10 fuji/ kodak/jindal 278 ecg machine battery charger 279 x ray fixer 13.5 ltr. 280 tmt electrode 281 tmt report chart 282 x ray film dental 283 x ray film 14x17 284 8 x 10digital x ray film (150 films)per pkt. fuji/ kodak/jindal 285 10 x 12 digital x ray film (150 films)per pkt. fuji/ kodak/jindal 286 11 x 14 digital x ray film (150 films)per pkt. fuji/ kodak/jindal 287 14 x 17digital x ray film (150 films)per pkt. fuji/ kodak/jindal 288 dental & occlusal x ray films 57x76 mm fuji/ kodak/jindal 289 imaging plate and cassettes(c.r.system) 08”x10” fuji/ kodak/jindal 290 imaging plate and cassettes(c.r.system) 10”x12” fuji/ kodak/jindal 291 imaging plate and cassettes(c.r.system) 14”x17” fuji/ kodak/jindal 292 protactive screen (mobile) lead barriar with lead glass window ...

Medical And Health Services - Rajasthan

31629658 supply of lab reagents n bangur hospital pali for the year 2022 23 1 a.p.t.t 3ml j.mitra/arkery/transasia 2 a.s.o. latex with control 100 test aspen/arkery/tulip/expedia 3 absolute alcohol 500 ml rankem/biolab/b.d.h/c.d.h 4 acetotone test powder 100 gr. rankem/biolab/b.d.h/c.d.h 5 acid phosphate kit 8 ml accurex/erba/semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem/biolab/b.d.h/c.d.h 8 albert stain b 500 ml rankem/biolab/b.d.h/c.d.h 9 albumin kit 5x50 ml accurex/erba/ semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex/erba/semens 12 amylase liquid stable 6x6 ml accurex/erba/semens 13 anti a monoclonal 10 ml tulip/arkery/ortho/j. mitra 14 anti a1 5 ml tulip/arkery/ortho/j. mitra 15 anti ab 10 ml tulip/arkery/ortho/j. mitra 16 anti b monoclonal 10 ml tulip/arkery/ortho/j. mitra 17 anti d igm monoclonal 10 ml tulip/arkery/ortho/j. mitra 18 anti h 5 ml tulip/arkery/ortho/j. mitra 19 anti human globin 10 ml tulip/arkery/ortho/j. mitra 20 aqua 4 water 1 ltr accurex/erba/semens 21 barium cloride 10 % 500 ml rankem/biolab/b.d.h/c.d.h 22 beaker glass 100 ml per pcs borosil 23 beaker glass 200 ml per pcs borosil 24 beaker glass 500 ml per pcs borosil 25 bile pigment rapid biolab/ microexpres/ titan 26 billrubin t&d 4x60 ml accurex/ erba/semens/randox 27 bleaching powder 1 kg isi 28 blood bag quardipal sagam per pcs mitra/hll/panpol 29 blood bags 100 ml per pcs mitra/hll/panpol 30 blood bags 350 ml per pcs mitra/hll/panpol 31 blood bags triple sagam per pcs mitra/hll/panpol 32 blood bags weighing machine per pcs isi 33 blood lancet 100 pcs isi 34 bovin albumin 10% 10 ml tulip/arkery/ortho/j. mitra 35 c.k. mb kit 2x8/2x2 ml accurex/ erba/semens/randox 36 c.k. nac kit 2x8/2x2 ml accurex/ erba/semens/randox 37 c.r.p. latex with control 100 test arkery/aspen/accurex/ expedia/tulip 38 c.r.p. turbilatex 50 ml accurex/erba/horiba 39 c.s.f. chloride 2x50 ml accurex/erba/ semens 40 c.s.f. protin 2x50 ml accurex/erba/ semens 41 calcium kit 2x50 ml accurex/ erba/semens/randox 42 capilary tube 1x100 pcs top tech/ merinfield/labtech 43 centifuse machine 16 tube ce certified per pcs remi/ appendrop/ isi 44 centifuse machine 32 tubece certified per pcs remi/ eppendrof/ isi 45 centifuse machine 8 tube cecertified per pcs remi/ eppendorf/ isi 46 chikanguniya elisa kit 96 test j.mitra/s.d.biosensor/novatech 47 chikguniya card igg/igm per card j.mitra/s.d./meril 48 cholestrol kit 5x20 ml accurex/ erba/semens/randox 49 combistix 100 st semens/erba/accurex 50 counting chamber per pcs top tech/ merinfield/labtech 51 cover slip english glass 18 mm 200 gr bluestar/borosil/meri nfield 52 cover slip english glass 22 mm 200 gr bluestar/borosil/meri nfield 53 creatitine kit 4x60 ml accurex/erba/ semens 54 cuppling jar per pcs polylab /abdos/labtech 55 deionized water 5 ltr ases/jupiter/vardhmaan 56 dengue duo ns1,igg,igm per card j.mitra/s.d. biosensor/ meril 57 dengue elisa igg 96 test j.mitra/s.d. biosensor/ meril 58 dengue elisa igm 96 test j.mitra/s.d. biosensor/ meril 59 dengue elisa ns1 96 test j.mitra/s.d. biosensor/ meril 60 dengue igg/igm rapid card per card j.mitra/s.d. biosensor/ meril 61 dengue ns1 rapid card per card j.mitra/s.d. biosensor/ meril 62 disposable e.s.r. pippete per pcs lab tech/top tech/ premier plus 63 disposable needle per pcs b.d./dispovan/nipro 64 disposable syringe 3 cc per pcs b.d./dispovan/nipro 65 disposable syringe 5 cc per pcs b.d./dispovan/nipro 66 distal water 5 ltr ases/jupiter/vardhmaan 67 drabkin solution 1 ltr ases/jupiter/vardhmaan 68 dry bath incubater per pcs isi 69 e.d.t.a. solution 500 ml rankem/biolab/b.d.h/c 70 e.s.r. felling vial per pcs rankem/biolab/b.d.h/c.d.h 71 e 10 stand per kit top tech/lab tech/ premier plus 72 eosnophil counting fluid 100 ml rankem/biolab/b.d.h/c.d.h 73 ethnol absolute 500 ml rankem/biolab/b.d.h/c.d.h 74 examination gloves 100 pcs hll/ttk/nulife 75 face mask 3 ply(sigle pack) per pcs nulife/mcare/romson 76 field stain a 500 ml rankem/biolab/b.d.h/c.d.h 77 field stain b 500 ml rankem/biolab/b.d.h/c.d.h 78 filter paper 13.5 cm 100 leavs whatman/axiva/ no1 79 formalline 5 ltr rankem/biolab/b.d.h/c.d.h 80 fouchest reagents 125 ml rankem/biolab/b.d.h/c.d.h 81 giemsa stain 500 ml rankem/biolab/b.d.h/c.d.h 82 glucose kit 2x200 ml accurex/erba/ semens 83 grams stain kit 500 ml rankem/biolab/b.d.h/c.d.h 84 gulcosign strips per strips gulcosign 85 h.a.v. elisa igg 96 test c.t.k/meril/j.mitra/s.d. 86 h.a.v. igg card 96 test c.t.k/meril/j.mitra/s.d. 87 h.b. meter squre per pcs toptech/premierplus/m erinfield 88 h.b. pipeete per pcs toptech/premierplus/m erinfield 89 h.b. tube squre per pcs toptech/premierplus/m erinfield 90 h.c.l. n/10 solution 500 ml rankem/biolab/b.d.h/c.d.h 91 h.c.v. tri dot card it should be 4th generation. it should be based on flow through technolog. it should must have a long shelf life & only in the form of card not in the form of strips. it should be approved and evaluaed by nib . it should be short interpretation time not more than 3 5 per card j.mitra minutes. it should have specificity and sensitivity of 100% 92 h.c.v.elisa 4 th gen wells coated with synthetic peptide including ns3,ns4,ns5 and core. sensitivity should be over 99.8% of whoand nib panels. specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity and specificity. should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. 96 test j.mitra/meril/g.b.c/erba / 93 h.e.v. elisa igm 96 test meril/j.mitra/s.d. 94 h.e.v. igm card per card meril/j.mitra/s.d. 95 h.i.v. tri dot + ag (4th generation) it should be 4th generation. it should be based on flow through technolog with dual detections system.(synthetic peptide & recombinent). it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips. it should be short interprepation time 3 to 5 minutes. it should be approved and evaluaed by nib , nari and who (naco). per card j.mitra/meril/s.d. biosensor 96 h.i.v. tri dot card it should be 3th generation. it should be based on flow through technolog with dual detections system.(synthetic peptide & recombinent). it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips. it should be short interprepation time 3 to 5 minutes. it should be approved and evaluaed by nib , nari and who (naco). per card j.mitra/s.d.biosensor/m eril 97 h.i.v. rapid test it should be direct sandwitch assay 3rd gen & detection of igm,igg & iga antibodies it should have serum,plasma,whole blood it should be sensitivity >99.50% and specificity 99.00%. it should have sample volume 10ul serum/plasma or 20ul whole blood it should be long shelf life it should be who,nari,nib approved. per card s.d. biosensor /erba/ meril/j.mitra/ qualpro/ 98 h.i.v.elisa 4th gen it should detect hiv 1,hiv 2,hiv o and antigen p24 simultaneously (4th gen) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity and specificity. should be compatible with automated as wellas manual elisa. one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel. tmb substrate should be stable ready. 96 test j.mitra/meril/erba/s.d. biosensor/g.b.c. tiwan 99 hbsag elisa kit wells coated with two or more monoclonal anti hbs (murine 96 test j.mitra/meril/erba/s.d. and human origin). should detect all subtypes e.g. ad,ay,etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity and specificity. should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels. specificity should be over 99.8%. tmb substrate should be ready to use. must be evaluated and approved by nib. biosensor/novatech 100 incubater 18x18x18 s.s. per pcs isi 101 j.s.b. 11nd stain 500 ml rankem/biolab/b.d.h/c.d.h 102 j.s.b. 1st stain 500 ml rankem/biolab/b.d.h/c.d.h 103 ketodiastix 50 strips semens/erba/accurex 104 l.d.h. kit accurex/reba/semens/randox 105 lancets per pcs plaza/top tech/s.d. 106 leishmaan stain liqued 500 ml rankem/biolab/b.d.h/c.d.h 107 leishmaan stain powder 500 gr rankem/biolab/b.d.h/c.d.h 108 lipase kit accurex/reba/semens/randox 109 malaria pf/pv ag test it should be based on pldh & hrp antigen detection on plastic cassette(not dipstick). infection/cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. each j.mitra/s.d. bio sensor/ meril/erba/ 110 methnol 5 ltr rankem/biolab/b.d.h/c.d.h 111 methylene blue liquid 500 ml rankem/biolab/b.d.h/c.d.h 112 micro pipeete fix fully autoclavable with 3 years warrenty per pcs transasasia/finepipeete/thermo / durapet 113 micro pipeete variable fully autoclavable with 3 year warranty per pcs transasasia/finepipeete/thermo / durapet 114 micro protin kit accurex/erba/ semens 115 micro tips up to 1000 ul 500 pcs gilson/ labtech/a.v.dis 116 micro tips up to 200 ul 1000 pcs gilson/ labtech/a.v.dis 117 microglass slide isi 50 slide bluestar/borosil/alph achem 118 microscope blub per pcs phillps/osram/bajaj/ 119 multi chanal pipeete with 3 years warranty per pcs transasasia/finepipeete/thermo / durapet 120 multi stix 14 parameter (dekhaphen) 100 st semens/transasia/accu rex/durai/ 121 n 95 mask per pcs romson/3m/polymed/mrk 122 nitral gloves 100 pcs romson/m care/mrk/polymed 123 nitric adid 500 gr rankem/biolab/b.d.h/c.d.h 124 normal sline 500 ml rankem/biolab/b.d.h/c.d.h 125 o2 valve with humidifier per pcs isi 126 occult blood in stool 200 test tulip/accurex/biolab 127 oil immersion 100 ml rankem/biolab/b.d.h/c.d.h 128 ovan 18x18x18 s.s. per pcs isi/remi/ 129 kit 130 p.p.e kit per pcs drdo approved 131 paper roll 50x20 mtr per roll erba 132 paper roll 57x10 mtr per roll horiba 133 paper roll 57x20 mtr per roll erba 134 pasture pipeete per pcs lab tech/top tech/a.v. consumable 135 phosphrous kit accurex/erba/ semens 136 pipeete stand per pcs plaza/top tech/expedia /labsystem 137 platlet diluting fluid 500 ml rankem/biolab/b.d.h/c.d.h 138 pregnancy card per card acon/aspen/erba/diagnocure 139 r.a. test kit with control 100 test acurex/erba/spinreact/arkrey/b iolab 140 r.b.c. diluting fluid 500 ml rankem/biolab/b.d.h/c.d.h 141 r.f. turbilatex 50 ml accurex/erba/human/arkrey/bi olal 142 r.h. view box per pcs remi/ plus/top tech/alpha 143 r.p.r. test 100 test tulip/erba/acurex/human/arkr ey 144 rapid pap stain 250 simmer tulip/biolab/ himedia 145 recticlusytes count fluid 100 ml rankem/biolab/b.d.h/c.d.h 146 ria tube 12x100 mm 100 pcs labtech/toptech/a.v. consumable/polylab 147 ria vial 12x100 mm 100 pcs labtech/toptech/a.v. consumable/polylab 148 room thermometer per pcs labtech/toptech/a.v. consumable/isi 149 s.g.o.t. kit 5x20 ml accurex/erba/ semens/randox 150 s.g.p.t. kit 5x20 ml accurex/erba/ semens/randox 151 sample cups from xl300 500 pcs erba/ hitachi/top tech 152 screw cap tube 13x100 100 tube labtech/polylab/a.v. cons 153 scrub typhus elisa 96 test novatech/j.mitra/s.d.biosenso r/g.b.c 154 seman diluting fluid 100 ml rankem/biolab/b.d.h/c. d.h 155 slide cage per pcs labtech/toptech/a.v.co/k.d 156 slide rack per pcs labtech/toptech/a.vcon/k.d 157 slide stand per pcs labtech/toptech/a.v.co/k.d 158 slide staning rack per pcs labtech/toptech/a.v. /k.d 159 sodium citrate 3.8% 500 ml rankem/biolab/b.d.h/c.d.h 160 sodium hypochloride 8 10 % 5 ltr rankem/biolab/b.d.h/c.d.h 161 stain rack per pcs labtech/toptech/a.v./k.d 162 stethoscope per pcs litman/isi/ 163 sulpher powder 500 gr rankem/biolab/b.d.h/c.d.h 164 surgical gloves 6,7.5.7 pair m.r.k./caltex/hll/ 165 t.s.h. elisa 96 test j.mitra/erba/suyog/s.d. bio 166 t3 elisa 96 test j.mitra/erba/suyog/ 167 t4 elisa 96 test j.mitra/erba/suyog/ 168 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 169 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 170 test tube brush per pcs labtech/toptech/a.v. /k.d 171 thermoplastin 5 ml j.mitra/erba/arkery 172 timmer watch digital per pcs k.d./top tech/amron/isi 173 tincher iodine 400 ml 174 tissue paper roll per roll 175 total protin kit 5x50 ml accurex/erba/ semens/randox 176 triglycerdies kit 5x20 ml accurex/erba/ semens/randox 177 tronicate rubber per pcs 178 troponine i per card alfa/j.mitra/ accurex/diagnocure 179 troponine t per card roche 180 tsutsugamuchi card per card j.mitra/s.d. biosensor/athenesedx/ 181 typhoid card igg/igm per card j.mitra/diagnocure/s.d. biosensor/ 182 urea bertlot kit 2x100 det accurex/erba/semens/r andox 183 urea bun 5x20 ml accurex/erba/ semens 184 uric acid kit 5x20 ml accurex/erba/ semens 185 urine continer 50 ml with sticker individually packed per pcs labtech/a.v/ top tech 186 uristix glu/ketone/pro 100 st semens/accurex/erba/t ransasia 187 v.d.r.l. card assay for qualitative detection of all isotype of antibodies(igm,igg & iga) against treponema pallidium. it should must have a long shelf life & only in the form of card not in the form of strips. rapid card test in individual pack. it should be nib,naco,nari approved per card meril/s.d. biosensor/accurex /diagnocure 188 v.d.r.l. shaker per pcs remi/penpol/oxford/to p tech 189 vacutanier clot,gel activete 13x75 mm 3 to 5ml it should be made of clear latex free polyethylene terephthalate batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified. 100 pcs b.d./ 190 vacutanier k2 edta 13x75 mm it should be made of clear latex free polyethylene terephthalate batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified. 100 pcs b.d 191 vacutanier sodium citrate 13x75 mm for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalate batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified. 100 pcs b.d 192 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility ,pyrogenicity and toxicity certificate should be given it should be usfda/europen ce certified. pcs b.d 195 viral transport media 50 vial icmr approved 196 w.b.c. fluid 500 ml rankem/biolab/b.d.h/c. d.h 197 water bath per pcs remi/top tech/premier plus 198 widal kit 4x5 ml per kit arkery/becon/tulip 199 xylene 500 ml rankem/biolab/b.d.h/c.d.h 200 z.n. stain 4x50 ml rankem/biolab/b.d.h/c.d.h 201 covid ag card icmr approved test icmr approved 202 covid ab card icmr approved test icmr approved 203 covid elis igg icmr approved 96 test icmr approved 204 hand santizer 500 ml icmr approved 205 hand santizer 5ltr icmr approved 206 automatic hand santizer machine pcs icmr approved 207 bandid round pcs j&j/labtech/hll/mrk 208 chest stand wall model per pcs. 209 dental hanger per pcs. 210 x ray developer 13.5 ltr per pkt. 211 x ray fixer 13.5 ltr per pkt. 212 u.s.g. jelly 250 gr per pcs. 213 e.c.g jelly 250 gr. per pcs. 214 e.c.g roll 8310m 210x20 ml per pcs. 215 eeg electrode per pcs. 216 eeg paste per pcs. 217 ecg battery digital per pcs. 218 ecr battery for 108 t per pcs. 219 ecg belt per pcs. 220 ecg cable for digital per pcs. 221 ecg chest electrode per pcs. 222 ecg clip per pcs. 223 ecg roll for 108 t per pcs. 224 ecg roll for 6108 . per pcs. 225 ecg rubber bulb per pcs. 226 ecg trolly . per pcs. 227 glysrine 100 ml per bottle per bottle 228 lead aprin . per pcs. 229 lead divider 7x17 per pcs. 230 tmt jelly 250 ml per pcs. 231 usg jelly 250 gr. per pcs. 232 usg printer roll per pcs. 233 usg tissue paper roll per pcs. 234 x ray cassetts 10x12 per pcs. 235 x ray cassetts 12x15 per pcs. 236 x ray cassetts 14x17 per pcs. 237 x ray cassetts 6.5x8.5 per pcs. 238 x ray cassetts 8x10 per pcs. 239 x ray film 10x12 (150 films) per pkt. 240 x ray film 12x15 (150 films) per pkt. 241 x ray film 6.5x8.5 (150 films) per pkt. 242 x ray film 8x10 (150 films) per pkt. 243 x ray hanger 10x12 per pcs. 244 x ray hanger12x15 per pcs. 245 x ray hanger 14x17 per pcs. 246 x ray hanger 6.5x8.5 per pcs. 247 x ray hanger 8x10 per pcs. 248 x ray screen 10x12 per pcs. fuji/ kodak/jindal 249 x ray screen 12x15 per pcs. fuji/ kodak/jindal 250 x ray screen 14x17 per pcs. fuji/ kodak/jindal 251 x ray screen 6.5x8.5 per pcs. fuji/ kodak/jindal 252 x ray screen 8x10 per pcs. fuji/ kodak/jindal 253 ecg machine battery charger per pcs. 254 tmt electrode 255 tmt report chart 256 x ray film dental per pkt. fuji/ kodak/jindal 257 x ray film 14x17 per pkt. fuji/ kodak/jindal 258 8 x 10 digital x ray film (150 films) per pkt. fuji/ kodak/jindal 259 10 x 12 digital x ray film (150 films) per pkt. fuji/ kodak/jindal 260 11 x 14 digital x ray film (150 films) per pkt. fuji/ kodak/jindal 261 14 x 17 digital x ray film (150 films) per pkt. fuji/ kodak/jindal 262 dental & occlusal x ray films 57x76 mm per pkt. fuji/ kodak/jindal 263 imaging plate and cassettes(c.r.system) 08”x10” per pcs. fuji/ kodak/jindal 264 imaging plate and cassettes(c.r.system) 10”x12” per pcs. fuji/ kodak/jindal 265 imaging plate and cassettes(c.r.system) 14”x17” per pcs. fuji/ kodak/jindal 266 protactive screen (mobile) lead barriar with lead glass window ...

Malaviya National Institute Of Technology - Rajasthan

31586771 purchase of chemicals for chemical engg. deptt. 1. acetone cdh ( 2 faculty ) 2.5ltrx3 20.0ltr loba 2.5ltr.x1 rankem 2ltrx1 fisher scientific 500mlx4 99% for synthesis ( hplc ) 2.5 ltrx1 500mlx14 rankem 99.5% 500mlx3 2. acetonitrile for hplc ( >99% ) hplc ( >99% ) spectrochem 5 ltr.x1 17.5ltrloba ( hplc ) 2.5ltr.x3 hplc grade ( srl ) 2.5mlx2 3. ammonium chloride merck 500gmx1 1kg 4. activated carbon granular loba chemie, size: 1.5 mm 2x500g 1kg 5. amy alcohol sri sai baba chemicals industries 1ltr.x1 1 ltr 6. ammonium sulfate ( nh4 ) 2so4 500gx1 500gm 7. aluminum hydroxide 500gx1 500gm 8. ammonium dihydrogen phosphate cdh 500gmx1 500gm 9. acetic acid glacial lr 500mlx3 10. boric acid 500mlx1 500ml 11. bismuth nitrate cdh 100 gmx1 100gm 12. n butanol ( gc grade ) 99.5% gc grade ( hplc ) 2.5 ltrx1 2. 5ltr 13. cyclohexane loba chemie 2.5lx1 2.5ltr 14. choline chloride loba chemical 500gmx4 5.0kg99% extra pure ( hplc ) 500 gmx1 98% extra pure 500gx5 15. chlorella vulgaris ( algae ) krishpa biotech p.l. 2kgx1 2kg 16. citric acid srl 500gmx1 500gm 17. calcium nitrate srl 500gmx1 500gm 18. cerium nitrate loba 100gmx1 100gm 19. copper oxide ( 99% ) otto 500gmx1 500gm 20. cerous nitrate hexa hydrate ( 99.9% ) 100gm loba 100gmx4 400gm 21. cadmium nitrate loba chemie 500gx1 500gm 22. cadmium sulfide ( pigment yellow ) sigma aldrich 100gmx1 100gm 23. cadmium selenide ( pigment red ) sigma aldrich 100gmx1 100gm 24. carboxymethyl cellulose merck india 500 gx1 500gm 25. cetyl pyridinium chloride alg chemicals 100gmx1 100gm 26. carbon tetra chloride loba 1ltr.x1 1 ltr 27. conductivity buffer tablets 3x1 3 28. di methyl sulfoxide fisher scientific 500mlx 2 1 ltr 29. di methyl formamide fisher scientific 500ml x 2 1 ltr 30. di ethyl phthalate sigma aldrich 100ml 100ml 31. 1, 1 diethoxybutane sigma aldrich 250mgx1 250mg 32. di ( 2 ethylhexyl ) phosphate tci 500 mlx1 500ml 33. dl tartaric acid 99%, hplc 500 gmx1 500gm 34. decanoic acid 98.5 100.05% for synthes ( hplc ) 500 mlx1 500ml 35. di ammonium hydrogen phosphate cdh 500gmx1 500gm 36. diethylenetriaminepentakis ( methylphosphonic acid ) solution ( dtpmpa ) sigma 100mlx1 100 ml 37. ethanol ( merck, german ) 500mlx10 23.5 ltr css 500mlx5 germany 3ltr ar 500mlx4 css 2.5ltrx2 2ltr merck 500mlx1 99.9% pure 500mlx12 38. ethyl acetate 99 % pure rankem 2.5ltr x4 18.5ltr 1 ltr x1 qualikem 2.5ltrx3 39. ethylene glycol srl 500gmx1 500gm &2.5ltr99% pure 500mlx5 40. erichrome black t indicator ( loba chemie ) 100 gx1 100gm sigma aldrich 100gmx1 41. edta 2 l 2ltr 42. formic acid ( >98% ) spectrochem 500 mlx1 500ml 43. ferroin indicator rankem 100mlx1 300ml 100mlx1 rankem 50ml x2 44. ferrous ammonium sulphate rankem 500gmx1 500gm 45. folin ciocalteu reagent fischer scientific ( ar grade ) 10x100 ml 1 ltr 46. fas 500gx1 500gm 47. ferrous sulphate ar 500gmx2 1 kg 48. ferric chloride 500mxl 1500ml 49. lr rankem 500mlx2 50. ferrous ammonium sulphate ( sfas ) 98.5% rankem 500 g x4 2xkg 51. fecl3 anhydrous 97% ( hplc ) 500 gmx1 500gm 52. granular activated carbon cdh 500 gmx1 500gm 53. glycerol 99.5% loba 2.5ltr.x1 5 ltr 98% purified ( hplc 2.5 ltrx1 54. glycine ( amino acetic acid ) srl 1kgx1 1kg 55. glycerol monolaurate 98.0% ( gc ) glycerol α monolaurate ( tci ) 5 gmx1 5 gm 56. hydrogen peroxide rankem 1lx1 3.5 ltrmerck, ar grade 2x500 ml 30%, ar, hplc 500 mlx1 ar 1 ltrx1 57. heneicosane sigma aldrich 1gmx1 1 gm 58. hexane 500 mlx1 500ml 59. nh3 nh4cl buffer ( loba chemie ) 500 mlx1 500ml 60. hydrochloric acid ( hcl ) 500mlx2 6.5 ltr ( 37% ) lrrankem 500ml x4 ( 2n ) rankem 1ltr x2 32% 500mlx4 61. ranchem 500mlx1 62. hypochlorous acid 2 l 2 ltr 63. isopropanol cdh 1lx1 1 ltr 64. iodine resublimed 99.8% ar grade ( loba chemie ) 100 gx1 100gm 65. iron ( iii ) nitrate nonahydrate cdh 500gmx1 500gm 66. lactose monohydrate loba chemie 500gmx1 500gm 67. liquor ammonia fisher 500mlx4 2ltr 68. lanthanum nitrate hexahydrate extra pure 99% srl 100gmx1 100gm 69. lead nitrate loba chemie 500gx1 500gm 70. lauric acid 99% ( hplc ) 500 gmx1 500gm 71. l menthol crystals natural 99% ( hplc ) 100 mlx1 100gm & 500ml ( >99% ) spectrochem 500 ml x1 72. magnesium sulphate pentahydrate sigma aldrich 500gmx1 500gm 73. methanol loba ( hplc ) 2.5ltr.x4 17 ltr hplc grade ( srl ) 2.5ltrx1 2l 99.8% hplc grade ( hplc ) 2.5 lx1 74. methacrylic acid 500mlx1 500ml 75. manganous sulphate99% extra pure rankem 250g x2 500gm 76. mercuric sulphate 98% pure rankem 100g x1 100gm page 13 of 16 77. methylphosphonic acid sigma 1gmx1 1gm 78. n methyl 2 pyrrolidone loba chemie 500mlx1 500ml 79. n, n dimethyl acetamide fisher scientific 500 ml x 2 1 ltr 80. n methyl 2 pyrrolidone fisher scientific 500mlx2 1 ltr 81. nickel nitrate hexahydrate loba 500gmx4 2kg 82. n, n, n, n ethylenediaminetetrakis ( methylenephosphonic acid ) ( edtmp ) tci 100gmx1 100gm 83. nitric acid ar 500 mlx1 500ml 84. o cresol loba chemie 500mlx4 1 ltr 85. oxalic acid ( 2n ) rankem 500ml x4 2 ltr & 2kg 86. loba chemie ( solid ) 500gmx4 87. octanoic acid 97.5% ( hplc ) 500 mlx1 500ml 88. polyvinyal chloride thermofisher scientific 500gmx1 500gm 89. potassium dichromate rankem 500gmx1 500gm 90. phenylphosphonic acid spectro chem 100gmx1 100gm 91. potassium iodine loba chemie 100gmx1 600gm98% pure rankem 250 gx2 92. potassium peroxymonosulfate, sigma aldrich, ar 2x100 g 200gm 93. phosphoric acid merck 500mlx1 500ml ar 5gx1 94. poly vinyl pyrrolidone loba 500gmx1 500gm 95. polyethylene glycol 200 loba chemie 500 mlx1 500ml 96. polyethylene glycol 600 loba chemie 500 mlx1 500ml 97. potassium iodide 99.5% ar grade ( loba chemie ) 100 gx1 100gm 98. ph buffer tablets 3bottle each 6 3 99. potassium dichromate ( k2cr2o7 ) 500gx1 2.5kg 99.5% pure rankem 500gm x4 100. potassium chloride 1000 mlx1 1ltr 101. potassium sulphate 500gx1 500gm 102. petroleum ether 60 80 deg. c. rankem 500ml x4 2 ltr 103. p toluene sulphate acid 96% pract ( hplc ) 500 gmx1 500gm 104. quercetin ( >99% ) sigma aldrich 10 grx1 10gm 105. silver sulphate merck 25 gmx1 25gm 106. sodium persulfate 500gmx1 500gm 107. silver conductive ink alfa 5gmx1 5gm 108. strontium nitrate srl 500gmx1 500gm 109. sds spectro chem 500gmx1 500gm 110. sulfuric acid fisher scientific 500 mlx1 4.5ltr fisher scientific 500mlx1 2l 95 97% 500mlx3 111. sorbitane monooleate ( span 80 ) loba 500 mlx1 500ml 112. sodium laureth sulfate rankleen 500mlx2 1kg 113. sodium dodecyl benzene sulfonate sisco research laboratories 100gmx1 1 kg 114. sodium arsenate loba chemie 100gx1 100gm 115. silver sulfate 10gmx1 35gm 25gmx1 116. silicon grease wacker metrorack 50gmx2 600gm 500gx1 117. sodium chloride ( nacl ) 500gmx2 3kg 99.5% pure rankem 500g x4 118. sodium acetate ar 500gx1 500gm 119. ar 1500gx1 1500gm 120. sodium nitrate ar 500gmx1 500gm 121. sodium carbonate 1 kgx1 1kg 122. sulphuric acid concentrated lr rankem 500ml x2 1ltr 123. sodium thiosulphate anhydrous 97% extra pure rankem 500g x2 1kg page 14 of 16 124. sodium hydroxide pellets 97% pure rankem 500 g x5 14.0kg 98%, ar, hplc 1 kgx1 ( 2n ) rankem 2ltr x5 fisher 500gx3 125. sodium azide 99% pure rankem 500 g x 1 500gm 126. sodium carbonate anhydrous 99.5% pure rankem 500g x4 2kg 127. solketal 98% optical purity 99% glc ( merck chemicals ) 100 gmx1 100gm 128. sulfonic acid ( molychem ) 25 gm x1 25gm 129. trioctylphosphine oxide > 99% for synthesis [ 78 50 2 ] spectrochem 100 grx1 100gm 130. titanium ( iv ) bis ( ammonium lactatto ) dihydroxide sigma aldrich 1 1 131. tetra sodium pyrophosphate decahydrate 99% ar / acs ( loba chemie ) 500 gx1 500gm 132. titanium ( iv ) isoproxide cdh 500mlx1 500ml 133. titanium ( iv ) chloride cdh 500mlx1 500ml 134. tin ( ii ) oxalate cdh 100gmx1 100gm 135. tin ( iv ) chloride cdh 500mlx1 500ml 136. toluene 99% low sulphur rankem 500mlx2 1 ltr 137. tbab 99% for synthesis ( hplc ) 250 gmx1 250gm 138. tbac 50% methanol ( sdfc ) 100 mlx1 100ml 139. thymol extra pure ( hplc ) 250 gmx1 250gm 140. tetraethyl ammonium hydroxide 35% ( 25% in h2o ) ( merck ) 250 mlx1 250ml 141. teos >98.0% ( gc ) ( tci ) 500 gmx1 500gm 142. tetraethyl glycol ( teg ) 99% ( merck ) 100 gmx1 100gm 143. triclosan sd fine chemicals 100gmx1 100gm 144. urea sdfcl 500 gmx1 500gm 145. xylene loba chemie 2.5lx1 2.5ltr 146. zirconyl nitrate hydrate 100gm...